Identification of UGT84A13 as a candidate enzyme for the first committed step of gallotannin biosynthesis in pedunculate oak (Quercus robur)

Article abstract of DOI:10.1016/j.phytochem.2013.11.023

A cDNA encoding the ester-forming hydroxybenzoic acid glucosyltransferase UGT84A13 was isolated from a cDNA library of Quercus robur swelling buds and young leaves. The enzyme displayed high sequence identity to resveratrol/hydroxycinnamate and hydroxybenzoate/hydroxycinnamate glucosyltransferases from Vitis species and clustered to the phylogenetic group L of plant glucosyltransferases, mainly involved in the formation of 1-O-β-d-glucose esters. In silico transcriptome analysis confirmed expression of UGT84A13 in Quercus tissues which were previously shown to exhibit UDP-glucose:gallic acid glucosyltransferase activity. UGT84A13 was functionally expressed in Escherichia coli as N-terminal His-tagged protein. In vitro kinetic measurements with the purified recombinant enzyme revealed a clear preference for hydroxybenzoic acids as glucosyl acceptor in comparison to hydroxycinnamic acids. Of the preferred in vitro substrates, protocatechuic, vanillic and gallic acid, only the latter and its corresponding 1-O-?-D-glucose ester were found to be accumulated in young oak leaves. This indicates that in planta UGT84A13 catalyzes the formation of, 1-O-galloyl-?-D-glucose, the first committed step of gallotannin biosynthesis.

Full text of DOI:10.1016/j.phytochem.2013.11.023

Phytochemistry 99 (2014) 44–51
Contents lists available at ScienceDirect
Phytochemistry
journal homepage: www.elsevier.com/locate/phytochem
Identification of UGT84A13 as a candidate enzyme for the first
committed step of gallotannin biosynthesis in pedunculate oak
(Quercus robur)
Juliane Mittasch a, Christoph Böttcher b, Nadezhda Frolova a, Markus Bönn c,d, Carsten Milkowski a,
⇑
a Interdisciplinary Center for Crop Plant Research, Martin-Luther University Halle-Wittenberg, Hoher Weg 8, D-06120 Halle, Germany
b Department of Stress and Developmental Biology, Leibniz Institute of Plant Biochemistry, Weinberg 3, D-06120 Halle, Germany
c UFZ – Helmholtz Centre for Environmental Research, Department of Soil Ecology, Theodor-Lieser-Str. 4, 06120 Halle, Germany
d Institute of Computer Science, Martin-Luther University Halle-Wittenberg, Von-Seckendorff-Platz 1, 06120 Halle, Germany
a r t i c l e i n f o
a b s t r a c t
Article history:
A cDNA encoding the ester-forming hydroxybenzoic acid glucosyltransferase UGT84A13 was isolated
from a cDNA library of Quercus robur swelling buds and young leaves. The enzyme displayed high
sequence identity to resveratrol/hydroxycinnamate and hydroxybenzoate/hydroxycinnamate glucos-
yltransferases from Vitis species and clustered to the phylogenetic group L of plant glucosyltransferases,
Received 5 September 2013
Received in revised form 5 November 2013
Available online 9 January 2014
mainly involved in the formation of 1-O-b-D-glucose esters. In silico transcriptome analysis confirmed
Keywords:
Quercus robur
Fagaceae
Gallotannins
Glucosyltransferase
Substrate specificity
expression of UGT84A13 in Quercus tissues which were previously shown to exhibit UDP-glucose:gallic
acid glucosyltransferase activity. UGT84A13 was functionally expressed in Escherichia coli as N-terminal
His-tagged protein. In vitro kinetic measurements with the purified recombinant enzyme revealed a clear
preference for hydroxybenzoic acids as glucosyl acceptor in comparison to hydroxycinnamic acids. Of the
preferred in vitro substrates, protocatechuic, vanillic and gallic acid, only the latter and its corresponding
1-O-ß-D-glucose ester were found to be accumulated in young oak leaves. This indicates that in planta
UGT84A13 catalyzes the formation of , 1-O-galloyl-ß-D-glucose, the first committed step of gallotannin
biosynthesis.
Ó 2013 Elsevier Ltd. All rights reserved.
Introduction
The biochemistry of HT formation was elucidated by enzymatic
studies with protein extracts from HT-producing plants like
Hydrolyzable tannins (HTs), also denoted as gallotannins, are
polyphenolic compounds, which accumulate in a wide range of
dicotyledonous plants. As potent protein-denaturing agents and
antioxidants, as well as antimicrobial, antiviral and antitumor sub-
stances, HTs have been widely used (reviewed by Gross et al.,
1999). In planta, HTs form part of the chemical defense against
pathogens and herbivors (Beart et al., 1985; Scalbert, 1991; Iason,
2005).
pedunculate oak (Quercus robur), northern red oak (Quercus rubra)
or staghorn sumach (Rhus typhina) (Gross, 1999; Grundhöfer et al.,
2001). Biosynthesis of HTs starts with the formation of 1-O-galloyl-
ß-D-glucose (b-glucogallin) from UDP-glucose and gallic acid. By a
series of acyltransfer reactions, 1-O-galloyl-ß-D-glucose is then
successively converted to 1,2,3,4,6-penta-O-galloyl-ß-D-glucose
(pentaGG). Remarkably, the energy-rich b-acetal ester 1-O-gal-
loyl-ß-D-glucose serves as activated acyl donor as well as acyl
acceptor in gallotannin biosynthesis. In this regard, HT biosynthe-
sis resembles the formation of acyl glucoses in wild tomato (Li
et al., 1999) and of sinapate esters in Brassicaceae (Milkowski
et al., 2004), which also utilize 1-O-esters of ß-D-glucose. More-
over, recent studies provided evidence of 1-O-galloyl-ß-D-glucose
as acyl donor for the galloylation of proanthocyanidins in grape-
vine (Vitis vinifera) (Khater et al., 2012) and of catechin in the tea
plant (Camellia sinensis) (Liu et al., 2012).
HTs are characterized by a common ester structure composed of
gallic acid and a polyol, mostly b-D-glucose (Freudenberg, 1920).
Besides simple galloylglucoses (mono- to penta-O-galloyl-ß-D-glu-
cose), HTs include the groups of complex gallotannins character-
ized by depsidic meta-digalloyl moieties, and ellagitannins
formed by oxidative linkage of adjacent galloyl groups. By further
coupling, substitution and oligomerization reactions plants syn-
thesize a large array of diverse HTs, which accumulate in species-
and organ-specific patterns (Niemetz and Gross, 2005).
Given the pivotal role of 1-O-galloyl-ß-D-glucose in the biosyn-
thesis of HTs and other galloylated compounds, the interest in
identification of UDP-glucose-dependent glycosyltransferases
(UGTs), which catalyze the formation of 1-O-galloyl-ß-D-glucose
⇑
Corresponding author. Tel.: +49 (0)345 55 22644; fax: +49 (0)345 55 27531.
E-mail address: carsten.milkowski@izn.uni-halle.de (C. Milkowski).
0031-9422/$ - see front matter Ó 2013 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.phytochem.2013.11.023

J. Mittasch et al. / Phytochemistry 99 (2014) 44–51
45
(EC 2.4.1.136) has rapidly grown. Early enzymatic studies de-
scribed the formation of 1-O-galloyl-ß-D-glucose from UDP-glu-
cose and gallic acid by leaf extracts from Q. robur (Gross, 1982)
and detected an UGT activity in leaves of Q. rubra that converted
several hydroxybenzoic (HBA) and hydroxycinnamic acids (HCA)
into the related 1-O-esters of ß-D-glucose (Gross, 1983). Recently,
the advances in transcriptome analysis combined with the se-
quence information available on the UGT enzyme family produced
evidence for candidate genes in several crop plants. In pomegran-
ate (Punica granatum) gene expression analysis identified putative
UGT sequences whose expression corresponded to HT accumula-
tion (Ono et al., 2012). This led to speculations about a potential
role of the encoded enzymes as UDP-glucose:gallic acid glucos-
yltransferases. From grapevine, three UGTs have been described
which nonspecifically catalyzed the formation of 1-O-ß-D-glucose
esters with HBAs and HCAs (Khater et al., 2012). The authors sug-
gest that these UGTs could be involved in planta in the synthesis of
1-O-galloyl-ß-D-glucose, the predicted acyl donor for the galloyla-
tion of proanthocyanidins. From the tea plant, enzymatic studies
revealed an UDP-glucose:gallic acid glucosyltransferase activity,
which provides 1-O-galloyl-ß-D-glucose as the acyl donor for cat-
echin galloylation (Liu et al., 2012).
flanking sequences of the cloning vector, 160 clones were tested
for cDNA insertions. As a result, 71 clones were found to carry
cDNA inserts. Since UDP-glucose:gallic acid glucosyltransferase
should be highly expressed in the HT-producing tissues of swelling
buds and young leaves, a sample set of about 30% of the cloned
cDNA population was subjected to sequence analysis. Sequence
comparison to Genbank database (http://www.ncbi.nlm.nih.gov/
genbank/) revealed two candidate cDNAs (QrUGT1, QrUGT2) shar-
ing sequence identities in the range of 70–80% with functionally
proven UGTs. A Neighbor Joining analysis showed that QrUGT1
clustered within the phylogenetic group L of UGTs together with
ester-forming glucosyltransferases. In contrast, QrUGT2 clustered
outside of group L together with UGTs involved in the formation
of O-glucosides (Fig. 1). Since this initial classification strongly sug-
gested an ester-forming specificity for the QrUGT1 gene product, a
full-length coding sequence was generated for QrUGT1. Therefore,
the 50-coding sequence of QrUGT1 was amplified from the Q. robur
cDNA library by a RACE-PCR approach. In silico combination of the
overlapping 50- and 30-partial QrUGT1-cDNAs revealed a complete
open reading frame used to derive specific primers for PCR-ampli-
fication of the full length coding sequence of QrUGT1 from the Q.
robur cDNA library. The cDNA of QrUGT1 (Genbank accession
KF527849) was found to encode a protein of 510 amino acid resi-
dues with a predicted molecular mass of 56.554 kDa and a calcu-
lated isoelectric point (pI) of 4.88. According to the UGT
nomenclature by Mackenzie et al. (1997), the glucosyltransferase
QrUGT1 was denominated as UGT84A13. At the amino acid level,
UGT84A13 shared sequence identity of 86% with three related en-
zymes: a resveratrol/hydroxycinnamate glucosyltransferase from
Vitis labrusca (VIRSgt, Genbank accession ABH03018; Hall and De
Luca, 2007) and two hydroxybenzoate/hydroxycinnamate glucos-
yltransferases from V. vinifera (VvgGT2, Genbank accession
AEW31188; VvgGT3, Genbank accession AEW31189; Khater
et al., 2012). With the related enzyme VvgGT1 (Genbank accession
AEW31187) UGT84A13 showed a sequence identity of 84%.
In silico analyses confirmed the expression of UGT84A13 in plan-
ta. Using the facilities of the TrophinOak platform (http://
www.ufz.trophinoak.de), a tblastx search of the UGT84A13 cDNA
against the OakContig DF159.1 database (Tarkka et al., 2013) re-
sulted in a single close match. Contig 28422_c0_seq1 was found
to cover the full length of the UGT84A13 cDNA and showed 98%
identity. A megablast search of the UGT84A13 sequence against
the Quercus EST collection of Genbank database revealed 40 ESTs.
Electronic Northern Blot analysis showed that 40% of these
UGT84A13 ESTs originated from buds, 30% from roots and about
18% from leaves (Supplemental Fig. S1). The results clearly proved
expression of UGT84A13 in the oak tissues where previous studies
(Gross, 1983) showed UDP-glucose:gallic acid glucosyltransferase
activity to be found.
Here, we describe the identification of a gene from pedunculate
oak (Q. robur) that encodes the glucosyltransferase UGT84A13. In
vitro assays confirmed that UGT84A13 catalyzed preferentially
the formation of 1-O-ß-D-glucose esters with several HBAs includ-
ing gallic acid, the phenolic constituent of gallotannins, which rep-
resents an abundant metabolite within the leaf metabolome of Q.
robur. In silico transcript analysis revealed expression of UGT84A13
in planta.
Results and discussion
Cloning of UGT84A13 from Q. robur and heterologous expression
The enzyme UDP-glucose:gallic acid glucosyltransferase con-
verts gallic acid into the corresponding b-acetal ester 1-O-galloyl-
ß-D-glucose by transferring the glucosyl moiety from UDP-glucose
to the carboxyl group of the acid. Within the family 1 of UGTs, this
specificity of ester formation is related to phylogenetic group L,
whereas the capacity to form O-glucosides is distributed among
the other phylogenetic UGT groups (Ross et al., 2001; Li et al.,
2001). Accordingly, to isolate candidate cDNAs for UDP-glu-
cose:gallic acid glucosyltransferase a targeted approach was used
aiming at the identification of abundant group L UGTs from HT-
producing oak tissues followed by heterologous expression and
in vitro characterization of the encoded enzymes.
Swelling buds and young leaves of Q. robur, described as a rich
source for HT biosynthetic enzymes (Grundhöfer et al., 2001), were
used to generate a plasmid-based cDNA library of about 900,000
clones. From this library, 30-sequences of potential UGT reading
frames were amplified by PCR with degenerate primers derived
from the highly conserved THCGWN peptide motif. This peptide
motif is part of the plant secondary product glycosyltransferase
(PSPG) box, the UGT signature sequence, which forms the binding
site for the activated nucleotide sugar in the mature enzyme
(Hughes and Hughes, 1994). To increase the specificity of the ap-
proach, PCR-amplification was split into eight reactions. Each reac-
tion was performed with a low degenerate forward primer against
the THCGWN motif in combination with a specific reversed primer
recognizing 30-flanking vector sequences (for details see Sec-
tion ‘‘cDNA library construction and isolation of UGT sequences’’).
Amplicons generated by individual PCR-reactions were pooled and
cloned into pGEMTeasy plasmid vector followed by transformation
of Escherichia coli. By colony-PCR using M13 primers that bind to
For functional assays, UGT84A13 was expressed in E. coli as N-
terminal His-tag fusion protein and purified from the bacterial ex-
tract by metal affinity chromatography with Ni-NTA (Fig. 2). From
2 l of induced culture, 7.2 mg of recombinant UGT84A13 protein
were obtained.
Substrate preference of UGT84A13 and kinetic data
To verify the catalytic activity of UGT84A13 in vitro, the purified
His-tag fusion protein was tested for the ability to catalyze the
transfer of the glucosyl moiety from UDP-glucose to several
hydroxybenzoic (HBA, C6–C1 compounds) and hydroxycinnamic
acids (HCA, C6–C3 compounds). According to the substrate prefer-
ences described for the purified UGT activity from Q. robur (Gross,
1983) and related enzymes from grapevine (Khater et al., 2012),
gallic acid, protocatechuic acid and vanillic acid (C6–C1), as well
as caffeic acid, ferulic acid, and sinapic acid (C6–C3) were tested

46
J. Mittasch et al. / Phytochemistry 99 (2014) 44–51
98
99
97
99
100
81
92
96
100
98
63
72
100
glucoside formation
ester formation
0.1
Fig. 1. Composite tree of UGT sequences showing that UGT84A13 clusters with 1-O-ester-forming UGTs. The tree was derived from a multiple alignment of peptide
sequences of about 120 amino acids starting with the conserved HCGWN motif of the PSPG box. The tree was inferred using the Neighbour-Joining method (Saitou and Nei,
1987) implemented in MEGA4 (Tamura et al., 2011). The scale represents 0.1 fixed mutations per site. Bootstrap values (1000 replicates) over 60% are indicated. The dashed
line highlights functional diversification of UGTs catalyzing the formation of 1-O-glucose esters or glucosides. The ester-forming UGTs shown belong to the phylogenetic
cluster L of UGTs (Ross et al., 2001). Ant5GT(Ph), Petunia hybrida anthocyanin 5-O-GT (BAA89009); Ant5GT(Gh), Glandularia hybrida anthocyanin 5-O-GT (BAA36423);
Ant5GT1(Pf), Perilla frutescens anthocyanin 5-O-GT (BAA36421); Fv3GT(Gt), Gentiana triflora anthocyanidin 3-O-GT (Q96493); Fvd3GT(Vv), Vitis vinifera flavonoid 3-O-GT
(BAB41026); Fvd3GT(Fi), Forsythia intermedia flavonoid 3-O-GT (AAD21086); Fvd3GT(Pf), Perilla frutescens flavonoid 3-O-GT (BAA19659); QrUGT2, Quercus robur putative
UGT; UGT7(Fi), Forsythia intermedia coniferylalcohol GT (BA165909); UGT84A9, Brassica napus sinapic acid 1-O-GT; UGT84A2, Arabidopsis thaliana (At) sinapic acid 1-O-GT;
UGT84A1, A3, A4, At hydroxycinnamic acid 1-O-GT; QrUGT1 (UGT84A13), Quercus robur gallic acid 1-O-GT; VvGT1-3, Vitis vinifera hydroxybenzoate/hydroxycinnamate
glucosyltransferases (AEW31187, AEW31188, AEW31189). The resveratrol/hydroxycinnamate glucosyltransferase from Vitis labrusca (VIRSgt, ABH03018) was identical with
VvGT2 over the sequence considered for this analysis.
as potential glucosyl acceptor. Qualitative analyses of enzymatic
reaction mixtures by UPLC/ESI(-)-QTOFMS revealed in all cases for-
mation of a single reaction product whose elemental composition
was in accordance with a glucosylated HBA/HCA (Fig. 3A and B).
Among them, 1-O-galloyl-ß-D-glucose and 1-O-sinapoyl-ß-D-glu-
cose were identified using authenticated standards. For the
remaining products, analysis of the collision-induced dissociation
mass spectra obtained from the deprotonated molecular ion indi-
cated the presence of similar characteristic fragment ions as ob-
served for 1-O-galloyl-ß-D-glucose and 1-O-sinapoyl-ß-D-glucose
(Fig. 3C). Hence, UGT84A13 converts all tested C6–C1 and C6–C3
phenolic acids into the corresponding 1-O-esters of ß-D-glucose.
specific activities in the same range toward protocatechuic, gallic
and caffeic acid, accompanied by a relatively high activity toward
sinapic acid (Khater et al., 2012). Therefore, by substrate specific-
ity, UGT84A13 was classified as hydroxybenzoic acid UGT. Kinetic
measurements showed that the Vmax values of UGT84A13 for the
three C6–C1 substrates tested were in the similar range with a
slight increase for protocatechuic acid (Table 1). The KM values
indicated the highest affinity of UGT84A13 for vanillic acid fol-
lowed by protocatechuic acid and gallic acid. In summary, the
in vitro kinetic data suggested a slight preference of UGT84A13
for protocatechuic acid and vanillic acid to gallic acid. This resem-
bled the catalytic properties of a glucosyltransferase activity puri-
fied from leaves of red oak (Gross, 1983; Weisemann et al., 1988).
Compared to VvGT1, described as the most efficient gallic acid glu-
cosyltransferase among the three related grapevine enzymes (Kha-
ter et al., 2012), in our experiments with UGT84A13 the KM was
about 20% lower and the Vmax about fivefold higher with gallic acid
(Table 1). This revealed that UGT84A13 was more efficient in the
formation of 1-O-galloyl-ß-D-glucose than VvGT1. The KM values
Specific enzyme activities indicated
a clear preference of
UGT84A13 for C6–C1 phenolic acids as glucosyl acceptors com-
pared to the C6–C3 phenolic acids (Fig. 4). With regard to sinapic
acid, the best C6–C3 substrate tested, UGT84A13 activity was in-
creased by factors of 3.5–5 with all C6–C1 glucosyl acceptors inves-
tigated. This clearly distinguished UGT84A13 from the related
glucosyltransferases VvGT1-3 from grapevine, which displayed

J. Mittasch et al. / Phytochemistry 99 (2014) 44–51
47
sequencing of EST collections from gallotannin-producing tissues
should be applied.
M
[kDa]
2
1
3
4
Experimental
Plant material
Swelling buds and young leaves were harvested from two indi-
vidual plants of pedunculate oak (Q. robur) from the natural habi-
tat, immediately frozen in liquid nitrogen and stored at ꢀ80 °C.
66.4
55.6
Chemicals
The substrates protocatechuic acid and vanillic acid as well as
ferulic acid and caffeic acid were purchased from Roth (http://
www.carl-roth.de/). Gallic acid, sinapic acid and UDP-glucose were
purchased from Sigma (http://www.sigmaaldrich.com/). From the
authenticated standards, 1-O-sinapoyl-ß-D-glucose was isolated
from seedlings of Brassica napus and provided by Baumert et al.
(2005). 1-O-galloyl-ß-D-glucose (b-glucogallin) was purchased
from Phytolab (http://www.phytolab.com/).
Fig. 2. SDS–PAGE of protein fractions from the purification of His-tagged
UGT84A13 expressed in E. coli. Proteins were stained with Coomassie brilliant
blue. M, molecular weight marker; lane 1, crude protein extract; lanes 2–4, eluted
fractions from affinity column. Protein fraction of lane 3 was used for in vitro
characterization of UGT84A13. (For interpretation of the references to color in this
figure legend, the reader is referred to the web version of this article.)
cDNA library construction and isolation of UGT sequences
From swelling buds and 1 week old leaves of Q. robur total RNA
was purified by commercial preparation kits applying selective
adsorption onto silica (RNeasy Plant Mini Kit, Qiagen; http://
www.qiagen.com). Poly (A+) RNA was enriched from total RNA
by selective binding to oligo (dT)-Oligotex beads (Oligotex mRNA
Mini Kit, Qiagen). For cDNA library construction, 100 ng of poly
(A+) RNA pooled from swelling buds and 1 week old leaves were
subjected to cDNA synthesis and cloning into plasmid pSMART2IFD
using the In-FusionÒ SmarterÒ Directional cDNA Library Construc-
tion Kit (Clontech; http://www.clontech.com). The resulting plas-
mid-based cDNA library was transformed into E. coli by
electroporation using Stellar Electrocompetent Cells (Clontech,
http://www.clontech.com). The library covered about 900,000
clones, which were pooled and stored as DMSO freeze stocks at
ꢀ80 °C. For downstream application the cDNA library was purified
from the bacterial host by commercial plasmid preparation kits
(GeneJET Plasmid Miniprep Kit, Thermo Scientific). Partial 30 UGT
sequences were amplified from the Q. robur cDNA library by PCR
with degenerate forward primers derived from the conserved PSPG
box peptide motif THCGWN (ACS(W) CAY TGY GGS(W) TGG AAC;
of UGT84A13 obtained with protocatechuic, vanillic and gallic acid
(Table 1) were in the range of KM values described for glucos-
yltransferases from Arabidopsis, which catalyzed the formation
of 1-O-ß-D-glucose esters with several C6–C1 phenolic acids (Lim
et al., 2002; Eudes et al., 2008).
UPLC/ESI(-)-QTOFMS-based analyses of methanolic extracts
prepared from one and 3 week old leaves of Q. robur failed in the
detection of vanillic and protocatechuic acid and revealed only
trace amounts of the corresponding glucose esters 1-O-vanilloyl-
ß-D-glucose and 1-O-protocatechuoyl-ß-D-glucose near the
detection limit, if any. In contrast, gallic acid and the related
1-O-galloyl-ß-D-glucose were found in major abundance
(Supplemental Fig. S2). This suggests that – in terms of enzyme
evolution – glucosyl acceptor specificity of UGT84A13 was not
selected against vanillic and protocatechuic acid.
Concluding remarks
To isolate a cDNA of the enzyme UDP-glucose:gallic acid gluco-
syltransferase we used a strategy designed to clone abundantly ex-
pressed sequences of ester-forming UGTs from gallotannin-
producing tissues of Q. robur. The approach resulted in the isolation
and characterization of a novel glucosyltransferase denominated as
UGT84A13. In vitro kinetic measurements demonstrated that
UGT84A13 transferred the glucosyl moiety preferentially to the
carboxyl group of several HBAs including gallic acid, the highly
abundant phenolic substrate of gallotannin biosynthesis. In con-
trast to gallic acid, other in vitro glucosyl acceptors of UGT84A13
like protocatechuic acid and vanillic acid were not detectable in
young oak leaves; and the corresponding 1-O-esters of ß-D-glucose
were at detection limit or below. This indicates that gallic acid is
the preferred substrate of UGT84A13 in developing leaves of Q. ro-
bur. In summary, the results strongly suggest that UGT84A13 cat-
alyzes the first committed step of gallotannin biosynthesis in
planta. Although the cloning strategy described here has proven
successful in detecting abundant ester-forming group L UGTs from
other plants (Mittasch et al., 2007), we cannot exclude the pres-
ence of related UGTs, which may contribute to the formation of
1-O-galloyl-ß-D-glucose in Q. robur. To answer this question, deep
ACS(W) CAY TGY GGS(W) TGG AAT) and a reverse primer
(CCTCTTCGCTATTACGCCAGC) binding to the 30 adjacent sequence
of the library vector. PCR was run with DyNAzyme DNA Polymer-
ase I (ThermoScientific; http://www.thermoscientificbio.com/finn-
zymes/) in a 50 ll reaction mixture containing 1 ll of the diluted
(1:100) cDNA library as the template. For yield optimization, a
touch down protocol was developed including successively declin-
ing annealing temperatures (2 cycles at melting temperature
(Tm) + 5 °C, followed by
5 cycles of Tm + 3 °C, 5 cycles of
Tm + 1 °C, 7 cycles of Tm ꢀ 1 °C, 7 cycles of Tm ꢀ 3 °C, and 10 cy-
cles of Tm ꢀ 5 °C). PCR cycles included denaturation for 15 s at
95 °C, annealing for 30 s followed by elongation for 1 min at
72 °C. PCR products were purified using the MinElute PCR Purifica-
tion Kit (Qiagen) and cloned into the E. coli plasmid pGEMTeasy
(Promega; http://www.promega.com). Transformant clones were
analyzed for cDNA insertion by colony-PCR with M13 uni (ꢀ21)
(TGTAAAACGACGGCCAGT) and M13 reverse (ꢀ29) (CAGGAAA-
CAGCTATGACC) primers using MangoMix (http://www.bio-
line.com). The identified 30 partial QrUGT1 sequence was used to
derive the specific reverse primer for amplification of the 50 se-
quence of QrUGT1 (GGCTTCACCACGGCACATTC). For 50 sequence

48
J. Mittasch et al. / Phytochemistry 99 (2014) 44–51
A
B
R2
R1
-H+
d
+H
HO
HO
O
O
n
O
OH
a
HO
OH
b
c
compound
n
R1
R2
elem. comp. ret. time
[M-H]-
m/z
error
ppm
2.2
[s]
1-O-galloyl-β-D-glucose
0
OH
OH
OH
H
C13H16O10
C13H16O9
C14H18O9
C15H18O9
C16H20O9
C17H22O10
150a
72b
331.0663
1-O-protocatechuoyl-β-D-glucose 0
315.0711
329.0852
341.0877
355.1024
385.1127
3.5
8.0
0.2
3.0
3.4
0
OCH3
OH
H
154b
167b
239b
250b
1-O-vanilloyl-β-D-glucose
1-O-caffeoyl-β-D-glucose
1-O-feruloyl-β-D-glucose
1-O-sinapoyl-β-D-glucose.
1
1
1
H
OCH3
H
OCH3 OCH3
agradient program 1, bgradient program 2
C
compound
[M-
[a-
[b-H]-
[c-
[c-
H2O-
H]-
193
(2)
[d-
[d-
other ions
CE
H]-
H]-
H]-
H]-
H2O-
[eV]
H]-
151
(48)
331
(40)
271 241(2) 211
(25)
169
(100)
141 (3, [d-H-CO]-), 125
(14, [d-H-CO2]-), 123
20
1-O-galloyl-β-D-glucose
(36)
(18[d-H-H2CO2]-), 119 (3,
-
-
C4H7O4 ), 113 (4, C5H5O3
-
), 101 (3, C4H5O3 )
1-O-protocatechuoyl-
β-D-glucose
1-O-vanilloyl-β-D-glucose
315
(60)
329
255
(28)
269
225
(3)
239
(6)
195
(44)
209
(65)
-
-
153
(100)
167
-
-
119 (3)*, 113 (4)*, 109 (3,
15
15
[d-H-CO2]-), 101 (1)*
314 (4, [M-CH3-H]•-), 251
(2, [a-H2O-H]-), 221 (2,
[b-H2O-H]-), 181 (16, [c-
CO-H]-), 123 (3, [d-H-
CO2]-), 119 (4)*, 113 (6)*,
101 (5)*
(100) (18)
(90)
341
(13)
281
(4)
251
(1)
221
(3)
203
(3)
179
(20)
161
135 (2, [d-H-CO2]-), 133
15
15
1-O-caffeoyl-β-D-glucose
1-O-feruloyl-β-D-glucose
(100) (2[d-H-H2CO2]-), 119
(0.5)*, 113 (0.6)*
160 (5, [e-CH3-H]•-), 149
355
(5)
295
(3)
265
(1)
235
(4)
217
(5)
193
(17)
175
(100)
(1, [d-CO2-H]-), 134 (1,
[d-CO2-CH3-H]•-), 119
(0.3)*, 113 (0.6)*, 101
(0.2)*
190 (4, [e-CH3-H]•-), 179
1-O-sinapoyl-β-D-glucose.
385
(8)
325
(4)
295
(1)
265
(5)
247
(7)
223
(18)
205
(100)
15
(2, [d-H-CO2]-), 164 (1,
[d-CO2-CH3-H]•-), 119
(0.4)*, 101 (0.3)*
a=[M-C2H4O2]; b=[M-C3H6O3]; c=[M-C4H8O4]; d=[M-C6H10O5]; CE, collision energy; *for elemental
composition see compound 1
Fig. 3. Verification of reaction products by UPLC/ESI(-)-QTOFMS. (A) Mass spectral fragmentation of the deprotonated molecular ion of substituted 1-O-hydroxybenzoyl/
hydroxycinnamoyl-ß-D-glucoses upon collision-induced dissociation. (B) Accurate mass measurements of deprotonated molecular ions of enzymatic reaction products using
UPLC/ESI(-)-QTOFMS. (C) Collision-induced dissociation mass spectra obtained from the deprotonated molecular ion of enzymatic reaction products using UPLC/ESI(-)-
QTOFMS [m/z (rel. int.)]. Elemental compositions of fragment ions are supported by accurate mass measurements ( 10 ppm).
amplification the specific QrUGT1 reverse primer was used in com-
bination with the forward primer TCACACAGGAAACAGCTATGA,
which binds to the 50 adjacent sequence of the library vector, in
a PCR with the cDNA library as template. PCR was run according
to a touch-down protocol, which included an initial decrease of
the annealing temperature from 61 °C to 51 °C over 10 cycles fol-
lowed by 25 cycles at 51 °C. The produced amplicons were sepa-
rated by agarose gel electrophoresis and purified using the
MinElute Gel Extraction Kit (Qiagen). Fragments were cloned into
plasmid pGEMTeasy and subjected to sequence analyses. The iden-
tified overlapping 50- and 30-sequences of QrUGT1 were used to
assemble a full length reading frame of QrUGT1 in silico. From this

J. Mittasch et al. / Phytochemistry 99 (2014) 44–51
49
300
250
200
150
100
50
C6-C1
C6-C3
0
Fig. 4. Substrate specificity of UGT84A13 towards hydroxybenzoic acids (C6–C1) and hydroxycinnamic acids (C6–C3). Assays were performed in the presence of 4 mM UDP-
glucose and 2 mM phenolic acid. Specific activities were calculated from the linear increase in product formation over 4 min. Each bar represents the mean of three
independent trials standard deviation.
www.sigmaaldrich.com) and 0.8 mg mlꢀ1 lysozyme (Applichem,
http://www.applichem.com) and incubated for 30 min on ice. After
Table 1
Kinetic parameters of UGT84A13.
Substrate
Vmax [nkat mgꢀ1
]
KM
(l
M)
Vmax/KM
cell lysis by sonication (2 ꢁ 1 min on ice), high molecular DNA was
[(nkat/(l ]
M mg)ꢀ1
digested by DNaseI (Applichem) added to a final concentration of
10 mg mlꢀ1 for 10 min at room temperature. Cell debris was re-
moved by centrifugation (20,000g, 4 °C, 45 min) and the clear
supernatant passed through a cellulose acetate syringe filter of
Gallic acid
Protocatechuic acid
Vanillic acid
204
283
203
420
290
230
0.49
0.98
0.88
0,45 lm pore size (30/0,45 CA-S; Whatman, http://www.what-
man.com). The recombinant His tag UGT84A13 protein was puri-
fied by immobilized metal ion affinity chromatography (IMAC)
on Ni2+ Sepharose using the Äkta explorer 100 chromatographic
system (Pharmacia Biotech) equipped with a HisTrap HP column
(1 ml, 0.7 ꢁ 2.5 cm) and Unicorn™ 5.31 software (GE Healthcare;
http://www.gelifesciences.com). The Äkta system was run with a
flow rate of 1 ml minꢀ1 at 20 °C and a pressure of 0.5 MPa. The col-
umn was equilibrated with binding buffer and the filtrated bacte-
rial raw extract was applied using Superloop 50 ml (GE
Healthcare). After washing with 10 column volumes of binding
buffer, elution was done by a linear gradient from 10 mM to
500 mM imidazole over 20 column volumes. Fractions of 2 ml were
collected and analyzed for protein content by measuring the
absorption at 280 nm. Selected fractions were applied to PD-10
Sephadex G-25 columns (GE Healthcare), and the protein eluted
into 50 mM phosphate buffer (pH 7.0), 0.5 mM EDTA, 10% (v/v)
glycerol, 0.1% b-mercaptoethanol. Protein concentration was deter-
mined by the method of Bradford (1976) with bovine serum albu-
min as the standard. Purified proteins were analysed by SDS–
polyacrylamide gel electrophoresis on an 11% gel according to Lae-
mmli (1970). The selected fractions were tested for UGT activity
under standard assay conditions with gallic acid as the glucose
acceptor.
sequence, specific primers were derived for the amplification of
full length QrUGT1. Amplification was performed with the Q. robur
cDNA library as template and the MyFi DNA Polymerase Mix (Bio-
line) using the specific primers ATGGGATCCGAAGCTCTAGTTC (fw)
and CTAGGCCTCCACCAATTCTACC (rev). PCR amplification was run
for 35 cycles at constant annealing temperature of 55 °C according
to the protocol given by the supplier.
Heterologous expression of UGT84A13 cDNA
A full-length UGT84A13 coding sequence except for the start
codon was amplified from UGT84A13 cDNA with primers introduc-
ing restriction sites for BamHI (GTAGGATCCGAAGCTCTAGTTC (fw))
and PstI (TACCTGCAGCTAGGCCTCCACCAATTC (rev)) using DyNA-
zyme DNA Polymerase I (ThermoScientific). The amplification
product was inserted as BamHI-PstI fragment into plasmid pQE30
(Qiagen) thereby generating a 50 fusion to 6xHis codons resulting
in the N-terminal His tag of the expressed UGT84A13 protein.
The ligation product was transformed into E. coli strain M15
[pREP4] (Qiagen). For heterologous expression, cells were grown
under vigorous shaking at 37 °C in liquid Luria–Bertani medium
supplemented with ampicillin (100
(25
g mlꢀ1) to the early exponential phase (OD600 0.7). The
expression of recombinant UGT84A13 was then induced by further
cultivation in the presence of 1 mM isopropyl-b- -thiogalactopyra-
l ) and kanamycin
g mlꢀ1
l
UGT activity assays
D
noside at 20 °C for 20 h. Cells were harvested by centrifugation
(10 min, 10,000g, 4 °C), and the cell pellets were stored at ꢀ80 °C.
Standard UGT assays were performed in 0.1 M MES, 10% glyc-
erol, 0.01% ß-mercaptoethanol, 0.5 mM EDTA (pH 6.0) containing
6 l
g mlꢀ1 of recombinant UGT84A13 protein, 4 mM UDP-glucose,
Purification of recombinant UGT84A13
and 2 mM of the hydroxybenzoic or hydroxycinnamic acid sub-
strate. Reaction mixtures were incubated at 30 °C, and the reac-
tions stopped after 1, 2, 3 and 4 min by mixing aliquots of the
assay mixture with equal volume of methanol (C6–C1 phenolic
acids) or with 0.2 volume of trifluoroacetic acid (C6–C3 phenolic
acids). Reaction products were analyzed by HPLC-PDA. Specific
A bacterial cell pellet from 2 l of induced culture was re-sus-
pended in 40 ml ice-cold binding buffer (50 mM NaH2PO4,
300 mM NaCl, 10 mM imidazole, pH 8.0) supplemented with
300 ll of Proteinase Inhibitor Cocktail (Sigma–Aldrich, http://

50
J. Mittasch et al. / Phytochemistry 99 (2014) 44–51
enzyme activities were calculated from the increase in the forma-
tion of reaction products and expressed as nmol of substrate glu-
cosylated per second and per mg protein (nkat mgꢀ1).
www.ncbi.nlm.nih.gov/GenBank/index.html). Phylogenetic tree
construction was done with the Neighbour-Joining method (Saitou
and Nei, 1987) implemented in the MEGA4 software package
(Tamura et al., 2011).
The isolated cDNA sequence for UGT84A13 described in this pa-
per was submitted to Genbank database and assigned the acces-
sion number KF527849.
Kinetic parameters were determined from enzyme assays under
standard conditions (pH 6.0; 30 °C;
6
l
g mlꢀ1 recombinant
UGT84A13). Initial reaction velocities were measured over a range
of 0.2–3.0 mM phenolic acid in the presence of 4 mM UDP-glucose.
Product formation was quantified after 1, 2 and 4 min. KM and Vmax
values were calculated from hyperbolic Michaelis–Menten satura-
tion curves by non-linear fitting using the Enzyme Kinetics 1.3
module of Sigma Plot 10 (Systat Software, http://systat.de).
HPLC separations were performed on a C18 column Atlantis T3
Acknowledgements
We are grateful to S. Herrmann and M. Tarkka from the UFZ –
Helmholtz Centre for Environmental Research for discussions and
access to the TrophinOak platform. Support by E. Blum (Martin
Luther University Halle-Wittenberg, Institute of Pharmacy) with
the Äkta Explorer 100 Chromatographic System and skillful techni-
cal assistance of A. Wodak (Martin Luther University Halle-Witten-
berg, Institute of Pharmacy) are gratefully acknowledged. This
work was supported by the German Research Foundation (DFG)
in two independent projects, MI 723/3-1 and the ‘‘TrophinOak –
multitrophic interactions with Oaks’’ project.
(4.6 ꢁ 150 mm, 5
www.waters.com) using the LaChrom Elite HPLC system equipped
with L-2450 Photodiode Array Detector (Hitachi; http://
lm particle size) obtained from Waters (http://
a
www.hitachi-hta.com). For analysis of hydroxybenzoyl glucose es-
ters, HPLC solvents A and B were water and acetonitrile, both con-
taining 0.1% (v/v) formic acid. After injection, the linear gradients
to 1.8%, 26%, and 95% B in 6, 12, and 0.1 min, respectively, were
successively run. The analytes were detected by their absorption
at 280 nm (1-O-galloyl-ß-D-glucose) or at 265 nm (1-O-vanilloyl-
ß-D-glucose; 1-O-protocatechuoyl-ß-D-glucose). For analysis of
hydroxycinnamoyl glucose esters, HPLC solvents A and B were
water and 98% (v/v) aqueous acetonitrile, respectively, both con-
taining 0.1% (v/v) trifluoroacetic acid. After injection, the linear
gradients to 20%, 27%, and 95% B in 1, 12, and 1 min, respectively,
were successively run. The analytes were detected by their absorp-
tion at 330 nm (1-O-feruloyl-ß-D-glucose; 1-O-sinapoyl-ß-D-glu-
cose; 1-O-caffeoyl-ß-D-glucose). The assay products were
quantified by external standardization with the corresponding
acids as reference compounds.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.phytochem.
2013.11.023.
References
Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local
alignment search tool. J. Mol. Biol. 215, 403–410.
Baumert, A., Milkowski, C., Schmidt, J., Nimtz, M., Wray, V., Strack, D., 2005.
Formation of a complex pattern of sinapate esters in Brassica napus seeds,
catalysed by enzymes of a serine carboxypeptidase-like acyltransferase family.
Phytochemistry 66, 1334–1345.
All assays were repeated in quadruplicate, HPLC measurements
were done with three technical replicates for each data point.
Beart, J.E., Lilley, T.H., Haslam, E., 1985. Plant polyphenols – secondary metabolism
and chemical defence: some observations. Phytochemistry 24, 33–38.
Böttcher, C., Westphal, L., Schmotz, C., Prade, E., Scheel, D., Glawischnig, E., 2009.
The multifunctional enzyme CYP71B15 (PHYTOALEXIN DEFICIENT3) converts
cysteine-indole-3-acetonitrile to camalexin in the indole-3-acetonitrile
metabolic network of Arabidopsis thaliana. Plant Cell 21, 1830–1845.
Characterization of enzymatic reaction products and leaf extracts by
UPLC/ESI-QTOFMS
After 100-fold dilution with water, enzymatic reaction mixtures
(2
equipped with a HSS T3 column (100 ꢁ 1.0 mm, particle size
1.8 m, Waters) applying the following binary gradient programs
at a flow rate of 150
l minꢀ1: gradient program 1; 0–1 min,
ll) were separated on a Acquity UPLC platform (Waters)
Bradford, M.M., 1976.
A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem. 72, 248–254.
Eudes, A., Bozzo, G.G., Waller, J.C., Naponelli, V., Lim, E.-K., Bowles, D.J., Gregory III,
J.F., Hanson, A.D., 2008. Metabolism of the folate precursor p-aminobenzoate in
plants. J. Biol. Chem. 283, 15451–15459.
Freudenberg, K., 1920. Die Chemie der Natürlichen Gerbstoffe. Springer, Berlin.
Gross, G.G., 1982. Synthesis of b-glucogallin from UDP-glucose and gallic acid by an
enzyme preparation from oak leaves. FEBS Lett. 148, 67–70.
Gross, G.G., 1983. Partial purification and properties of UDP-glucose:vanillate 1-O-
glucosyltransferase from oak leaves. Phytochemistry 22, 2179–2182.
Gross, G.G., 1999. Biosynthesis of hydrolysable tannins. In: Pinto, B.M. (Ed.),
Comprehensive Natural Products Chemistry, vol. 3. Elsevier, Amsterdam, pp.
799–826.
l
l
isocratic 100% A (water/0.1% formic acid), 0% B (acetonitrile/0.1%
formic acid); 1–5 min, linear from 0% to 7% B; gradient program
2; 0–1 min, isocratic 95% A, 5% B, 1–10 min, linear from 5% to
40% B. For separation of oak leaf extracts gradient program
3 (0–1 min, isocratic 98% A, 2% B, 1–16 min; linear from 2% to
60% B) was used. Eluting compounds were consecutively detected
in a wavelength range of 190–500 nm using a photodiode array
detector (Waters) and in
a
m/z range of 50–1000 using
a
Gross, G.G., Hemingway, R.W., Yoshida, T. (Eds.), 1999. Plant Polyphenols 2.
Chemistry, Biology, Pharmacology, Ecology. Kluwer Academic/Plenum
Publishers, New York.
Grundhöfer, P., Niemetz, R., Schilling, G., Gross, G.G., 2001. Biosynthesis and
subcellular distribution of hydrolyzable tannins. Phytochemistry 57, 915–927.
Hall, D., De Luca, V., 2007. Mesocarp localization of a bi-functional resveratrol/
hydroxy-cinnamic acid glucosyltransferase of Concord grape (Vitis labrusca).
Plant J. 49, 579–591.
Hughes, J., Hughes, M.A., 1994. Multiple secondary plant product UDP-glucose
glucosyltransferase genes expressed in cassava (Manihot esculenta Crantz)
cotyledons. DNA Seq. 5, 41–49.
Iason, G., 2005. The role of plant secondary metabolites in mammalian herbivory:
ecological perspectives. Proc. Nutr. Soc. 64, 123–131.
MicrOTOF-Q I hybrid quadrupole time-of-flight mass spectrometer
equipped with an Apollo II electrospray ion source (Bruker
Daltonics) in negative ion mode. For specific instrument settings
and instrument calibration see Böttcher et al. (2009). For acquisi-
tion of collision-induced dissociation (CID) mass spectra, deproto-
nated molecular ions were isolated in the first quadrupole
(isolation width of m/z 3) and fragmented inside the collision cell
applying collision energies in the range of 15–20 eV. Argon was
used as collision gas.
Khater, F., Fournand, D., Vialet, S., Meudec, E., Cheynier, V., Terrier, N., 2012.
Identification and functional characterization of cDNAs coding for
hydroxybenzoate/hydroxycinnamate glucosyltransferases co-expressed with
genes related to proanthocyanidin biosynthesis. J. Exp. Bot. 63, 1201–1214.
Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature 227, 680–685.
Li, Y., Baldauf, S., Lim, E.-K., Bowles, D.J., 2001. Phylogenetic analysis of the UDP-
glycosyltransferase multigene family of Arabidopsis thaliana. J. Biol. Chem. 276,
4338–4343.
Sequence analysis
DNA and protein sequences were analyzed by the software
package Clone Manager (Scientific & Educational Software). For se-
quence comparison, the BLAST algorithm (Altschul et al., 1990) was
employed. The online database used was Genbank (http://

J. Mittasch et al. / Phytochemistry 99 (2014) 44–51
51
Li, A.X., Eannetta, N., Ghangas, G.S., Steffens, J.C., 1999. Glucose polyester
biosynthesis. Purification and characterization of a glucose acyltransferase.
Plant Physiol. 121, 453–460.
Lim, E.-K., Doucet, C.J., Li, Y., Elias, L., Worrall, D., Spencer, S.P., Ross, J., Bowles,
D.J., 2002. The activity of Arabidopsis glycosyltransferases toward salicylic
acid, 4-hydroxybenzoic acid, and other benzoates. J. Biol. Chem. 277, 586–
592.
Ono, N.N., Bandaranayake, P.C.G., Tian, L., 2012. Establishment of pomegranate
(Punica granatum) hairy root cultures for genetic interrogation of the
hydrolysable tannin biosynthetic pathway. Planta 236, 931–941.
Ross, J., Li, Y., Lim, E.-K., Bowles, D.J., 2001. Higher plant glycosyltransferases.
Genome. Biol. 2, reviews 3004.1–3004.6.
Scalbert, A., 1991. Antimicrobial properties of tannins. Phytochemistry 30, 3875–
3883.
Liu, Y., Gao, L., Liu, L., Yang, Q., Lu, Z., Nie, Z., Wang, Y., Xia, T., 2012. Purification and
characterization of a novel galloyltransferase involved in catechin galloylation
in the tea plant (Camellia sinensis). J. Biol. Chem. 287, 44406–44417.
Mackenzie, P., Owens, I., Burchell, B., Bock, K., Bairoch, A., Belanger, A., Fournel-
Gigleux, S., Green, M., Hum, D., Iyanagi, T., et al., 1997. The UDP
glycosyltransferase gene superfamily: recommended nomenclature update
based on evolutionary divergence. Pharmacogenetics 7, 255–269.
Milkowski, C., Baumert, A., Schmidt, D., Nehlin, L., Strack, D., 2004. Molecular
regulation of sinapate ester metabolism in Brassica napus: expression of genes,
properties of the encoded proteins and correlation of enzyme activities with
metabolite accumulation. Plant J. 38, 80–92.
Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:
molecular evolutionary genetics analysis using maximum likelihood,
evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28,
2731–2739.
Tarkka, M.T., Herrmann, S., Wubet, T., Feldhahn, L., Recht, S., Kurth, F., Mailänder, S.,
Bönn, M., Neef, M., Angay, O., Bacht, M., Graf, M., Maboreke, H., Fleischmann, F.,
Grams, T.E.E., Ruess, L., Schädler, M., Brandl, M., Scheu, S., Schrey, S.D., Grosse, I.,
Buscot, F., 2013. OakContigDF159.1, a reference library to study differential
gene expression in Quercus robur L. during controlled biotic interactions: first
assessment by transcriptomic profiling in ectomycorrhizal symbiosis. New
Phytol. 199, 529–540.
Mittasch, J., Strack, D., Milkowski, C., 2007. Secondary product glycosyltransferases
in seeds of Brassica napus. Planta 225, 515–522.
Niemetz, R., Gross, G.G., 2005. Enzymology of gallotannin and ellagitannin
biosynthesis. Phytochemistry 66, 2001–2011.
Weisemann, S., Denzel, K., Schilling, G., Gross, G.G., 1988. Enzymatic synthesis of 1-
O-phenylcarboxyl-ß-D-glucose esters. Bioorg. Chem. 16, 29–37.