Biosynthesis of thiamin thiazole in eukaryotes: Conversion of NAD to an advanced intermediate

Article abstract of DOI:10.1021/ja067606t

Thiazole synthase catalyzes the formation of the thiazole moiety of thiamin pyrophosphate. The enzyme from Saccharomyces cerevisiae (THI4) copurifies with a set of strongly bound adenylated metabolites. One of them has been characterized as the ADP adduct of 5-(2-hydroxyethyl)-4-methylthiazole-2- carboxylic acid. Attempts toward yielding active wild-type THI4 by releasing protein-bound metabolites have failed so far. Here, we describe the identification and characterization of two partially active mutants (C204A and H200N) of THI4. Both mutants catalyzed the release of the nicotinamide moiety from NAD to produce ADP-ribose, which was further converted to ADP-ribulose. In the presence of glycine, both the mutants catalyzed the formation of an advanced intermediate. The intermediate was trapped with orthophenylenediamine, yielding a stable quinoxaline derivative, which was characterized by NMR spectroscopy and ESI-MS. These observations confirm NAD as the substrate for THI4 and elucidate the early steps of this unique biosynthesis of the thiazole moiety of thiamin in eukaryotes.

Full text of DOI:10.1021/ja067606t

Published on Web 02/20/2007
Biosynthesis of Thiamin Thiazole in Eukaryotes: Conversion
of NAD to an Advanced Intermediate
Abhishek Chatterjee, Christopher T. Jurgenson, Frank C. Schroeder,
Steven E. Ealick,* and Tadhg P. Begley*
Contribution from the Department of Chemistry and Chemical Biology, Cornell UniVersity,
Ithaca, New York 14853
Received October 24, 2006; E-mail: tpb2@cornell.edu; see3@cornell.edu
Abstract: Thiazole synthase catalyzes the formation of the thiazole moiety of thiamin pyrophosphate. The
enzyme from Saccharomyces cerevisiae (THI4) copurifies with a set of strongly bound adenylated
metabolites. One of them has been characterized as the ADP adduct of 5-(2-hydroxyethyl)-4-methylthiazole-
2-carboxylic acid. Attempts toward yielding active wild-type THI4 by releasing protein-bound metabolites
have failed so far. Here, we describe the identification and characterization of two partially active mutants
(C204A and H200N) of THI4. Both mutants catalyzed the release of the nicotinamide moiety from NAD to
produce ADP-ribose, which was further converted to ADP-ribulose. In the presence of glycine, both the
mutants catalyzed the formation of an advanced intermediate. The intermediate was trapped with ortho-
phenylenediamine, yielding a stable quinoxaline derivative, which was characterized by NMR spectroscopy
and ESI-MS. These observations confirm NAD as the substrate for THI4 and elucidate the early steps of
this unique biosynthesis of the thiazole moiety of thiamin in eukaryotes.
thiazole formation (THI4).9 We recently reported the charac-
Introduction
terization of an adenylated thiazole (ADT, 15, Figure 1) tightly
Thiamin pyrophosphate is an essential cofactor in all living
systems, where it plays an important role in amino acid and
carbohydrate metabolism.1,2 Bacteria, fungi, and plants can
biosynthesize this cofactor, whereas most other eukaryotes
cannot. They need to obtain it as an essential vitamin from their
diet (vitamin B1). Thiamin was the first vitamin discovered and
consists of a thiazole linked to a pyrimidine. The biosynthesis
of thiamin involves the separate biosyntheses of the thiazole
and pyrimidine moieties, which are then coupled.3-5 The
biosynthesis of the thiazole moiety in prokaryotes is well-
characterized and involves a complex oxidative condensation
of 1-deoxy-D-xylulose-5-phosphate, glycine (or tyrosine), and
cysteine, which is catalyzed by five different enzymes.3 In
eukaryotes, the biosynthesis of the thiazole occurs by a different
route, the details of which are only beginning to emerge.6-8
bound to the active site of THI4 (Figure 2, peak D).7,8 This
identification suggested NAD 1 as the probable precursor to
ADT 15 and provided key insights into the mechanism of
thiazole biosynthesis in eukaryotes (Figure 1). Two other major
adenylated metabolites were also found to be tightly bound to
the active site (peaks A and B, Figure 2). These could not be
characterized due to their instability. Peak C was always a minor
component, and its abundance varied between different protein
preparations. All attempts to reconstitute active THI4 by
releasing the bound metabolites failed, making it impossible to
experimentally confirm the novel proposal that NAD was the
thiamin-thiazole precursor in S. cereVisiae.
In an attempt to generate a product-free enzyme able to
catalyze the early steps of thiazole formation, several THI4
mutants were constructed based on the recently solved crystal
structure.8 Here, we report the identification and characterization
of two partially active mutants (C204A and H200N), which
show informative activities. In the presence of glycine 5, these
mutants catalyzed the conversion of NAD 1 to one of the
previously observed unstable THI4-bound metabolites (peak A,
Figure 2) via the intermediacy of ADP-ribose 3 and ADP-
Extensive mutagenesis in Saccharomyces cereVisiae has
resulted in the identification of only one gene required for
(1) Butterworth, R. F. Thiamin deficiency and brain disorders. Nutr. Res. ReV.
2003, 16 (2), 277-283.
(2) Jordan, F. Current mechanistic understanding of thiamin diphosphate-
dependent enzymatic reactions. Nat. Prod. Rep. 2003, 20 (2), 184-201.
(3) Settembre, E.; Begley, T. P.; Ealick, S. E. Structural biology of enzymes
of the thiamin biosynthesis pathway. Curr. Opin. Struct. Biol. 2003, 13
(6), 739-747.
(7) Chatterjee, A.; Jurgenson, C. T.; Schroeder, F. C.; Ealick, S. E.; Begley,
T. P. Thiamin biosynthesis in eukaryotes: characterization of the enzyme-
bound product of thiazole synthase from Saccharomyces cereVisiae and
its implications in thiazole biosynthesis. J. Am. Chem. Soc. 2006, 128 (22),
7158-7159.
(8) Jurgenson, C. T.; Chatterjee, A.; Begley, T. P.; Ealick, S. E. Structural
insights into the function of the thiamin biosynthetic enzyme Thi4 from
Saccharomyces cereVisiae. Biochemistry 2006, 45 (37), 11061-11070.
(9) Praekelt, U. M.; Byrne, K. L.; Meacock, P. A. Regulation of THI4 (MOL1)
a thiamine-biosynthetic gene of Saccharomyces cereVisiae. Yeast 1994,
10 (4), 481-90.
(4) Begley, T. P.; Downs, D. M.; Ealick, S. E.; McLafferty, F. W.; Van Loon,
A. P. G. M.; Taylor, S.; Campobasso, N.; Chiu, H.-J.; Kinsland, C.; Reddick,
J. J.; Xi, J. Thiamin biosynthesis in prokaryotes. Arch. Microbiol. 1999,
171 (5), 293-300.
(5) Spenser, I. D.; White, R. L. Biosynthesis of vitamin B1 (thiamin): an
instance of biochemical diversity. Angew. Chem., Int. Ed. Engl. 1997, 36
(10), 1032-1046.
(6) Godoi, P. H. C.; Galhardo, R. S.; Luche, D. D.; Van Sluys, M.-A.; Menck,
C. F. M.; Oliva, G. Structure of the thiazole biosynthetic enzyme THI1
from Arabidopsis thaliana. J. Biol. Chem. 2006, 281 (41), 30957-30966.
9
2914
J. AM. CHEM. SOC. 2007, 129, 2914-2922
10.1021/ja067606t CCC: $37.00 © 2007 American Chemical Society

Biosynthesis of Thiamin Thiazole in Eukaryotes
A R T I C L E S
Figure 1. Mechanistic proposal for the THI4 catalyzed formation of ADT, 15 (peak D, Figure 2).
Figure 2. Metabolites associated with THI4 that are released upon
denaturing the protein. Peak D is ADT (15). Peaks A and B were unstable
and degraded during the isolation process.
Figure 3. Conversion of NAD (1, peak G) to ADPr (3, peak E),
nicotinamide (2, peak H), and an unknown species (peak F) catalyzed by
the partially active mutant C204A. Reaction 1 represents the HPLC analysis
of the reaction mixture containing the mutant C204A and NAD. Control 1
represents an experiment where the mutant C204A, with no NAD, was
treated identically to reaction 1. It represents the protein-bound small
molecules (A, B, and D). Control 2 represents an enzyme-free reaction
mixture, where NAD was incubated in the same reaction buffer and was
treated identically to reaction 1. The condition (heat) applied to denature
the protein caused minor hydrolysis of NAD to produce ADPr and
nicotinamide. The ADPr and nicotinamide peaks were identified by
comigration with ADPr and nicotinamide standards.
ribulose 4, confirming NAD as the thiazole precursor. The
unstable metabolite, corresponding to peak A, could be ef-
ficiently trapped with ortho-phenylenediamine (oPDA, 16),
suggesting that it contains a 1,2-diketone or equivalent func-
tionality. A mechanistic proposal consistent with these observa-
tions is described (Figure 1).
Results
Mutagenesis Studies on THI4 to Identify Product-Free
Partially Active Mutants. Extensive mutagenesis on wild-type
THI4 was performed in an attempt to identify partially active
mutants. Each mutant was analyzed for tightly bound metabo-
lites by HPLC. The mutants were also incubated with NAD 1,
and the reaction mixture was analyzed by HPLC. Mutants
D238A, C205S, C204A, and H200N were shown to degrade
NAD 1 (peak G) to produce ADPr 3 (peak E) and nicotinamide
2 (peak H) as products (Figure 3 and Table 1). All the other
mutants (H237N, H237A, R301Q, R301A, P304A, E97A,
E97Q, and D207A) did not show any activity toward NAD and
did not contain bound metabolites. These observations confirm
that NAD 1 is one of the substrates for THI4 and demonstrate
that the hydrolysis of NAD 1 to form ADPr 3 and nicotinamide
2 is the first step in the THI4 catalyzed biosynthesis of
ADT 15.
9
J. AM. CHEM. SOC. VOL. 129, NO. 10, 2007 2915

A R T I C L E S
Chatterjee et al.
Table 1. Catalytic Properties of THI4 Mutants
products (no. of turnovers after
mutant
bound metabolites
overnight incubation)
D238A
wild-type (A, B,
and D)
none
ADPr 3, ADPrl 4, and nicotinamide
2 (<0.1)
C205S
C204A
H200N
other
ADPr 3, ADPrl 4, and nicotinamide
2 (<0.1)
<wild-type (A, B, ADPr 3, ADPrl 4, and nicotinamide
and D)
only peak A
2 (∼0.8)
ADPr 3, ADPrl 4, and nicotinamide
2 (∼0.8)
none
none
mutantsa
a H237N, H237A, R301Q, R301A, P304A, E97A, E97Q, and D207A.
Figure 5. C204A mediated conversion of NAD (1, peak G) to the protein-
bound metabolite A, in the presence of glycine 5. HPLC chromatograms:
reaction 1 represents a reaction mixture containing C204A and NAD (no
glycine). Reaction 2 represents a reaction mixture containing C204A, NAD,
and glycine. Control 1 represents the experiment where a sample of C204A
was incubated in the absence of both NAD and glycine (to reveal protein-
bound metabolites A, B, and D). Control 2 represents the experiment where
NAD and glycine were incubated in the same reaction buffer, in the absence
of protein, under the same conditions as for reactions 1 and 2. Peaks for
ADPr (3, peak E), ADPrl (4, peak F), nicotinamide (2, peak H), NAD
(1, peak G), and protein-bound molecules (peaks A, B, and D) are labeled.
The glycine-dependent decrease in the intensity of E and F and a
concomitant increase in the intensity of A are illustrated.
Figure 4. Conversion of ADP-ribose (3, peak E) to ADP-ribulose (4, peak
F) catalyzed by the THI4 C204A mutant and ribose-5-phosphate isomerase
(RPi). Reactions 1 and 2 represent the reactions of ADP-ribose catalyzed
by RPi and C204A, respectively. Control 1 represents a sample of the C204A
THI4 protein that was denatured and analyzed for bound metabolites. It
shows the enzyme-bound metabolites A-D. Control 2 shows the ADP-
ribose control where ADP-ribose was incubated with the same reaction
buffer and treated identically to reactions 1 and 2.
Enzyme Catalyzed Generation of ADP-Ribulose (ADPrl
4) from ADP-Ribose (ADPr 3). Incubation of the partially
active mutants (D238A, C205S, C204A, and H200N) with NAD
also resulted in the formation of a new adenylated species
(Figure 3, peak F) along with ADPr 3. The same adenylated
species could be generated directly from ADPr 3 (peak E), by
incubating ADPr with these mutants (Figure 4). A standard
ADP-ribulose sample (ADPrl, 4) was shown to comigrate with
this new adenylated metabolite (Figure 4). Attempts at the direct
isolation and characterization of the peak F compound failed,
as the compound decomposed during the isolation process.
However, it was possible to reduce the peak F compound with
NaBD4, and the resulting stable deuterated reduction product
was characterized by NMR. These observations establish the
isomerization of ADPr 3 to ADPrl 4 as the second step in the
THI4 catalyzed biosynthesis of ADT 15 from NAD 1.
Glycine-Dependent Conversion of ADPr 3 and ADPrl 4
to a New Species. Prolonged incubation of NAD 1 or ADPr 3
with the C204A or H200N mutants resulted in a small increase
in the intensity of one of the three Thi4-bound adenylated
metabolites (peak A, Figure 2). This increase varied with
different protein preparations. However, in the presence of
glycine 5, incubation of these mutants with NAD 1 or ADPr 3
always resulted in a significant increase in the intensity of peak
A and a concomitant decrease in the intensities of peak E (ADPr
3) and peak F (ADPrl 4) when compared to a similar reaction
mixture without glycine (Figure 5). This observation indicates
Figure 6. Trapping of the THI4-bound metabolite A with oPDA (16, peak
I) as a new species J. The blue trace represents the reaction mixture where
the metabolites released from THI4 (by heat denaturing) were incubated
with an excess of oPDA at room temperature. The purple trace represents
a control reaction where oPDA was not added (only THI4-bound metabo-
lites).
that glycine is important for the further conversion of ADPrl 4
to the advanced intermediate represented by peak A in
Figure 2.
Characterization of the Peak A Compound by Trapping
with ortho-Phenylenediamine (oPDA). The attempts at
direct isolation and characterization of the compound eluting
as peak A (Figure 2) failed due to its instability. However,
incubation with ortho-phenylenediamine (oPDA, 16) resulted
in its clean conversion to a stable new species, which was
purified by HPLC (peak J, Figure 6). The other protein-bound
metabolites were stable under the mild trapping conditions used.
This new species had absorption maxima at 260 and 321 nm,
suggesting the presence of an adenine moiety as well as a
putative quinoxaline moiety (Figure 7A). Treatment of this
derivative with nucleotide pyrophosphatase (pptase) followed
by HPLC analysis revealed the formation of AMP and another
species (peak K) that had an absorption maximum only at 321
nm (Figure 7B). This suggests a general structure where a
9
2916 J. AM. CHEM. SOC. VOL. 129, NO. 10, 2007

Biosynthesis of Thiamin Thiazole in Eukaryotes
A R T I C L E S
Figure 7. (A) UV-vis spectrum of the quinoxaline adduct, J, formed as a result of the trapping of the THI4-bound metabolite A by oPDA, 16 (peak I,
Figure 6). (B) Purified peak J compound can be cleaved with nucleotide pyrophosphatase (pptase) to produce AMP and another species K (19) that has only
one absorption maximum at 321 nm. The blue and purple traces represent the same reaction mixture containing the purified quinoxaline adduct J and pptase,
observed at 261 and 321 nm, respectively. The green trace represents a control reaction, where pptase was not added, observed at 261 nm. (C) Proposed
diketone (or equivalent) trapping with oPDA 16 and pyrophosphate hydrolysis of 18 with pptase.
Figure 8. Structure 20 represents the partial structure deduced from the NMR experiments and the observations suggesting the presence of a quinoxaline
moiety. The five carbon atoms attached to ADP, derived from ADP-ribose, are labeled as u, v, w, y, and z. Structure 21 represents the actual structure
deduced from additional negative mode ESI-MS experiments and other observations. Structure 21 must be generated from the 1,2-diketone containing
species 22 (or equivalent) and oPDA (16).
quinoxaline moiety is attached to an ADP unit (structure 18,
Figure 7C).
proximity of the methyl group to the CHOH-CH2-OP spin
system was confirmed by a ROESY spectrum that revealed a
strong NOE between the methyl and the methine protons (on
v) and a weaker NOE between the methyl and the methylene
protons (on u). In summary, the analyses of the NMR
spectroscopic data, coupled with the observations implying the
presence of a quinoxaline moiety, suggested the partial structure
20 (Figure 8). The combined results of the mass spectrometric
analysis (described next), the required presence of an ADP unit
and partial structure 20, unambiguously identify 21 as the
structure of the oPDA derivative (peak J) of the compound
corresponding to peak A. In negative mode ESI-MS spectra
(Figure 10), both the monoanionic (m/z ) 612) and the dianionic
(m/z ) 305.6) species were visible, and extensive fragmentation
analyses performed on both the monoanionic and the dianionic
species further corroborated structure 21. Isolation of the
nucleotide pyrophosphatase cleavage product of 21 (peak K)
by HPLC, followed by 1H NMR (Figure 11) analysis, revealed
the expected quinoxaline 23 serving as a further confirmation
for the structure 21.
Analysis of 1H, (1H,1H)-dqfCOSY, HMQC, and HMBC NMR
spectra obtained for the peak J compound confirmed the
presence of a 5′-phosphorylated adenosine (Figure 9, 1H NMR
of J). Additionally, a three proton spin system representing a
-CHOH-CH2-OP fragment (CH2 at 4.24 and 4.35 ppm, m;
CH at 5.40 ppm, dd), a methyl singlet (2.73 ppm), and a 1,2-
disubstituted benzene (7.77, m, 1H; 7.65, m, 1H; 7.62-7.58,
m, 2H) were identified. In HMBC spectra, these four aromatic
protons showed correlations to two quaternary carbons (139.4
and 139.8 ppm), one of which also showed a weak correlation
to the singlet methyl protons. Furthermore, the HMBC spectra
showed strong correlations of the methyl protons and the CHOH
methine proton to two additional quaternary aromatic carbons
(y, 153.06 ppm, and w, 152.91 ppm in structure 20, Figure 8).
As the cross-peaks representing the interaction of these two
carbons with methyl protons in the HMBC spectrum overlapped
considerably, the exact chemical shift values for these two
carbons were determined from a 13C NMR spectrum. Spatial
9
J. AM. CHEM. SOC. VOL. 129, NO. 10, 2007 2917

A R T I C L E S
Chatterjee et al.
Figure 9. 1H NMR spectrum of the purified quinoxaline adduct (peak J). The peaks have been assigned as shown in the structure.
Figure 10. Negative mode ESI-MS analysis of the quinoxaline derivative 21. The m/z for the monoanionic species is 612 and for the dianionic species is
305.6. Peaks with m/z ) 477, 426.1, 346.1, and 185 result from the fragmentation of 21 under spraying conditions.
Discussion
could either arise from a weaker affinity of a mutant toward its
reaction products or from a catalytically impaired mutant that
is unable to make the late intermediates or the product. The
early steps of the complex reaction sequence leading to ADT
15 could be characterized if such a mutant retained some
activity. The recently published crystal structure of THI4 enabled
us to select a set of conserved active site residues for mutagen-
esis (Table 2 and Figure 12).
Recombinant wild-type THI4 copurifies with a set of tightly
bound adenylated metabolites (peaks A-D, Figure 2). One of
these was shown to be an adenylated thiazole derivative (ADT
15, peak D).7 This discovery provided the first clues to the
enzymology of thiamin-thiazole formation in eukaryotes and
suggested that the precursor to ADT 15 might be an adenylated
pentose/pentulose such as ADP-ribose 3. It was reasonable to
propose NAD 1 as the precursor to ADT 15 because NAD could
be converted to ADPr 3 by a well-characterized reaction similar
to that involved in protein ADP-ribosylation,10 and the conver-
sion of ADPr 3 to ADT 15 could be accomplished using
reasonable chemistry (Figure 1). In addition, sequence analysis
of THI4 predicted a nucleotide binding motif. However, this
proposal could not be tested using recombinant THI4 overex-
pressed in Escherichia coli or in S. cereVisiae because the tightly
bound metabolites in the active site of this protein inhibited
catalysis. All attempts to prepare active enzyme by releasing
the bound metabolites, under a variety of denaturing conditions,
failed.
The D238A and C205S mutants showed very weak activities
toward NAD 1 (peak G), the proposed substrate, to produce
ADPr 3 (peak E) and nicotinamide 2 (peak H) as products
(unpublished data). This same activity was much stronger for
the C204A and H200N mutants (Figure 3). FAD and NADP
were also tested as substrates for these two active mutants, but
no reaction was detected. These observations confirm the
hypothesis that NAD 1 is one of the substrates for THI4 and
identify the hydrolysis of NAD 1 to form ADPr 3 as the first
step of thiazole biosynthesis in eukaryotes.
In addition to the formation of ADPr 3 and nicotinamide 2
from NAD 1, the partially active mutants also catalyzed the
formation of a new adenylated species (peak F, Figure 3). The
production of the same unknown species was observed when
the C204A and H200N mutants were treated with ADPr (Figure
4). To determine if this intermediate was ADP-ribulose (ADPrl,
We therefore carried out extensive mutagenesis on THI4 to
identify a partially active mutant with empty active sites. This
(10) Ueda, K.; Hayaishi, O. ADP ribosylation. Annu. ReV. Biochem. 1985, 54,
73-100.
9
2918 J. AM. CHEM. SOC. VOL. 129, NO. 10, 2007

Biosynthesis of Thiamin Thiazole in Eukaryotes
A R T I C L E S
Figure 11. 1H NMR spectrum of the HPLC-purified quinoxaline phosphate unit (23) obtained from 21 by its hydrolysis catalyzed by nucleotide pyrophosphatase
(pptase).
Table 2. Summary of All THI4 Mutants Constructed
amino acid
possible role(s)
mutants
E97
binding adenylated intermediates product via H-bonding
to the ribose part of the ADP moiety
catalysis of thiazole formation
E97A, E97Q
H200a
C204a,b
C205a
H200N
C204A
C205S
catalysis of thiazole formation
Only conserved cysteine; catalysis of thiazole formation;
possibly important in the sulfur transfer
catalysis of thiazole formation
catalysis of thiazole formation
catalysis of thiazole formation
binding advanced intermediates via H-bonding to the carboxylate
unit coming from glycine; other catalytic role
providing structural rigidity to a loop spanning the active site
D207a
H237
D238
R301
D207A
H237N, H237A
D238A
R301Q, R301A
P304
P304A
a These conserved residues are part of a flexible loop that spans the active site of a different monomer in the octameric structure (see Figure 12). b This
cysteine residue is replaced by a conserved serine in most THI4 orthologs.
4), the next intermediate on our proposed pathway (Figure 1),
a reference sample of this compound was prepared by the ribose-
5-phosphate isomerase (RPi) catalyzed isomerization of ADPr
to ADPrl.11 This reference compound comigrated with the
compound corresponding to peak F generated by treating ADPr
with either of the C204A or H200N mutants of THI4 (Figure
4). To further confirm the identity of the peak F compound as
ADPrl 4, it was reduced with NaBD4 to produce a stable
deuterated reduction product, which was isolated by HPLC and
characterized by NMR. These observations establish the isomer-
ization of ADPr to ADPrl as the second step in the THI4
catalyzed biosynthesis of ADT from NAD.
In the absence of glycine, the C204A and H200N mutants
catalyzed low levels of conversion of ADPrl 4 to the compound
corresponding to peak A after prolonged incubation. The amount
of the peak A compound formed over the background was
always low and varied between experiments using different
protein preparations. In the presence of glycine, however, the
same conversion occurred at a much higher level (Figure 5).
This reaction, for the first time, led to the reconstitution of the
biosynthesis of one of the previously observed unstable THI4-
bound adenylated metabolites (peak A, Figure 2).
Direct characterization of the compound corresponding to
peak A could not be achieved due to its instability. The
mechanistic proposal outlined in Figure 1 suggested a possible
presence of a 1,2-diketone or a 1,2-ketoimine functionality in
this intermediate compound (e.g., structures 9 and 10). Facile
decomposition of the isolated peak A compound to produce
ADP as the major product is consistent with this prediction
(unpublished results). Treatment of the reaction mixture with
ortho-phenylenediamine (oPDA, 16), which traps reactive 1,2-
diketones as stable quinoxalines,12,13 resulted in the selective
and efficient conversion of the peak A compound to a stable
adduct, which was isolated and its structure determined as the
quinoxaline 21 (discussed in the Results). While this assignment
does not unambiguously determine the structure of the com-
pound generating peak A, it is consistent with structure 9. The
observation that the conversion of ADPrl 4 to the peak A
(12) Hauck, T.; Bruehlmann, F.; Schwab, W. Formation of 4-hydroxy-2,5-
dimethyl-3[2H]-furanone by Zygosaccharomyces rouxii: identification of
an intermediate. Appl. EnViron. Microbiol. 2003, 69 (7), 3911-3918.
(13) Zhu, J.; Patel, R.; Pei, D. Catalytic mechanism of S-ribosylhomocysteinase
(LuxS): stereochemical course and kinetic isotope effect of proton transfer
reactions. Biochemistry 2004, 43 (31), 10166-10172.
(11) Franco, L.; Guida, L.; Zocchi, E.; Silvestro, L.; Benatti, U.; De Flora, A.
Adenosine diphosphate ribulose in human erythrocytes: a new metabolite
with membrane binding properties. Biochem. Biophys. Res. Commun. 1993,
190 (3), 1143-1148.
9
J. AM. CHEM. SOC. VOL. 129, NO. 10, 2007 2919

A R T I C L E S
Chatterjee et al.
Figure 12. Stereoview of the active site of THI4 with the ADT (15) carbon atoms labeled in cyan. Two separate monomers contribute to the ADT binding
site. Carbon atoms from one monomer are labeled in green and those from the other are labeled in yellow. His200 is on a disordered region and is not shown.
compound is facilitated by glycine is consistent with the
mechanism outlined in Figure 1, in which imine formation
facilitates deprotonation reactions at the C3 carbon of the ribose.
In this mechanism, imine formation between ADPrl 4 and
glycine 5 gives 6, imine deprotonation at C3 gives 7, which
eliminates water and tautomerizes to give 9, the proposed
intermediate giving rise to peak A (Figure 1). Model studies
have demonstrated that imine deprotonation is about 108 times
faster than the corresponding ketone deprotonation.14,15 This pKa
enhancement strategy is used by many enzymes including the
prokaryotic thiazole synthase.16
Much still remains to be understood about this protein and
its function in the eukaryotic cell. None of the mutant THI4
enzymes are able to catalyze multiple turnovers presumably
because the products in each case bind tightly to the enzyme.
In addition, it was not possible to advance the thiazole
biosynthesis beyond the compound corresponding to peak A
(9). This could be due to the fact that the correct sulfur donor
has not yet been identified. The following observations reported
on this enzyme also require further investigation: THI4 appears
to be involved in mitochondrial DNA damage prevention and
other stress related pathways.17-21 THI4 in Neurospora crassa
is highly expressed (1.5% of the entire proteome) in the
exponential growth phase and seems to be post-translationally
modified and forms a stable complex with a cyclophilin (cis/
trans-proline isomerase).22,23
The identification of reaction intermediates is a valuable tool
in the investigation of an enzyme mechanism. In most cases,
this involves extensive kinetic characterization and insightful
design of substrate analogues to block the reaction at intermedi-
ate stages. THI4 allows a remarkable departure from this
traditional strategy for investigating enzyme mechanisms. This
protein copurifies with a set of tightly bound metabolites that
identify its function as well as provide a series of molecular
snapshots that reveal the mechanism of the complex reaction
sequence that it catalyzes.
Experimental Procedures
All the chemicals and snake venom nucleotide pyrophosphatase were
purchased from Sigma-Aldrich Corporation unless otherwise mentioned.
For all the HPLC analysis, a Supelco LC-18-T (150 mm × 4.6 mm, 3
µm i.d.) reverse phase column was used. The ribose-5-phosphate
isomerase plasmid was a kind gift from Prof. Sherry L. Mowbray
(Swedish University of Agricultural Sciences).
Construction of the THI4 Mutants. All the THI4 mutants were
constructed by the Cornell Protein Purification Facility. Standard
methods were used for DNA manipulations.24,25 Plasmid DNA was
purified with the Qiagen Miniprep kit. E. coli strain MachI (Invitrogen)
was used as a recipient for transformations during plasmid construction
and for plasmid propagation and storage.
(14) Bender, M. L.; Williams, A. Ketimine intermediates in amine catalyzed
enolization of acetone. J. Am. Chem. Soc. 1966, 88 (11), 2502-2508.
(15) Roberts, R. D.; Ferran, H. E., Jr.; Gula, M. J.; Spencer, T. A. Superiority
of very weakly basic amines as catalysts for R-proton abstraction via
iminium ion formation. J. Am. Chem. Soc. 1980, 102 (23), 7054-7058.
(16) Dorrestein, P. C.; Zhai, H.; Taylor, S. V.; McLafferty, F. W.; Begley,
T. P. The biosynthesis of the thiazole phosphate moiety of thiamin (vitamin
B1): the early steps catalyzed by thiazole synthase. J. Am. Chem. Soc.
2004, 126 (10), 3091-3096.
(17) Machado, C. R.; Costa de Oliveira, R. L.; Boiteux, S.; Praekelt, U. M.;
Meacock, P. A.; Menck, C. F. M. Thi1, a thiamine biosynthetic gene in
Arabidopsis thaliana, complements bacterial defects in DNA repair. Plant
Mol. Biol. 1996, 31 (3), 585-593.
(21) Wang, G.; Ding, X.; Yuan, M.; Qiu, D.; Li, X.; Xu, C.; Wang, S. Dual
function of rice OsDR8 gene in disease resistance and thiamine accumula-
tion. Plant Mol. Biol. 2006, 60 (3), 437-449.
(18) Machado, C. R.; Praekelt, U. M.; De Oliveira, R. C.; Barbosa, A. C. C.;
Byrne, K. L.; Meacock, P. A.; Menck, C. F. M. Dual role for the yeast
THI4 gene in thiamine biosynthesis and DNA damage tolerance. J. Mol.
Biol. 1997, 273 (1), 114-121.
(22) Faou, P.; Tropschug, M. A novel binding protein for a member of CyP40-
type cyclophilins: Neurospora crassa CyPBP37, a growth and thiamine
regulated protein homologue to yeast Thi4p. J. Mol. Biol. 2003, 333 (4),
831-844.
(19) Choi, G. H.; Marek, E. T.; Schardl, C. L.; Richey, M. G.; Chang, S.; Smith,
D. A. sti35, a stress-responsive gene in Fusarium spp. J. Bacteriol. 1990,
172 (8), 4522-8.
(23) Faou, P.; Tropschug, M. Neurospora crassa CyPBP37: a cytosolic stress
protein that is able to replace yeast Thi4p function in the synthesis of vitamin
B1. J. Mol. Biol. 2004, 344 (4), 1147-1157.
(20) Medina-Silva, R.; Barros, M. P.; Galhardo, R. S.; Netto, L. E. S.; Colepicolo,
P.; Menck, C. F. M. Heat stress promotes mitochondrial instability and
oxidative responses in yeast deficient thiazole biosynthesis. Res. Microbiol.
2006, 157 (3), 275-281.
(24) Ausubel, F. M., Brent, R. et al., Eds. Current protocols in molecular biology;
John Wiley and Sons: New York, 1987.
(25) Sambrook, J., Fritsch, E. F. et al. Molecular cloning: a laboratory manual;
Cold Spring Harbor Laboratory Press: Plainview, NY, 1989.
9
2920 J. AM. CHEM. SOC. VOL. 129, NO. 10, 2007

Biosynthesis of Thiamin Thiazole in Eukaryotes
A R T I C L E S
Table 3. Primers Used in the Mutagenesis Process
mutant
mutagenesis primer sequence, top strand
restriction site
C205S
R301Q
R301A
H237N
H237A
D238A
C304A
E97A
CCCAAGCTCACGGTACTCAATGTTCCATGGACCCTAACG
GGATGGATTAAACCAAATGGGACCAACTTTTGGAGCTATGGC
CTGGATGGATTAAACGCCATGGGTCCAACTTTTGGAGCTATGGC
GGTGTCATTTTATCCACTACCGGCAATGATGGTCCATTTGGTGC
GGTGTCATTTTATCCACTACCGGAGCGGATGGTCCATTTGGTGC
GGTGTCATTTTATCCACTACCGGTCATGCGGGACCATTTGGTGC
GGATTAAACCGTATGGGCGCCACTTTTGGAGCTATGGC
CTTGAAGGTTTGTATTATCGCGAGTTCAGTTGCACCAGGTGG
CTTGAAGGTTTGTATTATCCAGAGCTCAGTTGCACCAGGTGG
CCAAGCTCACGGTACTCAAGCTTGCATGGACCCTAACG
GTTAGTTACCCAAGCTAACGGCACTCAATGTTGCATGG
GGTACTCAATGTTGCATGGCCCCTAACGTAATTGAATTGG
StyI
BsmFI
NcoI
BsrDI
BsrBI
BsmFI
KasI
NruI
E97Q
HgiAI
HindIII
N/A
C204A
H200N
D207A
N/A
Table 4. Screening Primers Used Only for H200N and D207A
Mutants
B 15% C, 19 min 30% A 40% B 30% C, 21 min 100% B, and 30 min
100% B. The absorbance at 220, 261, and 320 nm was monitored. The
UV-vis spectra of the resolved components were analyzed by an inline
diode-array UV detector.
mutant
screening primer sequence
H200N
D207A
TAGTTACCCAAGCTAACGGC
GGTACTCAATGTTGCATGGC
Activity Assays with the Mutants. The purified mutants (100 µM)
were incubated with 300 µM NAD or ADP-ribose (in the presence or
absence of 300 µM glycine) for 10 h at room temperature (25 °C).
Control reactions were set up with the enzyme (without the substrate)
or with the substrate(s) in the reaction buffer. Subsequently, the enzyme
in the reaction mixture was heat denatured (100 °C, 40 s), and the
precipitated enzyme was removed by centrifugation. The supernatant
was filtered through a 10 kDa MWCO filter (Microcon YM-10,
Millipore). The control reactions were treated identically. The filtrate
was analyzed by HPLC as described previously.
Site-directed mutagenesis was performed on pThi4.287 by a standard
PCR protocol using PfuTurbo DNA polymerase per the manufacturer’s
instructions (Invitrogen) and DpnI (New England Biolabs) to digest
the methylated parental DNA prior to transformation.
For the C205S, R301Q, R301A, H237N, H237A, D238A, C304A,
E97A, E97Q, and C204A mutants, primers were designed to introduce
or remove a diagnostic restriction enzyme site to facilitate screening
for a mutated clone. Only clones producing the anticipated restriction
pattern were sequenced. For the H200N and D207A mutants, a third
primer was designed to screen for the presence of the mutant by colony
PCR with an appropriate vector specific primer. Only clones that
produced a PCR product were sequenced. In every case, the mutagenesis
primer pair consisted of the primer whose sequence and its reverse
complement are in Tables 3 and 4.
Preparation of ADP-Ribulose. E. coli ribose-5-phosphate isomerase
was overexpressed in E. coli strain BL21(DE3) containing the over-
expression plasmid (containing a full length clone of the E. coli ribose-
5-phosphate isomerase gene in the pET15b vector) in LB medium as
described previously. The protein was purified on Ni-NTA resin
following the manufacturer’s (Qiagen) instructions and desalted into
50 mM Tris-HCl, pH 7.5 containing 100 mM NaCl. The 50 µM protein
was incubated with 250 µM ADP-ribose for 5 h. The reaction mixture
was heat denatured (100 °C, 40 s), and the precipitated protein was
removed by centrifugation. The supernatant was filtered through a 10
kDa MWCO filter (Microcon YM-10, Millipore), and the filtrate was
analyzed by HPLC as described previously.
Overexpression and Purification of THI4 and Its Mutants.
E. coli BL21(DE3) containing the overexpression plasmid (containing
a full length clone of THI4, or its mutant, in the pET28 vector) was
grown in LB medium containing kanamycin (40 µg/mL) with shaking
at 37 °C until the OD600 reached 0.6. Isopropyl-â-D-thiogalactopyra-
noside (IPTG) was then added (final concentration ) 2 mM), and cell
growth was continued at 15 °C for 16 h. The cells were then harvested
by centrifugation, and the resulting cell pellets were stored at -20 °C
until needed. To purify the protein, the cell pellets from 1 L of culture
were resuspended in 20 mL of lysis buffer (10 mM imidazole, 300
mM NaCl, 50 mM NaH2PO4, pH 8) and lysed by sonication (Heat
Systems Ultrasonics model W-385 sonicator, 2 s cycle, 50% duty).
The resulting cell lysate was clarified by centrifugation, and the THI4
protein was purified on Ni-NTA resin following the manufacturer’s
(Qiagen) instructions. After elution, the protein was desalted using a
PD-10 column (Amersham) pre-equilibrated with 50 mM potassium
phosphate buffer, pH 8.0. All the THI4 mutant proteins expressed well
and were well-behaved except for the E97A and E97Q mutants. These
two mutants mostly precipitated immediately after purification.
Characterization of NaBD4 Reduced Peak F Compound. The
ADP-ribose (1 mM) was incubated with the C204A THI4 mutant (100
µM) overnight at room temperature. The reaction mixture was heat
denatured (100 °C, 40 s), and the precipitated protein was removed by
centrifugation. The supernatant was filtered through a 10 kDa MWCO
filter (Microcon YM-10, Millipore). From the filtrate thus obtained,
the peak F compound (putative ADPrl) was purified by HPLC. The
pooled fractions were combined (∼20 mL), and directly reduced with
NaBD4 (2 mM, 20 min, room temperature) and neutralized with 1 M
HCl, the entire sample was subjected to HPLC purification, and the
collected fractions were lyophilized. The lyophilized product was
dissolved in 0.5 mL of 100% D2O (Sigma) and was relyophilized. The
residue thus obtained was dissolved in about 0.25 mL of 100% D2O,
and the solution was placed in a Shigemi NMR tube (standardized for
D2O). NMR data were acquired on a Varian INOVA 600 MHz
instrument equipped with a 5 mm triple-gradient inverse-detection HCN
probe. The NaBD4 reduction yielded two species observed by HPLC
with an approximately 1:1 ratio, both of which were isolated. One of
these was easily identified by NMR as the NaBD4 reduction product
of ADPrl. The NMR analysis of the other product revealed very similar
characteristics and most likely is the borate adduct of the reduction
product.
HPLC Analysis of THI4 and Its Mutants for Bound Metabolites.
The purified enzyme was denatured by heat (100 °C, 40 s) and then
rapidly cooled on dry ice. The precipitated protein was removed by
centrifugation. The supernatant was filtered through a 10 kDa MW
cut-off filter (Microcon YM-10, Millipore), and 100 µL of the filtrate
was analyzed by reversed phase HPLC. The following linear gradient
(method 1, in some experiments minor modifications to the method
were made to obtain better resolution at certain parts of the chromato-
gram) was used at 1 mL/min flow rate: solvent A is water, solvent B
is 100 mM KPi pH 6.6, and solvent C is methanol; 0 min 100% B, 5
min 10% A 90% B, 8 min 25% A 60% B 15% C, 14 min 25% A 60%
Trapping of the Peak A Compound with ortho-Phenylenediamine
(Analytical Sample). A total of 500 µL of a concentrated wild-type
THI4 sample was heat denatured to release all the bound metabolites,
9
J. AM. CHEM. SOC. VOL. 129, NO. 10, 2007 2921

A R T I C L E S
Chatterjee et al.
and the precipitated protein was removed by centrifugation. The
supernatant was filtered through a 10 kDa MWCO filter (Microcon
YM-10, Millipore). To 150 µL of the filtrate was added a freshly
prepared aqueous solution of ortho-phenylenediamine to a final
concentration of 4 mM. The mixture was incubated on ice for 15 min
and analyzed by HPLC.
trap instrument, Bruker), this aqueous solution was mixed with 100
µL of methanol containing 0.1% triethyl amine. The sample was
analyzed in the negative ion mode, and the peaks thus obtained were
isolated and fragmented.
Cleavage of the Quinoxaline Containing Adduct 21 by Nucleotide
Pyrophosphatase and the Isolation of the Quinoxaline Fragment.
To a 100 µL solution of the purified quinoxaline-ADP adduct (21) was
added 200 µg of lyophilized snake venom nucleotide pyrophosphatase
(EC 3.6.1.9, Sigma) and MgCl2 to a final concentration of 1 mM (20
mM Tris-HCl, pH 8.0). A control reaction was set up with only MgCl2
and no enzyme. Both the samples were incubated at 37 °C for 2 h and
filtered (10 kDa MW cut-off filter), and the filtrates were analyzed by
HPLC (method 1 described previously). The same reaction was repeated
on a large scale, and the quinoxaline fragment (23) peak was collected
(method 2 described previously) and lyophilized. The product thus
obtained was dissolved in 0.25 mL of 100% D2O, and the solution
was placed in a Shigemi NMR tube (standardized for D2O) and analyzed
by 1H NMR. 1H NMR (600 MHz, D2O): δ 8.12-8.06 (m, 1H,
aromatic), δ 8.01-7.96 (m, 1H, aromatic), δ 7.87-7.79 (m, 2H,
aromatic), δ 5.46 (dd, 1H, J ) 3.66, 7.57 Hz), δ 4.16-4.03 (m, 2H),
δ 2.83 (s, 3H).
Purification of the Trapped Species. All the THI4 protein obtained
from a 3 L culture (∼150 mg) was concentrated to 6 mL (Amicon
Utra-4, Millipore, 10 kDa cut-off) and divided into ten 600 µL aliquots.
Each aliquot was heat denatured (100 °C), and the precipitated protein
was removed by centrifugation. The supernatants were combined and
filtered through a 10 kDa MW cut-off filter (Amicon Ultra-4, Millipore).
ortho-Phenylenediamine (oPDA) was added to the filtrate to a final
concentration of 4 mM, and the mixture was incubated for 15 min on
ice. A different HPLC method was developed for purification of the
adduct because the buffer system had to be compatible with the ESI-
MS analysis. The following linear gradient was used at a 1 mL/min
flow rate (method 2): solvent A is ammonium acetate buffer (20 mM,
pH 7) and 1% methanol and solvent B is 10% ammonium acetate buffer
(20 mM, pH 7) and 90% methanol; 0 min 100% A, 3 min 100% A, 12
min 70% A 30% B, 14 min 70% A 30% B, 16 min 100% A, and 25
min 100% A. The peak corresponding to the adduct was collected,
frozen with dry ice, and lyophilized. The product residue was
redissolved in water and checked for purity by HPLC. It was found to
be stable when kept cold (on ice) or frozen.
NMR Spectroscopy and Negative Mode ESI-MS Analysis of the
Purified Adduct. The lyophilized product was dissolved in 0.5 mL of
100% D2O (Sigma) and was relyophilized. The residue thus obtained
was dissolved in about 0.25 mL of 100% D2O, and the solution was
placed in a Shigemi NMR tube (standardized for D2O). The 13C NMR
data was acquired on a Varian INOVA 500 MHz instrument. All other
NMR data were acquired on a Varian INOVA 600 MHz instrument
equipped with a 5 mm triple-gradient inverse-detection HCN probe.
For ESI-MS analysis, the lyophilized product was dissolved in 100
µL of water. Right before spraying into the instrument (Esquire ion
Acknowledgment. We thank Dr. Cynthia Kinsland (Cornell
Protein Overexpression and Characterization Facility) for the
preparation of the THI4 mutants and Prof. Sherry L. Mowbray
for sending us the RPi plasmid. This research was funded by
NIH Grants DK44083 (T.P.B.) and DK67081 (S.E.E.)
Supporting Information Available: NMR data for the
characterization of ADPrl 4, ESI-MS fragmentation analysis,
2-D NMR data, summary of chemical shifts, and NMR
correlations for compound 21. This material is available free
of charge via the Internet at http://pubs.acs.org.
JA067606T
9
2922 J. AM. CHEM. SOC. VOL. 129, NO. 10, 2007