Improving the catalytic activity of lipase LipK107 from Proteus sp. by site-directed mutagenesis in the lid domain based on computer simulation

Article abstract of DOI:10.1016/j.molcatb.2010.12.001

The capacity of lipase LipK107 from Proteus sp. catalyzing the kinetic resolution of racemates was investigated. The resolution of racemic 1-phenylethanol in organic medium was selected as model reaction. The conversion was dramatically dependent on the water content and the LipK107 showed high activity in a wide range of water content without appreciable loss of enzyme enantiodiscrimination. Besides, the chain length of acyl donor also had a significant effect on the conversion, and the highest enantioselectivity was achieved when methyl palmitate was used. Based on the analysis of computer model structure of LipK107, different mutations were introduced into the lid region. Each derivative of LipK107 was expressed, purified, and assessed of the activity. According to the prediction, using mutants E130L + K131I and T138V as catalyst, respectively, the conversions of 1-phenylethanol improved greatly with a slight increase of enantiodiscrimination. In addition, the effects of hydrophobicity and electrostatic of the lid on lipase activity were determined. This work indicated that the modification of the lid might considerably enhance the activity and improve the yield of catalytic reactions, which could apply to other lipases. The computer simulations would make the process of identifying amino acids for substitution efficiently.

Full text of DOI:10.1016/j.molcatb.2010.12.001

Journal of Molecular Catalysis B: Enzymatic 68 (2011) 286–291
Contents lists available at ScienceDirect
Journal of Molecular Catalysis B: Enzymatic
journal homepage: www.elsevier.com/locate/molcatb
Improving the catalytic activity of lipase LipK107 from Proteus sp. by
site-directed mutagenesis in the lid domain based on computer simulation
Bei Gaoa, Tao Xua, Jinping Lina, Lujia Zhanga, Erzheng Sua, Zhengbing Jiangb, Dongzhi Weia,∗
a State Key Laboratory of Bioreactor Engineering, New World Institute of Biotechnology, East China University of Science and Technology, Shanghai 200237, PR China
b College of Life Science, Hubei University, Wuhan 430062, PR China
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 21 July 2010
Received in revised form 1 December 2010
Accepted 1 December 2010
Available online 9 December 2010
The capacity of lipase LipK107 from Proteus sp. catalyzing the kinetic resolution of racemates was inves-
tigated. The resolution of racemic 1-phenylethanol in organic medium was selected as model reaction.
The conversion was dramatically dependent on the water content and the LipK107 showed high activity
in a wide range of water content without appreciable loss of enzyme enantiodiscrimination. Besides, the
chain length of acyl donor also had a significant effect on the conversion, and the highest enantioselec-
tivity was achieved when methyl palmitate was used. Based on the analysis of computer model structure
of LipK107, different mutations were introduced into the lid region. Each derivative of LipK107 was
expressed, purified, and assessed of the activity. According to the prediction, using mutants E130L + K131I
and T138V as catalyst, respectively, the conversions of 1-phenylethanol improved greatly with a slight
increase of enantiodiscrimination. In addition, the effects of hydrophobicity and electrostatic of the lid on
lipase activity were determined. This work indicated that the modification of the lid might considerably
enhance the activity and improve the yield of catalytic reactions, which could apply to other lipases. The
computer simulations would make the process of identifying amino acids for substitution efficiently.
© 2010 Elsevier B.V. All rights reserved.
Keywords:
LipK107
1-Phenylethanol
Lid
Site-directed mutagenesis
Computer simulation
1. Introduction
by a combination of hydrophobic and electrostatic interactions
between the lid and the lipid assemblies [10,11]. Therefore, the
Lipase is a diverse and ubiquitous family of enzymes catalyzing
both the hydrolysis and synthesis of various ester compounds [1,2].
Since lipase usually displays exquisite chemoselectivity, regiose-
lectivity and stereoselectivity in nonaqueous reactions, more and
more researches have focused their attention on developing lipase
into ideal tool for industries [3,4]. Although the organic solvents are
the main component in reaction, some water is needed and proved
to be crucial [5]. However, the exact role of water is still not very
clear so far, and one common hypothesis is that water retains the
fundamental role of enzyme in controlling its three-dimensional
structure [6,7].
It is well-known that most lipases are activated by the pres-
ence of a water–lipid interface. It associates with a conformational
change that the lid domain, consisting of at least one ␣-helix, opens
up by rotating around its hinge regions [8,9]. Fluorescence experi-
ments have suggested that the lid open conformation is stabilized
specific residues of the lid might be important for activity and
specificity of lipases [12,13]. However, to our knowledge, only a
few attempts were made to demonstrate the influence of specific
amino acids of the lid on lipase activity, and even fewer studies
were focus on modifying the lid to improve the outcome of reac-
tions [14]. One possible reason is that the characterization of the lid
and such large conformational transitions remain challenging for
experimental methods. Thus, molecular modeling techniques are of
utmost interest to access dynamic information on macromolecular
systems [15,16].
Molecular modeling is a collective term that refers to theoreti-
cal methods and computational techniques to model or mimic the
behaviors of molecules. And it has been widely used in the area
of biology. For lipases of microbes, a rather simple enzyme with-
out any coenzymes or cofactors, molecular modeling becomes the
alternatives to investigate the structure–function relationship [17].
Previously, we cloned the lipase gene lipK107 from Proteus sp.
It consisted of 864 bp, and belonged to the Group I Proteobacterial,
but showed low identities with other known lipases [18]. In this
work, we utilized the LipK107, into the resolution of racemic 1-
phenylethanol. Some key parameters were explored. Based on the
analysis of computer model structure of LipK107, we introduced
mutations into the lid domain and improved the yield. The effect
∗
Corresponding author. Tel.: +86 21 64252981; fax: +86 21 64250068.
E-mail addresses: beigao@mail.ecust.edu.cn (B. Gao),
robertxutao@mail.ecust.edu.cn (T. Xu), jplin@ecust.edu.cn (J. Lin),
ljzhang@ecust.edu.cn (L. Zhang), ezhsu@mail.ecust.edu.cn (E. Su),
zhbjiang@hubu.edu.cn (Z. Jiang), dzhwei@ecust.edu.cn (D. Wei).
1381-1177/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.molcatb.2010.12.001

B. Gao et al. / Journal of Molecular Catalysis B: Enzymatic 68 (2011) 286–291
287
Table 1
Oligonucleotides used in this experiment.
Function
Names
Sequences (5ꢀ → 3ꢀ)
Primers for the 5ꢀ and 3ꢀ ends of gene lipK107
Up
ccggaattcatgtcaacgaaatatcctat
cccaagcttctttaaagttgcttactcgcta
catttaatactattaggacaatatattctg
atatattgtcctaatagtattaaatgcatt
gcgtgttgagataataacaccaaatgc
gcggcatttggtgttattatctcaaca
gcgtactttttcgtcttcatattctggg
gcgcccagaatatgaagacgaaaaagta
gcggatactgtctggagccataatgcgt
gcgacgcattatggctccagacagtatc
gcgaggatcgcctgtactgccagaaaat
gcgattttctggcagtacaggcgatcct
Down
Mu-1a
Mu-1s
Mu-2a
Mu-2s
Mu-3a
Mu-3s
Mu-4a
Mu-4s
Mu-5a
Mu-5s
Primers for mutant E130L + K131I
Primers for mutant T138V
Primers for mutant I128E + V129D
Primers for mutant R120P + K121P
Primers for mutant H146S + R147T
of the characteristics of the lid on the LipK107 activity was also
determined.
2.4. General procedure with LipK107 and its derivatives for the
resolution reaction
Resolution reactions were carried out with 0.5 mmol racemic 1-
phenylethanol and 1.5 mmol methyl palmitate. LipK107 (1% based
on 1-phenylethanol weight) was used as catalyst. Various amounts
of water (0–400% by weight of the 1-phenylethanol) were added to
examine the water effect. Isooctane was added to make up a 5-ml
system.
To test the influence of acyl donor on the resolution, start-
ing mixtures were 0.5 mmol racemic 1-phenylethanol and 250%
water (based on 1-phenylethanol weight). Methyl acetate, methyl
butyrate, methyl caprylate, methyl dodecanoate, methyl palmitate
and methy arachidate were added as acyl donor, respectively.
Mutants E130L + K131I, T138V, I128E + 129D, R120P + K121P,
H146S + R147T were used as catalysts, respectively, for the
resolution reaction. Starting mixtures were 0.5 mmol racemic 1-
phenylethanol, 1.5 mmol methyl palmitate, and 250% water (based
on 1-phenylethanol weight). Isooctane was added as described
above. All these reactions were performed at 20 ◦C with shaking
at 180 rpm.
2. Materials and methods
2.1. Materials
Plasmid pMD19-T (Takara, Dalian, China) and pET-28a
(Novagen, Madison, WI) were used as TA cloning vector and expres-
sion vector respectively. Escherichia coli strains DH5␣ and BL21
(DE3) were used as the recipient strains for recombinant plas-
mids. DNA polymerase and restriction enzymes were purchased
from Takara. All molecular techniques were performed essentially
as described by Sambrook et al. [19].
Racemic 1-phenylethanol, methyl acetate, methyl butyrate,
methyl caprylate, methyl dodecanoate, methyl palmitate and
methyl arachidate (Sigma, USA) were used for resolution as sub-
strate and acyl donors, respectively. All other chemicals and
reagents were obtained commercially and were of analytical grade.
Enantiomeric excesses (ee), conversions (c), and enantiomeric
ratios (E) were calculated using the corresponding peak areas:
2.2. Site-directed mutagenesis and construction of the
recombinant plasmids
- ee = 100×(A − B)/(A + B), where (A and B) were the peak areas of
enantiomers, and (A) > (B);
- c = ees/(ees + eep), where s and p represented substrate and prod-
uct;
Lipase gene lipK107 (GenBank accession no. EU600201) was
cloned from
a strain of Proteus sp. as reported previously
[18]. Five lipK107 derivatives: E130L + K131I, T138V, I128E + 129D,
R120P + K121P, H146S + R147T were constructed using the PCR
overlap extension technique [20] with two internal primers car-
rying the specific mutations, and another two external primers
corresponding to the 5ꢀ and 3ꢀ ends of lipK107, respectively
(Table 1). Purified PCR products were sequenced. Primers Up and
Down (Table 1), with EcoRI and HindIII restriction sites respectively,
were used to amplify the complete ORF of lipK107 gene and its
derivatives. The purified PCR products were digested and cloned
into plasmid pET-28a, then expressed in E. coli BL21.
- E = ln[1 − c(1 + eep)]/ln[1 − c(1 − eep)] = ln[(1 − c)(1 − ees)]/ln
[(1 − c)(1 + ees)].
The conversion and the enantiomeric excess of products (eep)
were examined by HPLC according to the method of Tamalampudi
et al. [21]. All values are an average of three independent experi-
ments.
2.5. Hydrophobic and electrostatic mapping of the lid
The hydrophobic and electrostatic mapping of the lids of
LipK107 and its derivatives were modeled using the SYBYL molec-
ular modeling package version 7.3 (Tripos Inc.) on a SGI Octane
workstation. The hydrophobicity of lids was depicted according
to the Ghose method [22]. The partial charges of all atoms were
assigned according to the Gasteiger–Marsili rules.
2.3. Preparation of enzymes
Isopropylthiogalactoside (IPTG) (0.8 mM) was used to induce
the expression of LipK107 and its derivatives at 30 ◦C. Cells
were harvested and disrupted ultrasonically. After centrifugation
(10,000 × g, 4 ◦C for 10 min), the supernatants were loaded on
Ni-NTA sepharose columns. The proteins were eluted with imida-
zole and desalted with desalting columns (Amersham Pharmacia
Biotech, Sweden). The purified proteins were lyophilized in a
lyophilizer (Christ, Germany), and these dry powders were used
as catalysts.
3. Results
3.1. Effect of water and acyl donor
In the resolution of racemic 1-phenylethanol with methyl
palmitate, the effect of water was investigated first. As presented

288
B. Gao et al. / Journal of Molecular Catalysis B: Enzymatic 68 (2011) 286–291
Table 2
The effect of water content on the resolution of racemic 1-phenylethanol.
Water contenta
eep (%)
E
0
0
0
10
92.2
25.2
30
92.8
27.4
50
93.0
28.4
70
93.9
37.3
100
95.4
59.4
150
95.9
70.1
200
95.8
70.4
250
95.8
70.7
300
95.4
63.9
350
95.3
61.8
400
95.2
58.6
a
The water content was expressed as the percentage of the weight of 1-phenylethanol.
in Fig. 1, LipK107 displayed low activity in the presence of less than
50% water (based on 1-phenylethanol weight). However, when
more than 50% water was added, the conversion of 1-phenylethanol
increased sharply, and reached a plateau of nearly 30% after 24 h.
This result indicated that water played a crucial role in the organic
reaction catalyzed by LipK107. When water was added more than
300%, the conversion decreased, mainly due to the fact that high
water content induced the diffusive limitations of substrate and
promoted the hydrolysis of product. It was worth mentioning that
with the increasing of water, a considerable increase of activity was
towards the R-isomer (preferred isomer) without appreciable loss
of enzyme enantiodiscrimination (Table 2).
Different acyl donors were screened to improve the yield. As
shown in Fig. 2, the conversion of 1-phenylethanol was dramati-
cally dependent on the chain length of acyl donor, and the highest
conversion of 29.9% was achieved when methyl palmitate was
used. The decrease of conversion with methyl arachidate might
be ascribed to the large steric hindrance, which could block the
enzyme active site. It could be further observed that the enan-
tiomeric excess of product (eep) also crept up with the increasing
of chain length of acyl donors (Table 3).
Fig. 2. Effect of different acyl donors on the resolution of racemic 1-phenylethanol.
Reaction conditions: 20 ◦C, 180 rpm, 1% (based on 1-phenylethanol weight) dry pow-
der of purified LipK107 used as catalyst, 250% (based on 1-phenylethanol weight)
water added, methyl acetate, methyl butyrate, methyl caprylate, methyl dode-
canoate, methyl palmitate and methy arachidate used as acyl donors respectively.
Reaction time: 24 h. The values shown are the means of three independent experi-
ments and the error bars represent the standard deviations.
3.2. Mutation design in the lid domain
It was reported that the hydrophobic and electrostatic inter-
actions between the lid and the lipid assemblies contributed to
the stabilization of the lipase open conformation [23]. In this
work, state-of-the-art of molecular modeling was used to give a
visual description of the lid of LipK107. Then several mutations
were designed to change the hydrophobicity and electrostatic of
the lid domain. Fig. 3 shows the whole structure of the LipK107.
Fig. 4 displays the hydrophobicity mapping of the lid helixes of
all three mutants as well as the native LipK107. Compared with
the LipK107 (Fig. 4a), there was an additional hydrophobic region
(yellow circled region) in mutant E130L + R131I (Fig. 4b). A little
increase of hydrophobicity was also observed in mutant T138V
(Fig. 4c). However, in mutant I128E + V129D (Fig. 4d), an originally
existing hydrophobic region was changed to hydrophilic region
(yellow circle). Fig. 5 demonstrates the electrostatic mapping of
the lid regions of LipK107 and its derivatives. As we can see in
Fig. 5a, positive residues (R120 and K121 in upstream coil, H146
and R147 in downstream coil) existed in the corresponding flank-
Fig. 1. Effect of water content on the resolution of racemic 1-phenylethanol. Reac-
tion conditions: 20 ◦C, 180 rpm, methyl palmitate used as acyl donor, 1% dry powder
of purified LipK107 (based on 1-phenylethanol weight) used as catalyst. Water con-
tents from 0 to 400% by weight of the 1-phenylethanol were added. Reaction time:
24 h. Data presented are an average of three independent experiments with the
standard deviation, indicated by the error bar.
Fig. 3. The whole structure of the lipase LipK107. It consisted of 9 ␣-helix and 6
␤-sheet. The catalytic residues were Ser79, Asp232, and His254
.

B. Gao et al. / Journal of Molecular Catalysis B: Enzymatic 68 (2011) 286–291
289
Table 3
The effect of different acyl donors on the resolution of racemic 1-phenylethanol.
Chain lengtha
2
4
8
12
16
20
eep (%)
E
90.1
19.3
90.5
20.4
92.4
30.5
94.1
42.4
95.8
71.0
94.3
46.3
a
The chain length represented the alkyl part of the acyl donor.
Fig. 4. Hydrophobicity mapping of the lid regions of LipK107 and its mutants. A black and white ramp was displayed for measuring the hydrophobicity. As the hydrophobicity
increase, the color of the surface changed from light grey to dark grey. The circle gives prominence to the site of the mutation. (a) Lid of LipK107; (b) lid of mutant E130L + R131I;
(c) lid of mutant T138V; (d) lid of mutant I128E + V129D.
Fig. 5. Electrostatic mapping of the lid regions of LipK107 and its mutants. A black and white ramp was displayed for measuring the electrostatic. As region become more
positively charged, the color of the surface changed from light grey to dark grey. The circle gives prominence to the site of the mutation. (a) Lid of LipK107; (b) lid of mutant
R120P + K121P; (c) lid of mutant H146S + R147T.

290
B. Gao et al. / Journal of Molecular Catalysis B: Enzymatic 68 (2011) 286–291
Fig. 7. Effect of electrostatic of the lid domain on the resolution of racemic 1-
phenylethanol. Reaction conditions: 20 ◦C, 180 rpm, methyl palmitate used as acyl
donor, 250% (based on 1-phenylethanol weight) water added. (ꢀ) native LipK107 as
catalyst; (ꢁ) mutant R120P + K121P as catalyst; (᭹) mutant H146S + R147T as cat-
alyst. Reaction time: 24 h. The values shown are the means of three independent
experiments and the error bars represent the standard deviations.
Fig. 6. Effect of hydrophobicity of the lid domain on the resolution of racemic 1-
phenylethanol. Reaction conditions: 20 ◦C, 180 rpm, methyl palmitate used as acyl
donor, 250% (based on 1-phenylethanol weight) water added. (ꢀ) native LipK107
as catalyst; (ꢁ) mutant E130L + K131I as catalyst; (ꢂ) mutant T138V as catalyst;
(᭹) mutant I128E + V129D as catalyst. Reaction time: 24 h. Data presented are an
average of three independent experiments with the standard deviation, indicated
by the error bar.
The effect of electrostatic property of the lid on the lipase
activity is presented in Fig. 7. It can be seen that the conver-
sions of 1-phenylethanol catalyzed by mutants R120P + K121P and
H146S + R147T were much lower than that catalyzed by LipK107.
In addition, the eep and E (enantiomeric ratio) of the resolution
edged down (Table 4), which in agreement with the view that lid
affected the enantioselectivity of lipase. These observed changes
indicated that the electrostatic property of lid was another factor
that played a key role in the function of lipases, and decreasing the
electrostatic property of lid could result in a great loss of lipase
activity.
ing regions of the lid of LipK107, while these positively charged
region disappeared in mutants R120P + K121P and H146S + R147T
(Fig. 5b and c).
3.3. Construction, expression and purification of the mutants
Mutants were constructed by the method of site-directed
mutagenesis as described in Section 2.2. The presence of the
correct mutation and the absence of PCR-generated random muta-
tions were verified by DNA sequencing. The hydrophobicity of
the lid domain was increased in mutants E130L + K131I and
T138V, and decreased in mutant I128E + V129D. The electrostatic
of the lid domain was decreased in mutants R120P + K121P and
H146S + R147T. The gene of LipK107 and its derivatives were
expressed in E. coli BL21 (DE3), and the recombinant lipases protein
were purified by a Ni-NTA sepharose column.
4. Discussion
Lipase is one of the most versatile enzymes in bioconversion
processes. During the last decade, there has been an increasing
interest in the development of lipases for asymmetric synthesis
and kinetic resolution to obtain pure enantiomers for pharmaceu-
ticals and agrochemicals [25]. Here we widened the application of
LipK107 into the resolution of 1-phenylethanol, the chiral deriva-
tives of which were important building blocks for drug substrates
and agricultural products.
3.4. Resolution of 1-phenylethanol catalyzed by LipK107 and its
derivatives
The purified proteins LipK107 and its derivatives were
lyophilized and these dry powders were used as catalysts for the
resolution of racemic 1-phenylethanol with methyl palmitate. As
Fig. 6 illustrates, the conversions of 1-phenylethanol catalyzed by
mutants E130L + K131I and T138V were much higher than that
catalyzed by LipK107. This result suggested that increasing the
hydrophobicity of the lid could greatly increase the lipase activity.
A further demonstration of the role of the hydrophobicity of the lid
was obtained when mutant I128E + V129D was used as catalyst. As
expected, the conversion of 1-phenylethanol was lower due to a
reduced ratio of hydrophobic residues of the lid. Noteworthy, the
eep and E (enantiomeric ratio) of the resolution changed slightly,
indicating that the lid played a role in dictating the selectivity in
nonaqueous media (Table 4) [24].
Water effect was investigated first and the activity of LipK107
was dramatically dependent on the amount of water added in the
reaction. The shape of the curves obtained in Fig. 1 was quite simi-
lar to that presenting the kinetic behavior of lipase [26,27], which
reminded us of the fact that the oil–water interface was required for
most lipases to unmask and restructure of the active site through
conformational changes. In this work, LipK107 was purified and
freeze-dried without a covalently bound inhibitor or detergent
occluding the active site, in what was assumed to be closed con-
formation when used as catalyst in organic reaction. Therefore, the
water added might increase the flexibility of lid and form a well-
defined interface to help the lid open. The open lid rendered the
active site accessible for substrate binding and significantly increas-
ing the activity of LipK107.
Table 4
The effect of different catalysts on the resolution of racemic 1-phenylethanol.
Mutanta
eep (%)
E
1
2
96.3
92.1
3
92.6
31.5
4
92.3
27.6
5
93.0
30.0
6
95.8
70.5
97.1
167.5
a
1, 2, 3, 4, 5, 6 represented the mutants E130L + K131I, T138V, I128E + 129D, R120P + K121P, H146S + R147T, and the LipK107 respectively.

B. Gao et al. / Journal of Molecular Catalysis B: Enzymatic 68 (2011) 286–291
291
On the other hand, excessive water in non-aqueous system may
stimulate the competing hydrolysis reaction. Thus the optimum
water content is a compromise between minimizing hydrolysis and
maximizing synthesis. For most lipases, the resolution activities are
inhibited at high water content, so many industrial substrates could
not be used, or they need to be pre-prepared. Even the extensively
used Novozym435 (lipase B from Candida antarctica) could catalyze
the resolution of secondary alcohols when no water was added [28].
However, LipK107 showed high activity with wide range of water
(50–300% by weight of the substrate), which would make it a poten-
tial effective enzyme to eliminate substrate availability limitations
and distinctly simplify operational procedures.
According to our knowledge, most lipases showed a pref-
erence of short chain acyl donor in the resolution of racemic
1-phenylethanol [29,30]. But this was not true for LipK107, which
displayed high activity when methyl palmitate was used. It might
be related to the extremely large and hydrophobic lid of LipK107.
The hydrocarbon chains of methyl palmitate might exhibit the opti-
mal size to be accommodated along the hydrophobic face of the
amphipathic lid helices, thus inducing and stabilizing the open
conformation of LipK107 [31].
National Special Fund for State Key Laboratory of Bioreactor Engi-
neering: 2060204; Nation Natural Science Foundation of China:
50808069.
References
[1] M.T. Reetz, Curr. Opin. Chem. Biol. 6 (2002) 145–150.
[2] K.E. Jaeger, T. Eggert, Curr. Opin. Biotechnol. 13 (2002) 390–397.
[3] U.T. Bornscheuer, R.J. Kazlauskas, Hydrolases in Organic Synthesis- Regio- and
Stereoselective Biotransformations, Wiley-VCH, Weinheim, 1999.
[4] M.Y. Lee, J.S. Dordick, Curr. Opin. Biotechnol. 13 (2002) 376–384.
[5] L. Ma, M. Persson, P. Adlercreutz, Enzyme Microb. Technol. 31 (2002)
1024–1029.
[6] A. Zaks, A.M. Klibanov, J. Biol. Inorg. Chem. 263 (1988) 8017–8021.
[7] N.M. Micaelo, V.H. Teixeira, A.M. Baptista, C.M. Soares, Biophys. J. 89 (2005)
999–1008.
[8] A.M. Brzozowski, U. Derewenda, Z.S. Derewenda, G.G. Dodson, D.M. Lawson,
J.P. Turkenburg, F. Bjorkling, B. Huge-Jensen, S.A. Patkar, L. Thim, Nature 351
(1991) 491–494.
[9] R. Verger, Trends Biotechnol. 15 (1997) 32–38.
[10] Y. Cajal, A. Svendsen, J. De Bolos, S.A. Patkar, M.A. Alsina, Biochemie 82 (2000)
1053–1061.
[11] A. Thomas, M. Allouche, F. Basyn, R. Brasseur, B. Kerfelec, J. Biol. Chem. 280
(2005) 40074–40083.
[12] Y.B. Ali, H. Chahinian, S. Petry, G. Muller, F. Carriere, R. Verger, A. Abousalham,
Biochemistry 43 (2002) 9298–9306.
Some reports have indicated that the specific residues of the
lid might be of importance for the activity of lipases. But only a
few attempts were made to demonstrate the influence of amino
acids of the lid on the specific catalytic reactions [32]. On the other
hand, the importance of molecular modeling in mutant design has
been uncovered [33,34]. Therefore, we analyzed the 3D structure of
LipK107 and introduced some mutations based on the hydropho-
bicity and electrostatic mapping of the lid. Section 3.4 showed that
these mutants did work according to our prediction and the conver-
sion of 1-phenylethanol increased dramatically. Additionally, the
effect of hydrophobic and electrostatic interactions between the
lid and substrate on the activity of lipase was determined. These
findings provided evidence for the idea that the characteristics of
lid were crucial for the activity of lipase. For most other lipases, the
modification of the lid region may also greatly enhance the activity
and improve the yield of reactions. Furthermore, the computer sim-
ulation made the process of identifying amino acids for substitution
more efficiently. Therefore, the current work in our lab might shed
some light on the site-directed mutagenesis to enhance the lipase
activity and develop highly performing biocatalysts for industrial
needs.
[13] V. Belle, A. Fournel, M. Woudstra, S. Ranaldi, F. Prieri, V. Thome, J.
Currault, R. Verger, B. Guigliarelli, F. Carriere, Biochemistry 46 (2007)
2205–2214.
[14] C.A. Godoy, B. de las Rivas, M. Filice, G. Fernandez-Lorente, J.M. Guisan, J.M.
Palomo, Process Biochem. 45 (2010) 534–541.
[15] K. Henzler-Wildman, M. Lei, V. Thai, S.J. Kerns, M. Karplus, D. Kern, Nature 450
(2007) 913–916.
[16] K. Henzler-Wildman, D. Kern, Nature 450 (2007) 964–972.
[17] R.J. Kazlauskas, Curr. Opin. Chem. Biol. 4 (2000) 81–88.
[18] B. Gao, E. Su, J. Lin, Z. Jiang, Y. Ma, D. Wei, J. Biotechnol. 139 (2009)
169–175.
[19] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual,
2nd edn., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989.
[20] R. Higuchi, Using PCR to Engineer DNA in PCR Technology: Principles and Appli-
cations for DNA Amplification, Stockton, New York, 1992, 61–70.
[21] S. Tamalampudi, S. Hamac, T. Tanino, M.R. Talukder, A. Kondo, H. Fukuda, J. Mol.
Catal. B: Enzym. 48 (2007) 33–37.
[22] A.K. Ghose, V. Viswanadhan, J.J. Wendoloski, J. Phys. Chem. A 102 (1998)
3762–3772.
[23] D.M. Lawson, A.M. Brzozowski, S. Rety, C. Verma, G.G. Dodson, Protein Eng. 7
(1994) 543–550.
[24] M. Skjot, L. Maria, R. De Chatterjee, A. Svendsen, S.A. Patkar, P.R. Tergaard, J.
Brask, Chem. Biochem. 10 (2009) 520–527.
[25] M. Persson, D. Costes, E. Wehtje, P. Adlercreutz, Enzyme Microb. Technol. 30
(2002) 916–923.
[26] H. Chahiniana, L. Ninib, E. Boitardc, J. Dubèsc, L. Comeau, L. Sarda, Lipids 37
(2002) 653–662.
[27] A.B. Bacha, Y. Gargouri, Y.B. Ali, N. Miled, J. Reinbolt, H. Mejdoub, Enzyme
Microb. Technol. 37 (2005) 309–317.
[28] R.N. Patel, A. Banerjee, V. Nanduri, A. Goswami, F.T. Comezoglu, JAOCS 77 (2000)
1015–1019.
[29] M. Habulin, Z. Knez, J. Mol. Catal. B: Enzym. 58 (2009) 24–28.
[30] M. Singh, R.S. Singh, U.C. Banerjee, Process Biochem. 45 (2010)
25–29.
In conclusion, we successfully improved the activity of lipase
LipK107 by combining the computer simulation with the site-
directed mutagenesis. The biocatalyst with high activity can
distinctly simplify operational procedures and improve the pro-
duction of chiral derivatives, which make it a potential viable
biocatalyst in industry.
[31] M.C. Bano, H. Gonzalez-Navarro, C. Abad, Biochim. Biophys. Acta 1632 (2003)
55–61.
[32] S. Ranaldi, V. Belle, M. Woudstra, J. Rodriguez, B. Guigliarelli, J. Sturgis, F. Car-
riere, A. Fournel, Biochemistry 48 (2009) 630–638.
Acknowledgements
[33] R.R. Klein, G. King, R.A. Moreau, M.J. Haas, Lipids 32 (1997) 123–130.
[34] P. Trodler, J. Pleiss, BMC Struct. Biol. 8 (2008) 9.
This work was supported by the following grants: National
Basic Research Program of China (973 Program): 2009CB724703;