Discovery of an in vivo chemical probe of the lysine methyltransferases G9a and GLP

Article abstract of DOI:10.1021/jm401480r

Among epigenetic "writers", "readers", and "erasers", the lysine methyltransferases G9a and GLP, which catalyze mono- and dimethylation of histone H3 lysine 9 (H3K9me2) and nonhistone proteins, have been implicated in a variety of human diseases. A "toolk

Full text of DOI:10.1021/jm401480r

Article
pubs.acs.org/jmc
Discovery of an in Vivo Chemical Probe of the Lysine
Methyltransferases G9a and GLP
Feng Liu,†,# Dalia Barsyte-Lovejoy,⊥ Fengling Li,⊥ Yan Xiong,† Victoria Korboukh,† Xi-Ping Huang,‡
Abdellah Allali-Hassani,⊥ William P. Janzen,† Bryan L. Roth,‡ Stephen V. Frye,† Cheryl H. Arrowsmith,⊥
Peter J. Brown,⊥ Masoud Vedadi,⊥ and Jian Jin*,†,§,∥
†Center for Integrative Chemical Biology and Drug Discovery, Division of Chemical Biology and Medicinal Chemistry, UNC
‡
§
Eshelman School of Pharmacy, National Institute of Mental Health Psychoactive Drug Screening Program, Department of
∥
Pharmacology, School of Medicine, and Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill,
Chapel Hill, North Carolina 27599, United States
⊥Structural Genomics Consortium, University of Toronto, Toronto, Ontario M5G 1L7, Canada
S
* Supporting Information
ABSTRACT: Among epigenetic “writers”, “readers”, and “erasers”, the lysine
methyltransferases G9a and GLP, which catalyze mono- and dimethylation of histone
H3 lysine 9 (H3K9me2) and nonhistone proteins, have been implicated in a variety
of human diseases. A “toolkit” of well-characterized chemical probes will allow
biological and disease hypotheses concerning these proteins to be tested in cell-based
and animal models with high confidence. We previously discovered potent and
selective G9a/GLP inhibitors including the cellular chemical probe UNC0638, which
displays an excellent separation of functional potency and cell toxicity. However, this
inhibitor is not suitable for animal studies due to its poor pharmacokinetic (PK)
properties. Here, we report the discovery of the first G9a and GLP in vivo chemical
probe UNC0642, which not only maintains high in vitro and cellular potency, low
cell toxicity, and excellent selectivity, but also displays improved in vivo PK properties, making it suitable for animal studies.
GLP [also known as KMT1D (lysine methyltransferase 1D) or
EHMT1 (euchromatic histone methyltransferase 1)] are two
closely related proteins and were initially identified as H3K9
(histone H3 lysine 9) methyltransferases.37,38 They share 80%
sequence identity in their respective SET (suppressor of
variegation 3−9, enhancer of zeste and trithorax) domains.38 In
addition to H3K9, G9a and GLP methylate many nonhistone
proteins.39,40 For example, G9a and GLP catalyze dimethyla-
tion of the tumor suppressor p53, resulting in inactivation of
the transcriptional activity of p53.6 G9a is overexpressed in
leukemia,6 prostate carcinoma,6,41 hepatocellular carcinoma,42
and lung cancer.43 Knockdown of G9a inhibits prostate, lung,
and leukemia cancer cell growth.41,43,44 Moreover, G9a and/or
GLP play a role in cocaine addiction,45,46 mental retardation,47
maintenance of HIV-1 (human immunodeficiency virus type 1)
latency,48 and stem cell function, maintenance, differentiation,
and reprogramming.49−54 In addition, GLP has been implicated
in Kleefstra syndrome,55,56 a disorder affecting intellectual
ability.
INTRODUCTION
■
Protein lysine methylation catalyzed by protein lysine
methyltransferases [PKMTs, also known as histone methyl-
transferases (HMTs)] has been increasingly recognized as a
major signaling mechanism in eukaryotic cells.1−5 PKMTs
target both histone and nonhistone substrates and display
significant variation in their ability to catalyze mono-, di-, and/
or trimethylation.1,3,5−8 In the context of epigenetic gene
regulation, the different states of histone lysine methylation
encode distinct signals and are recognized by a host of proteins
and protein complexes. More than 50 PKMTs have been
identified to date and many of them have been implicated in
various human diseases.1,3,9,10 During the last several years, the
PKMT target class has received considerable attention from the
drug discovery and medicinal chemistry community. A number
of selective small-molecule inhibitors that target the PKMT
substrate binding groove,11−17 cofactor binding site,18−31 and a
PRMT (protein arginine methyltransferase) allosteric binding
site32,33 have been reported. However, well-characterized
chemical probes34−36 of PKMTs that are suitable for cell-
based and animal studies are still rare. Such probes are
invaluable tools for testing biological and therapeutic
hypotheses concerning the PKMTs and for their validation as
drug targets.
BIX01294 (1), the first selective inhibitor of G9a and GLP,
was discovered via high-throughput screening (Figure 1).11
Optimization of this chemical series based on the cocrystal
structure of GLP in complex with inhibitor 157 led to the
G9a [also known as KMT1C (lysine methyltransferase 1C)
or EHMT2 (euchromatic histone methyltransferase 2)] and
Received: September 24, 2013
Published: October 8, 2013
© 2013 American Chemical Society
8931
dx.doi.org/10.1021/jm401480r | J. Med. Chem. 2013, 56, 8931−8942

Journal of Medicinal Chemistry
Article
Figure 1. Known small-molecule inhibitors of G9a/GLP.11−15,20
a
Scheme 1. Synthesis of Compounds 7 and 13−19
a
Reagents and conditions: (a) 1-chloro-3-iodopropane, K2CO3, CH3CN, reflux; (b) HNO3, Ac2O, 0 °C to rt, 75% over two steps; (c) pyrrolidine,
K2CO3, NaI, cat. tetrabutylammonium iodide, CH3CN, reflux, 81%; (d) Fe dust, NH4OAc, AcOEt, H2O, reflux, 63%; (e) NaOCN, AcOH, H2O, rt;
(f) NaOH, H2O, MeOH, reflux; (g) N,N-diethylaniline, POCl3, reflux, 50% over three steps; (h) 1-isopropylpiperidin-4-amine, DIEA, THF, rt, 94%;
(i) 1-cyclopropylpiperidin-4-amine, DIEA, THF, rt, 89%; (j) various amines, TFA, i-PrOH, 160 °C, microwave, 74−82%.
discovery of the potent and selective G9a/GLP inhibitors
UNC0224 (2), UNC0321 (3), and E72 (4) (Figure 1).12−14
Further optimization of this quinazoline scaffold resulted in the
discovery of the G9a and GLP cellular chemical probe
UNC0638 (5), which displays balanced in vitro potency,
aqueous solubility, and cell membrane permeability (Figure
1).15,16 Inhibitor 5 is highly selective for G9a and GLP over a
broad range of epigenetic and nonepigenetic targets and
exhibits robust on-target activities in cells and low cell
toxicity.15 More recently, BRD9539 (6), a structurally distinct
inhibitor of G9a, was reported (Figure 1).20 Although inhibitor
5 is an excellent chemical probe for cell-based studies,54,58 it is
not suitable for animal studies due to its poor in vivo
pharmacokinetic (PK) properties.15 We therefore endeavored
to optimize the PK properties of the quinazoline series. Here
we report the discovery of UNC0642 (7), the first in vivo
chemical probe of G9a and GLP. This inhibitor not only
displays high in vitro and cellular potency, low cell toxicity, and
excellent selectivity, but also exhibits greatly improved in vivo
PK properties as compared to inhibitor 5. We describe (1) the
synthesis of novel compounds aimed at improving PK
properties of this series; (2) structure−activity relationships
(SAR) of these compounds in biochemical and cell-based
assays; (3) in vitro and in vivo PK properties of selected
inhibitors; and (4) further characterization of inhibitor 7 in a
number of biochemical and cell-based studies, including
mechanism of action, selectivity, and phenotypic effect studies.
RESULTS AND DISCUSSION
■
Synthesis. We hypothesized that the 2-cyclohexyl group of
inhibitor 5 could contribute to its poor metabolic stability due
to cytochrome P450 mediated oxidation of the cyclohexyl ring.
Because modifications to the 2-substituent of the quinazoline
scaffold are well-tolerated,14,16 we extensively explored this
region and designed a number of novel analogs aimed at
improving metabolic stability while maintaining high in vitro
and cellular potency. We also conducted limited exploration of
the 4-amino and 7-aminoalkoxy regions.
8932
dx.doi.org/10.1021/jm401480r | J. Med. Chem. 2013, 56, 8931−8942

Journal of Medicinal Chemistry
Article
a
Scheme 2. Synthesis of Compound 22
a
Reagents and conditions: (a) 4 N HCl, dioxane, tetrahydro-2H-pyran-4-carbonitrile, 100 °C; (b) N,N-diethylaniline, POCl3, reflux, 48% over two
steps; (c) 1-isopropylpiperidin-4-amine, K2CO3, DMF, 60 °C, 78%.
a
Scheme 3. Synthesis of Compounds 26a and 26b
a
Reagents and conditions: (a) 4,4-difluoropiperidine, K2CO3, NaI, cat. tetrabutylammonium iodide, CH3CN, reflux, 81%; (b) Fe dust, NH4OAc,
AcOEt−H2O, reflux, 60%; (c) 4 N HCl, dioxane, cyclohexanecarbonitrile or tetrahydro-2H-pyran-4-carbonitrile, 100 °C; (d) N,N-diethylaniline,
POCl3, reflux, 49−53% over two steps; (e) 1-isopropylpiperidin-4-amine, K2CO3, DMF, 60 °C, 75−77%.
We previously developed an efficient synthetic route for
preparing 2-aminoquinazolines, which allows various 2-amino
groups to be installed at the last step of the synthetic
sequence.16 Using this efficient route, we synthesized the 2-
aminoquinazolines 7 and 13−17 from commercially available
methyl 4-hydroxy-3-methoxybenzoate (8) in nine steps in good
yields (Scheme 1 and Table 1). Briefly, compound 8 was
reacted with 1-chloro-3-iodopropane, followed by nitration, to
afford the chloride 9. Substitution of the chloride with
pyrrolidine and subsequent reduction of the nitro group
yielded the aniline 10. Urea formation and subsequent ring
closure afforded the intermediate 11, which was then converted
to the 2,4-dichloroquinazoline 12. Two consecutive displace-
ment reactions yielded the desired final products 7 and 13−17.
It is worth noting that 5 g of inhibitor 7 was produced in 14.8%
overall yield using this synthetic route. We also synthesized
compounds 18 and 19, which contain a cyclopropyl group
instead of an isopropyl group as the N-capping group of the
upper piperidine moiety, following the same synthetic route.
Compound 22, which contains a tetrahydropyran-4-yl group
at the 2-position, was prepared according to the synthetic
route15 developed for synthesis of inhibitor 5 (Scheme 2). In
brief, the aniline 10 was reacted with tetrahydro-2H-pyran-4-
carbonitrile to yield the cyclization product 20, which was then
converted to the 4-chloroquinazoline 21. Subsequent displace-
ment of the chloride with 1-isopropylpiperidin-4-amine
afforded the desired product 22.
Finally, compounds 26a and 26b, which were designed to
explore the 7-aminoalkoxy moiety, were synthesized according
to Scheme 3. Substitution of the chloride 9 with 4,4-
difluoropiperidine and subsequent reduction of the nitro
group afforded the aniline 23, which was reacted with
cyclohexanecarbonitrile or tetrahydro-2H-pyran-4-carbonitrile
to yield the quinazolines 24. Similarly to synthesis of
compound 22, the intermediates 24 were converted to the 4-
8933
dx.doi.org/10.1021/jm401480r | J. Med. Chem. 2013, 56, 8931−8942

Journal of Medicinal Chemistry
Article
chloroquinazolines 25, which were subsequently converted to
the desired products 26a and 26b.
results,14,16 further demonstrating that modifications to the 2-
amino region of the quinazoline scaffold are well-tolerated.
For the N-capping group of the upper piperidine moiety, we
found that the isopropyl group can be replaced by a cyclopropyl
group (7 versus 18, and 14 versus 19) without a significant
change in potency (Table 2). Although we previously showed
SAR in a G9a Biochemical Assay. The synthesized
compounds were evaluated in a radioactive biochemical assay
that measures the transfer of the tritiated methyl group from
3
the cofactor H-S-adenosyl methionine (SAM) to a peptide
substrate catalyzed by G9a. IC50 values of these compounds in
this biochemical assay are summarized in Tables 1−3.
We were pleased to find that the 2-cyclohexyl group (5) can
be replaced by a variety of 2-substituents without a significant
loss of potency (Table 1). In particular, compounds possessing
Table 2. SAR of the N-Capping Group of the Upper
Piperidine Moiety
Table 1. SAR of the 2-Amino Moiety
a
IC50 determination experiments were performed in triplicate.
that a large N-capping group such as cyclohexylmethyl is
tolerated in this region,16 we thought that such a large lipophilic
group might increase metabolic liability and, therefore, did not
explore this region further. In addition, we attempted to replace
the 7-(3-(pyrrolidin-1-yl)propoxy) group with the 7-(3-(4,4-
difluoropiperidin-1-yl)propoxy) group (Table 3). To our
surprise, this replacement resulted in a complete loss of
potency (5 versus 26a, and 22 versus 26b). Because a basic
nitrogen in this region is required for maintaining high in vitro
Table 3. SAR of the 7-Aminoalkoxy Moiety
a
IC50 determination experiments were performed in triplicate.
a 2-(4,4-difluoropiperidin-1-yl) (7), 2-(morpholin-4-yl) (13),
2-(piperidin-1-yl) (16), or 2-(azepan-1-yl) (17) maintained
high in vitro potency (IC50 < 2.5 nM). Although compounds
14, 15, and 22, which contain a 2-(1,1-dioxidethiomorpholin-4-
yl), 2-(3,3,4,4-tetrafluoropyrrolin-1-yl), or 2-(tetrahydropyran-
4-yl) group, were not as potent as compound 5, the in vitro
potency of these inhibitors is still quite good (IC50 < 30 nM).
These SAR findings are consistent with our previous
a
IC50 determination experiments were performed in triplicate.
8934
dx.doi.org/10.1021/jm401480r | J. Med. Chem. 2013, 56, 8931−8942

Journal of Medicinal Chemistry
Article
potency and few modifications are tolerated,14,16 we did not
further investigate this region.
compared with inhibitor 22. Taken together, these results
indicate that modifications aimed at preventing CYP450-
mediated oxidation of the 2-substituent of the quinazoline
scaffold can lead to improved in vitro metabolic stability.
On the basis of high in vitro and cellular potencies, low cell
toxicity, and good in vitro metabolic stability, we selected
inhibitors 7 and 13 for evaluation of their in vivo PK properties
in male Swiss Albino mice. A single intraperitoneal (ip)
injection (5 mg/kg) of inhibitor 7 resulted in a plasma Cmax
(maximum concentration) of 947 ng/mL, which is more than
10-fold higher than that of inhibitor 5, and an AUC (area under
the curve) of 1265 h·ng/mL, which is also much higher than
that of inhibitor 5 (Table 6). Similarly, a single 5 mg/kg ip
Assessment of Functional Potency and Cell Toxicity.
The inhibitors that displayed IC50 < 10 nM in the biochemical
assay were next evaluated in an H3K9me2 cell immunofluor-
escence in-cell Western (ICW) assay, for assessing their cellular
potency, and a standard resazurin (Alamar Blue) reduction
assay, for assessing their cell toxicity. MDA-MB-231 cells were
used in this study because this cell line possesses robust
H3K9me2 levels.
We were pleased to find that all eight inhibitors exhibited
good potency at reducing cellular levels of H3K9me2 (IC50
=
100−600 nM), low cell toxicity (EC50 > 5000 nM), and a good
separation of functional potency and cell toxicity with a ratio of
toxicity to functional potency (tox/function ratio, which is
determined by dividing the EC50 value of the observed toxicity
by the IC50 value of the functional potency) >45 (Table 4). In
particular, inhibitors 7, 13, and 22 displayed high cellular
potency and an excellent tox/function ratio (>130), similar to
that of our G9a/GLP cellular chemical probe 5.
a
Table 6. In Vivo PK Properties of Selected Inhibitors
Cmax
(ng/mL)
brain/plasma
ratio
compd matrix
AUC0−24h (h·ng/mL)
5
7
plasma
66
68
404
412
b
brain
0.33
0.68
plasma
947
99
1265
721
b
13
brain
Table 4. Functional Potency and Cell Toxicity of Selected
plasma
731
1061
a
Inhibitors in MDA-MB-231 Cells
a
Plasma and brain concentrations were measured at eight time points
with three animals per time point. Clearance, half-life, and volume
distribution values are not reported because only ip administration was
performed. The density of brain homogenate was considered as 1,
which is equivalent to plasma density (1); brain concentrations and
exposures are expressed as ng/g and h·ng/g, respectively.
compd H3K9me2 IC50 (nM) cell toxicity EC50 (nM) tox/function ratio
5
7
81
110
180
150
100
310
590
310
11 000
16 700
23 700
7 000
136
152
132
47
b
13
16
17
18
19
22
5 700
57
injection of inhibitor 13 gave a much improved Cmax and AUC
in plasma compared with inhibitor 5. In addition, while
inhibitor 7 displayed modest brain penetration with a brain/
plasma ratio of 0.33, inhibitor 13 exhibited increased CNS
(central nervous system) penetration with a brain/plasma ratio
of 0.68. These encouraging PK results suggest that inhibitors 7
and 13 could be used for animal studies and 13 might be
suitable for studies to explore the role of G9a/GLP in the CNS.
These results also indicate that appropriate modifications to the
2-substituent of the quinazoline scaffold can improve in vivo PK
properties, thus validating our probe design hypothesis.
14 700
>50 000
>50 000
47
>85
>161
a
IC50 or EC50 values are the average of experimental triplicates with
standard deviation (SD) values that are about 3-fold less than the
average.
Assessment of in Vitro and in Vivo PK Properties. We
next evaluated in vitro metabolic stability of selected inhibitors
using mouse liver microsomes. As shown in Table 5, inhibitors
Further Characterization of Inhibitor 7. We next carried
out a number of probe characterization studies. First, we
studied the MOA (mechanism of action) of inhibitor 7 by
determining Michaelis−Menten kinetic parameters associated
with both the peptide substrate and cofactor SAM. As shown in
Figure 2, the apparent Km of the peptide (Kmapp) increased
linearly with inhibitor concentration, whereas the Kmapp of SAM
remained constant in the presence of increasing concentrations
of the inhibitor. These results indicate that inhibitor 7 is
competitive with the peptide substrate and noncompetitive
with the cofactor SAM, the same MOA as inhibitor 5.15 The Ki
of inhibitor 7 was determined to be 3.7 1 nM (n = 3).
We next determined the selectivity of inhibitor 7 versus 15
methyltransferases and a broad range of nonepigenetic targets.
We expected this inhibitor to be highly potent for GLP on the
basis of the high sequence identity between G9a and GLP.10
Indeed, inhibitor 7 displayed high in vitro potency for GLP
(IC50 < 2.5 nM), similar to G9a (Figure 3A, Table 1). This
result is consistent with the selectivity profile of our cellular
chemical probe 5.15 Importantly, inhibitor 7 was more than 20
000-fold selective for G9a and GLP over 13 other
methyltransferases (IC50 > 50 000 nM) and more than 2000-
fold selective over PRC2−EZH2 (polycomb repressive
Table 5. In Vitro Metabolic Stability of Selected Inhibitors
compd
CLint (mL/min/g liver)
T1/2 (min)
5
7
1.0
0.5
73
>90
>90
>90
16
13
15
22
26
0.7
<0.5
4.7
7.4
10
7 and 13 displayed improved intrinsic clearance (CLint) and
half-life (T1/2) compared with inhibitor 5. Interestingly,
inhibitor 15, which possesses a 2-(3,3,4,4-tetrafluoropyrrolin-
1yl) group, exhibited the best in vitro metabolic stability,
although this inhibitor was significantly less potent than
inhibitors 5, 7, and 13 (see Table 1). On the other hand,
compounds 22 and 26b, which contain a 2-(tetrahydropyran-4-
yl) group, displayed a significant decrease in metabolic stability.
Surprisingly, inhibitor 26b, which has a 7-(3-(4,4-difluoropiper-
idin-1-yl)propoxy) group, was not only less potent than
compound 22, which contains a 7-(3-(pyrrolidin-1-yl)propoxy)
group (see Table 3), but also metabolically less stable
8935
dx.doi.org/10.1021/jm401480r | J. Med. Chem. 2013, 56, 8931−8942

Journal of Medicinal Chemistry
Article
Figure 2. MOA studies of inhibitor 7. (A and B) The competition of inhibitor 7 and the H3K9 peptide indicates that 7 is competitive with the
app
peptide substrate. The Km of the peptide increased linearly with compound concentration. (C and D) Inhibitor 7 is noncompetitive with the
app
cofactor SAM. The Km of SAM was not affected by inhibitor concentration.
Figure 3. Selectivity of inhibitor 7 versus 15 other methyltransferases.
complex 2−enhancer of zeste homologue 2, IC50 > 5000 nM)
(Figure 3B). In addition, inhibitor 7 showed no appreciable
inhibition (less than 20% inhibition at 10 000 nM) against a
panel of 50 representative kinases (Table S1, Supporting
Information). We also tested inhibitor 7 against 44 GPCRs (G
protein-coupled receptors), transporters, and ion channels in
the National Institute of Mental Health Psychoactive Drug
Screen Program Selectivity Panel. This inhibitor was found to
show less than 50% inhibition at 1000 nM against 39 targets
and >50% inhibition at 1000 nM against 5 targets in the panel
(Table S2, Supporting Information), and Ki values for each of
the 5 interacting targets were then determined in radioligand
binding assays. Inhibitor 7 had Ki values of 4500, >10 000, 45,
>10 000, and 900 nM for α1D, α2C, histamine H3, μ opioid, and
σ2 receptors, respectively (Table S3, Supporting Information).
Therefore, with the exception of the histamine H3 receptor,
inhibitor 7 was more than 300-fold selective for G9a and GLP
over a broad range of kinases, GPCRs, transporters, and ion
channels.
In addition to MDA-MB-231 cells, we assessed functional
potency and cell toxicity of inhibitor 7 in several other cell lines
(Table 7). Inhibitor 7 displayed high potency (IC50 < 150 nM)
in reducing cellular levels of H3K9me2 and low cell toxicity
(EC50 > 3000 nM), resulting in a good separation of functional
potency and cell toxicity with a tox/function ratio of >45 in
U2OS, PC3, and PANC-1 cells. In particular, this inhibitor
Table 7. Functional Potency and Cell Toxicity of Inhibitor 7
a
in Various Cell Lines
H3K9me2 IC50
(nM)
cell toxicity EC50
(nM)
tox/function
ratio
cell line
MDA-MB-
231
110
16700
152
U2OS
PC3
130
130
40
6000
8900
3500
46
68
88
PANC-1
a
IC50 or EC50 values are the average of experimental triplicates with
SD values that are about 3-fold less than the average.
8936
dx.doi.org/10.1021/jm401480r | J. Med. Chem. 2013, 56, 8931−8942

Journal of Medicinal Chemistry
Article
Figure 4. Inhibitor 7 affects the clonogenicity of PANC-1 cells but not MDA-MB-231 cells. (A) PANC-1 cell colonies after 2 weeks of growth in the
presence of inhibitor 7 at 0, 0.5, or 1 μM. (B) Graphical representation of data in part A. (C) MDA-MB-231 cell colonies after 2 weeks of growth in
the presence of inhibitor 7 at 0, 0.5, or 1 μM. (D) Graphical representation of data in part C.
exhibited excellent potency (IC50 = 40 nM) in PANC-1 cells
with a good tox/function ratio of 88.
at reducing the H3K9me2 mark, low cell toxicity, and good
separation of functional potency and cell toxicity in a number of
cell lines; (6) reduced clonogenicity in PANC-1 cells, a
pancreatic carcinoma cell line; and (7) importantly, displayed
improved in vitro and in vivo PK properties. We also
discovered inhibitor 13, which had better brain penetration
than inhibitor 7 and might be suitable for CNS studies. These
two inhibitors are valuable additions to our G9a/GLP inhibitor
toolbox and are freely available to the research community for
investigating the role of G9a and GLP in health and disease.
Lastly, we evaluated effects of inhibitor 7 on clonogenicity in
PANC-1 and MDA-MB-231 cells. As shown in Figure 4,
inhibitor 7 reduced clonogenicity in PANC-1 cells in a
concentration-dependent manner while it had no effect on
clonogenicity in MDA-MB-231 cells. These results are
consistent with the previous report that PANC-1 cells are
highly sensitive to G9a inhibitors20 and our previous finding
that MDA-MB-231 cells are insensitive to G9a/GLP inhib-
itors.15 These observations suggest that pharmacological
inhibition of G9a and GLP can have differential phenotypic
effects depending on the cell type and/or disease setting.
EXPERIMENTAL SECTION
■
Chemistry General Procedures. HPLC spectra for all com-
pounds were acquired using an Agilent 6110 Series system with UV
detector set to 254 nm. Samples were injected (5 μL) onto an Agilent
Eclipse Plus 4.6 × 50 mm, 1.8 μM, C18 column at room temperature.
A linear gradient from 10% to 100% B (MeOH + 0.1% acetic acid) in
5.0 min was followed by pumping 100% B for another 2 min with A
being H2O + 0.1% acetic acid. The flow rate was 1.0 mL/min. Mass
spectra (MS) data were acquired in positive ion mode using an Agilent
6110 single quadrupole mass spectrometer with an electrospray
ionization (ESI) source. High-resolution (positive ion) mass spectra
(HRMS) for compounds 7 and 13 were acquired using a Thermo
LTqFT mass spectrometer under FT control at 100 000 resolution.
Nuclear magnetic resonance (NMR) spectra were recorded with a
Varian Mercury spectrometer at 400 MHz for proton (1H NMR), 100
MHz for carbon (13C NMR), and 376 MHz for fluorine (19F NMR).
Chemical shifts are reported in ppm (δ). Preparative HPLC was
performed on Agilent Prep 1200 series with UV detector set to 220
nm. Samples were injected onto a Phenomenex Luna 75 × 30 mm, 5
CONCLUSIONS
■
We designed, synthesized, and biologically evaluated a set of
novel compounds aimed at improving the in vivo PK properties
of our previously reported G9a/GLP cellular chemical probe 5.
From these studies, we discovered inhibitor 7, which is the first
in vivo chemical probe of G9a and GLP. This inhibitor (1)
displayed high in vitro potency for G9a and GLP (IC50 < 2.5
nM); (2) was >2000-fold selective for G9a and GLP over
PRC2−EZH2 and >20 000-fold selective over 13 other
methyltransferases; (3) was >300-fold selective for G9a and
GLP over a broad range of kinases, GPCRs, ion channels, and
transporters with the exception of the histamine H3 receptor;
(4) was competitive with the peptide substrate and non-
competitive with the cofactor SAM; (5) exhibited high potency
8937
dx.doi.org/10.1021/jm401480r | J. Med. Chem. 2013, 56, 8931−8942

Journal of Medicinal Chemistry
Article
μM, C18 column at room temperature. The flow rate was 30 mL/min.
A linear gradient was used with 10% of MeOH (A) in 0.1% TFA in
H2O (B) to 100% of MeOH (A). HPLC was used to establish the
purity of target compounds. All compounds had >95% purity using the
HPLC methods described above.
2.59 (t, J = 7.3 Hz, 2H), 2.55−2.41 (m, 4H), 2.34−2.22 (m, 2H),
2.14−2.01 (m, 4H), 1.81−1.68 (m, 4H), 1.58 (ddd, J = 14.9, 12.0, 3.7
Hz, 2H), 1.03 (d, J = 6.6 Hz, 6H). 13C NMR (100 MHz, CDCl3): δ
158.69, 157.01, 154.25, 148.86, 146.47, 107.18, 103.50, 101.25, 67.40,
56.61, 54.56, 54.19 (2C), 52.89 (2C), 51.55 (2C), 48.80, 47.74, 42.96
(2C), 32.46 (2C), 28.46 (2C), 23.49, 18.44 (2C). HPLC: 98%, tR 1.97
min. MS (ESI): 561 [M + H]+.
Compound 5. Synthesis of compound 5 was reported previously.15
2-(4,4-Difluoropiperidin-1-yl)-N-(1-isopropylpiperidin-4-yl)-
6-methoxy-7-(3-(pyrrolidin-1-yl)propoxy)quinazolin-4-amine
(7). A mixture of compound 12 (0.72 g, 2.02 mmol) [prepared from
commercially available methyl 3-methoxyl-4-hydroxybenzoate (8)
according to the procedures described previously15], 1-isopropylpiper-
idin-4-amine·2TFA salt (2.3 g, 6.06 mmol) (this amine and other
noncommercially available amines were prepared according to
previously reported procedures59), and DIEA (0.67 mL, 4.04 mmol)
in THF (10 mL) was stirred overnight at rt. After concentration in
vacuo, the crude product was purified by silica gel chromatography
[0−20% MeOH (1% NH3)/CH2Cl2] to afford the desired product 2-
chloro-N-(1-isopropylpiperidin-4-yl)-6-methoxyl-7-(3-(pyrrolidin-1-
yl)propoxyl)quinazolin-4-amine as a yellow solid (0.88 g, 94% yield).
1H NMR (400 MHz, CDCl3): δ 7.12 (s, 1H), 6.78 (s, 1H), 5.36 (d, J =
N-(1-Isopropylpiperidin-4-yl)-6-methoxy-7-(3-(pyrrolidin-1-
yl)propoxy)-2-(3,3,4,4-tetrafluoropyrrolidin-1-yl)quinazolin-4-
amine (15). The procedure used for preparation of compound 7 was
followed for synthesis of compound 15. The title compound 15 was
1
obtained as a white solid (46 mg, 75% yield). H NMR (400 MHz,
CDCl3): δ 6.94 (s, 1H), 6.73 (s, 1H), 5.12 (d, J = 7.3 Hz, 1H), 4.25−
4.01 (m, 7H), 3.91 (s, 3H), 2.98−2.85 (m, 2H), 2.83−2.71 (m, 1H),
2.66−2.58 (m, 2H), 2.56−2.45 (m, 4H), 2.34 (td, J = 11.6, 2.1 Hz,
2H), 2.20−2.04 (m, 4H), 1.84−1.71 (m, 4H), 1.58 (qd, J = 11.8, 3.7
Hz, 2H), 1.07 (d, J = 6.6 Hz, 6H). 19F NMR (376 MHz, CDCl3): δ
−77.18. 13C NMR (100 MHz, CDCl3): δ 158.49, 156.76, 154.46,
148.92, 146.37, 118.61 (m, 2C), 107.17, 103.61, 101.22, 67.59, 56.70,
54.65, 54.32 (2C), 53.02 (2C), 50.76 (t, J = 28.8 Hz) (2C), 48.90,
47.87, 32.74 (2C), 28.62 (2C), 23.61, 18.57 (2C). HPLC: 99%, tR 2.49
min. MS (ESI): 569 [M + H]+.
7.7 Hz, 1H), 4.31−4.20 (m, 1H), 4.17 (t, J = 6.7 Hz, 2H), 3.96 (s,
3H), 2.90 (d, J = 11.9 Hz, 2H), 2.84−2.73 (m, 1H), 2.67−2.59 (m,
2H), 2.57−2.46 (m, 4H), 2.45−2.34 (m, 2H), 2.22−2.05 (m, 4H),
1.84−1.74 (m, 4H), 1.07 (d, J = 6.6 Hz, 6H). MS (ESI): 462 [M +
H]+. A mixture of this intermediate (55 mg, 0.12 mmol), 4,4-
difluoropiperidine hydrochloride salt (37 mg, 0.24 mmol), and TFA
(55 mg, 0.48 mmol) in i-PrOH (0.25 mL) was heated by microwave
irradiation at 160 °C for 15 min in a sealed tube. After concentration
in vacuo, the crude product was purified by preparative HPLC with a
gradient from 10% MeOH (A) in 0.1% TFA in H2O (B) to 100% of
MeOH (A). The resulting product was basified with saturated aq
NaHCO3 and extracted with CH2Cl2 to afford the title compound 7 as
a white solid (52 mg, 80% yield). 1H NMR (400 MHz, CDCl3): δ 6.91
(s, 1H), 6.70 (s, 1H), 4.97 (d, J = 7.2 Hz, 1H), 4.18 (t, J = 6.8 Hz,
2H), 4.13−4.03 (m, 1H), 4.02−3.94 (m, 4H), 3.92 (s, 3H), 2.97−2.86
(m, 2H), 2.83−2.72 (m, 1H), 2.63 (t, J = 7.2 Hz, 2H), 2.58−2.46 (m,
4H), 2.34 (td, J = 11.6, 2.2 Hz, 2H), 2.21−2.14 (m, 2H), 2.14−2.07
(m, 2H), 2.07−1.94 (m, 4H), 1.82−1.74 (m, 4H), 1.58 (ddd, J = 14.9,
11.8, 3.7 Hz, 2H), 1.08 (d, J = 6.5 Hz, 6H). 19F NMR (376 MHz,
CDCl3): δ −96.10 to −97.04 (m, 2F). 13C NMR (100 MHz, CDCl3):
δ 158.49, 158.32, 154.23, 149.33, 146.00, 122.95 (t, J = 241.4 Hz),
107.18, 103.18, 101.34, 67.47, 56.69, 54.59, 54.28 (2C), 53.01 (2C),
48.77, 47.85, 41.25 (t, J = 4.9 Hz) (2C), 34.00 (t, J = 22.4 Hz) (2C),
32.72 (2C), 28.62 (2C), 23.57, 18.58 (2C). HPLC: 100%, tR 2.37 min.
MS (ESI): 547 [M + H]+. HRMS (ESI): calcd for C29H44F2N6O2Na
[M + Na]+ 569.3392, found 569.3384.
N-(1-Isopropylpiperidin-4-yl)-6-methoxy-2-morpholino-7-
(3-(pyrrolidin-1-yl)propoxy)quinazolin-4-amine (13). The pro-
cedure used for preparation of compound 7 was followed for synthesis
of compound 13. The title compound 13 was obtained as a white solid
(55 mg, 78% yield). 1H NMR (400 MHz, CDCl3): δ 6.90 (s, 1H), 6.72
(s, 1H), 5.04 (d, J = 7.3 Hz, 1H), 4.15 (t, J = 6.8 Hz, 2H), 4.12−4.02
(m, 1H), 3.89 (s, 3H), 3.85−3.72 (m, 8H), 2.95−2.85 (m, 2H), 2.81−
2.71 (m, 1H), 2.61 (t, J = 7.2 Hz, 2H), 2.55−2.44 (m, 4H), 2.32 (td, J
= 11.6, 2.1 Hz, 2H), 2.21−2.12 (m, 2H), 2.12−2.02 (m, 2H), 1.82−
1.71 (m, 4H), 1.57 (ddd, J = 14.9, 11.8, 3.7 Hz, 2H), 1.06 (d, J = 6.6
Hz, 6H). 13C NMR (100 MHz, CDCl3): δ 159.06, 158.35, 154.21,
149.23, 145.96, 107.19, 103.38, 101.40, 67.47, 67.23 (2C), 56.71,
54.63, 54.29 (2C), 53.04 (2C), 48.68, 47.90, 44.80 (2C), 32.71 (2C),
28.63 (2C), 23.59, 18.58 (2C). HPLC: 100%, tR 2.19 min. MS (ESI):
513 [M + H]+. HRMS (ESI): calcd for C28H45N6O3 [M + H]+
513.3553, found 513.3550.
Compounds 16 and 17. Compounds 16 and 17 were synthesized
according to previously reported procedures.16
N-(1-Cyclopropylpiperidin-4-yl)-2-(4,4-difluoropiperidin-1-
yl)-6-methoxy-7-(3-(pyrrolidin-1-yl)propoxy)quinazolin-4-
amine (18). The procedure used for preparation of compound 7 was
followed for synthesis of compound 18. The title compound 18 was
obtained as a yellowish solid (47 mg, 82% yield). 1H NMR (400 MHz,
CDCl3): δ 6.90 (s, 1H), 6.73 (s, 1H), 5.08 (d, J = 7.2 Hz, 1H), 4.21−
4.05 (m, 3H), 4.02−3.93 (m, 4H), 3.88 (s, 3H), 3.08−2.98 (m, 2H),
2.68−2.57 (m, 2H), 2.57−2.46 (m, 4H), 2.38 (td, J = 11.7, 2.2 Hz,
2H), 2.16−2.06 (m, 4H), 2.06−1.92 (m, 4H), 1.82−1.72 (m, 4H),
1.65−1.59 (m, 1H), 1.52 (ddd, J = 14.9, 12.2, 3.8 Hz, 2H), 0.49−0.43
(m, 2H), 0.43−0.37 (m, 2H). 13C NMR (100 MHz, CDCl3): δ 158.49,
158.29, 154.18, 149.30, 145.97, 122.93 (t, J = 4.8 Hz), 107.17, 103.19,
101.34, 67.39, 56.66, 54.24 (2C), 52.99 (2C), 52.81, 48.54, 41.24 (t, J
= 241.4 Hz) (2C), 38.61, 33.99 (t, J = 22.4 Hz) (2C), 32.21 (2C),
28.50 (2C), 23.56, 6.15 (2C). HPLC: 99%, tR 2.45 min. MS (ESI): 545
[M + H]+.
4-(4-((1-Cyclopropylpiperidin-4-yl)amino)-6-methoxy-7-(3-
(pyrrolidin-1-yl)propoxy)quinazolin-2-yl)thiomorpholine 1,1-
Dioxide (19). The procedure used for preparation of compound 7
was followed for the synthesis of compound 19. The title compound
1
19 was obtained as a yellowish solid (42 mg, 76% yield). H NMR
(400 MHz, CDCl3): δ 6.90 (s, 1H), 6.76 (s, 1H), 5.21 (d, J = 7.3 Hz,
1H), 4.44−4.26 (m, 4H), 4.16 (t, J = 6.8 Hz, 2H), 4.13−4.01 (m, 1H),
3.90 (s, 3H), 3.10−2.96 (m, 6H), 2.66−2.58 (m, 2H), 2.57−2.46 (m,
4H), 2.43−2.29 (m, 2H), 2.15−2.01 (m, 4H), 1.83−1.69 (m, 4H),
1.66−1.48 (m, 3H), 0.49−0.43 (m, 2H), 0.42−0.36 (m, 2H). 13C
NMR (100 MHz, CDCl3): δ 158.72, 157.06, 154.35, 148.94, 146.57,
107.28, 103.50, 101.17, 67.45, 56.68, 54.25 (2C), 52.96 (2C), 52.73,
51.61 (2C), 48.67, 43.01 (2C), 38.57, 32.17 (2C), 28.49 (2C), 23.55,
6.17 (2C). HPLC: 98%, tR 1.97 min. MS (ESI): 559 [M + H]+.
4-Chloro-6-methoxy-2-(phosphinan-4-yl)-7-(3-(pyrrolidin-1-
yl)propoxy)quinazoline (21). In a sealed tube, a mixture of
compound 10 (0.61 g, 2.0 mmol) (prepared according to the
procedures described previously15), tetrahydro-2H-pyran-4-carbon-
itrile (2.2 g, 19.8 mmol), and HCl (4 N solution in dioxane, 8 mL,
32 mmol) was stirred overnight at 100 °C. The reaction mixture was
poured into water and neutralized with NaHCO3. The resulting
precipitate was collected and dried to provide the desired crude
product 20 (0.58 g, 1.5 mmol). A mixture of this crude compound 20
(0.58 g, 1.5 mmol) and N,N-diethylaniline (0.24 mL, 1.5 mmol) in
POCl3 (10 mL) was heated at reflux for 4 h. The reaction mixture was
concentrated in vacuo and saturated aq NaHCO3 (15 mL) was added.
The resulting mixture was extracted with chloroform (15 mL × 3).
The combined organic layers were dried, concentrated, and purified by
flash column chromatography on silica gel (0−10% MeOH/CH2Cl2)
to afford the title compound 21 as a yellow solid (0.38 g, 48% over two
4-(4-((1-Isopropylpiperidin-4-yl)amino)-6-methoxy-7-(3-
(pyrrolidin-1-yl)propoxy)quinazolin-2-yl)thiomorpholine 1,1-
Dioxide (14). The procedure used for preparation of compound 7
was followed for synthesis of compound 14. The title compound 14
was obtained as a white solid (47 mg, 81% yield). 1H NMR (400 MHz,
CDCl3): δ 6.88 (s, 1H), 6.79 (s, 1H), 5.32 (d, J = 7.3 Hz, 1H), 4.42−
4.24 (m, 4H), 4.14 (t, J = 6.8 Hz, 2H), 4.07−3.94 (m, 1H), 3.88 (s,
3H), 3.09−2.96 (m, 4H), 2.93−2.82 (m, 2H), 2.79−2.68 (m, 1H),
8938
dx.doi.org/10.1021/jm401480r | J. Med. Chem. 2013, 56, 8931−8942

Journal of Medicinal Chemistry
Article
1
steps). H NMR (400 MHz, CDCl3): δ 7.26 (s, 1H), 7.23 (s, 1H),
for preparation of compound 25a was then followed for the synthesis
of compound 25b. The title compound 25b was obtained as a
yellowish solid (0.39 g, 49% yield over two steps). H NMR (400
4.22 (t, J = 6.4 Hz, 2H), 4.07−4.02 (m, 2H), 3.96 (s, 3H), 3.50 (td, J =
11.2, 2.8 Hz, 2H), 3.12−3.06 (m, 1H), 2.65 (t, J = 7.2 Hz, 2H), 2.55−
2.53 (m, 4H), 2.15−2.09 (m, 2H), 2.05−1.92 (m, 4H), 1.77−1.74 (m,
4H).
1
MHz, CDCl3): δ 7.36 (s, 1H), 7.29 (s, 1H), 4.29 (t, J = 6 Hz, 2H),
4.13−4.09 (m, 2H), 4.03 (s, 3H), 3.57 (td, J = 11.6, 2.4 Hz, 2H),
3.21−3.14 (m, 1H), 2.74−2.43 (m, 6H), 2.16−1.96 (m, 10H).
7-(3-(4,4-Difluoropiperidin-1-yl)propoxy)-N-(1-isopropylpi-
peridin-4-yl)-6-methoxy-2-(tetrahydro-2H-pyran-4-yl)-
quinazolin-4-amine (26b). The procedure used for preparation of
compound 26a was followed for the synthesis of compound 26b. The
title compound 26b was obtained as a yellowish solid from compound
25b (48 mg, 75% yield). 1H NMR (400 MHz, CDCl3): δ 7.15 (s, 1H),
6.80 (s, 1H), 5.16 (d, J = 7.2 Hz, 1H), 4.28−4.13 (m, 3H), 4.13−4.02
(m, 2H), 3.93 (s, 3H), 3.55 (td, J = 11.9, 2.0 Hz, 2H), 3.01−2.85 (m,
3H), 2.83−2.71 (m, 1H), 2.63−2.47 (m, 6H), 2.36 (td, J = 11.6, 2.2
Hz, 2H), 2.26−2.14 (m, 2H), 2.14−1.82 (m, 10H), 1.56 (qd, J = 11.8,
3.7 Hz, 2H), 1.07 (d, J = 6.6 Hz, 6H). 13C NMR (100 MHz, CDCl3):
δ 167.56, 158.00, 153.75, 148.65, 147.32, 122.17 (t, J = 241.4 Hz),
108.53, 106.88, 99.95, 68.20 (2C), 67.29, 56.47, 54.63, 54.08 (2C),
50.15 (t, J = 5.4 Hz) (2C), 48.78, 47.86, 44.86, 34.13 (t, J = 22.9 Hz)
(2C), 32.82 (2C), 31.64 (2C), 26.75, 18.59 (2C). HPLC: 97%, tR 1.63
min. MS (ESI): 562 [M + H]+.
Methyltransferase Activity Assays. Methyltransferase activity
assays were performed by monitoring the incorporation of tritium-
labeled methyl group to biotinylated peptide substrates using a
scintillation proximity assay (SPA) for G9a, GLP, PRMT3, SETD7,
SETDB1, SETD8, SUV420H1, SUV420H2, SUV39H2, PRC2 trimeric
complex (EZH2:EED:SUZ12), MLL1 tetrameric complex
(MLL:WDR5:RbBP5:ASH2L), PRMT5-MEP50 complex, and
SMYD2. Assay components for all assays are summarized in Table
S4 of the Supporting Information. The following reaction buffers were
used: for SMYD2 and SMYD3, 50 mM Tris, pH 9.0, 5 mM DTT,
0.01% TritonX-100; for G9a, GLP, and SUV39H2, 25 mM potassium
phosphate, pH 8.0, 1 mM EDTA, 2 mM MgCl2, and 0.01% Triton X-
100; and for other HMTs, 20 mM Tris, pH 8.0, 5 mM DTT, 0.01%
TritonX-100. To stop the enzymatic reactions, 10 μL of 7.5 M
guanidine hydrochloride was added, followed by 180 μL of buffer, and
the reaction was mixed and transferred to a 96-well FlashPlate (Cat.#
SMP103; Perkin-Elmer; www.perkinelmer.com). After mixing, the
reaction mixtures were incubated and the cpm (counts per minute)
were measured using a Topcount plate reader (Perkin-Elmer, www.
perkinelmer.com). The cpm counts in the absence of compound for
each data set were defined as 100% activity. In the absence of the
enzyme, the cpm counts in each data set were defined as background
(0%). IC50 values were determined using compound concentrations
ranging from 100 nM to 100 μM. The IC50 values were determined
using SigmaPlot software.
For DNMT1, the assay was performed as described above using
hemimethylated dsDNA as a substrate. The dsDNA substrate was
prepared by annealing two complementary strands (biotinylated
forward strand, B-GAGCCCGTAAGCCCGTTCAGGTCG; reverse
strand, CGACCTGAACGGGCTTACGGGCTC), synthesized by an
Eurofins MWG Operon. Reaction buffer was 20 mM Tris-HCl, pH
8.0, 5 mM DTT, 0.01% Triton X-100.
Methyltransferase activity assays for DOT1L and SMYD3 were
performed using filter plates (Millipore; cat.# MSFBN6B10; www.
millipore.com). Reaction mixtures in 20 mM Tris-HCl, pH 8.0, 5 mM
DTT, 2 mM MgCl2, and 0.01% Triton X-100 were incubated at room
temperature for 1 h, 100 μL 10% TCA was added, and the reactions
were mixed and transferred to the filter plates. Plates were centrifuged
at 2000 rpm for 2 min followed by two additional 10% TCA washes
and one ethanol wash (180 μL) followed by centrifugation. Plates were
dried, 100 μL MicroO was added, and the plates were centrifuged.
Finally, 70 μL of MicroO was added and cpm were measured using the
Topcount plate reader.
N-(1-Isopropylpiperidin-4-yl)-6-methoxy-7-(3-(pyrrolidin-1-
yl)propoxy)-2-(tetrahydro-2H-pyran-4-yl)quinazolin-4-amine
(22). A suspension of compound 21 (95 mg, 0.23 mmol), 1-
isopropylpiperidin-4-amine·2TFA salt (0.24 g, 0.72 mmol), and
K2CO3 (0.33 g, 2.4 mmol) in DMF (3.0 mL) was stirred overnight
at 60 °C. The reaction mixture was cooled to rt, water (10 mL) was
added, and the mixture was extracted with CH2Cl2. The combined
organic layers were concentrated and purified by preparative HPLC.
The resulting product was basified with saturated aq NaHCO3 and
extracted with CH2Cl2 to afford the desired product 22 as a white solid
(91 mg, 78% yield). 1H NMR (400 MHz, CDCl3): δ 7.14 (s, 1H), 6.81
(s, 1H), 5.20 (d, J = 7.2 Hz, 1H), 4.26−4.12 (m, 3H), 4.12−4.02 (m,
2H), 3.91 (s, 3H), 3.54 (td, J = 11.9, 1.9 Hz, 2H), 3.00−2.85 (m, 3H),
2.83−2.71 (m, 1H), 2.65−2.55 (m, 2H), 2.55−2.42 (m, 4H), 2.42−
2.31 (m, 2H), 2.25−2.14 (m, 2H), 2.13−1.97 (m, 4H), 1.93−1.83 (m,
2H), 1.81−1.68 (m, 4H), 1.56 (ddd, J = 23.4, 11.9, 3.7 Hz, 2H), 1.06
(d, J = 6.6 Hz, 6H). 13C NMR (100 MHz, CDCl3): δ 167.45, 158.00,
153.85, 148.68, 147.34, 108.53, 106.83, 100.04, 68.19 (2C), 67.64,
56.50, 54.63, 54.28 (2C), 52.95 (2C), 48.74, 47.85, 44.82, 32.76 (2C),
31.63 (2C), 28.52 (2C), 23.58, 18.56 (2C). HPLC: 98%, tR 2.31 min.
MS (ESI): 512 [M + H]+.
Methyl 2-Amino-4-(3-(4,4-difluoropiperidin-1-yl)propoxy)-
5-methoxybenzoate (23). The procedure used for preparation of
compound 10 was followed for the synthesis of compound 23. The
title compound 23 was obtained as a yellow oil (2.1 g, 49% yield over
two steps). 1H NMR (400 MHz, CDCl3): δ 7.30 (s, 1H), 6.17 (s, 1H),
5.58 (br, 2H), 4.10 (t, J = 6.4 Hz, 2H), 3.85 (s, 3H), 3.79 (s, 3H),
3.17−2.81 (m, 6H), 2.48−2.19 (m, 6H).
4-Chloro-2-cyclohexyl-7-(3-(4,4-difluoropiperidin-1-yl)-
propoxy)-6-methoxyquinazoline (25a). In a sealed tube, a mixture
of compound 23 (1.1 g, 3.0 mmol), cyclohexanecarbonitrile (3.3 g,
30.0 mmol), and HCl (4 N solution in dioxane, 15 mL, 60 mmol) was
stirred overnight at 100 °C. The reaction mixture was poured into
water and neutralized with NaHCO3. The resulting precipitate was
collected and dried to provide the intermediate 24a (1.0 g, 2.3 mmol).
A mixture of the crude compound 24a (1.0 g, 2.3 mmol) and N,N-
diethylaniline (0.37 mL, 2.3 mmol) in POCl3 (20 mL) was heated at
reflux for 4 h. The reaction mixture was concentrated in vacuo and
saturated aq NaHCO3 (30 mL) was added. The resulting mixture was
extracted with chloroform (30 mL × 3). The combined organic layers
were dried, concentrated, and purified by flash column chromatog-
raphy on silica gel (0−10% MeOH/CH2Cl2) to afford the 25a as a
1
yellowish solid (0.72 g, 53% yield over two steps). H NMR (400
MHz, CDCl3): δ 7.35 (s, 1H), 7.28 (s, 1H), 4.28 (t, J = 6 Hz, 2H),
4.02 (s, 3H), 2.93 (tt, J = 11.6, 3.6 Hz, 1H), 2.83−2.41 (m, 6H), 2.27−
1.96 (m, 6H), 1.93−1.84 (m, 4H), 1.81−1.64 (m, 3H), 1.51−1.29 (m,
3H).
7-(3-(4,4-Difluoropiperidin-1-yl)propoxy)-N-(1-isopropylpi-
peridin-4-yl)-6-methoxy-2-cyclohexylquinazolin-4-amine
(26a). The procedure used for preparation of compound 5 was then
followed for the synthesis of compound 26a. The title compound 26a
was obtained as a yellowish solid from intermediate 25a (46 mg, 77%
yield). 1H NMR (400 MHz, CDCl3): δ 7.15 (s, 1H), 6.81 (s, 1H), 5.18
(d, J = 7.2 Hz, 1H), 4.24−4.13 (m, 3H), 4.13−4.02 (m, 2H), 3.90 (s,
3H), 2.90 (d, J = 12 Hz, 2H), 2.80−2.66 (m, 2H), 2.55−2.50 (m, 6H),
2.36 (td, J = 11.6, 2 Hz, 2H), 2.22−2.19 (m, 2H), 2.05−1.90 (m, 8H),
1.85−1.81 (m, 2H), 1.73−1.51 (m, 5H), 1.45−1.27 (m, 3H), 1.06 (d, J
= 6.0 Hz, 6H). 13C NMR (100 MHz, CDCl3): δ 169.42, 157.82,
153.44, 148.25, 147.26, 122.06 (t, J = 240 Hz), 108.44, 106.68, 99.89,
67.11, 56.28, 54.48, 53.94 (2C), 49.99 (t, J = 5 Hz) (2C), 48.56, 47.88,
47.74, 33.99 (t, J = 23 Hz) (2C), 33.76, 32.67 (2C), 26.61 (2C), 26.39
(2C), 26.21, 18.49 (2C). HPLC: 97%, tR 2.74 min. MS (ESI): 560 [M
+ H]+.
Ki Determination for Inhibitor 7. A competition between
inhibitor 7 and the peptide was measured using microfluidic capillary
electrophoresis to monitor the methylation status of peptide
substrates. Reactions (15 μL) were set up in Nunc polypropylene
shallow low-volume 384-well microplates containing a 5 μL spot of the
4-Chloro-7-(3-(4,4-difluoropiperidin-1-yl)propoxy)-6-me-
thoxy-2-(piperidin-1-yl)quinazoline (25b). The procedure used
8939
dx.doi.org/10.1021/jm401480r | J. Med. Chem. 2013, 56, 8931−8942

Journal of Medicinal Chemistry
Article
compound in 1.5% DMSO and 1× assay buffer (20 mM Tris-HCl pH
8, 25 mM NaCl, 0.05% Tween 20, and 2 mM DTT) and a 5 μL spot
of the peptide substrate60 in 1× assay buffer arrayed in a 6 × 8 grid
pattern. Inhibitor 7 was titrated from 20 to 1.76 nM using 1.5-fold
dilution, and peptide was titrated from 50 to 1.6 μM using a 2-fold
dilution scheme. A total of four grids for each assay time point were set
up. Five microliters of G9a and SAM cocktail was added to initiate the
reaction (to final concentration of 5 nM and 200 μM, respectively).
The reactions were allowed to proceed for 20, 30, 40, and 60 min at 25
°C, and 10 μL of Endo-LysC (40 pg/μL) and inhibitor 5 (10 μM) mix
were added to stop the reaction and digest remaining unmethylated
peptide. After 1 h, peptide concentrations over 10 μM were diluted to
10 μM in 1× reaction buffer (to avoid saturation of the optics) and the
plate was read on a Caliper Life Sciences EZR II, using upstream
voltage = −500 V, downstream voltage = −1200 V, and pressure = 1.5
psi. Predigested peptide was used as the marker. The steady-state
velocity was analyzed by linear regression of the peptide methylation
versus time and plotted to determine Michaelis−Menten kinetics
(GraphPad Prism 5.0). Km and kcat values were plotted to determine
the relationship of the peptide and the inhibitor on enzyme kinetics.
The Ki value is an average of three replicates SD.
AUTHOR INFORMATION
Corresponding Author
*Phone: 919-843-8459. Fax: 919-843-8465. E-mail: jianjin@
unc.edu.
■
Present Address
#Department of Pharmacology, Soochow University College of
Pharmaceutical Sciences, Suzhou, China 215325.
Notes
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
The research described here was supported by grant
R01GM103893 from the National Institute of General Medical
Sciences of the National Institutes of Health, the University
Cancer Research Fund and Carolina Partnership from
University of North Carolina at Chapel Hill, the V Foundation
for Cancer Research, and the Structural Genomics Consortium,
a registered charity (number 1097737) that receives funds from
the Canada Foundation for Innovation, Eli Lilly Canada,
GlaxoSmithKline, the Ontario Ministry of Economic Develop-
ment and Innovation, the Novartis Research Foundation,
Pfizer, AbbVie, Takeda, Janssen, Boehringer Ingelheim and the
Wellcome Trust.
Competition of Inhibitor 7 with SAM. This assay was performed
as described previously.15
Kinase Selectivity Assays. Selectivity of inhibitor 7 against a
panel of 50 kinases was conducted using a standard off-chip mobility
shift assay technology. The full list of the 50 kinases is included in
Table S1 (Supporting Information).
GPCRs, Ion Channels, and Transporters Selectivity Assays.
Selectivity of inhibitor 7 against 44 GPCRs, ion channels, and
transporters was determined in standard radioligand binding assays.
The full list of the 44 targets is included in Table S2 (Supporting
Information).
Cellular Assays. MDA-MB-231, PC3, and U2OS cells were
cultured in RPMI with 10% FBS, PANC-1 cells in DMEM with 10%
FBS. Cells were treated with inhibitors for 48 h. Cell viability assays
were performed by incubating cells with 0.1 mg/mL of resazurin
(Sigma) for 3−4 h. Resazurin reduction was monitored with 544 nm
excitation, measuring fluorescence at 590 nm. In-cell Western assay
was performed as described previously.15
For clonogenicity assays, PANC-1 and MDA-MB-231 cells were
cultured in the presence of the inhibitor for 2 days and seeded in 12-
well plates at the density of 200−300 cells per well in triplicates. The
cells were cultured for 2 weeks until colonies were visible. Cell media
and the inhibitor were changed every 3−4 days. Colonies were stained
with 1% methylene blue in 50% methanol and counted. The
experiments repeated twice with consistent results. Colonies were
scored using a Clono-Counter.
ABBREVIATIONS USED
■
H3K9me2, dimethylated lysine 9 on histone H3; PK,
pharmacokinetic; PKMTs, protein lysine methyltransferases;
HMTs, histone methyltransferases; PRMT, protein arginine
methyltransferase; KMT1C, lysine methyltransferase 1C;
EHMT2, euchromatic histone methyltransferase 2; KMT1D,
lysine methyltransferase 1D; EHMT1, euchromatic histone
methyltransferase 1; H3K9, histone H3 lysine 9; SET,
suppressor of variegation 3−9, enhancer of zeste and trithorax;
HIV-1, human immunodeficiency virus type 1; SAR, structure−
activity relationships; CYP450, cytochrome P450; SAM, S-
adenosyl-L-methionine; ICW, in-cell Western; tox/function
ratio, ratio of toxicity to functional potency; CLint, intrinsic
clearance; T1/2, half-life; ip, intraperitoneal; Cmax, maximum
concentration; AUC, area under the curve; MOA, mechanism
of action; Kmapp, apparent Km; PRC2−EZH2, polycomb
repressive complex 2−enhancer of zeste homologue 2;
GPCRs, G-protein-coupled receptors
In Vitro Metabolic Stability Studies. Standard in vitro metabolic
stability studies were conducted. Compound concentrations were
measured after 0, 5, 15, 30, and 45 min incubation of test compounds
with mouse liver microsomes.
Mouse PK studies. Standard PK studies were performed using
male Swiss albino mice. Plasma and brain concentrations were
measured at 0.08, 0.25, 0.5, 1, 2, 4, 8, and 24 h following a single ip
injection of inhibitor 7 or 13 at 5 mg/kg. The compound
concentration at each time point in plasma or brain is the average
value from three test animals.
REFERENCES
■
(1) Arrowsmith, C. H.; Bountra, C.; Fish, P. V.; Lee, K.; Schapira, M.
Epigenetic protein families: A new frontier for drug discovery. Nat.
Rev. Drug Discovery 2012, 11, 384−400.
(2) Bernstein, B. E.; Meissner, A.; Lander, E. S. The mammalian
epigenome. Cell 2007, 128, 669−681.
(3) Copeland, R. A.; Solomon, M. E.; Richon, V. M. Protein
methyltransferases as a target class for drug discovery. Nat. Rev. Drug
Discovery 2009, 8, 724−732.
(4) Kouzarides, T. Chromatin modifications and their function. Cell
2007, 128, 693−705.
(5) Martin, C.; Zhang, Y. The diverse functions of histone lysine
methylation. Nat. Rev. Mol. Cell Biol. 2005, 6, 838−849.
(6) Huang, J.; Dorsey, J.; Chuikov, S.; Zhang, X.; Jenuwein, T.;
Reinberg, D.; Berger, S. L. G9A and GLP methylate lysine 373 in the
tumor suppressor p53. J. Biol. Chem. 2010, 285, 9636−9641.
(7) Huang, J.; Perez-Burgos, L.; Placek, B. J.; Sengupta, R.; Richter,
M.; Dorsey, J. A.; Kubicek, S.; Opravil, S.; Jenuwein, T.; Berger, S. L.
Repression of p53 activity by Smyd2-mediated methylation. Nature
2006, 444, 629−632.
ASSOCIATED CONTENT
■
S
* Supporting Information
Kinases, GPCRs, ion channels, and transporters selectivity assay
results of inhibitor 7; methyltransferase assay components and
conditions; and 1H and 13C NMR spectra of compounds 7 and
13. This information is available free of charge via the Internet
at http://pubs.acs.org.
8940
dx.doi.org/10.1021/jm401480r | J. Med. Chem. 2013, 56, 8931−8942

Journal of Medicinal Chemistry
Article
(8) Rathert, P.; Dhayalan, A.; Murakami, M.; Zhang, X.; Tamas, R.;
Jurkowska, R.; Komatsu, Y.; Shinkai, Y.; Cheng, X.; Jeltsch, A. Protein
lysine methyltransferase G9a acts on non-histone targets. Nat. Chem.
Biol. 2008, 4, 344−346.
(9) Campagna-Slater, V.; Mok, M. W.; Nguyen, K. T.; Feher, M.;
Najmanovich, R.; Schapira, M. Structural chemistry of the histone
methyltransferases cofactor binding site. J. Chem. Inf. Model. 2011, 51,
612−623.
(10) Wu, H.; Min, J.; Lunin, V. V.; Antoshenko, T.; Dombrovski, L.;
Zeng, H.; Allali-Hassani, A.; Campagna-Slater, V.; Vedadi, M.;
Arrowsmith, C. H.; Plotnikov, A. N.; Schapira, M. Structural biology
of human H3K9 methyltransferases. PLoS One 2010, 5, e8570.
(11) Kubicek, S.; O’Sullivan, R. J.; August, E. M.; Hickey, E. R.;
Zhang, Q.; Teodoro, M. L.; Rea, S.; Mechtler, K.; Kowalski, J. A.;
Homon, C. A.; Kelly, T. A.; Jenuwein, T. Reversal of H3K9me2 by a
small-molecule inhibitor for the G9a histone methyltransferase. Mol.
Cell 2007, 25, 473−481.
(12) Liu, F.; Chen, X.; Allali-Hassani, A.; Quinn, A. M.; Wasney, G.
A.; Dong, A.; Barsyte, D.; Kozieradzki, I.; Senisterra, G.; Chau, I.;
Siarheyeva, A.; Kireev, D. B.; Jadhav, A.; Herold, J. M.; Frye, S. V.;
Arrowsmith, C. H.; Brown, P. J.; Simeonov, A.; Vedadi, M.; Jin, J.
Discovery of a 2,4-diamino-7-aminoalkoxyquinazoline as a potent and
selective inhibitor of histone lysine methyltransferase G9a. J. Med.
Chem. 2009, 52, 7950−7953.
(21) Knutson, S. K.; Wigle, T. J.; Warholic, N. M.; Sneeringer, C. J.;
Allain, C. J.; Klaus, C. R.; Sacks, J. D.; Raimondi, A.; Majer, C. R.;
Song, J.; Scott, M. P.; Jin, L.; Smith, J. J.; Olhava, E. J.; Chesworth, R.;
Moyer, M. P.; Richon, V. M.; Copeland, R. A.; Keilhack, H.; Pollock,
R. M.; Kuntz, K. W. A selective inhibitor of EZH2 blocks H3K27
methylation and kills mutant lymphoma cells. Nat. Chem. Biol. 2012, 8,
890−896.
(22) McCabe, M. T.; Ott, H. M.; Ganji, G.; Korenchuk, S.;
Thompson, C.; Van Aller, G. S.; Liu, Y.; Graves, A. P.; Iii, A. D.; Diaz,
E.; Lafrance, L. V.; Mellinger, M.; Duquenne, C.; Tian, X.; Kruger, R.
G.; McHugh, C. F.; Brandt, M.; Miller, W. H.; Dhanak, D.; Verma, S.
K.; Tummino, P. J.; Creasy, C. L. EZH2 inhibition as a therapeutic
strategy for lymphoma with EZH2-activating mutations. Nature 2012,
492, 108−112.
(23) Verma, S. K.; Tian, X.; LaFrance, L. V.; Duquenne, C.; Suarez,
D. P.; Newlander, K. A.; Romeril, S. P.; Burgess, J. L.; Grant, S. W.;
Brackley, J. A.; Graves, A. P.; Scherzer, D. A.; Shu, A.; Thompson, C.;
Ott, H. M.; Aller, G. S. V.; Machutta, C. A.; Diaz, E.; Jiang, Y.;
Johnson, N. W.; Knight, S. D.; Kruger, R. G.; McCabe, M. T.; Dhanak,
D.; Tummino, P. J.; Creasy, C. L.; Miller, W. H. Identification of
potent, selective, cell-active inhibitors of the histone lysine
methyltransferase EZH2. ACS Med. Chem. Lett. 2012, 3, 1091−1096.
́
(24) Zheng, W.; Ibanez, G.; Wu, H.; Blum, G.; Zeng, H.; Dong, A.;
̃
Li, F.; Hajian, T.; Allali-Hassani, A.; Amaya, M. F.; Siarheyeva, A.; Yu,
W.; Brown, P. J.; Schapira, M.; Vedadi, M.; Min, J.; Luo, M. Sinefungin
derivatives as inhibitors and structure probes of protein lysine
methyltransferase SETD2. J. Am. Chem. Soc. 2012, 134, 18004−18014.
(25) Qi, W.; Chan, H.; Teng, L.; Li, L.; Chuai, S.; Zhang, R.; Zeng, J.;
Li, M.; Fan, H.; Lin, Y.; Gu, J.; Ardayfio, O.; Zhang, J.-H.; Yan, X.;
Fang, J.; Mi, Y.; Zhang, M.; Zhou, T.; Feng, G.; Chen, Z.; Li, G.; Yang,
T.; Zhao, K.; Liu, X.; Yu, Z.; Lu, C. X.; Atadja, P.; Li, E. Selective
inhibition of EZH2 by a small molecule inhibitor blocks tumor cells
proliferation. Proc. Natl. Acad. Sci. U. S. A. 2012, 109, 21360−21365.
(26) Yu, W.; Chory, E. J.; Wernimont, A. K.; Tempel, W.; Scopton,
A.; Federation, A.; Marineau, J. J.; Qi, J.; Barsyte-Lovejoy, D.; Yi, J.;
Marcellus, R.; Iacob, R. E.; Engen, J. R.; Griffin, C.; Aman, A.;
Wienholds, E.; Li, F.; Pineda, J.; Estiu, G.; Shatseva, T.; Hajian, T.; Al-
awar, R.; Dick, J. E.; Vedadi, M.; Brown, P. J.; Arrowsmith, C. H.;
Bradner, J. E.; Schapira, M. Catalytic site remodelling of the DOT1L
methyltransferase by selective inhibitors. Nat Commun 2012, 3, 1288.
(27) Williams, D. E.; Dalisay, D. S.; Li, F.; Amphlett, J.; Maneerat,
W.; Chavez, M. A. G.; Wang, Y. A.; Matainaho, T.; Yu, W.; Brown, P.
J.; Arrowsmith, C. H.; Vedadi, M.; Andersen, R. J. Nahuoic acid A
produced by a Streptomyces sp. isolated from a marine sediment is a
selective SAM-competitive inhibitor of the histone methyltransferase
SETD8. Org. Lett. 2013, 15, 414−417.
(13) Chang, Y.; Ganesh, T.; Horton, J. R.; Spannhoff, A.; Liu, J.; Sun,
A.; Zhang, X.; Bedford, M. T.; Shinkai, Y.; Snyder, J. P.; Cheng, X.
Adding a lysine mimic in the design of potent inhibitors of histone
lysine methyltransferases. J. Mol. Biol. 2010, 400, 1−7.
(14) Liu, F.; Chen, X.; Allali-Hassani, A.; Quinn, A. M.; Wigle, T. J.;
Wasney, G. A.; Dong, A.; Senisterra, G.; Chau, I.; Siarheyeva, A.;
Norris, J. L.; Kireev, D. B.; Jadhav, A.; Herold, J. M.; Janzen, W. P.;
Arrowsmith, C. H.; Frye, S. V.; Brown, P. J.; Simeonov, A.; Vedadi, M.;
Jin, J. Protein lysine methyltransferase G9a inhibitors: Design,
synthesis, and structure activity relationships of 2,4-diamino-7-
aminoalkoxy-quinazolines. J. Med. Chem. 2010, 53, 5844−5857.
(15) Vedadi, M.; Barsyte-Lovejoy, D.; Liu, F.; Rival-Gervier, S.; Allali-
Hassani, A.; Labrie, V.; Wigle, T. J.; DiMaggio, P. A.; Wasney, G. A.;
Siarheyeva, A.; Dong, A.; Tempel, W.; Wang, S.-C.; Chen, X.; Chau, I.;
Mangano, T.; Huang, X.-P.; Simpson, C. D.; Pattenden, S. G.; Norris,
J. L.; Kireev, D. B.; Tripathy, A.; Edwards, A.; Roth, B. L.; Janzen, W.
P.; Garcia, B. A.; Petronis, A.; Ellis, J.; Brown, P. J.; Frye, S. V.;
Arrowsmith, C. H.; Jin, J. A chemical probe selectively inhibits G9a
and GLP methyltransferase activity in cells. Nat. Chem. Biol. 2011, 7,
566−574.
(16) Liu, F.; Barsyte-Lovejoy, D.; Allali-Hassani, A.; He, Y.; Herold, J.
M.; Chen, X.; Yates, C. M.; Frye, S. V.; Brown, P. J.; Huang, J.; Vedadi,
M.; Arrowsmith, C. H.; Jin, J. Optimization of cellular activity of G9a
inhibitors 7-aminoalkoxy-quinazolines. J. Med. Chem. 2011, 54, 6139−
6150.
(17) Ferguson, A. D.; Larsen, N. A.; Howard, T.; Pollard, H.; Green,
I.; Grande, C.; Cheung, T.; Garcia-Arenas, R.; Cowen, S.; Wu, J.;
Godin, R.; Chen, H.; Keen, N. Structural basis of substrate methylation
and inhibition of SMYD2. Structure 2011, 19, 1262−1273.
(18) Daigle, S. R.; Olhava, E. J.; Therkelsen, C. A.; Majer, C. R.;
Sneeringer, C. J.; Song, J.; Johnston, L. D.; Scott, M. P.; Smith, J. J.;
Xiao, Y.; Jin, L.; Kuntz, K. W.; Chesworth, R.; Moyer, M. P.; Bernt, K.
M.; Tseng, J. C.; Kung, A. L.; Armstrong, S. A.; Copeland, R. A.;
Richon, V. M.; Pollock, R. M. Selective killing of mixed lineage
leukemia cells by a potent small-molecule DOT1L inhibitor. Cancer
Cell 2011, 20, 53−65.
(28) Anglin, J. L.; Deng, L.; Yao, Y.; Cai, G.; Liu, Z.; Jiang, H.;
Cheng, G.; Chen, P.; Dong, S.; Song, Y. Synthesis and structure−
activity relationship investigation of adenosine-containing inhibitors of
histone methyltransferase DOT1L. J. Med. Chem. 2012, 55, 8066−
8074.
(29) Konze, K. D.; Ma, A.; Li, F.; Barsyte-Lovejoy, D.; Parton, T.;
MacNevin, C. J.; Liu, F.; Gao, C.; Huang, X. P.; Kuznetsova, E.;
Rougie, M.; Jiang, A.; Pattenden, S. G.; Norris, J. L.; James, L. I.; Roth,
B. L.; Brown, P. J.; Frye, S. V.; Arrowsmith, C. H.; Hahn, K. M.; Wang,
G. G.; Vedadi, M.; Jin, J. An orally bioavailable chemical probe of the
lysine methyltransferases EZH2 and EZH1. ACS Chem. Biol. 2013, 8,
1324−1334.
(30) Knutson, S. K.; Warholic, N. M.; Wigle, T. J.; Klaus, C. R.;
Allain, C. J.; Raimondi, A.; Porter Scott, M.; Chesworth, R.; Moyer, M.
P.; Copeland, R. A.; Richon, V. M.; Pollock, R. M.; Kuntz, K. W.;
Keilhack, H. Durable tumor regression in genetically altered malignant
rhabdoid tumors by inhibition of methyltransferase EZH2. Proc. Natl.
Acad. Sci. U. S. A. 2013, 110, 7922−7927.
(31) Beguelin, W.; Popovic, R.; Teater, M.; Jiang, Y.; Bunting, K. L.;
Rosen, M.; Shen, H.; Yang, S. N.; Wang, L.; Ezponda, T.; Martinez-
Garcia, E.; Zhang, H.; Zheng, Y.; Verma, S. K.; McCabe, M. T.; Ott, H.
M.; Van Aller, G. S.; Kruger, R. G.; Liu, Y.; McHugh, C. F.; Scott, D.
W.; Chung, Y. R.; Kelleher, N.; Shaknovich, R.; Creasy, C. L.;
(19) Yao, Y.; Chen, P.; Diao, J.; Cheng, G.; Deng, L.; Anglin, J. L.;
Prasad, B. V. V; Song, Y. Selective inhibitors of histone
methyltransferase DOT1L: Design, synthesis and crystallographic
studies. J. Am. Chem. Soc. 2011, 133, 16746−16749.
(20) Yuan, Y.; Wang, Q.; Paulk, J.; Kubicek, S.; Kemp, M. M.; Adams,
D. J.; Shamji, A. F.; Wagner, B. K.; Schreiber, S. L. A small-molecule
probe of the histone methyltransferase G9a induces cellular senescence
in pancreatic adenocarcinoma. ACS Chem. Biol. 2012, 7, 1152−1157.
8941
dx.doi.org/10.1021/jm401480r | J. Med. Chem. 2013, 56, 8931−8942

Journal of Medicinal Chemistry
Article
Gascoyne, R. D.; Wong, K. K.; Cerchietti, L.; Levine, R. L.; Abdel-
Wahab, O.; Licht, J. D.; Elemento, O.; Melnick, A. M. EZH2 Is
required for germinal center formation and somatic EZH2 mutations
promote lymphoid transformation. Cancer cell 2013, 23, 677−692.
(32) Siarheyeva, A.; Senisterra, G.; Allali-Hassani, A.; Dong, A.;
Dobrovetsky, E.; Wasney, G. A.; Chau, I.; Marcellus, R.; Hajian, T.;
Liu, F.; Korboukh, I.; Smil, D.; Bolshan, Y.; Min, J.; Wu, H.; Zeng, H.;
Loppnau, P.; Poda, G.; Griffin, C.; Aman, A.; Brown, P. J.; Jin, J.; Al-
awar, R.; Arrowsmith, C. H.; Schapira, M.; Vedadi, M. An allosteric
inhibitor of protein arginine methyltransferase 3. Structure 2012, 20,
1425−1435.
(33) Liu, F.; Li, F.; Ma, A.; Dobrovetsky, E.; Dong, A.; Gao, C.;
Korboukh, I.; Liu, J.; Smil, D.; Brown, P. J.; Frye, S. V.; Arrowsmith, C.
H.; Schapira, M.; Vedadi, M.; Jin, J. Exploiting an allosteric binding site
of PRMT3 yields potent and selective inhibitors. J. Med. Chem. 2013,
56, 2110−2124.
repressive histone methylation in cocaine-induced vulnerability to
stress. Neuron 2011, 71, 656−670.
(47) Schaefer, A.; Sampath, S. C.; Intrator, A.; Min, A.; Gertler, T. S.;
Surmeier, D. J.; Tarakhovsky, A.; Greengard, P. Control of cognition
and adaptive behavior by the GLP/G9a epigenetic suppressor
complex. Neuron 2009, 64, 678−691.
(48) Imai, K.; Togami, H.; Okamoto, T. Involvement of histone H3
Lysine 9 (H3K9) methyl transferase G9a in the maintenance of HIV-1
latency and its reactivation by BIX01294. J. Biol. Chem. 2010, 285,
16538−16545.
(49) Link, P. A.; Gangisetty, O.; James, S. R.; Woloszynska-Read, A.;
Tachibana, M.; Shinkai, Y.; Karpf, A. R. Distinct roles for histone
methyltransferases G9a and GLP in cancer germ-line antigen gene
regulation in human cancer cells and murine embryonic stem cells.
Mol Cancer Res 2009, 7, 851−862.
(50) Tachibana, M.; Matsumura, Y.; Fukuda, M.; Kimura, H.;
Shinkai, Y. G9a/GLP complexes independently mediate H3K9 and
DNA methylation to silence transcription. EMBO J. 2008, 27, 2681−
2690.
(51) Dong, K. B.; Maksakova, I. A.; Mohn, F.; Leung, D.; Appanah,
R.; Lee, S.; Yang, H. W.; Lam, L. L.; Mager, D. L.; Schubeler, D.;
Tachibana, M.; Shinkai, Y.; Lorincz, M. C. DNA methylation in ES
cells requires the lysine methyltransferase G9a but not its catalytic
activity. EMBO J. 2008, 27, 2691−2701.
(52) Shi, Y.; Desponts, C.; Do, J. T.; Hahm, H. S.; Scholer, H. R.;
Ding, S. Induction of pluripotent stem cells from mouse embryonic
fibroblasts by Oct4 and Klf4 with small-molecule compounds. Cell
Stem Cell 2008, 3, 568−574.
(53) Shi, Y.; Do, J. T.; Desponts, C.; Hahm, H. S.; Scholer, H. R.;
Ding, S. A combined chemical and genetic approach for the generation
of induced pluripotent stem cells. Cell Stem Cell 2008, 2, 525−528.
(54) Chen, X.; Skutt-Kakaria, K.; Davison, J.; Ou, Y. L.; Choi, E.;
Malik, P.; Loeb, K.; Wood, B.; Georges, G.; Torok-Storb, B.; Paddison,
P. J. G9a/GLP-dependent histone H3K9me2 patterning during human
hematopoietic stem cell lineage commitment. Genes Dev. 2012, 26,
2499−2511.
(55) Kleefstra, T.; Brunner, H. G.; Amiel, J.; Oudakker, A. R.;
Nillesen, W. M.; Magee, A.; Genevieve, D.; Cormier-Daire, V.; van
Esch, H.; Fryns, J. P.; Hamel, B. C.; Sistermans, E. A.; de Vries, B. B.;
van Bokhoven, H. Loss-of-function mutations in euchromatin histone
methyl transferase 1 (EHMT1) cause the 9q34 subtelomeric deletion
syndrome. Am. J. Hum. Genet. 2006, 79, 370−377.
(56) Kleefstra, T.; van Zelst-Stams, W. A.; Nillesen, W. M.; Cormier-
Daire, V.; Houge, G.; Foulds, N.; van Dooren, M.; Willemsen, M. H.;
Pfundt, R.; Turner, A.; Wilson, M.; McGaughran, J.; Rauch, A.;
Zenker, M.; Adam, M. P.; Innes, M.; Davies, C.; Lopez, A. G.;
Casalone, R.; Weber, A.; Brueton, L. A.; Navarro, A. D.; Bralo, M. P.;
Venselaar, H.; Stegmann, S. P.; Yntema, H. G.; van Bokhoven, H.;
Brunner, H. G. Further clinical and molecular delineation of the 9q
subtelomeric deletion syndrome supports a major contribution of
EHMT1 haploinsufficiency to the core phenotype. J. Med. Genet. 2009,
46, 598−606.
(57) Chang, Y.; Zhang, X.; Horton, J. R.; Upadhyay, A. K.;
Spannhoff, A.; Liu, J.; Snyder, J. P.; Bedford, M. T.; Cheng, X.
Structural basis for G9a-like protein lysine methyltransferase inhibition
by BIX-01294. Nat. Struct. Mol. Biol. 2009, 16, 312−317.
(58) Hauser, A. T.; Jung, M. Chemical probes: Sharpen your
epigenetic tools. Nat. Chem. Biol. 2011, 7, 499−500.
(59) Nazare, M.; Will, D. W.; Matter, H.; Schreuder, H.; Ritter, K.;
Urmann, M.; Essrich, M.; Bauer, A.; Wagner, M.; Czech, J.; Lorenz,
M.; Laux, V.; Wehner, V. Probing the subpockets of factor Xa reveals
two binding modes for inhibitors based on a 2-carboxyindole scaffold:
A study combining structure−activity relationship and X-ray
crystallography. J. Med. Chem. 2005, 48, 4511−4525.
(34) Frye, S. V. The art of the chemical probe. Nat. Chem. Biol. 2010,
6, 159−161.
(35) Workman, P.; Collins, I. Probing the probes: Fitness factors for
small molecule tools. Chem. Biol. 2010, 17, 561−577.
(36) Bunnage, M. E.; Chekler, E. L.; Jones, L. H. Target validation
using chemical probes. Nat. Chem. Biol. 2013, 9, 195−199.
(37) Tachibana, M.; Sugimoto, K.; Nozaki, M.; Ueda, J.; Ohta, T.;
Ohki, M.; Fukuda, M.; Takeda, N.; Niida, H.; Kato, H.; Shinkai, Y. G9a
histone methyltransferase plays a dominant role in euchromatic
histone H3 lysine 9 methylation and is essential for early embryo-
genesis. Genes Dev. 2002, 16, 1779−1791.
(38) Tachibana, M.; Ueda, J.; Fukuda, M.; Takeda, N.; Ohta, T.;
Iwanari, H.; Sakihama, T.; Kodama, T.; Hamakubo, T.; Shinkai, Y.
Histone methyltransferases G9a and GLP form heteromeric complexes
and are both crucial for methylation of euchromatin at H3-K9. Genes
Dev. 2005, 19, 815−826.
(39) Moore, K. E.; Carlson, S. M.; Camp, N. D.; Cheung, P.; James,
R. G.; Chua, K. F.; Wolf-Yadlin, A.; Gozani, O. A general molecular
affinity strategy for global detection and proteomic analysis of lysine
methylation. Mol. Cell 2013, 50, 444−456.
(40) Islam, K.; Bothwell, I.; Chen, Y.; Sengelaub, C.; Wang, R.; Deng,
H.; Luo, M. Bioorthogonal profiling of protein methylation using azido
derivative of S-adenosyl-L-methionine. J. Am. Chem. Soc. 2012, 134,
5909−5915.
(41) Kondo, Y.; Shen, L.; Ahmed, S.; Boumber, Y.; Sekido, Y.;
Haddad, B. R.; Issa, J. P. Downregulation of histone H3 lysine 9
methyltransferase G9a induces centrosome disruption and chromo-
some instability in cancer cells. PLoS One 2008, 3, e2037.
(42) Kondo, Y.; Shen, L.; Suzuki, S.; Kurokawa, T.; Masuko, K.;
Tanaka, Y.; Kato, H.; Mizuno, Y.; Yokoe, M.; Sugauchi, F.; Hirashima,
N.; Orito, E.; Osada, H.; Ueda, R.; Guo, Y.; Chen, X.; Issa, J. P.;
Sekido, Y. Alterations of DNA methylation and histone modifications
contribute to gene silencing in hepatocellular carcinomas. Hepatol. Res.
2007, 37, 974−983.
(43) Watanabe, H.; Soejima, K.; Yasuda, H.; Kawada, I.; Nakachi, I.;
Yoda, S.; Naoki, K.; Ishizaka, A. Deregulation of histone lysine
methyltransferases contributes to oncogenic transformation of human
bronchoepithelial cells. Cancer Cell Int. 2008, 8, 15.
(44) Goyama, S.; Nitta, E.; Yoshino, T.; Kako, S.; Watanabe-Okochi,
N.; Shimabe, M.; Imai, Y.; Takahashi, K.; Kurokawa, M. EVI-1
interacts with histone methyltransferases SUV39H1 and G9a for
transcriptional repression and bone marrow immortalization. Leukemia
2010, 24, 81−88.
(45) Maze, I.; Covington, H. E., 3rd; Dietz, D. M.; LaPlant, Q.;
Renthal, W.; Russo, S. J.; Mechanic, M.; Mouzon, E.; Neve, R. L.;
Haggarty, S. J.; Ren, Y.; Sampath, S. C.; Hurd, Y. L.; Greengard, P.;
Tarakhovsky, A.; Schaefer, A.; Nestler, E. J. Essential role of the
histone methyltransferase G9a in cocaine-induced plasticity. Science
2010, 327, 213−216.
(46) Covington, H. E., 3rd; Maze, I.; Sun, H.; Bomze, H. M.;
DeMaio, K. D.; Wu, E. Y.; Dietz, D. M.; Lobo, M. K.; Ghose, S.;
Mouzon, E.; Neve, R. L.; Tamminga, C. A.; Nestler, E. J. A role for
(60) Wigle, T. J.; Provencher, L. M.; Norris, J. L.; Jin, J.; Brown, P. J.;
Frye, S. V.; Janzen, W. P. Accessing protein methyltransferase and
demethylase enzymology using microfluidic capillary electrophoresis.
Chem. Biol. 2010, 17, 695−704.
8942
dx.doi.org/10.1021/jm401480r | J. Med. Chem. 2013, 56, 8931−8942