Genetic and biochemical analyses of chromosome and plasmid gene homologues encoding ICL and ArCP domains in Vibrio anguillarum strain 775

Article abstract of DOI:10.1007/s10534-011-9416-7

Anguibactin, the siderophore produced by Vibrio anguillarum 775 is synthesized from 2,3-dihydroxybenzoic acid (DHBA), cysteine and hydroxyhistamine via a nonribosomal peptide synthetase (NRPS) mechanism. Most of the genes encoding anguibactin biosynthetic proteins are harbored by the pJM1 plasmid. In this work we report the identification of a homologue of the plasmid-encoded angB on the chromosome of strain 775. The product of both genes harbor an isochorismate lyase (ICL) domain that converts isochorismic acid to 2,3-dihydro-2,3-dihydroxybenzoic acid, one of the steps of DHBA synthesis. We show in this work that both ICL domains are functional in the production of DHBA in V. anguillarum as well as in E. coli. Substitution by alanine of the aspartic acid residue in the active site of both ICL domains completely abolishes their isochorismate lyase activity in vivo. The two proteins also carry an aryl carrier protein (ArCP) domain. In contrast with the ICL domains only the plasmid encoded ArCP can participate in anguibactin production as determined by complementation analyses and site-directed mutagenesis in the active site of the plasmid encoded protein, S248A. The site-directed mutants, D37A in the ICL domain and S248A in the ArCP domain of the plasmid encoded AngB were also tested in vitro and clearly show the importance of each residue for the domain function and that each domain operates independently.

Full text of DOI:10.1007/s10534-011-9416-7

Biometals (2011) 24:629–643
DOI 10.1007/s10534-011-9416-7
Genetic and biochemical analyses of chromosome
and plasmid gene homologues encoding ICL and ArCP
domains in Vibrio anguillarum strain 775
•
Manuela Di Lorenzo Michiel Stork
•
Jorge H. Crosa
Received: 16 December 2010 / Accepted: 10 January 2011 / Published online: 1 February 2011
Ó Springer Science+Business Media, LLC. 2011
Abstract Anguibactin, the siderophore produced
by Vibrio anguillarum 775 is synthesized from
2,3-dihydroxybenzoic acid (DHBA), cysteine and
hydroxyhistamine via a nonribosomal peptide syn-
thetase (NRPS) mechanism. Most of the genes
encoding anguibactin biosynthetic proteins are har-
bored by the pJM1 plasmid. In this work we report
the identification of a homologue of the plasmid-
encoded angB on the chromosome of strain 775. The
product of both genes harbor an isochorismate lyase
(ICL) domain that converts isochorismic acid to 2,3-
dihydro-2,3-dihydroxybenzoic acid, one of the steps
of DHBA synthesis. We show in this work that both
ICL domains are functional in the production of
DHBA in V. anguillarum as well as in E. coli.
Substitution by alanine of the aspartic acid residue in
the active site of both ICL domains completely
abolishes their isochorismate lyase activity in vivo.
The two proteins also carry an aryl carrier protein
(ArCP) domain. In contrast with the ICL domains
only the plasmid encoded ArCP can participate in
anguibactin production as determined by comple-
mentation analyses and site-directed mutagenesis in
the active site of the plasmid encoded protein,
S248A. The site-directed mutants, D37A in the ICL
domain and S248A in the ArCP domain of the
plasmid encoded AngB were also tested in vitro and
clearly show the importance of each residue for the
domain function and that each domain operates
independently.
Keywords Iron ꢀ Siderophore ꢀ Nonribosomal
peptide synthetase ꢀ 2,3-dihydroxybenzoic acid ꢀ
Isochorismate lyase domain ꢀ Aryl carrier protein
domain
Introduction
M. Di Lorenzo (&)
Department of Microbial Ecology, Netherlands Institute
of Ecology, Wageninegen, The Netherlands
e-mail: M.diLorenzo@nioo.knaw.nl
Vibrio anguillarum is a marine bacterium responsible
for both marine and freshwater fish epizootics
throughout the world (Actis et al. 1999). Many
serotype O1 strains of V. anguillarum possess the
65 kb virulence plasmid pJM1 or pJM1-like plasmids
encoding an iron-scavenging system, which is essen-
tial for virulence in this bacterium (Conchas et al.
1991; Crosa 1980; Di Lorenzo et al. 2003; Tolmasky
et al. 1988a, b). This system includes a low-
M. Stork
Department of Molecular Microbiology, Utrecht
University, Utrecht, The Netherlands
J. H. Crosa
Department of Molecular Microbiology and Immunology,
Oregon Health and Science University, Portland,
OR 97239-3098, USA
123

630
Biometals (2011) 24:629–643
molecular-weight iron-binding compound, anguibac-
tin, which once secreted, competes for bound iron
within the host fish (Actis et al. 1988; Wolf and Crosa
1986). The iron-anguibactin complex is then inter-
nalized by a transport system that includes the FatA,
-B, -C, and -D proteins and requires the TonB2
complex for energy-transduction to the outer mem-
brane (Actis et al. 1988; Stork et al. 2004). Anguibactin
possesses both a catechol and a hydroxamate group and
it has been characterized as x-N-hydroxy-x-N
((20-(200,300-dihydroxyphenyl)thiazolin-40-yl)carboxy)
histamine by crystal X-ray diffraction studies and
chemical analysis (Jalal et al. 1989). Retrobiosynthesis
and experimental data showed that anguibactin is
synthesized from 2,3-dihydroxybenzoic acid (DHBA),
cysteine, and hydroxyhistamine (Di Lorenzo et al.
2004a).
homology to the plasmid-encoded angB gene was
identified in the chromosomal DNA of V. anguillarum
775 within a gene cluster encoding vanchrobactin
biosynthesis and transport genes (Alice et al. 2005;
Balado et al. 2006; Naka et al. 2008). We report in
this work the complete sequence of this chromosomal
gene, vabB, from strain 775 and the analyses of its
domains as compared to the plasmid-encoded ver-
sion. Our results also explain the phenotypic differ-
ences in DHBA production between the 531A and
775 strains of V. anguillarum.
Materials and methods
Bacterial strains and plasmids
The genes encoding proteins involved in the
biosynthesis and transport of anguibactin lie on a
25 kb contiguous region of the virulence plasmid
(Tolmasky et al. 1988a). An additional gene cluster
was identified in a non-contiguous region of pJM1
and the products encoded by the genes in this cluster
are homologues of enzymes involved in the biosyn-
thesis and activation of DHBA (Di Lorenzo et al.
2003). We have also reported the presence of this
cluster in the pJM1-like plasmid pJHC-1 of strain
531A including the gene encoding the bi-functional
AngB protein: its amino end conferring an isochoris-
mate lyase activity required for the production of
DHBA and its carboxyl end providing an aryl carrier
protein domain, functioning in anguibactin assembly
(Welch et al. 2000). Furthermore, the carboxy-
terminal end of AngB can be synthesized from the
30 region of angB, as an independent polypeptide
which, like the carboxy terminal portion of AngB,
also functions as an aryl carrier protein involved in
anguibactin assembly (Welch et al. 2000). This
pJHC1 plasmid-mediated angB gene is essential not
only for anguibactin biosynthesis but also for the
production of DHBA in the 531A strain since when
this strain was cured of the pJM1-like plasmid
pJHC1, resulting in strain S531A-1, it could no
longer produce DHBA (Welch et al. 2000). Previous
work in our laboratory had shown that the prototypic
strain 775 when cured of the pJM1 plasmid, gener-
ating plasmidless strain H775-3, still produced
DHBA (Chen et al. 1994). Recently a partial
sequence of an open reading frame (orf) with
Bacterial strains and plasmids used in this study are
described in Table 1. V. anguillarum was cultured at
25°C in either trypticase soy broth or agar supple-
mented with 1% NaCl (TSBS and TSAS, respec-
tively). For experiments to determine iron uptake
characteristics, the strains were first grown on TSAS
supplemented with the appropriate antibiotics and
then in M9 minimal medium (Sambrook and Russell
2001) supplemented with 0.2% Casamino acid, 5%
NaCl, the appropriate antibiotics and either ethylene-
diamine-di-(o-hydroxyphenyl acetic acid) (EDDA)
for iron-limiting condition or ferric ammonium
citrate (FAC) for iron-rich conditions. Antibiotic
concentrations used for V. anguillarum were ampicil-
lin (Ap) 500–800 lg/ml, rifampicin (Rif) 100 lg/ml,
spectinomycin (Sp) 100 lg/ml, chloramphenicol (Cm)
10–15 lg/ml and kanamycin (Km) 100–200 lg/ml.
E. coli strains were grown in Luria–Bertani (LB)
medium in the presence of the appropriate antibiotics.
Antibiotic concentrations used for E. coli were Ap
100 lg/ml, Sp 100 lg/ml, Cm 30 lg/ml, Km 50 lg/ml
and trimethoprim (Tp) 10 lg/ml.
General methods
Plasmid DNA preparations were performed using the
alkaline lysis method (Sambrook and Russell 2001).
Sequence quality plasmid DNA was generated using
WizardÒ Plus SV Minipreps (Promega). Restriction
endonuclease digestion of DNA was performed under
the conditions recommended by the supplier (Invit-
rogen, Roche, NEB). Transformations in the E. coli
123

Biometals (2011) 24:629–643
631
Table 1 Strains and plasmids used in this study
Bacterial strains
Genotype and relevant characteristics
Source or reference
Vibrio anguillarum
775(pJM1)
Wild type; Pacific ocean prototype
Wild type; Atlantic ocean prototype
Crosa et al. (1980)
531A(pJHC1)
775(pJM1::X)
Tolmasky et al. (1988b)
775 carrying pJM1 with X transcription-translation terminator This study
at the BglII site in angB
775(pJM1::K)
775 carrying pJM1 with a Klenow modification at the BglII site This study
in angB
775vabB::Cm
775 with the vabB gene replaced by the chloramphenicol
resistance cassette gene
This study
775vabB::Cm(pJM1::X) 775 with the vabB gene replaced by the chloramphenicol
resistance cassette gene, carrying pJM1 with X transcription-
translation terminator at the BglII site in angB
This study
775vabB::Cm(pJM1::K) 775 with the vabB gene replaced by the chloramphenicol
resistance cassette gene, carrying pJM1 with a Klenow
modification at the BglII site in angB
This study
CC9-16(pJHC9-16)
CC9-8(pJHC9-8)
Escherichia coli
XL1 blue
Anguibactin-deficient, iron transport-proficient
Anguibactin-deficient, iron transport-deficient
Walter et al. (1983)
Walter et al. (1983)
recA1, endA1, gyrA46, thi, hsdR17, supE44, relA, lacF0
[proAB?, lacIq, lacZDM15 Tn10(tetr)]
Stratagene
HB101
supE44 hsd20 (r-B m-B) recA13 ara-14 proA2 lacY1 galK2
rpsL20 xyl-5 mtl-1
F- ompT hsdSB (r-B m-B) gal dcmD(srl-recA)306::Tn10(tetB)
(DE3)
Boyer and Roulland-Dussoix (1969)
Novagen
BLR(DE3)
AN192
proC14 leu-6 trpE38 thi-1 fhuA23 lacY1 mtl-1 xyl-5 rpsL109
azi-6 tsx-67 entB402
Staab and Earhart (1990)
Salmonella typhimurium
enb-1
LT2 derivative, enterobactin-, Smr
LT2 derivative, enterobactin-, DHBA-, Smr
Pollack and Neilands (1970)
Pollack and Neilands (1970)
enb-7
Plasmids
pJM1
Indigenous plasmid in strain 775
Indigenous plasmid in strain 531A
pJM1 derivative carrying TAF and transport genes,
pJM1 derivative carrying only the TAF region
Helper plasmid for conjugation, Tpr, Tra?
Cloning vector, Apr, Kmr
Crosa et al. (1980)
Tolmasky et al. (1988b)
Tolmasky et al. (1988a,b)
Tolmasky et al. (1988a,b)
Figurski and Helinski (1979)
Invitrogen
pJHC1
pJHC9-16
pJHC9-8
pRK2073
pCRÒ2.1-TOPOÒ
SuperCos 1
pTW-MEV
pTW99
Cosmid vector, Apr
Suicide vector, R6K ori, sacB, Apr
Stratagene
Welch et al. (2000)
pBR322 with kanamycin resistance gene from pUC4K cloned Welch et al. (2000)
in SalI site
pBR322
pKD46
pKD3
Cloning vector, Tcr, Apr
pSC101 oriTS, ParaB g b exo, Apr
R6K ori, Cmr, Apr
T5 phage promoter expression vector, Apr
T7 phage promoter expression vector, Kmr
Bolivar (1978)
Datsenko and Wanner (2000)
Datsenko and Wanner (2000)
Qiagen
pQE60
pET29b
Cos#2
Novagen
SuperCos 1 harboring a 15 kb fragment from 775 genomic
DNA
Lab collection
123

632
Biometals (2011) 24:629–643
Table 1 continued
Bacterial strains
Genotype and relevant characteristics
Source or reference
pAngB
angB gene of plasmid pJM1 cloned by PCR in pTW99
This study
This study
pCR-vabB
1.1 kb PCR fragment from 775 genomic DNA containing the
vabB gene cloned in pCRÒ2.1-TOPOÒ
pVabB
ClaI-BamHI fragment from pCR-vabB cloned in pBR322
pAngB with mutation D37A in ICL domain
pVabB with mutation D71A in ICL domain
pAngB with mutation S248A in ArCP domain
angB cloned as a NcoI-BglII fragment in pQE60
pQEAngB with mutation D37A in ICL domain
pQEAngB with mutation S248A in ArCP domain
entC cloned in pET29b
This study
pAngB-D37A
pVabB-D71A
pAngB-S248A
pQEAngB
pQEAngB-D37A
pQEAngB-S248A
pEntC
This study
This study
This study
This study
This study
This study
This study
pVibE
vibE cloned in pET29b
Keating et al. (2000)
C. T. Walsh
pSfp
sfp cloned in pET29b
strains HB101, XL1 blue and BLR(DE3) and other
cloning strategies were performed according to stan-
dard protocols (Sambrook and Russell 2001). DNA
sequencing reactions were carried out by the OHSU-
MMI Research Core Facility (http://www.ohsu.edu/
core) using a model 377 Applied Biosystems Inc.
automated fluorescence sequencer. Sequencing prim-
ers were designed using Oligo 6.8Ò primer analysis
software and purchased from the OHSU-MMI
Research Core Facility (http://www.ohsu.edu/core)
and Invitrogen. DNA and protein sequence analysis
were carried out at the NCBIusing the BLAST network
service (Altschul et al. 1990). The web server Tcoffee
(http://igs-server.cnrs-mrs.fr/Tcoffee/tcoffee_cgi/
index.cgi) was used for multiple sequence alignment
(Notredame et al. 2000). Three-dimensional models of
the ArCP domains of AngB and VabB were built using
the web server 3D-JIGSAW (http://3djigsaw.com/).
Plasmids were transferred from E. coli to V. an-
guillarum by triparental conjugation as previously
described (Tolmasky et al. 1988a).
fragment containing the chromosomal vabB gene of
strain 775 was amplified by PCR using the VabB-ClaIF
(50-CAATCGATTTTTATGCGTAGAC-30) and the
VabB-BamHIR (50-AGTGGATCCGGTATACTCA
AA-30) primers and genomic DNA from 775 as a
template. The forward and the reverse primers were
modified to contain restriction endonuclease sites
(underlined in the sequence) suitable for cloning
downstream of the promoter of the tetracycline resis-
tance gene of pBR322. Reactions consisted of 3 min
at 95°C followed by 30 cycles of 45 s at 94°C, 1 min at
55°C, and 2 min at 72°C followed by a single cycle at
72°C for 10 min. The PCR product was cloned in the
pCRÒ2.1-TOPOÒ vector using the TOPO TA PCR
Cloning Kit (Invitrogen). The 1.1 kb ClaI-BamHI
fragment was subcloned into the ClaI-BamHI sites of
pBR322 to generate the pVabB plasmid carrying the
vabB gene. After recloning in pBR322 the entire vabB
gene was sequenced to verify that no mutation was
generated in the gene during amplification or cloning.
Site-directed mutagenesis
Construction of the complementing clone
Site-directed mutants were generated using the
QuickchangeTM site-directed mutagenesis kit (Strat-
agene). Plasmids pAngB and pVabB as template and
the primer pairs D37A-U (50-TCGGTTGTTCTAGT
TCACGCTTTACAGGCTTATTTTCTCA-30)/D37
A-L (50-TGAGAAAATAAGCCTGTAAAGCGTGA
ACTAGAACAACCGA-30) and D71A-U (50-GCG
GTACTGCTCATTCACGCTATGCAAAAGTACTT
The fragment containing the angB gene from the pJM1
plasmid was amplified by PCR and cloned into the
pBR322 derivative pTW99 as previously described for
the angB gene of plasmid pJHC1 (Welch et al. 2000).
The generated construct, pAngB, was sequenced to
confirm that the angB gene sequence was not mutated
during the PCR amplification or the cloning. A 1.1 kb
123

Biometals (2011) 24:629–643
633
TATCA-30)/D71A-L (50-TGATAAAGTACTTTTGC
ATAGCGTGAATGAGCAGTACCGC-30) were used
for the mutation in the ICL domain of the plasmid
(pAngB-D37A) and chromosomal (pVabB-D71A)
copy, respectively. For the mutant in the ArCP of
the plasmid copy primers S248A-U (50-TGATTTT
CCTTGGACTTGATGCGATACGCATAATGACA
CT-30) and S248A-L (50-AGTGTCATTATGCGTAT
CGCATCAAGTCCAAGGAAAATCA-30) were used
with plasmid pAngB as template to generate pAngB-
S248A. The procedure was performed according to
the manufacturer recommendations, with 16 cycles
consisting of: 30 s at 95°C followed by 1 min at 55°C
and 12 min at 68°C. For the amplification, Pfu
polymerase was used and after the PCR, the mixture
was treated with DpnI to cleave the parental DNA.
Then 1 ll of the mixture was transformed in the XL1
blue chemically competent cells provided with the
QuickchangeTM kit. Site-specific mutations were
confirmed by DNA sequencing with the appropriate
primers and the entire mutant genes (angB or vabB)
were sequenced to verify that no other region was
affected during mutagenesis.
After electroporation, cells were plated on LB plates
containing Cm at 37°C. At this temperature the
pKD46 plasmid is lost and only cells containing
Cos#2 where the vabB sequence is replaced with the
cat gene are able to grow. Plasmid isolation and
restriction digest was performed to assure no rear-
rangements occurred during the mutagenesis. The
NotI fragment containing the entire insert from the
cosmid was cloned in vector pTW-MEV. The vabB
knock-out was obtained using the pTW-MEV vector
containing vabB::Cm, as described for the plasmid
mutants. The same procedure was repeated in
775(pJM1::X) and 775(pJM1::K) strains to obtain
the double mutants.
Determination of DHBA and anguibactin
production
DHBA was assayed by employing the Arnow reac-
tion for cathecols (Arnow 1937). In addition, a
growth assay with Salmonella strains that require
DHBA, was used to confirm the presence of this
catechol (Pollack and Neilands 1970).
The siderophore anguibactin was detected by three
methods. Chrome azurol S (CAS) plates were used to
test production of iron-binding compounds by each
strain (Schwyn and Neilands 1987). The results
obtained on CAS plates were confirmed by a bioassay
using strains CC9-16 and CC9-8 that detect specif-
ically anguibactin synthesis, as previously described
(Tolmasky et al. 1988a; Walter et al. 1983). Further-
more, strains were tested for sensitivity to the iron-
chelating compound EDDA via growth assay in
liquid minimal medium.
Construction of V. anguillarum mutant strains
by allelic-exchange
Mutants 775(pJM1::X) and 775(pJM1::K) were gen-
erated as previously described by Welch et al. (2000),
employing the suicide vector pTW-MEV harboring
either the angB::X or the angB::K mutation.
To construct mutant 775vabB::Cm, the vabB gene
was replaced with the chloramphenicol resistance
cassette in the cosmid vector Supercos harboring a
15 kb insert containing the vabB gene (Cos#2) using
the kred system (15). The chloramphenicol acetyl
transferase (cat) gene was amplified from plasmid
pKD3 with primers vabB-P1 (50-GGCTTTAAGG-
CATCACGAACGAGAAAAGCCTCTTTTAAC AG
TGTAGGCTGGAGCTGCTTC-30) and vabB-P2 (50-
AACTGGTTGCTCTTCAGT AGAACGCGTGTCC
GTTACTTGACATATGAATATCCTCCTTAG-30)
that have 40 bases of homology to the vabB sequence
at their 50-end and 20 bases of homology with pKD3
at the 30-end. The PCR product was transferred by
electroporation in HB101 cells harboring Cos#2 and
pKD46. Cells were made electro-competent by
washing the cells grown in the presence of arabinose
(0.2%) four times with ice-cold sterile water at 0°C.
AngB protein expression and purification
The complete angB gene was cloned in the expres-
sion vector pQE60 under the control of the T5
promoter (pQEAngB). Cloning into the BglII site of
pQE60 adds a C-terminal hexahistidine tag and two
extra amino acids to the overexpressed protein
(GSHHHHHH). Site-directed mutations in the over-
expression clone were generated as described above
using primer pairs D37A-U/D37A-L (pQEAngB-
D37A) and S248A-U/S248A-L (pQEAngB-S248A),
the angB gene cloned in pQE60 as template. The
AngB proteins were purified from E. coli XL1 blue
containing the expression vector. Cultures were
123

634
Biometals (2011) 24:629–643
grown in LB broth supplemented with Ap at 37°C to
an OD600 of 0.3 and then cooled to room temperature.
Gene expression was induced with 100 mM isopro-
pyl-b-D-thiogalactopyranoside (IPTG) at 25°C for
4 h. The harvested cells were resuspended in 25 mM
Tris, pH 8.0, 300 mM NaCl and 2 mM MgCl2, lysed
by sonication and the lysate clarified by centrifuga-
tion. The supernatant was incubated with Qiagen
Ni–NTA Superflow resin for 16 h at 4°C. Proteins
were eluted with a step gradient of five column
volumes of lysis buffer containing 25–200 mM
imidazole in 25 mM increments. Fractions containing
purified AngB proteins (as determined by 12% SDS–
PAGE analysis) were pooled and dialyzed against
20 mM Tris, pH 8.0, 50 mM NaCl, 2 mM MgCl2,
1 mM DTT and 10% glycerol. Samples were con-
centrated using a Centricon YM-3 (Amicon) and
quantified from absorbance at 280 nm using the
predicted molar extinction coefficient e = 48790
(http://au.expasy.org/tools/protparam.html).
supplemented with kanamycin at 37°C to an OD600 of
0.6 prior induction with 1 mM IPTG for 5 h at 25°C.
Assay for isochorismate lyase activity
Isochorismate lyase activity of the ICL domain of the
AngB protein was determined by a coupled assay
with L-lactate dehydrogenase, LDH (Rusnak et al.
1990). In this assay the concentration of pyruvate in
the reaction mixture was calculated from the decrease
of absorbance at 340 nm due to NADH oxidation.
Pyruvate and 2,3-dihydro-2,3-dihydroxybenzoic acid
are formed from isochorismic acid in equimolar
amounts in the reaction catalyzed by isochorismate
lyases. EntC catalyzes the conversion of chorismic
acid to isochorismic acid, the substrate of the ICL
domain. Reaction mixtures contained 100 mM Tris,
pH 7.5, 6 mM MgCl2, 1.3 mM chorismic acid,
76 nM EntC, 80 nM AngB (wild type and mutant
proteins), 0.2 mM NADH and 7 units of LDH. The
reaction mixtures were incubated at 25°C for 40 min
and the OD340 measured every 5 min. After 40 min,
virtually all the NADH was oxidized in the reaction
mixtures containing an active ICL domain.
Expression and purification of EntC, Sfp
and VibE
The entC gene was amplified from E. coli HB101
genomic DNA using primers EntC-NdeI (50-TGTG-
GAGGATCATATGGATA-30) and EntC-XhoI (50-
CTCGCTCGAGATGCAA TCCA-30) and cloned in
the corresponding sites of the expression vector
pET29b. The resulting plasmid pEntC expressed the
EntC protein as a translational fusion of a C-terminal
hexahistidine tag. The construct was transferred to
strain BLR(DE3) for expression. EntC was expressed
and purified as described above for AngB with few
modifications. Cells were grown in LB broth supple-
mented with kanamycin at 37°C to an OD600 of 0.5
prior inductions with 500 mM IPTG. Harvested cells
were resuspended in 50 mM Tris, pH 8.0, 300 mM
NaCl and 20 mM b-mercaptoethanol and then dis-
rupted by sonication.
Analysis of covalent [14C] salicylation
of the ArCP domain
Reaction mixtures contained 75 mM Tris, pH 7.5,
10 mM MgCl2, 2 mM tris(carboxyethyl)phosphine
(TCEP), 200 mM Coenzyme A, 1 mM Sfp (the
phosphopantetheinyl transferase) and 10 mM AngB
(wild type and mutant proteins). After 1 h incubation
at 25°C to obtain holo-AngB, 10 mM ATP, 100 mM
[14C] salicylate and 1 mM VibE (adenylation
enzyme) were added to the mixtures and the samples
were incubated at 25°C for additional 60 min before
precipitation with 10% trichloroacetic acid (TCA)
and 60 mg of BSA. Pellets were washed twice with
10% TCA, redissolved in 88% formic acid and
submitted for liquid scintillation counting. The per-
centage of label protein was calculated from the cpm,
the specific activity of [14C] salicylate and the moles
of AngB protein present in the reaction (Marshall
et al. 2002).
The construct overexpressing the Sfp and the VibE
proteins as translational fusions to C-terminal hexa-
histidine tags were received from the laboratory of
Professor Christopher T. Walsh (Harvard Medical
School). VibE was expressed and purified as previ-
ously described (Keating et al. 2000). Sfp was
expressed and purified following the same procedure
of the AngB proteins with minor modification. Strain
BLR(DE3) harboring pSfp was cultured in LB broth
The accessory proteins Sfp and VibE used in this
assay are not the proteins specific for the AngB
protein and the anguibactin system. It was previously
shown that Sfp and VibE work to high efficiency in
123

Biometals (2011) 24:629–643
635
the phosphopantetheinylation of AngB and activation
of the substrate to be loaded on AngB (Marshall et al.
2002). Salycilate is not the actual substrate for VibE
or AngB but it was shown to work in this system and
the natural substrate DHBA is not available in
radioactive-labeled form (Marshall et al. 2002).
(Rusnak et al. 1990). The ArCP domain is the domain
required for tethering of activated DHBA and thus
required for siderophore biosynthesis (Gehring et al.
1997; Welch et al. 2000).
Sequencing of the same chromosomal locus of
V. anguillarum 531A showed that the same orf is
present in this strain but a deletion of a base at the
50-end of the gene resulted in premature termination
of translation. As shown in Fig. 1b, in 531A the
predicted product of the vabB gene is only 94 amino
acids long. Welch et al. (2000) previously showed
that in 531A the angB gene is required for DHBA and
anguibactin production, thus the frame-shift gener-
ated by the base deletion in the chromosomal vabB
gene of 531A resulted in the plasmid-encoded AngB
becoming essential for DHBA production.
Nucleotide sequences accession number
The GenBank accession numbers for the sequences
were as follows: for angB, AY312585 for strain 775
and AF311973 for strain 531A; for entC, M36700.
The sequences of the vabB genes of 775 and 531A
strains were deposited with GenBank and assigned
the accession numbers DQ066620 and DQ066621.
Results
Mutational analysis of the angB gene in strain 775
Identification of a chromosomal angB homologue
in strain 775
To test the functionality of the vabB gene in strain
775 we generated a mutant, 775(pJM1::X), consisting
of the insertion of the X transcriptional-translational
terminator (Frey and Krisch 1985) at the BglII site in
the 50-end of the angB gene (Fig. 2). This mutant was
tested for its ability to produce DHBA by the Arnow
test, specific for catechols, and the results were
confirmed by bioassay using Salmonella strains enb-1
and enb-7 that require DHBA and/or enterobactin to
grow in iron limiting conditions. Anguibactin pro-
duction was determined by CAS agar (data not
shown) and growth in iron limiting conditions. To
confirm that the iron-binding compound detected on
CAS agar is actually anguibactin, bioassays employ-
ing strains CC9-8(pJHC9-8) and CC9-16(pJHC9-16)
were performed as explained in the ‘‘Materials and
methods’’ section. As shown in Fig. 2, strain
775(pJM1::X) did not produce anguibactin but it
was still able to produce DHBA. Since it is known
that in strain 531A, the ArCP domain of AngB can be
produced as a polypeptide separate from the ICL
domain, a strategy was designed to mutate only the
ICL domain. Mutant 775(pJM1::K) is a 4 bp insertion
at the BglII site in angB, generated by cleaving the
BglII site and filling in the ends with the Klenow
fragment of DNA polymerase I prior to re-ligation.
This mutant could still produce anguibactin as
determined by CAS and bioassay without any DHBA
exogenously added to the media since it was able to
Previous work in our laboratory had shown that strain
775 of V. anguillarum when cured of the pJM1
plasmid (H775-3) still produced 2,3-dihydroxyben-
zoic acid, DHBA (Chen et al. 1994). On the contrary
the plasmid-less strain derivative of 531A (S531A-1)
could no longer produce DHBA (Welch et al. 2000).
Furthermore, it was also shown that in the 531A
strain only one of the genes of the DHBA biosyn-
thetic pathway, angB, encoded on the pJM1-like
plasmid pJHC1 was required to complement strain
S531A-1 (Welch et al. 2000). Recently a partial
sequence of an open reading frame (orf) with
homology to the plasmid-encoded angB gene was
identified in the chromosomal DNA of V. anguillarum
775 within the vancrobactin gene cluster (Alice et al.
2005; Naka et al. 2008). Completion of the nucleotide
sequence of the chromosomal gene revealed an orf of
1038 bp that encodes a predicted protein with 64%
identity and 78% similarity to the plasmid-encoded
AngB. The chromosomally encoded AngB-homo-
logue (VabB) of 775 possesses the isochorismate
lyase (ICL) and the aryl carrier protein (ArCP)
domains that are also found in the plasmid-encoded
AngB (Fig. 1a). ICL domains are involved in DHBA
biosynthesis and catalyze the conversion of isochor-
ismic acid to 2,3-dihydro 2,3-dihydroxybenzoic acid
123

636
Biometals (2011) 24:629–643
A
ArCP
ICL
OH
OH
OH
OH
O
O
COOH
O
OH
OH
OH
AngB
2 VabB
AngA
C
C
CH
OH
OH
OH
SH
S
2,3 dihydroxybenzoic
COOH
COOH
COOH
acid
2,3 dihydro -
Isochorismic
acid
2,3 dihydroxybenzoic
acid
AngE
ATP
2,3 dihydroxybenzoic
acid
ICL ArCP
ArCP
ICL ArCP
B
VabB-775
ICL
VabB-531A
ΔICL
Fig. 1 Domain organization of plasmid-encoded AngB and
chromosomally encoded VabB. A The ICL and ArCP domain
organization of the AngB protein of V. anguillarum 775 and
their putative function in DHBA and anguibactin production,
respectively, are shown. B Schematic representation of the
predicted vabB products from V. anguillarum 775 and 531A.
The 531A VabB possesses only a truncated ICL domain
OD600
0.4
DHBA
0.0
0.2
0.6
0.8
+
+
+
+
-
775
775(pJM1:: )
775(pJM1::K)
775vabB::Cm
775vabB::Cm(pJM1:: )
775vabB::Cm(pJM1::K)
-
Fig. 2 DHBA and anguibactin production of mutants of the
V. anguillarum angB and vabB genes. The angB, vabB and the
double mutants with their phenotype in DHBA and anguibactin
production are shown and compared to the wild type strain.
Presence of DHBA in the supernatant of cultures grown in
iron-limiting conditions was analyzed by using the Arnow
reaction and confirmed by bioassays with Salmonella strain
enb-1 and enb-7. Anguibactin production by the different
strains was detected by CAS agar, bioassays and growth in iron
limiting conditions. The results obtained for the growth in iron
limiting conditions are represented as the OD600 at 48 h of each
strain grown in M9 supplemented with 2 lM EDDA. Shown is
a representative growth experiment
produce DHBA endogenously (Fig. 2). Therefore, the
ICL domain of VabB in 775 must be functional
although not essential while the ArCP of AngB is
essential for anguibactin biosynthesis. Furthermore,
the results obtained with mutant 775(pJM1::K)
indicate that also in 775 the plasmid-encoded ArCP
domain can be translated and function independently
of the ICL domain.
123

Biometals (2011) 24:629–643
637
Mutational analysis of the vabB gene
and generation of double angB/vabB mutant
in strain 775
on an alignment of this domain with several other
ICL domains. In the isochorismate lyase PhzD from
Pseudomonas aeruginosa, an aspartic acid residue in
the active site is essential for 2,3-dihydro-3-hydro-
xyanthranilic acid production from 2-amino-2-deox-
yisochorismate (Parsons et al. 2003). The PhzD
protein possesses only an ICL domain and it is
involved in the biosynthesis of phenazine (Parsons
et al. 2003). The same aspartic acid and several
surrounding residues are conserved in AngB and
VabB as well as in the ICL domain of several
enzymes involved in DHBA production (Fig. 3). This
conserved aspartic acid residue was mutated to an
alanine in the construct harboring either the angB or
the vabB gene generating the constructs pAngB-
D37A and pVabB-D71A, respectively. In the ArCP
domain of AngB, the residue mutated to an alanine
was the conserved serine (S248) that has been shown
for the AngB protein of strain 531A to be essential
for the attachment of the phosphopantetheinyl arm
(Welch et al. 2000). Since we have shown that the
ArCP domain of VabB is not functional in anguib-
actin production, we did not mutate this domain,
although it is worthy to note that a conserved serine
(S283) in the chromosomally encoded VabB corre-
sponds to the serine residue 248 of AngB and to the
conserved serine residue of other ArCP domains
(Fig. 3).
To confirm that the vabB gene product is only
functional in DHBA production and that the AngB
protein possesses the only ArCP domain involved in
anguibactin biosynthesis, we generated a mutation in
the vabB gene by replacing almost the complete gene
with a chloramphenicol resistance gene as explained
in the ‘‘Materials and methods’’ section. The vabB
gene was replaced by the vabB::Cm construct in 775,
775(pJM1::X) and 775(pJM1::K) at its chromosomal
location in each strain and the resulting derivatives
analyzed for DHBA and anguibactin production.
Anguibactin was determined by CAS agar, bioassay
and growth of the strains in minimal media supple-
mented with 2 lM ethylenediamine-di-(o-hydroxy-
phenyl acetic acid), EDDA. The presence of DHBA
in the supernatant was determined as described above
for the angB mutants. Strain 775(pJM1::X) although
not able to synthesize anguibactin can still produce
DHBA (Fig. 2). Strain 775vabB::Cm and strain
775(pJM1::K) are not affected in DHBA and in
anguibactin production, while both double mutants,
775vabB::Cm(pJM1::X) and 775vabB::Cm(pJM1::K),
are unable to produce either compound (Fig. 2). As
expected, addition of DHBA to the growth media
restored siderophore production in strain 775vabB::
Cm(pJM1::K), data not shown. Clearly both ICL
domains function in the synthesis of DHBA and they
are the only two ICL domains present in strain 775
involved in the production of DHBA, an essential
precursor of anguibactin. This product can then be
incorporated in the siderophore only by the plasmid-
encoded ArCP domain.
The wild type and mutant constructs were used to
complement strain AN192 (an E. coli entB mutant) as
well as the plasmid terminator mutant 775(pJM1::X)
and the double angB/vabB mutant of V. anguillarum.
The E. coli strain AN192 can be complemented
for DHBA production by both wild type angB and
vabB genes of V. anguillarum (Fig. 4a). Strain
AN192 complemented with pAngB or pVabB were
demonstrated to produce enterobactin as determined
by growth in iron-limiting conditions and by bioas-
say with the Salmonella strains (Fig. 4a). Enterob-
actin production in strain AN192 does not require
the ArCP domain of AngB since the mutation in
entB in this strain affects only the functionality of
the ICL domain of EntB and not of its ArCP domain
(Staab and Earhart 1990). The ICL D to A mutants
in either of the pAngB or pVabB constructs were
not able to complement strain AN192, clearly
showing that the aspartic acid residue is indeed
essential for the activity of the ICL domain of both
proteins (Fig. 4a).
Characterization of the VabB and AngB functions
in vivo
The angB and vabB genes from V. anguillarum were
cloned in vector pBR322 or its derivative pTW99
downstream of the tetracycline resistance gene pro-
moter generating pAngB and pVabB, respectively.
To analyze the functionality of both domains, we
mutated conserved residues in the ICL and ArCP
domain by site-directed mutagenesis. In the ICL
domain the residue to be mutated was chosen based
123

638
Biometals (2011) 24:629–643
Fig. 3 Multiple sequence alignment of isochorismate lyase
enzymes. All the proteins in this alignment except PhzD
participate in DHBA biosynthesis as well as in siderophore
biosynthesis. PhzD possesses only the ICL domain and it is
involved in the biosynthesis of phenazine. The identical
residues are shown shaded in darker grey while similar amino
acids are shaded in lighter grey. The two conserved residues in
the ICL and ArCP domains that have been selected to be
replaced by an alanine in the AngB or VabB proteins are boxed
and indicated with an asterisk
Activities of the ICL and ArCP domain
of AngB in vitro
Complementation of both V. anguillarum mutants
with pAngB restores anguibactin production while
strains containing pVabB still cannot produce the
siderophore; nevertheless both constructs in the double
mutant restored DHBA production (Fig. 4b). As it was
the case in E. coli, the ICL mutant constructs could not
complement the double V. anguillarum mutant for
DHBA production (Fig. 4b). Furthermore, the ArCP
mutant in AngB (pAngB-S248A) could not comple-
ment strain 775(pJM1::X) for anguibactin production
although it was able to restore DHBA production in
strain 775vabB::Cm(pJM1::X) (Fig. 4b and data not
shown). These results further confirm that the ArCP
domain of AngB is the only one that can tether DHBA
to be utilized in anguibactin production while either of
the plasmid or chromosomal ICL domain can intervene
in DHBA production.
To assess the functionality in vitro of the AngB
domains, we over-expressed the wild type and the
mutant proteins as C-terminal His-tagged proteins in
E. coli as described in the ‘‘Materials and methods’’
section.
To determine ICL activity, an L-lactate dehydro-
genase-coupled assay was used in which pyruvate
concentration in the reaction mixture was calculated
from the amount of NADH oxidized, measured by the
decrease of absorbance at 340 nm (Rusnak et al.
1990). In the reaction that converts isochorismate to
2,3-dihydro-2,3-dihydroxybenzoic acid catalyzed by
ICL domains, pyruvate is produced in equimolar
amounts with 2,3-dihydro-2,3-dihydroxybenzoic acid
123

Biometals (2011) 24:629–643
639
Fig. 4 Complementation of
the entB mutant of E. coli
and the mutants of V.
A
E. coli
strains0
enb1
ent
enb7
DHBA/ent
OD600
0.6
0.2
0.4
0.8
1
1.2
anguillarum 775.
A Complementation of the
E. coli entB mutant AN92
with the wild type and
mutant constructs of angB
and vabB of V. anguillarum.
The ability to produce
AN192
-
-
AN192 pAngB
+
+
DHBA and enterobactin of
each strain is measured as
the ability to grow in iron-
limiting conditions and by
bioassay with the Salmonella
strains enb1 and enb7.
Shown is a representative
growth experiment. B The
phenotypes in DHBA and
anguibactin production of
the complemented angB
mutants are shown and
compared to the wild type
strain. DHBA production
was measured by the Arnow
test on supernatant of
cultures grown in iron-
limiting conditions. Growth
in iron-limiting conditions
(minimal media
supplemented with 2 lM
EDDA) is used to determine
the ability of each strain to
produce anguibactin. Shown
is a representative growth
experiment
AN192
pAngB-D37A
-
+
-
-
+
-
AN192 pVabB
AN192
pVabB-D71A
B
OD600
V. anguillarum
DHBA
strains
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
775
775
+
+
(pJM1:: Ω
)
775
+
+
-
(pJM1:: Ω/pAngB)
775
(pJM1:: Ω/pAngB-S248A)
775vabB::Cm
(pJM1:: Ω
)
775vabB::Cm
(pJM1:: Ω/pAngB)
+
-
775vabB::Cm
(pJM1:: Ω/pAngB-D37A)
775vabB::Cm
(pJM1:: Ω/pVabB)
+
-
775vabB ::Cm
(pJM1::Ω /pVabB-D71A)
(Fig. 5a). As shown in Fig. 5b, NADH was com-
pletely oxidized to NAD? in the reaction containing
wild type AngB or the ArCP mutant protein. On the
contrary the ICL mutant protein behaved as the no-
ICL sample in the oxidation of NADH confirming the
results obtained in vivo for this mutant protein
(Fig. 5b).
subtilis, Sfp (Quadri et al. 1998) and coenzymeA
(CoA). Figure 6 shows that the wild type AngB
protein as well as the ICL mutant can be salicylated
in vitro to similar extent while the percentage of the
ArCP S248A mutant labeled with [14C] salicylate is
similar to that of the sample in which no adenylation
domain (VibE) was added. These results are in
agreement with the results obtained for the AngB-
S248A mutant in anguibactin production in vivo.
Functionality of the ArCP domain was determined
by in vitro salicylation with 14C labeled salicylate of
the purified proteins (Marshall et al. 2002). Although
the wild type AngB protein purified from E. coli is
obtained partially in its holo form, i.e. with the
phosphopantetheine arm already tethered to the ArCP
domain (data not shown), holo-ArCP was formed in
vitro prior to the salicylation reaction by incubation
with the phosphopantetheinyl transferase of Bacillus
Discussion
The iron uptake system mediated by the plasmid
pJM1 is composed by the 348 Da siderophore
anguibactin that is synthesized from DHBA, cysteine
123

640
Biometals (2011) 24:629–643
Fig. 5 In vitro ICL
OH
A
reaction with purified wild
type and mutant AngB
proteins. A Scheme of the
in vitro ICL reaction.
COOH
COOH
OH
OH
O
O
COOH
HC
EntC
AngB
+
3
CH
CH
2
2
OH
O
Isochorismic acid, the
substrate for AngB is
COOH
COOH
COOH
2,3 dihydro -
2,3 dihydroxybenzoic
acid
Pyruvate
obtained from chorismic
acid by addition of purified
EntC protein. Production of
pyruvate from isochorismic
acid is measured as the
oxidation of NADH by
L-lactate dehydrogenase in
the reaction mix.
Chorismic
acid
Isochorismic
acid
NADH
L-Lactate
dehydrogenase
+
NAD
L-Lactate
B Production of pyruvate
expressed as nanomoles is
plotted over time for each
AngB protein. Each point is
calculated as the mean of
three independent
experiments in which the
same amount of proteins
and substrate were used.
The error bars indicate the
standard error of the mean
(SEM)
B
225
no-ICL
AngB
200
175
150
125
100
75
AngB-D37A
AngB-S248A
50
25
0
0
10
20
30
40
50
time (min)
and hydroxyhistamine, and a membrane receptor
complex specific for ferric-anguibactin. This system
is an important virulence factor for the fish pathogen
V. anguillarum (Wolf and Crosa 1986).
on the chromosome of strain 775. We identified an
orf with homology to the plasmid-encoded angB gene
in the chromosomal DNA of V. anguillarum 775
within the vanchrobactin cluster. Sequencing of this
orf revealed that it encoded a protein 78% similar and
64% identical to the plasmid-encoded AngB,
although 57 amino acids longer. The predicted amino
acid sequence of the chromosomal homologue
includes the ICL and ArCP domains as it is the case
for the AngB protein. Surprisingly, the same
sequence was found on the 531A chromosomal
DNA but deletion of a base at the 50-end resulted in
a non-functional truncated protein as the truncation
occurs in the ICL domain before the conserved
residues of the active site.
Sequencing of the pJM1 plasmid of strain 775
revealed a gene cluster (orf39 to 43) that encodes
products that share homology with proteins involved
in synthesis and activation of DHBA (Di Lorenzo
et al. 2003). A similar cluster was identified on the
pJM1-like plasmid pJHC1 of strain 531A and it was
shown that the angB gene (orf41) in this cluster is
essential for DHBA and anguibactin production in
this strain (Welch et al. 2000). One interesting
difference between these two V. anguillarum strains
was revealed by the study of their plasmidless
derivatives. H775-3, the 775 derivative, is proficient
in DHBA production while S531A-1, the 531A
derivative, is not. Therefore, we hypothesized that
an additional copy of the angB gene might be present
Furthermore, in this work we also characterized
the two homologues of 775 and assessed their
functions by a combination of knock-out and site-
directed mutations. We clearly showed that the ArCP
123

Biometals (2011) 24:629–643
641
55
50
45
40
35
30
25
20
15
10
5
The identification and characterization of the
chromosomally encoded homologue vabB add
another chapter to the complex tale of the iron-
uptake systems of V. anguillarum species. The
chromosomally encoded gene lies within a cluster
of other genes dedicated to DHBA biosynthesis and
activation and these genes have been shown to be part
of the vanchrobactin biosynthetic pathway (Alice
et al. 2005; Balado et al. 2006; Naka et al. 2008).
Naka et al. (2008) showed that the ArCP of VabB
perfectly functions in vanchrobactin assembly line.
The fact that this clearly functional ArCP domain is
not able to participate in anguibactin production
suggests a system specificity of the AngB-ArCP
domain for the anguibactin system.
0
AngB
VibE
wt
-
wt
+
D37A D37A S248A S248A
-
+
-
+
Fig. 6 In vitro salicylation reaction with purified wild type
and mutant AngB proteins. The percentage of ArCP domain
labeled with [14C]-salicylate is shown with each bar calculated
from the mean of three independent experiments in which the
same amounts of proteins and substrate where used. As
controls each AngB protein was incubated without the
adenylating enzyme VibE. The means for the wild type and
the D37A mutant AngB proteins are not significantly different
when compared by the t-test at P B 0.05 (P = 0.45). The error
bars indicate the standard error of the mean of the results from
replicate samples. wt, wild type AngB; D37A, D37A mutant of
AngB; S248A, S248A mutant of AngB
In the enterobactin system, three residues have
been identified that, when mutated, result in a
decreased rate of enterobactin production (Lai et al.
2006). Two of these residues map within helix 3 of
EntB crystal structure and helix 3 is suggested to be
the major recognition element on EntB-ArCP domain
for EntF, the downstream elongation module (Drake
et al. 2006; Lai et al. 2006). AngB-ArCP and VabB-
ArCP homology models were generated using 3D
JIGSAW web server (Bates et al. 2001). Interestingly,
the two models differ in helix 3 where AngB-ArCP
seems to lack in the model a helix 3 and to have a
longer helix 2, whereas the VabB-ArCP domain
shows a 4 helices model highly similar to the EntB
structure. As a consequence, we propose that other
recognition elements in the ArCP domain are
required for the interaction of AngB with AngM,
the downstream module (Di Lorenzo et al. 2004b).
The proposed difference in the interaction-surface of
the two ArCP domains could explain the inability of
the VabB-ArCP domain to function in anguibactin
production.
domain of the plasmid-encoded copy is essential for
anguibactin biosynthesis, while the ICL domain of
either the chromosomal or the plasmid homologue
can be used in DHBA production. The two ICL
domains can also complement an E. coli entB mutant
for DHBA production.
Site-directed mutagenesis of the ICL domain of the
two proteins of 775 confirmed that the active site of this
domain corresponds to the active site of PhzD, an
isochorismate lyase that is not part of the DHBA
biosynthetic pathway and is not associated with an
ArCP domain (Parsons et al. 2003). In vitro experi-
ments with the purified plasmid-encoded AngB protein
demonstrated that the site-directed mutant in the ICL
domain was affected in the isochorismate lyase activity
but its ArCP domain could still be loaded with
[14C]-salicylate as it is the case for the wild type protein.
The same was true for the ArCP domain mutant
(S248A), whose ability to convert isochorismate to
2,3-dihydro-dihydroxybenzoic acid was not altered
while the loading of [14C]-salicylate was completely
abolished. Thus, the in vitro results confirmed those
obtained in vivo in V. anguillarum and E. coli. Further-
more, the in vitro experiments with the site-directed
mutants (D37A and S248A) clearly showed the impor-
tance of each residue for the domain function.
Furthermore, short N-terminal and C-terminal
sequences have been shown to be involved in
protein–protein interactions in the NRPS family
(Hahn and Stachelhaus 2004). The VabB protein
presents amino acid extensions at both ends when
compared with the other homologues including
V. anguillarum AngB and these extra sequences at
the N- and C-terminus could be the specific signature
of the vanchrobactin system that prevent VabB from
interacting with the other proteins of the anguibactin
system. The system specificity of the anguibactin
pathway does not apply to DHBA biosynthesis since
123

642
Biometals (2011) 24:629–643
marine fish pathogen Vibrio anguillarum. Infect Immun
27:897–902
the ICL domain activity seems to be independent of
the other enzymes and strain background.
Datsenko KA, Wanner BL (2000) One-step inactivation of
chromosomal genes in Escherichia coli K-12 using PCR
products. Proc Natl Acad Sci USA 97:6640–6645
Di Lorenzo M, Stork M, Tolmasky ME, Actis LA, Farrell
DH, Welch TJ, Crosa LM, Wertheimer AM, Chen Q,
Salinas P, Waldbeser L, Crosa JH (2003) Complete
sequence of virulence plasmid pJM1 from the marine
fish pathogen Vibrio anguillarum strain 775. J Bacteriol
185:5822–5830
Acknowledgments This project was supported by Grants
from the National Institute of Health, AI19018 and GM64600,
to J.H.C. We are grateful to Christopher T. Walsh for his
insightful discussions and the VibE and Sfp expression
constructs.
References
´
Di Lorenzo M, Stork M, Alice AF, Lopez CS, Crosa JH
(2004a) Vibrios. In: Crosa JH, May A, Payne SM (eds)
Iron transport in bacteria: molecular biology, physiology
and ecology. ASM press, Washington
Actis LA, Tolmasky ME, Farrell DH, Crosa JH (1988) Genetic
and molecular characterization of essential components of
the Vibrio anguillarum plasmid-mediated iron-transport
system. J Biol Chem 263:2853–2860
Actis LA, Tolmasky ME, Crosa JH (1999) Vibriosis. In: Woo
P, Bruno D (eds) Fish diseases and disorders. Viral, bac-
terials, and fungal infections, vol. 3. Cab International
Publishing, Wallingford, pp 523–557
Alice AF, Lopez CS, Crosa JH (2005) Plasmid- and chromo-
some-encoded redundant and specific functions are
involved in biosynthesis of the siderophore anguibactin in
Vibrio anguillarum 775: a case of chance and necessity?
J Bacteriol 187:2209–2214
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990)
Basic local alignment search tool. J Mol Biol 215:403–410
Arnow EL (1937) Colorimetric determination of the compo-
nents of 2, 3-dihydroxy-phenylalanine tyrosine mixtures.
J Biol Chem 118:531–537
Balado M, Osorio CR, Lemos ML (2006) A gene cluster
involved in the biosynthesis of vanchrobactin, a chromo-
some-encoded siderophore produced by Vibrio anguilla-
rum. Microbiology 152:3517–3528
Bates PA, Kelley LA, MacCallum RM, Sternberg MJE (2001)
Enhancement of protein modelling by human intervention
in applying the automatic programs 3D-JIGSAW and 3D-
PSSM. Proteins 5:39–46
Bolivar F (1978) Construction and characterization of new
cloning vehicles. III. Derivatives of plasmid pBR322
carrying unique Eco RI sites for selection of Eco RI
generated recombinant DNA molecules. Gene 4:121–136
Boyer HW, Roulland-Dussoix D (1969) A complementation
analysis of the restriction and modification of DNA in
Escherichia coli. J Mol Biol 41:459–472
Chen Q, Actis LA, Tolmasky ME, Crosa JH (1994) Chromo-
some-mediated 2, 3-dihydroxybenzoic acid is a precursor
in the biosynthesis of the plasmid-mediated siderophore
anguibactin in Vibrio anguillarum. J Bacteriol 176:4226–
4234
Di Lorenzo M, Poppelaars S, Stork M, Nagasawa M, Tolmasky
ME, Crosa JH (2004b) A nonribosomal peptide synthetase
with a novel domain organization is essential for sidero-
phore biosynthesis in Vibrio anguillarum. J Bacteriol
186:7327–7336
Drake EJ, Nicolai DA, Gulick AM (2006) Structure of the
EntB multidomain nonribosomal peptide synthetase and
functional analysis of its interaction with the EntE ade-
nylation domain. Chem Biol 13:409–419
Figurski DH, Helinski DR (1979) Replication of an origin-
containing derivative of plasmid RK2 dependent on a
plasmid function provided in trans. Proc Natl Acad Sci
USA 76:1648–1652
Frey J, Krisch HM (1985) Omega mutagenesis in gram-negative
bacteria: a selectable interposon which is strongly polar in a
wide range of bacterial species. Gene 36:143–150
Gehring AM, Bradley KA, Walsh CT (1997) Enterobactin bio-
synthesis in Escherichia coli: isochorismate lyase (EntB) is
a bifunctional enzyme that is phosphopantetheinylated by
EntD and then acylated by EntE using ATP and 2, 3-di-
hydroxybenzoate. Biochemistry 36:8495–8503
Hahn M, Stachelhaus T (2004) Selective interaction between
nonribosomal peptide synthetases is facilitated by short
communication-mediating domains. Proc Natl Acad Sci
USA 101:15585–15590
Jalal M, Hossain D, van der Helm D, Sanders-Loehr J, Actis
LA, Crosa JH (1989) Structure of anguibactin, a unique
plasmid-related bacterial siderophore from the fish path-
ogen Vibrio anguillarum. J Am Chem Soc 111:292–296
Keating TA, Marshall CG, Walsh CT (2000) Reconstitution
and characterization of the Vibrio cholerae vibriobactin
synthetase from VibB, VibE, VibF, and VibH. Biochem
39:15522–15530
Lai JR, Fischbach MA, Liu DR, Walsh CT (2006) A protein
interaction surface in nonribosomal peptide synthesis
mapped by combinatorial mutagenesis and selection. Proc
Natl Acad Sci USA 103:5314–5319
Marshall CG, Burkart MD, Meray RK, Walsh CT (2002) Carrier
protein recognition in siderophore-producing nonriboso-
mal peptide synthetases. Biochem 41:8429–8437
Conchas RF, Lemos ML, Barja JL, Toranzo AE (1991) Dis-
tribution of plasmid- and chromosome-mediated iron
uptake systems in Vibrio anguillarum strains of different
origins. Appl Environ Microbiol 57:2956–2962
´
Naka H, Lopez CS, Crosa JH (2008) Reactivation of the
Crosa JH (1980) A plasmid associated with virulence in the
marine fish pathogen Vibrio anguillarum specifies an iron-
sequestering system. Nature 284:566–568
Crosa JH, Hodges LL, Schiewe MH (1980) Curing of a plas-
mid is correlated with an attenuation of virulence in the
vanchrobactin siderophore system of Vibrio anguillarum
by removal of a chromosomal insertion sequence origi-
nated in plasmid pJM1 encoding the anguibactin sidero-
phore system. Environ Microbiol 10:265–277
123

Biometals (2011) 24:629–643
643
Notredame C, Higgins DG, Heringa J (2000) T-coffee: a novel
method for multiple sequence alignments. J Mol Biol
302:205–217
Parsons JF, Calabrese K, Eisenstein E, Ladner JE (2003)
Structure and mechanism of Pseudomonas aeruginosa
PhzD, an isochorismatase from the phenazine biosynthetic
pathway. Biochemistry 42:5684–5693
Pollack JR, Neilands JB (1970) Enterobactin, an iron transport
compound from Salmonella typhimurium. Biochem
Biophys Res Commun 38:989–992
Quadri LE, Weinreb PH, Lei M, Nakano MM, Zuber P, Walsh
CT (1998) Characterization of Sfp, a Bacillus subtilis
phosphopantetheinyl transferase for peptidyl carrier pro-
tein domains in peptide synthetases. Biochemistry
37:1585–1595
Rusnak F, Liu J, Quinn N, Berchtold GA, Walsh CT (1990)
Subcloning of the enterobactin biosynthetic gene entB:
expression, purification, characterization, and substrate
specificity of isochorismatase. Biochemistry 29:1425–1435
Sambrook J, Russell DW (2001) Molecular cloning: a labora-
tory manual, 3rd edn. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor
Schwyn B, Neilands JB (1987) Universal chemical assay for
the detection and determination of siderophores. Anal
Biochem 160:47–56
Stork M, Di Lorenzo M, Mourino S, Osorio CR, Lemos ML,
Crosa JH (2004) Two tonB systems function in iron
transport in Vibrio anguillarum, but only one is essential
for virulence. Infect Immun 72:7326–7329
Tolmasky ME, Actis LA, Crosa JH (1988a) Genetic analysis of
the iron uptake region of the Vibrio anguillarum plasmid
pJM1: molecular cloning of genetic determinants encod-
ing a novel trans activator of siderophore biosynthesis.
J Bacteriol 170:1913–1919
Tolmasky ME, Salinas PC, Actis LA, Crosa JH (1988b)
Increased production of the siderophore anguibactin
mediated by pJM1-like plasmids in Vibrio anguillarum.
Infect Immun 56:1608–1614
Walter MA, Potter SA, Crosa JH (1983) Iron uptake system
mediated by Vibrio anguillarum plasmid pJM1. J Bacte-
riol 156:880–887
Welch TJ, Chai S, Crosa JH (2000) The overlapping angB and
angG genes are encoded within the trans-acting factor
region of the virulence plasmid in Vibrio anguillarum:
essential role in siderophore biosynthesis. J Bacteriol
182:6762–6773
Wolf MK, Crosa JH (1986) Evidence for the role of a sider-
ophore in promoting Vibrio anguillarum infections. J Gen
Microbiol 132:2949–2952
Staab JF, Earhart CF (1990) EntG activity of Escherichia coli
enterobactin synthetase. J Bacteriol 172:6403–6410
123