FM19G11, a new hypoxia-inducible factor (HIF) modulator, affects stem cell differentiation status

Article abstract of DOI:10.1074/jbc.M109.008326

The biology of the a subunits of hypoxia-inducible factors (HIFα) has expanded from their role in angiogenesis to their current position in the self-renewal and differentiation of stem cells. The results reported in this article show the discovery of FM19G11, a novel chemical entity that inhibits HIFα proteins that repress target genes of the two α subunits, in various tumor cell lines as well as in adult and embryonic stem cell models from rodents and humans, respectively. FM19G11 inhibits at nanomolar range the transcriptional and protein expression of Oct4, Sox2, Nanog, and Tgf-α undifferentiating factors, in adult rat and human embryonic stem cells, FM19G11 activity occurs in ependymal progenitor stem cells from rats (epSPC), a cell model reported for spinal cord regeneration, which allows the progression of oligodendrocyte cell differentiation in a hypoxic environment, has created interest in its characterization for pharmacological research. Experiments using small interfering RNA showed a significant depletion in Sox2 protein only in the case of HIF2α silencing, but not in HIF1α-mediated ablation. Moreover, chromatin immunoprecipitation data, together with the significant presence of functional hypoxia response element consensus sequences in the promoter region of Sox2, strongly validated that this factor behaves as a target gene of HIF2α in epSPCs. FM19G11 causes a reduction of overall histone acetylation with significant repression of p300, a histone acetyltransferase required as a co-factor for HIF-transcription activation. Arrays carried out in the presence and absence of the inhibitor showed the predominant involvement of epigenetic-associated events mediated by the drug.

Full text of DOI:10.1074/jbc.M109.008326

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 2, pp. 1333–1342, January 8, 2010
© 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
FM19G11, a New Hypoxia-inducible Factor (HIF) Modulator,
□
S
Affects Stem Cell Differentiation Status*
Received for publication, April 28, 2009, and in revised form, October 13, 2009 Published, JBC Papers in Press, November 6, 2009, DOI 10.1074/jbc.M109.008326
Victoria Moreno-Manzano‡1, Francisco J. Rodríguez-Jime´nez‡1, Jose L. Acen˜a-Bonilla‡, Santos Fustero-Lardíes‡§,
Slaven Erceg‡, Joaquin Dopazo‡, David Montaner‡, Miodrag Stojkovic‡, and Jose M. Sa´nchez-Puelles‡¶2
From the ‡F.V. Centro de Investigacio´n Príncipe Felipe, E-46012 Valencia, the §Universidad de Valencia, E-46071 Valencia, and the
¶Centro de Investigaciones Biolo´gicas, CSIC, E-28040 Madrid, Spain
The biology of the ␣ subunits of hypoxia-inducible factors
(HIF␣) has expanded from their role in angiogenesis to their
current position in the self-renewal and differentiation of
stem cells. The results reported in this article show the dis-
covery of FM19G11, a novel chemical entity that inhibits
HIF␣ proteins that repress target genes of the two ␣ subunits,
in various tumor cell lines as well as in adult and embryonic
stem cell models from rodents and humans, respectively.
FM19G11 inhibits at nanomolar range the transcriptional
and protein expression of Oct4, Sox2, Nanog, and Tgf-␣
undifferentiating factors, in adult rat and human embryonic
stem cells, FM19G11 activity occurs in ependymal progenitor
stem cells from rats (epSPC), a cell model reported for spinal
cord regeneration, which allows the progression of oligoden-
drocyte cell differentiation in a hypoxic environment, has
created interest in its characterization for pharmacological
research. Experiments using small interfering RNA showed a
significant depletion in Sox2 protein only in the case of
HIF2␣ silencing, but not in HIF1␣-mediated ablation. More-
over, chromatin immunoprecipitation data, together with the
significant presence of functional hypoxia response element
consensus sequences in the promoter region of Sox2, strongly
validated that this factor behaves as a target gene of HIF2␣ in
epSPCs. FM19G11 causes a reduction of overall histone
acetylation with significant repression of p300, a histone
acetyltransferase required as a co-factor for HIF-transcrip-
tion activation. Arrays carried out in the presence and
absence of the inhibitor showed the predominant involve-
ment of epigenetic-associated events mediated by the drug.
regulators of cell reaction to the lack of cell oxygen. They are
widely referred to, in the context of pathological processes of
cancer, inflammation, cardiovascular, and neurodegenerative
diseases and, in general, all the angiogenic pathologies
(reviewed in Refs. 1–4). More recently, HIF biology has pro-
gressed due to its interactions with cell pathways that regulate
stem cell self-renewal and differentiation, suggesting a new
mechanism whereby HIF proteins may drive tumor growth
through the generation of tumor-initiating cells or cancer stem
cells (5, 6). HIF␣ proteins, a hallmark of different tumor types,
were the focus of many drug discovery efforts, but most inhib-
itors did not comply with the pharmacological properties
required for approval of the drug by the regulatory agencies.
Thus, even after more than 20 years of research, there is still
room for intervention with novel small molecules that modu-
late HIF. Strategies for HIF inhibitors include the wide area of
angiogenic pathologies and, within the field of regenerative
medicine, promising treatments for degenerative diseases
and/or the pre-conditioning of the stem cells used for cell trans-
plantation therapies.
HIF is a heterodimer consisting of an oxygen-regulated ␣
subunit (1␣, 2␣, or 3␣) and a constitutively expressed ␤ subunit,
or ARNT. HIF proteins are members of the basic helix loop
helix-PAS family and bind to canonical DNA sequences
(hypoxia-regulated elements or HREs) in the promoters or
enhancers of target genes. Despite the existing similarities, ␣
subunits trigger overlapping and specific genes and are there-
fore involved in different molecular pathways with different
physiological consequences for the cells with non-redundant or
compensatory function (7–9). Briefly, HIF1␣, but not HIF2␣,
induces genes involved in the glycolysis process (10), whereas
HIF2␣ regulates the angiogenic route, even in the absence of
hypoxia (11). HIF2␣ is also seen as the physiological regulator
of Epo production in adult mice (12). HIF3␣, however, forms an
abortive transcriptional complex with HIF-2␣ and prevents the
engagement of HIF-2 with the HREs acting as negative feed-
back regulators (13). HIF activity is mainly regulated at the pro-
tein level, due to the hydroxylation of key proline residues pres-
ent in the oxygen-dependent degradation domain of the ␣
subunits by the prolyl-hydroxylases (PHDs) triggering poly-
ubiquitination and rapid degradation of the HIF␣ proteins
Hypoxia-inducible transcription factors (HIFs)3 have been
the subject of numerous research studies, as they are the key
* This work was supported by the Fondo de Investigaciones Sanitarias, the
Instituto de Salud Carlos III (Spain), the Ministerio de Educacio´n, Ciencia y
Tecnología, and Generalitat Valenciana (Spain) Projects PI051973 RD06/
0010/1006, SAF2007-63714, and GVRE/2008/254.
□
S
The on-line version of this article (available at http://www.jbc.org) contains
supplemental Figs. S1–S3, Tables S1–S3, and data I and II.
1 Both authors contributed equally to this study.
2 To whom correspondence should be addressed: Centro de Investigaciones
Biolo´gicas, CSIC, 28040 Madrid, Spain. Tel.: 348373112; Fax: 34915360432;
E-mail: jmspuelles@cib.csic.es.
3 The abbreviations used are: HIF, hypoxia-inducible transcription factors; HRE,
hypoxia-responsiveelement;PHD,prolyl-hydroxylase;ChIP,chromatinimmu-
noprecipitation; RLU, relative luciferase unit; CRE, cAMP-response element;
GO, gene ontology; AcH3, histone 3-acetylated form; DMSO, dimethyl sulfox-
ide; epSPC, ependymal progenitor stem cell; SCI, spinal cord injury; EGF, epi-
dermal growth factor; hESC, human embryonic stem cell; GAPDH, glyceralde-
hyde-3-phosphate dehydrogenase; siRNA, small interfering RNA; TRE, 12-O-
tetradecanoylphorbol-13-acetate-responsive element; GFAP, glial fibrillary
acidic protein.
JANUARY 8, 2010•VOLUME 285•NUMBER 2
JOURNAL OF BIOLOGICAL CHEMISTRY 1333

Sox2, a New Target Gene of HIF2␣
through an E3 ubiquitin ligase complex (14). Depletion of oxy- upstream of start codon (pGL3-mpSox2). The in silico search of
gen prevents destruction, leading to stabilized ␣ proteins that HRE sequences in the mouse sequence showed the presence of
interact with ARNT in the nucleus, recognize the HRE two sites, Ϫ725 and Ϫ1320, and both were point-mutated by
sequences in the DNA, and activate the transcription mediated PCR (mpSox2⌬) using the following primers: Ϫ1320 HRE FW:
by the p300ꢀCBP complexes.
CCTATTTGTAACGGAAATGGGGCTGTGGCTC, RV_5Ј-
Ϫ725
HIF␣ proteins affect self-renewal and differentiation pro- GAGCCACAGCCCCATTTCCGTTACAAATAGG;
cesses of stem cells by specific regulation of relevant genes and HRE FW_5Ј-GAATTAGGGGTTGAGGACAAATGCTGCG-
the key transcription factors involved in these processes. It is GTTCCTTGAGC and RV_GCTCAAGGAACCGCAGCAT-
now known that lowered oxygen concentration enhances neu- TTGTCCTCAACCCCTAATTC.
rogenesis and delays certain differentiation processes (15, 16).
Luciferase Reporter Activity Assays—105 HEK293T, HeLa-
For instance, HIF1␣ interacts with Notch1 to maintain undif- 9x, 293-TRE, or 293-CRE cells per well were seeded onto white
ferentiated cell states (5), whereas HIF2␣ binds to the marker of 96-well plates in quadruplicate 24 h prior to assay. For transient
the undifferentiated state Oct4 promoter, inducing its expres- overexpression, 0.05 ␮g/well in 96-well plates of each plasmid,
sion and transcriptional activity (8). Sox2 controls pluripotency ATF2, JunB, c-JUN, c-FOS, PGL3-basic, pGL3-mpSox2, pGL3,
by direct modulation of Oct4 levels in embryonic stem cells of and mpSox2⌬ were transfected with FuGENE6 HD (3:6) 24 h
mice (17, 18). Recent articles have shown how pluripotency can before stimulation. Serial dilutions of FM19G11 from 0 (con-
be acquired through only a few genetic modifications. Interest- taining DMSO as a control) up to 1 ␮M were added immediately
ingly, the experiments of Takahashi et al. (19, 20) showed that before hypoxic stimulation in 1% O2 atmospheres created by
somatic cells can be reprogrammed into pluripotent stem cells the In vivo2 400 chamber (Ruskinn Life Sciences). 6 h after stim-
by transduction of four defined transcription factors, c-MYC, ulation, luciferase activity was quantified by addition of an
KLF4, SOX2, and OCT4, two of which (OCT4 and c-MYC) are equal volume of Bright-Glo Luciferase Reagent (Promega) and
directly activated by HIF2␣ (8, 21).
detected in the VICTOR3 luminometer (PerkinElmer Life
One of the most challenging objectives in cell therapy is to Sciences).
restore neurological function after spinal cord injury (SCI).
Cytotoxicity Assay—Cell viability was measured by following
After SCI, there is a significant cell proliferation of ependymal- the CellTiter 96ꢁ Aqueous Non-radioactive Cell Proliferation
derived stem/progenitor cells (epSPC) (22). It is possible to Assay instructions (Promega). 5 ϫ 104 HeLa cells per well were
restore locomotor activity when epSPC, activated by the seeded onto 96-well plates 24 h before assay. Serial dilutions of
injured tissue (epSPCi), are ectopically transplanted (23). Alter- FM19G11 from 0 (containing DMSO as a control) up to 100 ␮M
ing the fate of engrafted or endogenous epSPCi, to restrict dif- were used to stimulate the cells for 72 h under standard oxygen
ferentiation to oligodendrocytes or a neuronal lineage, would conditions (ϳ20% O2) or hypoxic atmosphere (1% O2).
replace the loss of functional units and would delay the demy-
Chemical Synthesis of FM19G11—The detailed protocols for
elination process (23). In the present study, we identified and the synthesis of FM19G11 and its precursors are included in
characterized a new chemical entity, FM19G11, which inhibits supplemental data I.
the expression and transcriptional activity of HIF␣ isoforms
Ependymal/Progenitor Cell Isolation and Culture—epSPC
and their corresponding target genes, including the HIF2␣-me- were harvested from adult female Sprague-Dawley rats (ϳ200
diated regulation of Sox2, newly characterized here. The spe- g), isolated, and cultured as described elsewhere (23).
cific inhibition of HIF␣ proteins by FM19G11 reduces the tran-
Oligodendrocyte-directed Differentiation—Differentiation
scriptional activation of the expression of pluripotency markers was performed as previously described (23). Briefly, epSPCs
Sox2 and Oct4 and the corresponding target genes Tgf-␣ and were cultured with glial restriction medium: Dulbecco’s modi-
Nanog in epSPC, thus driving cell differentiation to oligoden- fied Eagle’s medium, F-12, B27 supplement (Invitrogen), 25
drocytes in a process that may favor the design of pharmaco- ␮g/ml of insulin, 6.3 ng/ml of progesterone, 10 ␮g/ml of putres-
logical strategies for spinal cord regeneration.
cine, 50 ng/ml of sodium selenite, 50 ␮g/ml of holotransferrin,
40 ng/ml of tri-iodothyroidin, supplemented with 4 ng/ml of
basic fibroblast growth factor and 10 ng/ml of EGF (Sigma) for
EXPERIMENTAL PROCEDURES
Plasmids and Treatments—The plasmid 9x-HRE-Luc with a 1 day. Subsequently, cells were incubated with 20 ng/ml of EGF
luciferase reporter gene was kindly provided by Dr. M. O. and 10 ␮M of all-trans-retinoic acid for 1 week. All-trans-reti-
Landazuri. This plasmid containing the neomycin resistance noic acid was then removed and the cells were exposed to glial
gene was used to generate a stably transduced HeLa cell line restriction medium supplemented with 20 ng/ml of EGF for 25
(HeLa-9x). Plasmids pCMV-TRE (12-O-tetradecanoylphor- days. At day 28, the spheres were plated in Petri dishes coated
bol-13-acetate-responsive element) and pGL2-CRE containing with 1:30 Matrigel for 1 week and cultured on glial restriction
a firefly luciferase gene, and the plasmids containing the cDNAs medium supplemented with 20 ng/ml of EGF. For terminal dif-
of ATF2, JunB, c-FOS, and c-JUN, kindly provided by Dr. R. ferentiation, at day 35, oligodendrocyte precursor cells were
Farra´s, were used for stable and transient transfection in the seeded on poly-L-lysine and human laminin (Sigma)-coated
HEK293T cell line (the 293-TRE and 293-CRE cell lines were slides. At days 0 and 35, the cells were incubated under hypoxic
created).
conditions (1% O2) in the In vivo2 400 chamber (Ruskinn Life
For Sox2 promoter transcriptional activity analysis, a Sciences) for 72 h with 500 nM FM19G11 or its DMSO vehicle
reporter construct was created in pGL3-basic, including the as control. Then, the cells were harvested for total RNA or
region of the mouse Sox2 promoter sequence Ϫ392/Ϫ1725 immunocytochemical staining.
1334 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 2•JANUARY 8, 2010

Sox2, a New Target Gene of HIF2␣
hESC Culture—Primary human embryonic stem cell (hESC)
colonies from the H9 line (WiCell Inc., Madison, WI) were
cultured as described elsewhere (24). Briefly, hESC were
mechanically dispersed into several small clumps and cultured
on fresh, commercially available human foreskin fibroblasts
(American Type Culture Collection, Manassas, VA), inacti-
vated by mitomycin C in ES medium containing knock-out
Dulbecco’s modified Eagle’s medium, 1 mM L-glutamine, 100
mM non-essential amino acids, 20% serum replacement, 1%
penicillin/streptomycin, 8 ng/ml of basic fibroblast growth fac-
tor (Invitrogen), and 100 mM ␤-mercaptoethanol (Sigma). ES
medium was changed every second day. Human embryonic
stem cells were passaged by mechanical dissociation and then
removed to a freshly prepared human foreskin fibroblast layer.
RNA Isolation, Semi- and Quantitative Reverse Tran-
scription-PCR—One microgram of total RNA, extracted by
using the RNeasy Mini-kit (Qiagen, Germany), was reverse
transcribed in a total reaction volume of 50 ␮l by means of
incubation at 42 °C for 30 min using random hexamer primers.
The primer sequences for semiquantitative PCR are detailed in
supplemental data II. The target gene value was normalized to
the expression of an endogenous reference (GAPDH).
RNA Interference by Small Interfering RNA (siRNA) Duplex
Transfection for HIF1␣ and HIF2␣—Annealed siRNA duplexes
were purchased from Applied Biosystems. The siRNA
sequences targeting rat HIF1␣ (accession number
NM_0243591.1) and HIF2␣ (accession number NM_023090.1)
corresponded to catalog numbers 4390816_s131713 and
4390816_s131443, respectively (Applied Biosystems). 500 nM
siRNA were used for transfection.
ChIP Analysis—Chromatin immunoprecipitation analysis
used the LowCell ChIP kit (Diagenode), following the manufac-
turer’s instructions, as described elsewhere (27). Samples were
incubated with 10 ␮g of anti-HIF2␣ or AcH3 antibodies
(Abcam). An isotype-matched antibody was used as control for
nonspecific binding. The rat Sox2 promoter region was ana-
lyzed in silico using the Genomatix bioinformatics software
portal.
Statistical Analysis—Statistical comparisons were assessed
by the Student’s t test. All p values were derived from a two-
tailed statistical test using the SPSS 11.5 software. A p value
Ͻ0.05 was considered statistically significant.
RESULTS
FM19G11, a New HIF␣ Inhibitor—To identify novel mole-
cules targeting the HIF pathway, we used a stable luciferase
reporter gene-based screen containing 9 repetitions of the HRE
5Ј upstream of the start codon in the active promoter region
constitutively expressed in the HeLa cell line (HeLa-9x-HRE-
Luc). These cells displayed more than 100-fold higher luciferase
activity after incubation in hypoxia (1% O2). We tested the
HeLa-9x-HRE-Luc screen against a compound bank, contain-
ing more than 12,000 compounds, chosen as representatives of
the total chemical space. FM19G11 reduced hypoxia-induced
luciferase activity by 50% (IC50) at 80 Ϯ 5 nM concentration
(Fig. 1A, inset). FM19G11 showed significant relative luciferase
unit (RLU) inhibition from 30 nM, with steady reduction in a
characteristic dose-dependent manner (Fig. 1A) and reaching
80% inhibition at 1 ␮M (Fig. 1B). To test the specificity of
FM19G11 for HRE binding sites, we reproduced the luciferase-
reporter gene assay by stable overexpression of CRE or TRE
reporter constructs. ATF2 and JunB transient overexpression
was used to induce CRE-mediated reporter gene activity, and
c-fos and c-jun overexpression, for TRE induction (Fig. 1B,
inset). No significant RLU inhibition of TRE or CRE transcrip-
tional activity was found in the presence of any tested concen-
tration of FM19G11 (Fig. 1B). It is worth mentioning that no
cytotoxicity for concentrations of FM19G11 lower than 30 ␮M,
in standard oxygen tension, or 50 ␮M, under hypoxic condi-
tions, was observed on the HeLa cell line (supplemental Fig. S1).
Chemical Synthesis of FM19G11—The FM19G11 compound
was chemically re-synthesized for extensive evaluation. As
shown in Fig. 1C, reaction of 2,4-dinitrobenzoic acid with
methyl 3-aminobenzoate was followed by methyl ester hydro-
lysis and coupling with (bromomethyl)p-tolylketone to afford
the target compound. FM19G11 was purified by flash column
chromatography.
For quantitative PCR, mRNAs were amplified and quantified
by SYBR Green or TaqMan probes (Applied Biosystems) (sup-
plemental data II). As template, 40 ng of cDNA from the target
and housekeeping gene (GAPDH) were prepared in separate
tubes for each primer master mixture reaction. The compara-
tive threshold cycle (CT) method was used to calculate the rel-
ative expression (25).
DNA Microarray Analysis—epSPC isolation and DNA
microarray hybridization was performed as described else-
where (23). The gene profile was sorted by differential expres-
sion levels between the two experimental conditions (epSPC
48 h in hypoxia with FM19G11 versus DMSO) and clustered
into biological functional profiles by FatiGO application (26).
Western Blot Analysis—Cells were collected and washed with
cold phosphate-buffered saline. Total cell protein extracts were
isolated by use of 2% SDS Tris-Cl lysis buffer plus proteinase
inhibitors. Subcellular fractionation was performed in two
steps, by using hypotonic and hypertonic buffers for cytoplasm
and nuclear fraction isolation, respectively. SDS-PAGE and
hybridization steps were carried out as previously described
(23), with antibodies against HIF1␣ (a kind gift from Dr. Berra),
HIF2␣, PHD3, Sox2, Oct4, Notch1 (Abcam, UK), RIP, NG2,
Nestin, and glial fibrillary acidic protein (GFAP) (Chemicon) at
1:1000 dilution. ␤-Actin at 1:5000 dilution (Sigma) was used as
loading control. The resulting bands were densitometrically
analyzed by ImageJ software.
Immunocytochemistry—Fixed and permeabilized cells
(0.05% Triton X-100), after blocking (1% fetal bovine serum),
were incubated overnight at 4 °C with the primary mouse anti-
bodies (1:200), ␣-RIP, ␣-O4 (Chemicon), ␣-HIF-1␣ (BD Bio-
science), and rabbit antibodies, ␣-NG2 (Chemicon) and ␣-Sox2
(Abcam). For detection, Texas Red dye-conjugated goat anti-
rabbit IgG (Jackson ImmunoResearch Laboratories) and Ore-
gon Green 488 goat anti-mouse IgG at 1:400 (Invitrogen) were
used. Signals were viewed by confocal microscopy (Leica).
FM19G11 Inhibits HIF␣ Proteins in Human Tumor Cell
Lines—We evaluated the effect of FM19G11 on total protein
levels and on nuclear- and cytoplasm-fractionated extracts of
JANUARY 8, 2010•VOLUME 285•NUMBER 2
JOURNAL OF BIOLOGICAL CHEMISTRY 1335

Sox2, a New Target Gene of HIF2␣
HIF1␣ and -2␣ (Fig. 1, D and F), as
well as the effect on the expression
of their target genes PHD3 (Fig. 1D)
and VEGF (Fig. 1E) in the HeLa cell
line. Simultaneous incubation at
300 nM FM19G11 from 1 to 12 h of
hypoxia exposure (1% O2) pre-
vented HIF1␣ and HIF2␣ accumu-
lation (this effect was extended to
24 h for HIF1␣ accumulation).
Although most HIF␣ protein was
found in the nucleus in all cases, a
detectable amount of both isoforms
(1 and 2␣) was found in the cytosolic
fraction in the presence of
FM19G11 after 4 h of incubation at
1% O2. However, no significant
changes in the subcellular location
of HIF␣ proteins were observed at
any other tested time (Fig. 1F). The
prolyl hydroxylases (PHDs/EGLNs)
are the central regulators of the
molecular responses to oxygen
availability (28) and PHD3 is also
directly regulated by both ␣ pro-
teins (29). FM19G11 significantly
inhibited PHD3 protein levels (Fig.
1D). In addition, the hypoxic tran-
scriptional induction of VEGF, a
well known target gene of HIF␣ pro-
teins (30), was significantly blocked
by all tested doses of FM19G11 (Fig.
1E). Because the HIF promoter
region contains multiple HRE, indi-
cating a self-regulating mechanism
(31), we also analyzed both HIF␣
isoforms at the mRNA levels in the
presenceofFM19G11.Thehypoxia-
dependent induction of HIF1 and
2␣ mRNA was significantly lower in
the presence of FM19G11 after 6 h
of incubation (data not shown),
coinciding with the significant
reduction of the protein levels
induced by the compound. How-
ever, no significant changes in pro-
tein levels, in comparison with vehi-
cle-treated cells, were obtained at
shorter (1 or 3 h) or longer (9 or
12 h) hypoxic exposition times (data
not shown).
To investigate whether HIF1␣
protein inhibition by FM19G11 was
mediated by promoting the activa-
tion of the proteasomal system, we
performed an experiment in the
presence of the proteasomal inhibi-
tor MG132 in normoxia. Interest-
1336 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 2•JANUARY 8, 2010

Sox2, a New Target Gene of HIF2␣
from various tissue types, including
colon HT-29 and the breast cancer
cell line MDA-MB-435-S (data not
shown).
FM19G11 Inhibits HIF␣ Protein
Accumulation in Adult and Embry-
onic Stem Cells from Rodents and
Humans,
Respectively—Interest-
ingly, the compound FM19G11 had
a similar effect on HIF regulation in
stem cells. We analyzed the effect of
the compound on adult rat epSPC
and on hESC. Fig. 1G shows the
dose-dependent inhibitory effect of
FM19G11 on both HIF␣ proteins in
epSPC. Transcriptional repression
of Phd3 was also observed in the rat
epSPC (Fig. 1H) and hESC (data not
shown) treated with 500 nM
FM19G11 for 48 h under hypoxia.
FM19G11 Regulates Oct4 and Sox2
Pluripotency Markers—HIF2␣ tran-
scription factor directly regulates
the expression of Oct4, indicating a
function of this HIF protein in the
self-renewal and differentiation of
stem cell properties (8). We
observed by real time PCR that
FM19G11 abrogates the increment
associated with hypoxia of the tran-
scriptional expression of Oct4 in
both tested stem cell types, rat
epSPC (Fig. 2, A and B) and human
FIGURE 2. FM19G11 regulates Oct4 and Sox2 pluripotency markers in rodent and human stem cells.
epSPC (A and B) and hESC (C): A, upper panel: real time SYBR Green PCR analysis of rat Sox2 and Oct4 relative
expression levels. Lower panel, semi-quantitative PCR of Oct4, Sox2, and their direct target genes, Tgf␣ and
Nanog, respectively. Cells were incubated with 500 nM FM19G11 (ϩ) or its vehicle (Ϫ) for 48 h under hypoxia
(1% O2). 20% O2 was taken as the basal condition. GAPDH served as a loading control. B, left panels: represen-
tative Western blot (upper panels) and densitometry analysis of three independent experiments (lower panels).
FM19G11 dose-dependent effect on Oct4 and Sox2 protein expression after 48 h of hypoxia exposure. Values
are shown as a percentage of the control (20% O2). Right panels: representative immunostaining of the Sox2
protein in undifferentiated neurospheres treated for 48 h in 1% O2 with vehicle or 500 nM FM19G11. C, left
panel: TaqMan real time-PCR analysis of human Sox2 and Oct4 relative expression levels in hESC treated with ESC (Fig. 2C). In confirmation of
500 nM FM19G11 or its vehicle; right panel: qualitative immunostaining analysis of human Sox2 protein expres-
recently published results (32), this
sion in undifferentiated hESC colonies treated for 48 h in 1% O2 with DMSO (vehicle) or 500 nM FM19G11. 20%
O2 condition served as the basal control. Results were obtained from three independent experiments. Error
bars represent S.D. *, p Ͻ 0.05 versus 20% O2; §, p Ͻ 0.05 versus vehicle at 1% O2, determined by Student’s t test.
transcriptional inhibition of Oct4
by FM19G11 was observed in paral-
lel with the down-regulation in both
stem cell types of Sox2, another
important player in stemness maintenance (33) (Fig. 2). In addi-
tion, epSPC treated with FM19G11 under hypoxia showed
lower mRNA levels of Tgf-␣ and Nanog, target genes of Oct4
and Sox2, respectively (Fig. 2A, lower panel). The regulation of
ingly, MG132 did not affect any isoform, HIF1, or 2␣ accumu-
lation by FM19G11, suggesting a proteasome-independent
mechanism on HIF␣ inhibition (data not shown). The action of
FM19G11 on HIF␣ proteins was not restricted to HeLa cells,
because it was also observed in adult human cell lines derived
FIGURE 1. Synthesis and analysis of FM19G11 activity in HIF␣ proteins and their target genes under hypoxia. A, HeLa-9x-HRE-Luc cells treated with
different concentrations of FM19G11 (0–0.5 ␮M) were exposed to 1% O2 for 6 h. FM19G11 inhibits in a dose-responsive way the HIF-translational activity in the
luciferase reporter assay. Inset, calculation of IC50 by converting the RLU into % of RLU inhibition. B, 293-TRE or 293-CRE, transiently overexpressing c-fos and
c-jun or ATF2 and JunB, respectively, were treated with 0.3 ␮M FM19G11 for Western blot analysis (inset) or with 0–1 ␮M for 6 h in the luciferase reporter assay.
Luciferase activity in vehicle-treated cells was taken as 0% of inhibition. C, chemical synthesis of FM19G11 in three steps. The reaction of 2,4-dinitrobenzoic acid
with methyl 3-aminobenzoate was followed by methyl ester hydrolysis and coupling with (bromomethyl)p-tolylketone to form the target compound.
D, intracellular levels of HIF1 and -2␣ and PHD3 proteins were assayed after HeLa exposition to 1% O2 for 1–24 h with 300 nM FM19G11 (ϩ) or its vehicle (Ϫ).
24 h exposition at 20% O2 in the absence of FM19G11 (Ϫ) was taken as the basal condition. ␤-Actin served as loading control. The graphs represent the mean
of absolute densitometry values of each condition from three independent experiments. E, TaqManꢂ real time-PCR analysis of VEGF in HeLa cells treated for 6 h
with FM19G11 (0–300 nM) at 1 or 20% O2. F, left panel, representative example of nuclear (n) and cytoplasm (c) fractionated cell proteins assayed for HIF␣
protein expression. HeLa cells were treated with 300 nM FM19G11 (ϩ) or its vehicle (Ϫ) for 4–9 h at 1 or 20% O2. Right panel, immunostaining for HIF1␣ of HeLa
cells treated with FM19G11 or its vehicle (DMSO) under hypoxia for 6 h. G, epSPC, upper panel: representative experiment of the dose-response of FM19G11,
showing the effect on HIF␣ protein expression after 48 h in hypoxia (1% O2). Lower panel, mean of densitometry values of HIF␣ protein expression analysis.
Values are shown as a percentage of the control (20% O2). H, epSPC: TaqMan real time-PCR analysis of PHD3 relative expression levels with vehicle or FM19G11
(500 nM) treated for 48 h under normoxia (20% O2) or hypoxia (1% O2). Results were standardized by the housekeeping gene GAPDH. mRNA levels were
calculated by the 2⌬⌬C method. Results were obtained from three independent experiments. Error bars represent S.D. *, p Ͻ 0.05 versus 20% O2; §, p Ͻ 0.05
T
versus vehicle at 1% O2 determined by Student’s t test.
JANUARY 8, 2010•VOLUME 285•NUMBER 2
JOURNAL OF BIOLOGICAL CHEMISTRY 1337

Sox2, a New Target Gene of HIF2␣
the two proteins, Oct4 and Sox2,
by the compound showed
a
dose-dependent inhibitory pattern.
The time and dose-response exper-
iments carried out indicated that
the hypoxia-induced expression of
Oct4 and Sox2 was more efficiently
reduced at 500 nM FM19G11 after
48 h in 1% O2 (Fig. 2B, upper and left
panel). The immunocytochemical
studies confirmed the diminished
expression of Sox2 in cells treated
with FM19G11, with no apparent
alterations in protein location (Fig.
2, B and C) in relation to the
controls.
HIF2␣ Regulates Sox2 Expres-
sion—The role of Sox2 in pluripo-
tency is mostly based on its function
of maintaining Oct4 levels and the
consequent expression of many plu-
ripotency associated genes, e.g. Fgf4,
Lefty1, and Nanog, which are tightly
regulated by an enhancer contain-
ing Oct4 and Sox2 binding motifs
(18). Oct4 was reported to be a
direct target of HIF2␣ (8). Recently
McCord et al. (32), using the siRNA
approach, reported for the first time
experimental evidence indicating
that Sox2 have HIF-dependent reg-
ulation. Here, we validated these
results, by using specific siRNA oli-
gos, and the knockdown expression
of HIF2␣, but not of HIF1␣, which
blocks hypoxia-induced expression
of both Oct4 and Sox2 in epSPC
(Fig. 3A). These results strongly
indicate the direct involvement of
HIF2␣ in the positive regulation of
both pluripotency markers, Oct4
and Sox2. However, to provide
further and new data that may
indicate the direct connection
between HIF2␣ and Sox2 regula-
tion, we searched for putative
HRE-binding sequences within
the promoter region of the rodent
Sox2 gene. The in silico-predicted
occupancy of HIF for HRE binding
sites, over the 5-kb promoter
region immediately upstream of
the transcription start signal of
Sox2, was first analyzed by a
reporter-based screen including
the promoter sequence containing
two HRE sites (pGL3-mpSox2)
and after the performance of point
1338 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 2•JANUARY 8, 2010

Sox2, a New Target Gene of HIF2␣
mutation (pGL3-mpSox2⌬) to inactivate both sites. Tran-
scriptional activation under hypoxia, by using the wild-type
sequence (pGL3-mpSox2) rather than the empty vector, was
significantly abolished by using the mutated sequence
(pGL3-mpSox2⌬; Fig. 3B). Finally, to disclose a specific role
for HIF2␣ in Sox2 promoter activity depending on HRE acti-
vation, a ChIP assay was performed. The specific ChIP sig-
nals obtained after immunoprecipitation with anti-HIF2␣
antibody showed, first, more amplified immunoprecipitated
sequences after hypoxia stimulation and, then, reduced
binding of HIF2␣ within the Sox2 promoter when epSPC
were treated with FM19G11 (Fig. 3C).
FM19G11 Promotes Oligodendrocyte Differentiation under
Hypoxia—Hypoxia blocks stem cell differentiation; and HIF
expression is widely accepted to be associated with stemness.
Here, we showed the effect of FM19G11, an HIF␣ inhibitor, on
oligodendrocyte differentiation under hypoxia. An oligoden-
drocyte differentiation protocol from undifferentiated epSPC
was induced until day 42, in line with our earlier research (23),
by following the steps described in Fig. 4A. The process of dif-
ferentiation with epSPC occurred in parallel, in the presence
and absence of FM19G11, in an atmosphere of 1% O2, and for
early and late differentiation stages from day 1 to 3 and from day
35 to 37, respectively (Fig. 4). At both stages, the hypoxic con-
ditions blocked the differentiation process, according to cell
markers RIP and NG2 at early stage (day 1–3) and the mature
oligodendrocyte markers 04 and RIP at late stage (day 35–37)
(Fig. 4, B and C, for RIP expression). In all cases, the addition of
FM19G11 rescued the expression of the above mentioned cell
markers (Fig. 4, B and C, for RIP expression). It is also important
to mention the poor migration from the epSPC neurospheres
into the matrix, under low oxygen concentration and at an early
stage of the differentiation protocol (Fig. 4B). At day 37, the
cells were also harvested for reverse transcription-PCR and
Western blot analysis (Fig. 4C). From day 35 of the differentia-
tion protocol, the precursors were forced to a definitive matu-
ration by culturing in a laminin matrix (Fig. 4A). Sox2, Oct4,
Notch1, and Nestin, typically expressed in undifferentiated pro-
genitor cells, were at this late stage up-regulated in hypoxia, in
comparison with normoxic conditions (Fig. 4C). Olig2 and
Nkx2.2, homeodomain transcription factors, are linked to oli-
godendrocyte early specification during spinal cord develop-
ment, gradually reducing in mature cells. The exposure to low
oxygen concentration induced the expression of these early
specific oligodendrocyte markers, Olig2 and Nkx2.2 (Fig.
4C), but in the presence of FM19G11 the cells recovered the
low expression levels of these transcription factors at late
differentiation stages. The expression of the astrocytic
marker GFAP diminished from day 3 of the differentiation
protocol after all-trans-retinoic acid addition (23). Hypoxia
significantly induced the expression of GFAP, indicating
lower oligodendrocyte specification in the epSPC culture.
This induction was abolished by FM19G11 treatment (Fig.
4C). Considering all of the above, the hypoxia-induced delay
in directed oligodendrocyte differentiation was aborted by
FM19G11 treatment.
Epigenetic Influences on FM19G11-dependent Sox2
Regulation—To reveal the extended mechanism involved in
FM19G11-dependent regulation of Sox2 expression, we per-
formed a DNA microarray analysis, comparing the gene
expression profile of epSPC when treated under hypoxia with
the compound FM19G11 or its vehicle. The differentially
expressed genes were organized according to gene ontology
(GO) by using the corresponding gene-GO association table to
obtain FatiGO-implemented analysis. As shown in Figs. 3D or
supplemental S2 (for more details), two main groups after bio-
logical function clustering were overrepresented in the pres-
ence of FM19G11. The first group was related to chromatin
assembly; and the second, to transcriptional regulation. Taken
together, they may indicate that FM19G11 activity in transcrip-
tional regulation is mediated throughout alteration of epige-
netic events by chromatin modifications. Stabilized HIF␣ pro-
teins bind with the ARNT subunit and recruit the p300ꢀCBP
complex, two coactivators with histone acetyltransferase activ-
ity (34). Based on the transcription profile obtained in the pres-
ence of FM19G11, we tested whether FM19G11 would behave
as a histone deacetylase inhibitor, but no positive results were
obtained (data not shown). However, the presence of FM19G11
inhibited the hypoxia-induced expression levels of the histone
3-acetylated form (AcH3), as well as the levels of total p300,
which act as acetyltransferase (Fig. 3E). These results were
obtained in close association with the repression of HIF tar-
gets, including pluripotency markers. Furthermore, the
ChIP signals obtained after immunoprecipitation with anti-
AcH3 antibody revealed a rich acetylated region in the Sox2
promoter when the epSPC were exposed to hypoxia. In con-
trast, a significant reduction in AcH3 signals was seen in
epSPC maintained under hypoxic conditions when
FM19G11 was present (Fig. 3F).
FIGURE 3. Hif2␣ regulates Sox2 expression and influences the epigenetic mechanisms. A, epSPC were exposed to 1 or 20% O2 for 48 h. 500 nM of each
siRNA duplex, scramble (Scr, nonspecific probe), HIF1␣, or HIF2␣-specific rat probes were transfected 24 h before oxygen-dependent stimulation. The Western
blot assay showed that only HIF2␣ knockdown also reduced the protein levels of Sox2 and Oct4. ␤-Actin served as a loading control. *, when compared with
scrambleat20%O2;§, whencomparedwithscrambleat1%O2;pϽ0.05wasdeterminedbyStudent’sttest. B, ChIPanalysiswithintheratSox2promoter. There
were a significantly higher number of copies of the Sox2 promoter by real time-PCR amplification after chromatin immunoprecipitation assays using specific
antibody for HIF2␣. The presence of FM19G11 significantly inhibited hypoxia-dependent induction. *, p Ͻ 0.05 versus 20% O2; §, p Ͻ 0.05 versus vehicle at 1%
O2 determined by Student’s t test. C, luciferase reporter assay under hypoxia for 6 h. HEK293T cells transiently transfected with pGL3-basic, empty vector,
including the wild-type mouse Sox2 promoter sequence (pGL3-mpSox2) or point mutated at both HRE sites (pGL3-mpSox2⌬) (see diagram on the right) 24 h
before hypoxic stimulus. D, FatiGO analysis of epSPC treated with 500 nM FM19G11 was compared with vehicle alone for 48 h in hypoxia. Two biological
functional groups were overrepresented in the FM19G11-treated sample after hierarchical clustering. E, left panel: representative Western blot assay for epSPC
treated (ϩ) or not (Ϫ) with 500 nM FM19G11, exposed for 48 h at 1 or 20% O2; right panel: densitometry analysis of three independent experiments. F, ChIP
analysis within the rat Sox2 promoter by using AcH3 antibody for chromatin immunoprecipitation. Error bars represent S.D. *, versus 20% O2; §, versus vehicle
at 1% O2; p Ͻ 0.05 was determined by Student’s t test.
JANUARY 8, 2010•VOLUME 285•NUMBER 2
JOURNAL OF BIOLOGICAL CHEMISTRY 1339

Sox2, a New Target Gene of HIF2␣
FIGURE 4. FM19G11 favors oligodendrocyte cell differentiation of epSPC under hypoxia. A, diagram of differentiation protocol. B, immunostaining assay
foroligodendrocytecellmarkers:RIPandNG2(upperpanels)andO4(lowerpanels). Upperpanels, cellstreatedwith500nM FM19G11orDMSO(vehicle)fromday
1 to 3 of the differentiation protocol; lower panels, cells treated during day 35 to 37 of the differentiation protocol under both normoxic (20% O2) and hypoxic
(1% O2) conditions. C, extended analysis at day 37 of the differentiation process. epSPC were cultured under normoxic (20% O2) and hypoxic (1% O2)
atmospheresandtreatedwith500nM FM19G11(ϩ)andvehiclealone(Ϫ). Theundifferentiatedstage(Oct4, Sox2, Olig2, Nkx2.2, Notch1, Nestin, andGFAP)and
the oligodendrocyte-specific fate cell marker (RIP) were assayed by Western blot (right panel) and/or PCR (left panel). 18S and ␤-actin expression served as
loading controls for PCR and Western blot, respectively.
DISCUSSION
crucial in curing cancer; reduction of HIF activity may promote
their differentiation and decrease their ability to repopulate
tumors after chemo- and radiotherapy (6, 36). The low toxicity
of this small molecule, no cytotoxicity was observed at concen-
trations a thousand times higher than the IC50 even in a hypoxic
atmosphere, permitted its safe use in a wide variety of live-cell
assays, including immuno-based determinations and long-last-
ing experiments in stem cell differentiation.
Over the last 20 years, major efforts have gone into the search
for HIF␣ inhibitors for use in new drugs (35). Although a wide
range of diverse molecules have been found to inhibit the HIF
pathway, these molecules often have other actions that indi-
rectly cause lower HIF protein levels. At present, none of the
reported HIF inhibitors have met the pharmacokinetic require-
ments for human therapeutic use. Here we demonstrate that
the new chemical entity FM19G11 acts as a potent inhibitor of
HIF␣ proteins in hypoxia, giving high selectivity against other
transcription factors of the AP-1 complex used during the
screening campaign. Furthermore, we show that this molecule
represses the target genes of both HIF proteins, 1␣ and 2␣, in
cancer cell lines of various tissues showing lower transcript and
protein levels in rat epSPC and human ESC, which suggests a
steady mechanism of action for this new drug. The complete
Although hypoxia is widely linked to many pathological pro-
cedures (1–3), it is also a controller of major physiological pro-
cesses, such as differentiation status during embryogenesis and
in adulthood (1, 6, 8). Hypoxia is associated with the undiffer-
entiated status of stem cells; and the function of HIF␣ proteins
in maintaining multipotency was only found quite recently.
The real mechanisms by which the HIF pathway interacts with
other pathways to keep stemness are still largely unknown,
eradication of what are known as cancer stem cells might be despite a great many publications in the last few years (6, 36).
1340 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285•NUMBER 2•JANUARY 8, 2010

Sox2, a New Target Gene of HIF2␣
First, HIF1␣ was shown to block neuronal and myogenic differ- for SCI regeneration (23, 43, 44). As mentioned above,
entiation in a Notch-dependent manner (5) and, more recently, FM19G11 did repress a variety of key genes involved in stem-
OCT4 was identified as a HIF2␣-specific target gene (8) con- ness, and our reprogramming experiments showed that the
trolled by Sox2 (18). First of all, Keith and Simon (36) elegantly inhibitor favors oligodendrocyte differentiation, possibly
hypothesized that SOX2 and KLF4 might also be HIF targets through modulation of Sox2 and Oct4 expression and by allow-
and recently McCord et al. (32) validated this hypothesis based ing neural stem and/or precursor cells to differentiate. Sox-2
on the inhibition by a siRNA of the 2␣ isoform. However, was shown to be the key player in cell fate control, regulating
McCord et al. (32) do not show whether Sox2 is solely under the Oct4 and, combined with a few other factors (c-myc and/or
control of HIF2␣ or if there is an overlap with the 1␣ isoform. A Klf4), confers ES-like properties on mature murine fibroblasts
reporter assay, based on the promoter region of Sox2 contain- (20). However, given the results reported here, it should be
ing two HRE sites, a HIF2␣ ChIP experiment, and the use of emphasized that HIF2␣ is now positioned in the upper hierar-
siRNA experiments leading to HIF2␣ knockdown cells strongly chy of cell fate. All in all, the low toxicity profile of this drug
demonstrated that Sox2 is a direct target of the HIF␣ proteins, favors pharmacological approaches and enables it to act on SCI
and, in particular, that its regulation resides specifically in the regeneration in rigorously defined models.
2␣ isoform. Complementary information that reinforces the
role of HIF2␣ in the direct control of Sox2 was provided by
ChIP experiments carried out in the presence of the inhibitor
FM19G11. All of the above clearly point to the utility of this
small molecule, at present seen just as a tool compound, to
clarify the hierarchy of HIF2␣ in the control of two key genetic
factors that govern pluripotency.
Acknowledgments—We are especially grateful to Dr. M. O. Landazuri
and Dr. R. Farras for the HeLa-9x cell line and AP1 related plasmid,
respectively. We gratefully acknowledge Dr. Maria Teresa Calvo and
Raquel Garijo Ferna´ndez for excellent technical support. We also
thank the Confocal Microscopy and Genomic Services of the Centro de
Investigacio´n Príncipe Felipe (Valencia, Spain).
Microenvironment influence on chromatin assembly and
accessibility and/or dynamic interplay of certain transcription
factors determines the stem cell differentiating status (27,
37–39). In fact, the Oct4 locus adopts a closed conformation in
differentiating embryonic somatic cells, making it refractory to
regulation by HIF2␣ (8). Here, we confirmed the direct associ-
ation between the HIF2␣-positive transcriptional regulation of
Sox2 and the open chromatin conformation of its promoter.
FM19G11 prevented the general H3 acetylation induced by
hypoxia in epSPC and reduced the expression of p300, the main
co-activator for transcriptional activation of HIF␣ proteins
with histone acetyltransferase activity. ChIP analysis by AcH3
immunoprecipitation showed direct involvement of the acety-
lation mechanism in hypoxia and FM19G11 regulation over the
Sox2 transcriptional activity. Although p300 immunoprecipita-
tion experiments proved a Sox2 interaction,4 no evidence link-
ing Sox2 and p300 transcriptional regulation on maintaining
the undifferentiated stage was found, as was previously
described in the case of Notch1 (40). The inhibitory activity of
FM19G11 on Oct4 and Sox2, Notch, and Nanog and transform-
ing growth factor-␣ opened up new approaches to its use in cell
reprogramming experiments with neural progenitor cells for
the SCI regeneration model in the rat. Therefore, loss of mye-
linating oligodendrocytes or oligodendrocyte progenitor cells is a
feature of many central nervous system injury and disease
states. Moreover, due to secondary damage after SCI, the ische-
mic environment does not allow re-myelinization, partly
because there is an arrest of oligodendrocyte lineage matura-
tion (41). Indeed, when undifferentiated progenitors are trans-
planted into an ischemic environment, no significant cell dif-
ferentiation occurs (23, 42). The cell fate modulation of
transplanted or endogenous stem cells by forcing the genera-
tion of oligodendrocytes to re-myelinate spared axons in the
vicinity of the lesion would be a powerful therapeutic approach
REFERENCES
1. Folkman, J. (2007) Nat. Rev. Drug Discov. 6, 273–286
2. Pouysse´gur, J., Dayan, F., and Mazure, N. M. (2006) Nature 441, 437–443
3. Bertout, J. A., Patel, S. A., and Simon, M. C. (2008) Nat. Rev. Cancer 8,
967–975
4. Rankin, E. B., and Giaccia, A. J. (2008) Cell Death Differ. 15, 678–685
5. Gustafsson, M. V., Zheng, X., Pereira, T., Gradin, K., Jin, S., Lundkvist, J.,
Ruas, J. L., Poellinger, L., Lendahl, U., and Bondesson, M. (2005) Dev. Cell
9, 617–628
6. Simon, M. C., and Keith, B. (2008) Nat. Rev. Mol. Cell Biol. 9, 285–296
7. Raval, R. R., Lau, K. W., Tran, M. G., Sowter, H. M., Mandriota, S. J., Li,
J. L., Pugh, C. W., Maxwell, P. H., Harris, A. L., and Ratcliffe, P. J. (2005)
Mol. Cell. Biol. 25, 5675–5686
8. Covello, K. L., Kehler, J., Yu, H., Gordan, J. D., Arsham, A. M., Hu, C. J.,
Labosky, P. A., Simon, M. C., and Keith, B. (2006) Genes Dev. 20, 557–570
9. Covello, K. L., Simon, M. C., and Keith, B. (2005) Cancer Res. 65,
2277–2286
10. Hu, Y., Leaver, S. G., Plant, G. W., Hendriks, W. T., Niclou, S. P., Verhaa-
gen, J., Harvey, A. R., and Cui, Q. (2005) Mol. Ther. 11, 906–915
11. Dutta, D., Ray, S., Vivian, J. L., and Paul, S. (2008) J. Biol. Chem. 283,
25404–25413
12. Gruber, M., Hu, C. J., Johnson, R. S., Brown, E. J., Keith, B., and Simon,
M. C. (2007) Proc. Natl. Acad. Sci. U.S.A. 104, 2301–2306
13. Maynard, M. A., Evans, A. J., Shi, W., Kim, W. Y., Liu, F. F., and Ohh, M.
(2007) Cell Cycle 6, 2810–2816
14. Metzen, E., Zhou, J., Jelkmann, W., Fandrey, J., and Bru¨ne, B. (2003) Mol.
Biol. Cell 14, 3470–3481
15. Studer, L., Csete, M., Lee, S. H., Kabbani, N., Walikonis, J., Wold, B., and
McKay, R. (2000) J. Neurosci. 20, 7377–7383
16. Zhang, C. P., Zhu, L. L., Zhao, T., Zhao, H., Huang, X., Ma, X., Wang, H.,
and Fan, M. (2006) Neurosignals 15, 259–265
17. Avilion, A. A., Nicolis, S. K., Pevny, L. H., Perez, L., Vivian, N., and Lovell-
Badge, R. (2003) Genes Dev. 17, 126–140
18. Masui, S., Nakatake, Y., Toyooka, Y., Shimosato, D., Yagi, R., Takahashi,
K., Okochi, H., Okuda, A., Matoba, R., Sharov, A. A., Ko, M. S., and Niwa,
H. (2007) Nat. Cell Biol. 9, 625–635
19. Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda,
K., and Yamanaka, S. (2007) Cell 131, 861–872
20. Takahashi, K., and Yamanaka, S. (2006) Cell 126, 663–676
21. Gordan, J. D., Bertout, J. A., Hu, C. J., Diehl, J. A., and Simon, M. C. (2007)
Cancer Cell 11, 335–347
4 V. Moreno-Manzano, F. J. Rodríguez-Jime´nez, and J. M. Sa´nchez-Puelles,
unpublished data.
JANUARY 8, 2010•VOLUME 285•NUMBER 2
JOURNAL OF BIOLOGICAL CHEMISTRY 1341

Sox2, a New Target Gene of HIF2␣
22. Johansson, C. B., Momma, S., Clarke, D. L., Risling, M., Lendahl, U., and 33. Kim, J. B., Zaehres, H., Wu, G., Gentile, L., Ko, K., Sebastiano, V., Arau´zo-
Frise´n, J. (1999) Cell 96, 25–34
Bravo, M. J., Ruau, D., Han, D. W., Zenke, M., and Scho¨ler, H. R. (2008)
23. Moreno-Manzano, V., Rodríguez-Jime´nez, F. J., García-Rosello´, M.,
Laínez, S., Erceg, S., Calvo, M. T., Ronaghi, M., Lloret, M., Planells-Cases,
R., Sa´nchez-Puelles, J. M., and Stojkovic, M. (2009) Stem Cells 27, 733–743
Nature 454, 646–650
34. Fedele, A. O., Whitelaw, M. L., and Peet, D. J. (2002) Mol. Interv. 2,
229–243
24. Erceg, S., Laínez, S., Ronaghi, M., Stojkovic, P., Pe´rez-Arago´, M. A., 35. Giaccia, A., Siim, B. G., and Johnson, R. S. (2003) Nat. Rev. Drug Discov. 2,
Moreno-Manzano, V., Moreno-Palanques, R., Planells-Cases, R., and
Stojkovic, M. (2008) PLoS ONE 3, e2122
803–811
36. Keith, B., and Simon, M. C. (2007) Cell 129, 465–472
37. Ruau, D., Ensenat-Waser, R., Dinger, T. C., Vallabhapurapu, D. S., Rol-
letschek, A., Hacker, C., Hieronymus, T., Wobus, A. M., Mu¨ller, A. M., and
Zenke, M. (2008) Stem Cells 26, 920–926
25. Livak, K. J., and Schmittgen, T. D. (2001) Methods 25, 402–408
26. Al-Shahrour, F., Minguez, P., Vaquerizas, J. M., Conde, L., and Dopazo, J.
(2005) Nucleic Acids Res. 33, W460–W464
27. Rodriguez-Jime´nez, F. J., Moreno-Manzano, V., Lucas-Dominguez, R., 38. Maltepe, E., Krampitz, G. W., Okazaki, K. M., Red-Horse, K., Mak, W.,
and Sa´nchez-Puelles, J. M. (2008) Stem Cells 26, 2052–2062
28. Appelhoff, R. J., Tian, Y. M., Raval, R. R., Turley, H., Harris, A. L., Pugh,
C. W., Ratcliffe, P. J., and Gleadle, J. M. (2004) J. Biol. Chem. 279,
38458–38465
Simon, M. C., and Fisher, S. J. (2005) Development 132, 3393–3403
39. Lyssiotis, C. A., Walker, J., Wu, C., Kondo, T., Schultz, P. G., and Wu, X.
(2007) Proc. Natl. Acad. Sci. U.S.A. 104, 14982–14987
40. Wallberg, A. E., Pedersen, K., Lendahl, U., and Roeder, R. G. (2002) Mol.
Cell. Biol. 22, 7812–7819
29. Pescador, N., Cuevas, Y., Naranjo, S., Alcaide, M., Villar, D., Landa´zuri,
M. O., and Del Peso, L. (2005) Biochem. J. 390, 189–197
41. Segovia, K. N., McClure, M., Moravec, M., Luo, N. L., Wan, Y., Gong, X.,
Riddle, A., Craig, A., Struve, J., Sherman, L. S., and Back, S. A. (2008) Ann.
Neurol. 63, 520–530
30. Fitz, L. J., Morris, J. C., Towler, P., Long, A., Burgess, P., Greco, R., Wang,
J., Gassaway, R., Nickbarg, E., Kovacic, S., Ciarletta, A., Giannotti, J.,
Finnerty, H., Zollner, R., Beier, D. R., Leak, L. V., Turner, K. J., and Wood,
C. R. (1997) Oncogene 15, 613–618
42. Parr, A. M., Kulbatski, I., Zahir, T., Wang, X., Yue, C., Keating, A., and
Tator, C. H. (2008) Neuroscience 155, 760–770
31. Koh, M. Y., Spivak-Kroizman, T., Venturini, S., Welsh, S., Williams, R. R., 43. Meletis, K., Barnabe´-Heider, F., Carle´n, M., Evergren, E., Tomilin, N.,
Kirkpatrick, D. L., and Powis, G. (2008) Mol. Cancer Ther. 7, 90–100
32. McCord, A. M., Jamal, M., Shankavaram, U. T., Lang, F. F., Camphausen, 44. Ohori, Y., Yamamoto, S., Nagao, M., Sugimori, M., Yamamoto, N., Naka-
K., and Tofilon, P. J. (2009) Mol. Cancer Res. 7, 489–497 mura, K., and Nakafuku, M. (2006) J. Neurosci. 26, 11948–11960
Shupliakov, O., and Frise´n, J. (2008) PLoS Biol. 6, e182
1342 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 2•JANUARY 8, 2010

Molecular Basis of Cell and
Developmental Biology:
FM19G11, a New Hypoxia-inducible Factor
(HIF) Modulator, Affects Stem Cell
Differentiation Status
Victoria Moreno-Manzano, Francisco J.
Rodríguez-Jiménez, Jose L. Aceña-Bonilla,
Santos Fustero-Lardíes, Slaven Erceg, Joaquin
Dopazo, David Montaner, Miodrag Stojkovic
and Jose M. Sánchez-Puelles
J. Biol. Chem. 2010, 285:1333-1342.
doi: 10.1074/jbc.M109.008326 originally published online November 6, 2009
Access the most updated version of this article at doi: 10.1074/jbc.M109.008326
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
Supplemental material:
http://www.jbc.org/content/suppl/2009/11/06/M109.008326.DC1.html
This article cites 44 references, 16 of which can be accessed free at
http://www.jbc.org/content/285/2/1333.full.html#ref-list-1