S. Kang et al. / Bioorg. Med. Chem. Lett. 23 (2013) 1748–1751
1751
protease. Enterokinase was removed by purifying the recombinant proteins by
Ni-NTA affinity chromatography. To examine the TMPRSS4 proteolytic activity,
Supplementary data
1
l
g of the active form of recombinant TMPRSS4 serine protease was incubated
with 100 M Z-Phe-Arg-7-amido-4-methylcoumarin hydrochloride (Sigma, St
Louis, MO) in a reaction buffer (100 mM Tris, pH 8.0, 10 mM CaCl2, and 1
Supplementary data associated with this article can be found, in
l
lM
ZnCl2) at 25 °C. The fluorescence resulting from the hydrolysis of the peptide
substrate was measured with a fluorometer (Victor3 plate reader, PerkinElmer,
Wellesley, MA) using excitation and emission wavelengths of 385 and 455 nm,
respectively.
Referenced and notes
11. Otevrel, J.; Mandelova, Z.; Pesko, M.; Guo, J.; Kralova, K.; Sersen, F.; Vejsova, M.;
Kalinowski, D. S.; Kovacevic, Z.; Coffey, A.; Csollei, J.; Richardson, D. R.;
Jampilek, J. Molecules 2010, 15, 8122.
12. Vinsova, J.; Imramovsky, A.; Buchta, V.; Ceckova, M.; Dolezal, M.; Staud, F.;
Jampilek, J.; Kaustova, J. Molecules 2007, 12, 1.
13. Stachulski, A. V.; Pidathala, C.; Row, E. C.; Sharma, R.; Berry, N. G.; Lawrenson,
A. S.; Moores, S. L.; Iqbal, M.; Bentley, J.; Allman, S. A.; Edwards, G.; Helm, A.;
Hellier, J.; Korba, B. E.; Semple, J. E.; Rossignol, J. F. J. Med. Chem. 2011, 54, 8670.
14. Dahlgren, M. K.; Kauppi, A. M.; Olsson, I. M.; Linusson, A.; Elofsson, M. J. Med.
Chem. 2007, 50, 6177.
15. Ogawa, H.; Azuma, M.; Muto, S.; Nishioka, Y.; Honjo, A.; Tezuka, T.; Uehara, H.;
Izumi, K.; Itai, A.; Sone, S. Clin. Exp. Allergy 2011, 41, 104.
16. Lee, I. Y.; Gruber, T. D.; Samuels, A.; Yun, M.; Nam, B.; Kang, M.; Crowley, K.;
Winterroth, B.; Boshoff, H. I.; Barry, C. E., III Bioorg. Med. Chem. Lett. 2013, 21,
114.
17. Onai, Y.; Suzuki, J.; Kakuta, T.; Maejima, Y.; Haraguchi, G.; Fukasawa, H.; Muto,
S.; Itai, A.; Isobe, M. Cardiovasc. Res. 2004, 63, 51.
18. Heitsch, H.; Wagner, A.; Scholkens, B. A.; Wirth, K. Bioorg. Med. Chem. Lett.
1999, 9, 327.
1. Stetler-Stevenson, W. G.; Yu, A. E. Semin. Cancer Biol. 2001, 11, 143.
2. Deryugina, E. I.; Quigley, J. P. Cancer Metastasis Rev. 2006, 25, 9.
3. Andreasen, P. A.; Kjoller, L.; Christensen, L.; Duffy, M. J. Int. J. Cancer 1997, 72, 1.
4. Wallrapp, C.; Hahnel, S.; Muller-Pillasch, F.; Burghardt, B.; Iwamura, T.;
Ruthenburger, M.; Lerch, M. M.; Adler, G.; Gress, T. M. Cancer Res. 2000, 60,
2602.
5. Kebebew, E.; Peng, M.; Reiff, E.; Duh, Q. Y.; Clark, O. H.; McMillan, A. Ann. Surg.
2005, 242, 353.
6. Kim, S.; Kang, H. Y.; Nam, E. H.; Choi, M. S.; Zhao, X. F.; Hong, C. S.; Lee, J. W.;
Lee, J. H.; Park, Y. K. Carcinogenesis 2010, 31, 597.
7. Hooper, J. D.; Clements, J. A.; Quigley, J. P.; Antalis, T. M. J. Biol. Chem. 2001, 276,
857.
8. Netzel-Arnett, S.; Hooper, J. D.; Szabo, R.; Madison, E. L.; Quigley, J. P.; Bugge, T.
H.; Antalis, T. M. Cancer Metastasis Rev. 2003, 22, 237.
9. Jung, H.; Lee, K. P.; Park, S. J.; Park, J. H.; Jang, Y. S.; Choi, S. Y.; Jung, J. G.; Jo, K.;
Park, D. Y.; Yoon, J. H.; Lim, D. S.; Hong, G. R.; Choi, C.; Park, Y. K.; Lee, J. W.;
Hong, H. J.; Kim, S.; Park, Y. W. Oncogene 2008, 27, 2635.
10. TMPRSS4 serine protease assay was performed with peptide substrates
fluorometrically. Briefly, the TMPRSS4 serine protease domain (amino acid
residues 205–437) with 15 amino acids (DYKDDDGDYKDDDDK) containing an
enterokinase cleavage site at the N-terminus was subcloned into the
expression vector pET21b (Novagen, Darmstadt, Germany) by PCR with the
following primer set: (50-TCATATGGATTACAAA GACGATGACGGTGACTACAA
AGATGACGACGATAAGGTGGTGGGTGGGGAGG-30 and 50-GAATCTCGAGCAGCT
19. Rigaudy, J.; Seuleiman, A. M.; Cuong, N. K. Tetrahedron Lett. 1982, 38, 3157.
20. Gray, M.; Andrews, I. P.; Hook, D. F.; Kitteringham, J.; Voyle, M. Tetrahedron Lett.
2000, 41, 6237.
21. Toyota, K.; Kawasaki, S.; Yoshifuji, M. J. Org. Chem. 2004, 69, 5065.
22. A CCK-8 assay was performed to measure the cytotoxicity of the compounds in
TMPRSS4-overexpressing colon cancer cells. Cells were seeded onto 96-well
plates at a density of 10,000 cells/100
0.1 M of each compound at 37 °C. After 2 days of incubation, 10
solution (Dojindo Laboratories, Kumamoto, Japan) was added to each well, and
the absorbance at 450 nm was measured. The optical density directly
correlated with cell viability.
l
l/well and incubated with or without
l of CCK-8
CAGCCTTCCAGACAT-30).
A recombinant TMPRSS4 serine protease domain
l
l
fused with an enterokinase cleavage sequence (pro-form) with a six times His
tag was expressed in Escherichia coli BL21(DE3), purified with Ni-NTA resin
(Qiagen, Valencia, CA), and treated with enterokinase (New England Biolabs,
Ipswich, MA) to produce the active form of recombinant TMPRSS4 serine