Full text of DOI:10.1093/glycob/cwf075

Glycobiology vol. 12 no. 10 pp. 599–606, 2002
A highly conserved His-His motif present in α1→3/4fucosyltransferases is required for
optimal activity and functions in acceptor binding
Anne L. Sherwood, David A. Upchurch, Mark R. Stroud,
William C. Davis, and Eric H. Holmes1
multiple organisms. For example, in humans, six distinct
enzymes, designated FucT-III, -IV, -V, -VI, -VII, and -IX,
have been cloned (Kukowska-Latallo et al., 1990; Goelz et al.,
1990; Weston et al., 1992a,b; Koszdin and Bowen, 1992;
Sasaki et al., 1994; Natsuka et al., 1994; Kaneko et al., 1999).
Although each enzyme has the common property of binding
the GDP-fucose donor substrate, subtle differences in acceptor
specificity and tissue distribution distinguish members of this
family of enzymes. Additionally, α1→3/4FucTs have been
identified and cloned from other mammalian species (Nishihara
et al., 1999; Costache et al., 1997; Gersten et al., 1995; Smith
et al., 1996; Ozawa and Muramatsu, 1996; Kudo et al., 1998;
Sajdel-Sulkowska et al., 1997; Zhang et al., 1999; Oulmouden
et al., 1997), chicken (Lee et al., 1996), fish (Kageyama et al.,
1999), invertebrates (Trottein et al., 2000; DeBose-Boyd et
al., 1998), plants (Leiter et al., 1999), and bacteria (Rasko et al.,
2000). Many of these enzymes share significant sequence
homology and enzymatic properties with one or more human
counterparts.
Most sequence homology among FucTs occurs in the
C-terminal catalytic domain. Structure–function studies of
amino acids in this region have identified residues involved in
GDP-fucose binding (Holmes et al., 1995; Sherwood et al.,
2000), catalysis (Sherwood et al., 1998; Vo et al., 1998;
Britten and Bird, 1997), and disulfide bonding (Holmes et al.,
2000). Greater sequence heterogeneity is found in the
N-terminal cytoplasmic and transmembrane domains, and the
stem region. Residues involved in aspects of acceptor binding
have been reported to occur in more N-terminal portions of the
protein (Legault et al., 1995; Dupuy et al., 1999; Nguyen et al.,
1998). For example, Legault et al. (1995) reported that amino
acids present in a segment of FucT-III spanning residues 105
through 151 were associated with the enzyme’s ability to
transfer to type 1 chain structures. Substitution of residues in
this region unique to FucT-VI disabled transfer to type 1 chain
acceptors. Among these residues is R110 of FucT-VI (W111 in
FucT-III). In a recent report, Dupuy et al. (1999) confirmed
that residues in this position contribute in defining type 1 and 2
chain acceptor specificity. In another report, Nguyen et al.
(1998) demonstrated that amino acids from a more N-terminal
region of the protein were also involved in defining type 1
versus type 2 chain specificity. Modification of as few as two
amino acids of FucT-V to the corresponding residues of FucT-III
(Asn86 to His and Thr87 to Ile) increased α1→4FucT activity
with both oligosaccharide and glycolipid acceptors. Despite
the ability of these amino acid changes to elicit α1→4fucosyl
transfer to type 1 acceptors, kinetic parameters clearly showed
that other residues present in FucT-III must also be required for
optimal transfer (Nguyen et al., 1998).
Northwest Hospital, Molecular Medicine, Department of Cell Surface
Biochemistry, 21720 23rd Drive SE, Suite 101, Bothell, WA 98021, USA
Received on April 29, 2002; revised on June 12, 2002; accepted on June 13,
2002
α1→3/4Fucosyltransferases (FucTs) from several species
contain a highly conserved His-His motif adjacent to an
enzyme region correlating with the ability to catalyze
fucose transfer to type 1 chain acceptors. Site-directed
mutagenesis has been employed to analyze structure–function
relationships of this His-His motif in human FucT-IV. The
results indicate that most changes of His113 and His114 and
nearby residues of FucT-IV reduced the specific activity of
the enzymes. Analysis of acceptor properties demonstrated
close similarity of most mutants with wild-type FucT-IV,
whereas an apparent preference for the H-type II acceptor
was observed for the His114 mutants. Kinetic studies
demonstrated that mutants of His114 had a substantially
increased Km for acceptor compared to other enzymes
tested. The dramatic increase in acceptor Km for the His114
mutants, particularly for the nonfucosylated acceptor,
suggests that this His-His motif is involved in acceptor
binding and perhaps interacts with GlcNAc residues of
type 2 acceptors. The presence of fucose in acceptor
substrates may promote more efficient substrate binding
and presumably partially overcomes the weaker interaction
with GlcNAc caused by the mutation.
Key words: carbohydrate binding site/fucosyltransferase/His
motif/structure–function relationships
Introduction
α1→3/4Fucosyltransferases (FucTs) catalyze fucose transfer
on GlcNAc residues in lacto- or neolacto-series cell surface
carbohydrates of glycolipids or glycoproteins. These structures,
representing the Lea- and Lex-related antigens, accumulate in
many human cancers (Hakomori, 1989; Alhadeff, 1989),
undergo developmental regulation (Hakomori, 1989; Alhadeff,
1989; Sanders and Kerr, 1999; Listinsky et al., 1998), or
function as natural ligands for leukocyte adhesion during
inflammation (Sanders and Kerr, 1999; Listinsky et al., 1998;
Renkonen et al., 1997; McEver, 1997). A large number of
distinct α1→3/4FucTs have been identified and cloned in
1To whom correspondence should be addressed; E-mail: eholmes@nwbio.com
© 2002 Oxford University Press
599

A.L. Sherwood et al.
A highly conserved His-His motif is present in this
N-terminal hypervariable region of most presently cloned
FucTs (see Figure 1). This is adjacent to amino acids already
discussed, which have been shown to influence acceptor
binding properties (Legault et al., 1995; Dupuy et al., 1999;
Nguyen et al., 1998). We conducted site-directed mutagenesis
studies to change these His residues (as well as other nearby
residues) present in FucT-IV to determine their impact on
enzyme activity and acceptor binding properties. The results
demonstrate that the inherent enzymatic activity is reduced by
many of these changes, and, in particular, changes in His114
results in altered acceptor affinities.
Site-directed mutagenesis and analysis of expressed enzymes
Site-directed mutagenesis was performed by replacing the
sequence for codons within FucT-IV as summarized in Table I.
No mutation resulted in the introduction of a new potential
N-linked glycosylation site into the enzyme. Sequencing on
both strands of all mutants confirmed that there were no other
nucleotide modifications present compared to the wild-type
FucT-IV sequence (data not shown). The plasmid containing
both the wild-type FucT-IV sequence and that of the mutant
enzymes was composed of a truncated form of the FucT-IV
sequence missing the coding sequence for the first 57 amino
acids of the FucT-IV enzyme in the pPROTA vector. The
expressed protein was thus a fusion protein containing the
Protein A Ig binding domain fused to the FucT-IV sequences.
This aided in the isolation of the expressed protein by allowing
direct binding to Ig-Agarose beads in a single-step purification.
The presence of the Protein A Ig binding domain in the fusion
protein could also be used to visualize and quantitate the
protein in a western blot. No difference in enzymatic properties
has been observed between pPROTA expressed FucTs and
their native, full-length parent enzymes (De Vries et al., 1995).
Figure 2 shows results from a western blot analysis of the
pPROTA expressed wild-type FucT-IV and the mutant
enzymes. Bands migrating at approximately 70–80 kDa
corresponding to expressed wild-type FucT-IV and mutant
fusion proteins are observed. In some cases these bands are
weaker due to differences in expression levels. The majority of
the expressed protein for enzymes containing the H113N
mutation (both the single and double mutant) correspond to
protein bands migrating between 40 and 45 kDa. This was a
consistent finding because similar results were observed with
expressed enzymes containing the H113N mutation from
multiple expression experiments. These faster-migrating bands
most likely result from degradation of the expressed fusion
protein through protein turnover, possibly related to improper
protein folding caused by the H113N mutation. For specific
activity determinations, protein concentrations were based
Results
Structure–function studies among human α1→3/4FucTs have
led to the identification of amino acids involved in defining
carbohydrate acceptor binding specificity (Legault et al., 1995;
Dupuy et al., 1999; Nguyen et al., 1998). In general, these
residues are found in the N-terminal portions of the enzyme’s
catalytic domain. A productive strategy to define functional
characteristics of specific amino acids has proven to be analysis of
aligned protein sequences of α1→3/4FucTs to identify highly
conserved amino acids, production of site-directed mutants at
these positions, and analysis of the impact of these modifications
on enzymatic properties. One highly conserved motif among
cloned α1→3/4 FucTs is a His-His sequence corresponding,
for example, to His113 and His114 of FucT-IV (see Figure 1).
Although there is generally considerable sequence heteroge-
neity in this region among FucTs, this His-His motif is found
in most enzyme forms, including all human FucTs. To analyze
the functional properties of this motif, site-directed muta-
genesis was used to change each of these sites to an Asn
residue individually and together, and the effect of these
mutations on acceptor properties was analyzed.
Fig. 1. Aligned amino acid sequences of cloned α1→3/4FucTs around a His-His motif (shown in bold) distributed in the N-terminal region. The aligned sequences
are shown where they occur in the sequence compared to human FucT-III. Amino acid deletions are shown by dashes where they occur in the alignments.
For clarity and ease of sequence comparison, underscored amino acids define flanking residues of amino acid insertions of variable size from 1 to 26 amino acids.
The sequences of the inserted residues are not shown. The alignments shown for the enzymes from S. mansoni (Trottein et al., 2000), mung bean
(Leiter et al., 1999) C. elegans (DeBose-Boyd et al., 1998), and H. pylori (Rasko et al., 2000) are based on those given in the indicated references.
600

A highly conserved His-His motif in α1→3/4FucTs
Table I. Site-directed mutant enzymes used in this study
Position
110
Native codon
GTG
Native amino acid
Mutant codon
GCA
Mutant amino acid
Mutant designation
V110A
Val
Ala
113
CAC
His
CTC
Leu
H113L
113
CAC
His
AAC
Asn
Asn/Asn
Ala
H113N
113/114
114
CAC/CAC
CAC
His/His
His
AAC/AAC
GCA
H113N/H114N
H114A
114
CAC
His
CAA
Gln
H114Q
114
CAC
His
AAC
Asn
Tyr
H114N
119
AAG
Lys
TAT
K119Y
for each acceptor substrate tested. Similar results in comparison to
wild-type FucT-IV were also observed for the His114 mutants
with all acceptor oligosaccharides tested except for the H-type
2 acceptor. Relative transfer to the H-type 2 acceptor was
increased approximately two- to threefold compared to wild-
type FucT-IV for these mutants, indicating an inherent prefer-
ence for an acceptor with a terminal α1→2-linked fucose for
the His114 mutant enzyme. Wild-type FucT-IV is known to
transfer fucose to sialylated acceptors poorly, and no difference
was observed in the relative transfer to the sialylated acceptor
by either His mutant. No significant fucose transfer to type 1
chain acceptors occurred with any enzyme tested.
Fig. 2. Western blot analysis of pPROTA expressed enzymes. Lane 1,
wild-type FucT-IV (30 ng); lane 2, V110A mutant (4 ng); lane 3, H113L
mutant (7 ng); lane 4, H113N mutant (7 ng); lane 5, H113N/H114N double
mutant (3 ng); lane 6, H114A mutant (18 ng); lane 7, H114Q mutant (15 ng);
lane 8, H114N mutant (30 ng); and lane 9, K119Y mutant (40 ng).
The conditions of the experiment were as described under Materials and
methods using a standard volume of beaded enzyme containing the amount of
pPROTA expressed enzyme shown in parentheses. The asterisk on the right
indicates the position of a band corresponding to antibody heavy chain derived
from the IgG-Agarose beads used to capture the pPROTA expressed protein.
The migration of protein molecular weight standards (in kDa) is shown to
the left.
Analysis of enzyme kinetic parameters
The apparent Km values for wild-type FucT-IV and mutant
enzymes for GDP-fucose donor and various acceptor oligosac-
charides were determined as shown in Table II. The results
demonstrate that none of the mutant enzymes had a significantly
altered Km for GDP-fucose compared to wild-type FucT-IV. In
contrast, mutants of His114 had significantly higher Km values
for both LacNAc and H-type 2 acceptors when compared with
wild-type FucT-IV, as well as mutants at other nearby sites.
Interestingly, the increase in Km was not of the same magnitude
for both acceptor substrates. Wild-type FucT-IV and mutants at
positions 110, 113, and 119 had Km values for LacNAc in
generally the 1 mM range, which was reduced to approxi-
mately 0.25 mM for the H-type 2 acceptor. A much larger
proportionate difference was observed with the His114 mutants
tested. Km values for LacNAc varied from 5 to 11.6 mM and
0.6 to 1.1 mM for H-type 2. Thus the His114 mutant enzymes
have an increased Km for both acceptor substrates compared to
wild-type FucT-IV, but the relative (fucosylated versus
nonfucosylated substrate) effect on acceptor substrate binding
is different. This suggests that mutations of His114 differentially
alter the acceptor substrate binding site. Therefore, this amino
acid may be closer to the portion of the enzyme that binds the
GlcNAc rather than the Gal residue of type 2 acceptors. In
contrast to the alterations in acceptor substrate Km values, no
significant differences were found in Vmax when either LacNAc
or H-type 2 was used as an acceptor. Due to the very low
activity obtained with the H113N enzyme, limited kinetic
studies were possible. The results obtained indicate that the
H113N mutant has a Km for LacNAc similar to that observed
for the wild-type FucT-IV enzyme. The results obtained with
upon the amount of the 70–80-kDa protein present for each
enzyme.
Effect on enzyme specific activity and acceptor substrate
specificity
Table II shows the effect of the mutations on enzyme-specific
activity utilizing the disaccharide LacNAc as the acceptor.
Although the specific activity for the K119Y mutant was very
similar to wild-type FucT-IV, other mutants had reduced
specific activities of from 3- to 3500-fold compared with wild-
type FucT-IV. In particular, broad changes in specific activities
for His114 mutants were observed with the H114Q, H114A, and
H114N mutants having values 3-, 17-, and 80-fold lower,
respectively, compared with wild-type FucT-IV. The H113L
mutant and the H113N/H114N double mutant were found to be
inactive with LacNAc as the acceptor substrate.
To further characterize the active mutants, a range of
acceptor substrates were used. This analysis utilized synthetic
8-methoxycarbonyl derivatives of acceptor oligosaccharides
because many of these free carbohydrates are not commercially
available. The results are shown in Table III and are reported
relative to the activity observed with the 8-methoxycarbonyl
derivative of LacNAc. A standard acceptor concentration was
used in each case based on optimized concentrations for wild-
type FucT-IV. In these experiments, wild-type FucT-IV and
mutants at positions 110, 113, and 119 behaved very similarly
601

A.L. Sherwood et al.
Table II. Specific activities and Km values for wild-type FucT-IV and site-directed mutants
Specific activity
Enzyme
FucT-IV
V110A
(nmol/h/mg protein)
Km (GDP-fucose; µM)
Km (LacNAc; mM)
1.06 0.12
1.8 0.3
0.8 0.1
—
Km (H-Type 2; mM)
0.25 0.01
0.23 0.1
—
20.82
0.42
0.006
ND
28
19
—
—
35
33
27
—
27
4
3
H113N
H113L
—
H114N
0.26
1.22
6.50
ND
2
2
2
11.6 2.0
5.0 0.1
10.4 0.2
—
1.0 0.2
1.1 0.1
0.57 0.03
—
H114A
H114Q
H113N/H114N
K119Y
23.60
2
1.4 0.4
0.3 0.1
Assays were conducted as described under Materials and methods using free oligosaccharides as acceptors. Specific activities were defined using free LacNAc as
the acceptor.
ND = none detected.
Table III. Fucose transfer to oligosaccharide acceptors catalyzed by wild-type FucT-IV and site-directed mutants
Acceptora
Wild-type FucT-IV
V110A
<0.1
H113N
<0.1
H114N
<0.1
H114A
<0.1
H114Q
<0.1
K119Y
<0.1
Galβ1→3GlcNAc-R1 <0.1
H(Type I)-R1
<0.1
<0.1
<0.1
<0.1
<0.1
<0.1
<0.1
H(Type II)-R1
LacNAc-R1
1.14 0.22
1.0
1.2 0.22
1.0
1.52 0.18
1.0
3.31 0.21
1.0
1.87 0.04
1.0
1.9 0.04
1.0
1.33 0.27
1.0
Sulfo-LacNAc-R1
Sialyl-LacNAc-R1
0.83 0.04
0.15 0.05
1.13 0.15
0.35 0.08
1.27 0.38
0.21 0.05
1.48 0.5
0.08 0.01
0.72 0.01
0.07 0.06
0.72 0.21
0.07 0.02
1.18 0.32
0.32 0.18
Relative fucose transfer normalized to activity found with LacNAc-R1 as the acceptor is shown.
aR1 = O-(CH2)8COOCH3.
the two His mutants were different even though the two amino
acids are adjacent to each other in the linear sequence.
in the C-terminal catalytic domain. They differ in their tissue
distribution and acceptor specificity properties. Previous
reports have mapped amino acids involved in acceptor specificity
properties, particularly the ability to catalyze fucose transfer to
type 1 chain acceptors to amino acids present in the N-terminal
hypervariable region (spanning amino acids 76 through 151) of
FucT-III (Legault et al., 1995; Dupuy et al., 1999; Nguyen et
al., 1998). In particular, these reports identified His76, Ile77
(Nguyen et al., 1998), and Trp111 (Dupuy et al., 1999) as being
associated with transfer to type 1 chain acceptors. In addition
to variable amino acids that correlate with a specific catalytic
property, highly conserved amino acids are also found in this
region of the protein and likely also play a critical role in
acceptor binding.
One example is a highly conserved His-His motif that is
immediately proximal to the W/R position, which correlates
with type 1/type 2 chain transfer specificity (Dupuy et al.,
1999). This His-His motif is conserved among FucTs from
mammalian (Nishihara et al., 1999; Costache et al., 1997;
Gersten et al., 1995; Smith et al., 1996; Ozawa and Muram-
atsu, 1996; Kudo et al., 1998; Sajdel-Sulkowska et al., 1997;
Zhang et al., 1999; Oulmouden et al., 1997), chicken (Lee et
al., 1996), and fish (Kageyama et al., 1999) species. However,
Discussion
Glycosyltransferases catalyze the biosynthesis of cell surface
carbohydrates composed of multiple sugar moieties in discrete
sequences and linkages. A surprising observation is that fami-
lies of enzymes capable of catalyzing the same reaction are
commonly found in a single organism. Examples include fami-
lies of β1→3- and β1→4galactosyltransferases (Amado et al.,
1999), α2→3sialyltransferases (Natsuka and Lowe, 1994;
Kapitonov and Yu, 1999), and α1→3/4FucTs (Oriol et al.,
1999). Although we do not understand why there are so many
forms of these enzymes expressed in one organism, the avail-
ability of the multiple forms provides opportunities to obtain
useful information about how the substrate specificity is
encoded into the protein.
To date, six human α1→3/4fucosyltransferases have been
cloned (Kukowska-Latallo et al., 1990; Goelz et al., 1990;
Weston et al., 1992a,b; Koszdin and Bowen, 1992; Sasaki et
al., 1994; Natsuka et al., 1994; Kaneko et al., 1999). These
enzymes have relatively high sequence homology, particularly
602

A highly conserved His-His motif in α1→3/4FucTs
FucTs from evolutionarily more distant organisms (i.e., plant
[Leiter et al., 1999], bacteria [Rasko et al., 2000], and inverte-
brate species [Trottein et al., 2000; DeBose-Boyd et al., 1998])
do not have this motif. Studies of the acceptor specificities of
enzymes that do not contain the His-His motif are incomplete;
however, the evidence that is available indicates that at least
some of these enzymes catalyze fucose transfer to either
different (Leiter et al., 1999) or a wider variety (DeBose-Boyd
et al., 1998) of acceptor carbohydrate structures than lacto- or
neolacto-series structures.
His residue(s) in GDP-fucose binding. Future reports will
address these results to provide a broader perspective of structure–
function relationships within human FucTs.
Materials and methods
Materials
COS-7 cells were obtained from the American Type Cell
Collection (Rockville, MD). N-acetyllactosamine (LacNAc),
The results presented demonstrate these His residues in
human FucT-IV are important for optimal activity. Modification
of His113 resulted in either inactive or weakly active enzymes;
in some cases the mutant enzyme was partially degraded,
possibly due to improper protein folding. Mutants of His114 also
had reduced specific activity compared to wild-type FucT-IV,
although to a lesser extent of 3–80-fold. A double mutant
H113N/H114N was catalytically inactive with LacNAc. Other
mutants at surrounding positions had varying effects on
specific activity but had kinetic parameters very similar to the
wild-type enzyme. Interestingly, analysis of acceptor specificity
properties of the active mutants revealed that when normalized
to the activity with LacNAc as the acceptor, all had very
similar acceptor properties to the wild-type enzyme except for
mutants of His114, which displayed a two- to threefold
increased preference for the H-type 2 acceptor compared to the
wild-type and other enzymes. Kinetic analyses of these mutant
enzymes revealed that all mutant enzymes had a Km for GDP-
fucose similar to the wild-type enzyme. Apparent Km values
for LacNAc for mutants other than His114 were determined to
be equal to that of wild-type FucT-IV. In contrast, significant
differences in the Km for acceptors were found between wild-
type FucT-IV and the His114 mutants.
Although a contribution of His114 to maintaining proper
protein structure cannot be ruled out, changes in this site
dramatically altered the ratio of the Kms for the two acceptors,
leading to the likelihood that this position is directly involved
in acceptor binding. Saturation of wild-type FucT-IV, as well
as mutants in positions 110, 113, and 119, with LacNAc
resulted in an apparent Km for the acceptor of approximately
1 mM, similar to other published reports (Sherwood et al.,
1998, 2000; De Vries et al., 1995). An approximately fourfold
reduced Km was observed when the H-type 2 acceptor was used
(see also De Vries et al., 1995). Increased Km values were
observed for both acceptors with the His114 mutants. The
apparent Km for LacNAc varied between 5 and 11.6 mM for the
His114 mutants versus values between 0.6 and 1.1 mM for the
H-type 2 acceptor. Although both Kms are increased, the signifi-
cantly lower Km for H-type 2 gives rise to the increased relative
activity with this acceptor for the His114 mutant enzymes. The
altered relative binding of a fucosylated versus a nonfuco-
sylated acceptor suggests that this region may be an element of
an acceptor binding pocket that interacts with GlcNAc residues
of type 2 acceptors. Presumably, the presence of a fucose
residue on the terminal Gal of the acceptor partially overcomes
the reduced acceptor binding caused by weaker interactions
with the GlcNAc residue.
2′-fucosyl-N-acetyllactosamine (H-type
2
trisaccharide),
GDP-fucose, rabbit IgG-agarose beads, and DEAE-Dextran
were obtained from Sigma (St. Louis, MO). Plasmid pCR2.1
TOPO was from Invitrogen (San Diego, CA), and pPROTA
and pPROTA-FucT-IV (long form, amino acids 58–405) plasmids
were received from Dr. Bruce A. Macher (San Francisco State
University, San Francisco, CA). GDP-[14C]fucose (283 mCi/mmol)
and [35S]dATP were obtained from Dupont NEN (Boston,
MA). DNA sequencing of initial constructs was done using the
Sequenase Version 2.0 DNA sequencing kit or the Sequenase
polymerase chain reaction (PCR) product sequencing kit
obtained from U.S. Biochemical (Cleveland, OH). Automated
DNA sequencing of final pPROTA constructs was performed
at the San Francisco State University Sequencing Facility, by
Thetagen (Seattle, WA), or by GeneMed Synthesis (San Fran-
cisco, CA). PCR primers were obtained from Oligos, Etc.
(Wilsonville, OR), Integrated DNA Technologies (Coralville,
IA), or were made on a Beckman Oligo 1000 Synthesizer. All
other reagents were of the highest quality commercially available.
Cell culture
COS-7 cells were grown in tissue culture plates in Dulbecco’s
modified Eagle’s medium (DME), supplemented with 10%
fetal calf serum. These were passed 1:4 every 5–6 days.
Transfection of FucT constructs into COS-7 cells for enzyme
expression
COS-7 cells were transfected by the DEAE dextran technique
(Ausubel et al., 1993) with the pPROTA Fuc T-IV constructs:
chimeric, truncated wild-type FucT-IV, V110A, H113L,
H113N, H113N/H114N, H114A, H114Q, H114N, and
K119Y. Three to five days posttransfection, secreted fusion
proteins were adsorbed to rabbit IgG-Sepharose beads
(Sigma), washed extensively with phosphate buffered saline
(PBS), and stored in PBS containing 0.02% NaN3 for use in
these experiments.
Site-directed mutagenesis
Parental FucT coding sequences for site directed mutagenesis
were truncated catalytic domain forms of the native FucT-IV
in the pPROTA vector (Henion et al., 1994). Properties of
pPROTA expressed enzymes have been shown to be very
similar to those of full-length enzymes (De Vries et al., 1995).
Site-directed mutant enzymes used in this study are shown in
Table I. The flanking and mutagenic primers used in forming
the FucT-IV V110A, H113L, H113N, H113N/H114N,
H114A, H114Q, H114N, and K119Y mutants described in this
study are shown in Table IV. Site-directed mutagenesis of
FucT-IV in pPROTA was conducted as follows via recom-
binant PCR (Higuchi, 1990). The forward flanking primers
used for the three FucT-IV mutants contained an EcoR1 site
Human α1→3/4FucTs contain five highly conserved His
residues. The data presented in this report demonstrate an
involvement in acceptor binding for certain of these residues.
Other studies we are conducting address the involvement of
603

A.L. Sherwood et al.
Table IV. Primers used for recombinant PCR mutagenesis
for these constructs was established by either HindIII/MluI or
HindIII/EcoNI double digestion. Each mutation was confirmed
by DNA sequencing using an Applied Biosystems Model
373A DNA sequencing system.
Single mutations
Flanking primers
Forward:5′ TGgaattcGCCAACCCCGTCGCGACCG 3′
Enzyme assays
Reverse:5′
FucT-IV enzyme activities utilizing oligosaccharide acceptors
were determined in standard reaction mixtures composed of
1 µmol HEPES buffer, pH 7.2, 6 nmol GDP-[14C]fucose
(15,000 cpm/nmol), 0.4 µmol LacNAc or 0.072 µmol of
8-methoxycarbonyloctyl glycoside derivatives, 2 µmol NaCl,
0.125 µmol MnCl2, 10 µg bovine serum albumin, 0.01 µmol
ATP, and chimeric enzyme bound to IgG-Agarose beads in a
total volume of 0.02 ml. The reaction mixture was incubated
for 1 h at room temperature and stopped and quantitated
as described previously utilizing Dowex-1 for oligosaccharide
acceptors (De Vries et al., 1995) or C18 columns for 8-
methoxycarbonyl glycoside derivatives as acceptors (Palcic
et al., 1988).
Assays conducted with the mutant enzymes were modified
to increase sensitivity of the assay. This was accomplished by
increased specific activity of GDP-[14C]fucose (30,000 cpm/nmol),
longer assay times up to 4 h, and increased amounts of beaded
enzyme in the 0.02 ml reaction mixture. These modifications
resulted in assays with increased sensitivity of detection to
allow activity determinations for enzymes with low inherent
activity. All assays were linear with respect to both time and
protein concentration over the assay times used.
AGgtcgacTTCACCGCTCGAACCAGCTGGCCAA 3′
Mutagenic primers
V110A
Forward: 5′ GCTCAGGCCGCACTTTTCCACCAC 3′
Reverse: 5′ GTGGTGGAAAAGTGCGGCCTGAGC 3′
Forward: 5′ GCCGTGCTTTTCCTCCACCGCGAC 3′
Reverse: 5′ GTCGCGGTGGAGGAAAAGCACGGC 3′
Forward: 5′ CTTTTCAACCACCGCGACCTCGTG 3′
Reverse: 5′ CACGAGGTCGCGGTGGTTGAAAAG 3′
Forward: 5′ CTTTTCCACGCACGCGACCTCGTG 3′
Reverse: 5′ CACGAGGTCGCGTGCGTGGAAAAG 3′
Forward: 5′ CTTTTCCACCAACGCGACCTCGTG 3′
Reverse: 5′ CACGAGGTCGCGTTGGTGGAAAAG 3′
Forward: 5′ CTTTTCCACAACCGCGACCTCGTG 3′
Reverse: 5′ CACGAGGTCGCGGTTGTGGAAAAG 3′
Forward: 5′ CCACCGCGACCTCGTGTATGGGCC 3′
Reverse: 5′ GGCCCATACACGAGGTCGCGGTGG 3′
H113L
H113N
H114A
H114Q
H114N
K119Y
Double mutations
Flanking primers
Western blot analysis of pPROTA expressed enzymes
Forward: 5′ GgaattcACCAACCCCGTCGCGAC 3′
Reverse: 5′ CgaattcTCACCGCTCGAACCAGC 3′
The pPROTA expressed recombinant FucT enzymes were
separated on 12% Tris-glycine polyacrylamide gels, transferred to
nitrocellulose membranes, and probed as described previously
(Nguyen et al., 1998) to determine protein concentration of the
expressed enzyme. In all cases, protein quantitation from
western blot data for the purposes of specific activity determin-
ations was based on the amount of intact fusion protein
migrating between 70 and 80 kDa present in the expressed
protein bound to IgG-Agarose beads.
Mutagenic primers
H113N/H114N
Forward: 5′ CTTTTCAACAACCGCGACCTCGTG 3′
Reverse: 5′ CACGAGGTCGCGGTTGTTGAAAAG 3′
and nucleotides flanking the truncated form of each enzyme.
The reverse flanking primers contained nucleotides flanking
the C-terminal end of each enzyme, a STOP codon, and an
EcoR1 site for the H113N/H114N double mutant, or a SalI site
for the other single mutants. The SalI site was included in the
single-mutant constructs to provide flexibility in cloning into
an alternate pPROTA expression vector with a more diverse
polylinker, if needed. This site was not used.
In the first step, a specific mutation was introduced by using
a pair of mutagenic primers and a pair of opposite end flanking
primers. For the H114N mutant, for example, one PCR mixture
included the forward flanking primer and H114N reverse
primer to generate the N-terminal half of the mutated FucT-IV;
another PCR mixture included H114N forward and reverse
flanking primers to generate the C-terminal half of the mutated
FucT-IV. The PCR products were gel purified and used
together with only the flanking primers for the second-step
PCR mixture. The resulting PCR product for each FucT-IV
mutant was a 1053-bp DNA fragment encompassing the trun-
cated FucT-IV (Pro58 to Arg405) catalytic domain. These PCR
products were ligated into Invitrogen pCR2.1 TOPO vector for
amplification. The 1053-bp DNA fragments were excised with
EcoR1 and subcloned into pPROTA. The correct orientation
Acknowledgments
We thank Dr. Monica Palcic (University of Alberta, Canada)
for the 8-methoxycarbonylactyl glycosides for substrate
specificity studies, Ms. Stephanie Ho (San Francisco State
University) for her assistance in the western blot analyses of
pPROTA expressed enzymes, and Dr. Bruce Macher
(San Francisco State University) for critical reading of the
manuscript. This study was supported by research grant
CA70740 from the National Cancer Institute to E.H.H.
Abbreviations
FucT, fucosyltransferase; PBS, phosphate buffered saline;
PCR, polymerase chain reaction.
References
Alhadeff, J.A. (1989) Malignant cell glycoproteins and glycolipids. CRC Crit.
Rev. ncol./Hematol., 9, 37–107.
604

A highly conserved His-His motif in α1→3/4FucTs
Amado, M., Almeida, R., Scheientek, T., and Clausen, H. (1999) Identification
and characterization of large galactosyltransferase gene families: galacto-
syltransferases for all functions. Biochim. Biophys. Acta, 1473, 35–53.
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G.,
Smith, J.A., and Struhl, K. (eds.) (1993) Current protocols in molecular
biology. Wiley, New York
Britten, C.J. and Bird, M.I. (1997) Chemical modification of an α3-fucosyl-
transferase. Definition of amino acid residues essential for enzyme activity.
Biochim. Biophys. Acta, 1334, 57–64.
Costache, M., Apoil, P.A., Cailleau, A., Elmgren, A., Larson, G., Henry, S.,
Blancher, A., Iordachescu, D., Oriol, R., and Mollicone, R. (1997)
Evolution of fucosyltransferase genes in vertebrates. J. Biol. Chem., 272,
29721–29728.
DeBose-Boyd, R.A., Nyame, A.K., and Cummings, R.D. (1998) Molecular
cloning and characterization of an α1, 3-fucosyltransferase, CEFT-1, from
Caenorhabditis elegans. Glycobiology, 8, 905–917.
De Vries, T., Srnka, C.A., Palcic, M.M., Swiedler, S.L., van den Eijnden, D.H.,
and Macher, B.A. (1995) Acceptor specificity of different length constructs of
α1, 3/4fucosyltransferases. Replacement if the stem region and the trans-
membrane domain if fucosyltransferase V by protein A results in an
enzyme with GDP-fucose hydrolyzing activity. J. Biol. Chem., 270, 8712–8722.
Dupuy, F., Petit, J.M., Mollicone, R., Oriol, R., Julien, R., and Maftah, A.
(1999) A single amino acid in the hypervariable stem domain of vertebrate
Lee, K.P., Carlsom, L.M., Woodcock, J.B., Ramachandra, N., Schultz, T.L.,
Davis, T.A., Lowe, J.B., Thompson, C.B., and Larsen, R.D. (1996) Molecular
cloning and characterization of CFT1, a developmentally regulated avian
α1, 3-fucosyltransferase gene. J. Biol. Chem., 271, 32960–32967.
Legault, D.J., Kelly, R.J., Natsuka, Y., and Lowe, J.B. (1995) Human α1, 3/4-
fucosyltransferases discriminate between different oligosaccharide acceptor
substrates through a discrete peptide fragment. J. Biol. Chem., 270,
20987–20996.
Leiter, H., Mucha, J., Staudacher, E., Grimm, R., Glossl, J., and Altmann, F.
(1999) Purification, cDNA cloning, and expression of GDP-L-Fuc:Asn-
linked GlcNAc α1, 3-fucosyltransferase from mung beans. J. Biol. Chem.,
274, 21830–21839.
Listinsky, J.J., Siegal, G.P., and Listinsky, C.M. (1998) α-L-fucose: a poten-
tially critical molecule in pathologic processes including neoplasia. Am. J.
Clin. Pathol., 110, 425–440.
McEver, R.P. (1997) Selectin-carbohydrate interactions during inflammation
and metastasis. Glycoconj. J., 14, 585–591.
Natsuka, S. and Lowe, J.B. (1994) Enzymes involved in mammalian oligo-
saccharide biosynthesis. Curr. Opin. Struct. Biol., 4, 683–691.
Natsuka, S., Gersten, K.M., Zenita, K., Kannagi, R., and Lowe, J.B. (1994)
Molecular cloning of a cDNA encoding a novel human leukocyte α1,
3fucosyltransferase capable of synthesizing the sialyl Lewis x determinant.
J. Biol. Chem., 269, 16789–16794.
α1, 3/4-fucosyltransferases determines the type 1/type
2 transfer:
Nguyen, A.T., Holmes, E.H., Whitaker, J.M., Ho, S., Shetterly, S., and
Macher, B.A. (1998) Human α1→3fucosyltransferases: I. Identification of
amino acids involved in acceptor substrate binding by site-directed muta-
genesis. J. Biol. Chem., 273, 25244–25249.
Nishihara, S., Iwasaki, H., Kaneko, M., Tawada, A., Ito, M., and Narimatsu, H.
(1999) α1, 3-Fucosyltransferase 9 (FUT9; Fuc-TIX) preferentially fuco-
sylates the distal GlcNAc residue of polylactosamine chain while the other
four α1, 3FUT members preferentially fucosylate the inner GlcNAc
residue. FEBS Lett., 462, 289–294.
characterization of acceptor substrate specificity of the Lewis enzyme by
site-directed mutagenesis. J. Biol. Chem., 274, 12257–12262.
Gersten, K.M., Natsuka, S., Trinchera, M., Petryniak, B., Kelly, R.J.,
Hiraiwa, N., Jenkins, N.A., Gilbert, D.J., Copeland, N.G., and Lowe, J.B.
(1995) Molecular cloning, expression, chromosomal assignment, and tissue
specific expression of a murine α1, 3-fucosyltransferase locus correspond-
ing to the human ELAM-1 ligand fucosyltransferase. J. Biol. Chem., 270,
25047–25056.
Goelz, S.E., Hession, C., Goff, D., Griffiths, B., Tizard, R., Newman, B.,
Chi-Rosso, G., and Lobb, R. (1990) ELFT: a gene that directs the expression
of an ELAM-1 ligand. Cell, 63, 1349–1356.
Oriol, R., Mollicone, R., Cailleau, A., Balanzino, L., and Breton, C. (1999)
Divergent evolution of fucosyltransferase genes from vertebrates, inverte-
brates, and bacteria. Glycobiology, 9, 323–334.
Hakomori, S. (1989) Aberrant glycosylation in tumors and tumor-associated
carbohydrate antigens. Adv. Cancer Res., 52, 257–331.
Henion, T.R., Macher, B.A., Anaraki, F., and Galili, U. (1994) Defining the
minimal size of catalytically active primate α1, 3galactosyltransferase:
structure-function studies on the recombinant truncated enzyme. Glycobiology,
4, 193–201.
Higuchi, R. (1990) Recombinant PCR. In: PCR protocols: a guide to methods
and applications. Academic Press, New York, pp. 177–183.
Holmes, E.H., Xu, Z., Sherwood, A.L., and Macher, B.A. (1995) Structure-
function analysis of human α1, 2fucosyltransferases: a GDP-fucose- protected,
N-ethylmaleimide-sensitive site in FucT-III and FucT-V corresponds to
Ser 178 in FucT-IV. J. Biol. Chem., 270, 8145–8151.
Holmes, E.H., Yen, T.Y., Thomas, S., Joshi, R., Nguyen, A., Long, T.,
Julien, R., Gallet, F., Maftah, A., and Macher, B.A. (2000) Human α1,
3/4-fucosyltransferases: II. Characterization of highly conserved
cysteine residues and N-linked glycosylation sites. J. Biol. Chem., 275,
24237–24245.
Kageyama, N., Natsuka, S., and Hase, S. (1999) Molecular cloning and
characterization of two zebrafish α1, 3-fucosyltransferase genes develop-
mentally regulated in embryogenesis. J. Biochem., 125, 838–845.
Kaneko, M., Kudo, T., Iwasaki, H., Ikehara, Y., Nishihara, S., Nakagawa, S.,
Sasaki, K., Shiina, T., Inoko, H., Saitou, N., and Narimatsu, H. (1999) α1,
3-Fucosyltransferase IX (Fuc-TIX) is very highly conserved between
human and mouse. Molecular cloning, characterization and tissue distribu-
tion of human Fuc-TIX. FEBS Lett., 452, 237–242.
Kapitonov, D. and Yu, R.K. (1999) Conserved domains of glycosyltransferses.
Glycobiology, 9, 961–978.
Koszdin, K.L. and Bowen, B.R. (1992) The cloning and expression of a human
α1, 3fucosyltransferase capable of forming the E-selectin ligand. Biochem.
Biophys. Res. Commun., 187, 152–157.
Kudo, T., Ikehara, Y., Togayachi, A., Kaneko, M., Hiraga, T., Sasaki, K., and
Narimatsu, H. (1998) Expression cloning and characterization of a novel
murine α1, 3-fucosyltransferase, mFuc-TIX, that synthesizes the Lewis x
(CD15) epitope in brain and kidney. J. Biol. Chem., 273, 26729–26738.
Kukowska-Latallo, J., Larsen, R.D., Nair, R.P., and Lowe, J.B. (1990) A
cloned human cDNA determines expression of a mouse stage-specific
embryonic antigen and the Lewis blood group α1, 3/4-fucosyltransferase.
Genes Dev., 4, 1288–1303.
Oulmouden, A., Wierinckx, A., Petit, J.M., Costache, M., Palcic, M.M.,
Mollicone, R., Oriol, R., and Julien, R. (1997) Molecular cloning and
expression of a bovine α1, 3-fucosyltransferase gene homologous to a
putative ancestor gene of the human FUT3-FUT5-FUT6 cluster. J. Biol.
Chem., 272, 8764–8773.
Ozawa, M. and Muramatsu, T. (1996) Molecular cloning and expression of a
mouse α1, 3-fucosyltransferase gene that shows homology with the human
α1, 3-fucosyltransferase IV gene. J. Biochem., 119, 302–308.
Palcic, M.M., Heerze, L.D., Pierce, M., and Hindsgaul, O. (1988) The use of
hydrophobic synthetic glycosides as acceptors in glycosyltransferase
assays. Glycoconj. J., 5, 49–63.
Rasko, D.A., Wang, G., Palcic, M.M., and Taylor, D.E. (2000) Cloning and
characterization of the α1, 3/4-fucosyltransferase of Helicobacter pylori.
J. Biol. Chem., 275, 4988–4994.
Renkonen, R., Mattila, P., Majuri, M.L., Räbinä, J., Toppila, S., Renkonen, J.,
Hirvas, L., Niittymäki, J., Turunen, J.P., Renkonen, O., and Paavonen, T.
(1997) In vitro experimental studies of sialyl Lewis x and sialyl Lewis a on
endothelial and carcinoma cells: crucial glycans on selectin ligands. Glyco-
conj. J., 14, 593–600.
Sajdel-Sulkowska, E.M., Smith, F.I., Wiederschain, G., and McLuer, R.H.
(1997) Cloning of a rat α1, 3-fucosyltransferase gene: A member of the
fucosyltransferase IV family. Glycoconj. J., 14, 249–258.
Sanders, D.S. and Kerr, M.A. (1999) Lewis blood group and CEA related anti-
gens; coexpressed cell–cell adhesion molecules with roles in the biological
progression and dissemination of tumours. Mol. Pathol., 52, 174–178.
Sasaki, K., Kurata, K., Funayama, K., Nagata, M., Watanabe, E., Ohta, S.,
Hanai, N., and Nishi, T. (1994) Expression cloning of a novel α1,
3fucosyltransferase that is involved in biosynthesis of the sialyl Lewis x
determinant in leukocytes. J. Biol. Chem., 269, 14730–14737.
Sherwood, A.L., Nguyen, A.T., Whitaker, J.M., Macher, B.A., Stroud, M.R.,
and Holmes, E.H. (1998) Human α1→3fucosyltransferases: III. A Lys/Arg
residue located within the α1→3FucT motif is required for activity but not
substrate binding. J. Biol. Chem., 273, 25256–25260.
Sherwood, A.L., Davis, W.C., Ho, S., Macher, B.A., Stroud, M.R., Upchurch,
D.A., and Holmes, E.H. (2000) A GDP-fucose protected, pyridoxal-5′-
phosphate/NaBH4 sensitive Lys residue common to human FucT’s
corresponds to Lys300 in FucT-IV. Biochem. Biophys. Res. Commun., 273,
870–876
605

A.L. Sherwood et al.
Smith, P.L., Gersten, K.M., Petryniak, B., Kelly, R.J., Rogers, C., Natsuka, Y.,
Alford, J.A., Scheidegger, E.P., Natsuka, S., and Lowe, J.B. (1996)
Expression of the α1, 3-fucosyltransferase Fuc-TVII in lymphoid
aggregate high endothelial venules correlates with expression of L-selectin
ligands. J. Biol. Chem., 271, 8250–8259.
Trottein, F., Mollicone, R., Fontaine, J., de Mendonca, R., Piller, F., Pierce, R.,
Oriol, R., and Capron, M. (2000) Molecular cloning of a putative α3-fucosyl-
transferase from Schistosoma mansoni. Mol. Biochem. Parisitol., 107,
279–287
Weston, B.W., Nair, R.P., Larsen, R.D., and Lowe, J.B. (1992a) Isolation of a
novel human α1, 3- fucosyltransferase gene and molecular comparison to
the human Lewis blood group α1, 3/4-fucosyltransferase gene. Syntenic,
homologous, nonallelic genes encoding enzymes with distinct acceptor
substrate specificities. J. Biol. Chem., 267, 4152–4160.
Weston, B.W., Smith, P.L., Kelly, R.J., and Lowe, J.B. (1992b) Molecular
cloning of a fourth member of a human α1, 3fucosyltransferase gene family.
Multiple homologous sequences that determine expression of the Lewis
x, sialyl Lewis x and difucosyl sialyl Lewis x epitopes. J. Biol. Chem., 267,
24575–24584.
Vo, L., Lee, S., Marcinko, M.C., Holmes, E.H., and Macher, B.A. (1998)
Human α1→3fucosyltransferases: II. A single amino acid at the COOH
terminus of FucT-III and -V alters their kinetic properties. J. Biol. Chem.,
273, 25250–25255.
Zhang, A., Potvin, B., Zaiman, A., Chen, W., Kumar, R., Phillips, L., and
Stanley, P. (1999) The gain-of-function chinese hamster ovary mutant
LEC11B expresses one of two chinese hamster FUT6 genes due to the loss
of a negative regulatory factor. J. Biol. Chem., 274, 10439–10450.
606