The human mitochondrial enzyme BCO2 exhibits catalytic activity toward carotenoids and apocarotenoids

Article abstract of DOI:10.1074/jbc.RA120.015515

The enzyme b-carotene oxygenase 2 (BCO2) converts carotenoids into more polar metabolites. Studies in mammals, fish, and birds revealed that BCO2 controls carotenoid homeostasis and is involved in the pathway for vitamin A production. However, it is controversial whether BCO2 function is conserved in humans, because of a 4-amino acid long insertion caused by a splice acceptor site polymorphism. We here show that human BCO2 splice variants, BCO2a and BCO2b, are expressed as pre-proteins with mitochondrial targeting sequence (MTS). The MTS of BCO2a directed a green fluorescent reporter protein to the mitochondria when expressed in ARPE-19 cells. Removal of the MTS increased solubility of BCO2a when expressed in Escherichia coli and rendered the recombinant protein enzymatically active. The expression of the enzymatically active recombinant human BCO2a was further improved by codon optimization and its fusion with maltose-binding protein. Introduction of the 4-amino acid insertion into mouse Bco2 did not impede the chimeric enzyme’s catalytic proficiency. We further showed that the chimeric BCO2 displayed broad substrate specificity and converted carotenoids into two ionones and a central C14-apocarotendial by oxidative cleavage reactions at C9,C10 and C9’,C10’. Thus, our study demonstrates that human BCO2 is a catalytically competent enzyme. Consequently, information on BCO2 becomes broadly applicable in human biology with important implications for the physiology of the eyes and other tissues.

Full text of DOI:10.1074/jbc.RA120.015515

JBC Papers in Press. Published on September 1, 2020 as Manuscript RA120.015515
The latest version is at https://www.jbc.org/cgi/doi/10.1074/jbc.RA120.015515
The human mitochondrial enzyme BCO2 exhibits catalytic activity towards carotenoids and
apocarotenoids
Linda D. Thomas1, Sepalika Bandara1, Vipulkumar M. Parmar1, Ramkumar Srinivasagan1, Nimesh
Khadka1, Marcin Golczak1, 2, Philip D. Kiser3, 4 and Johannes von Lintig1*
1Department of Pharmacology, 2Cleveland Center for Membrane and Structural Biology, School of
Medicine, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, Ohio 44106, United
States of America; 3Department of Physiology and Biophysics, University of California, Irvine, California
92697, 4Research Service, Veterans Affairs Long Beach Healthcare System, Long Beach, California
90822.
*Corresponding author Department of Pharmacology, School of Medicine, Case Western Reserve
University, 10900 Euclid Avenue, Cleveland, Ohio 44106, United States of America, Tel: +1
2163683528; Fax: +1 2163681300. Email: johannes.vonlintig@case.edu.
Running title: Human BCO2 and carotenoid metabolism
Key words: Vision, retina, metabolism, dioxygenase, carotenoids, macular pigments, apocarotenoids, β-
carotene-oxygenase 2 (BCO2)
1

another mechanism of protection of cellular
components from the environment. Macular
pigments have been chemically identified as the
carotenoids lutein, zeaxanthin, and meso-
zeaxanthin (3). These carotenoids are enriched in
the fovea in primate retinas and confer its yellow
colour. Hence, the fovea is traditionally known as
the macula lutea, or ‘yellow spot’. The macular
pigments can protect the retina against light
damage (8,9) and reduce the adverse impact of
light scattering and chromatic aberration,
thereby optimizing contrast sensitivity of the
retina (10).
Carotenoids must be acquired from the diet
within the intestine and are distributed in
lipoproteins to target tissues (11,12). Genetic
studies in animals identified candidate genes that
affect tissue distribution and accumulation of
carotenoids, such as class B scavenger receptors
for cellular uptake of carotenoids (13,14), cellular
carotenoid binding proteins (15,16), and
carotenoid cleavage dioxygenases (CCDs)5 (17-
19). Clinical studies have associated genetic
polymorphism in these genes with macular
pigment density in the human population
(4,20,21). Amongst these genes, the BCO2 gene
encodes β-carotene-9’,10’-dioxygenase that
catalyzes a region specific oxidative cleavage at
the C9’,C10’ double bond in the central polyene
chain of carotenoids (22). Mouse and ferret
BCO2 display broad substrate specificity and
convert carotenoid substrates, including
zeaxanthin and lutein, into apocarotenoid
products (23-25). Studies in Bco2 knockout mice
showed that the enzyme controls carotenoid
homeostasis and is involved in the production of
apocarotenoid signaling molecules, including
retinoids (25-27). Genetic studies in cow, sheep,
and rabbits have identified inactivating mutations
in the BCO2 gene that phenotypically display as
yellow fat phenotype (28-31).
Abstract
The enzyme β-carotene-oxygenase 2 (BCO2)
converts carotenoids into more polar metabolites.
Studies in mammals, fish and birds revealed that
BCO2 controls carotenoid homeostasis and is
involved in the pathway for vitamin A
production. However, it is controversial whether
BCO2 function is conserved in humans, owing to
a four amino acid long insertion caused by a
splice acceptor site polymorphism. We here show
that human BCO2 splice variants, BCO2a and
BCO2b, are expressed as pre-proteins with
mitochondrial targeting sequence (MTS). The
MTS of BCO2a directed a green fluorescent
reporter protein to the mitochondria when
expressed in ARPE-19 cells. Removal of the
MTS increased solubility of BCO2a when
expressed in E. coli and rendered the recombinant
protein enzymatically active. The expression of
the enzymatically active recombinant human
BCO2a was further improved by codon
optimization and its fusion with maltose-binding
protein. Introduction of the four amino acid
insertion into mouse Bco2 did not impede the
chimeric enzyme’s catalytic proficiency. We
further showed that the chimeric BCO2 displayed
broad substrate specificity and converted
carotenoids into two ionones and a central C14-
apocarotendial by oxidative cleavage reactions at
C9,C10 and C9’,C10’. Thus, our study
demonstrate that human BCO2 is a catalytically
competent enzyme. Consequently, information
on BCO2 becomes broadly applicable in human
biology with important implications for the
physiology of the eyes and other tissues.
Introduction
The beneficial roles of carotenoids in human
health is currently a subject of intense
investigation. Low status of carotenoids is
associated with vitamin A deficiency and a
number of degenerative diseases including
cardiovascular disease, cognitive impairments,
and age-related macular degeneration (1-6). A
number of potential mechanisms through which
carotenoids can benefit human health have been
proposed. The most commonly cited is their
ability of acting as antioxidants, e.g., as free
radical scavengers, in lipophilic environments
such as membranes and lipoproteins (7). The blue
light filtering properties of carotenoids compose
Five splice variants of human BCO2 have been
annotated in the National Center for
Biotechnology Information (NCBI) website
(Gene ID: 83875) (Fig. 1). Interestingly, it was
shown that all human BCO2 variants possess a
GKAA insertion that is caused by the use of an
alternate donor splice site during mRNA
maturation (Fig. 1A) (32). This insertion is
specific for primate BCO2s and is not found in
2

other vertebrates. Previously, it was proposed that
inactivity of the BCO2a variant results in macular
pigment accumulation in the human retina (32).
Biochemical analysis suggested that recombinant
human BCO2 protein is enzymatically inactive
when expressed in E. coli (33) and that the
GKAA insertion rendered recombinant murine
BCO2 enzymatically inactive (32). However,
studies by others challenged this proposal. A
recombinant macaque BCO2 displays enzymatic
activity though the corresponding gene possesses
the same splice acceptor site polymorphism as the
human gene (23). Additionally, expression of
recombinant human BCO2 in a bacterial test
system revealed enzymatic activity of
recombinant human BCO2s (34-36).
The current claim that BCO2, a protein
evolutionarily conserved since the split between
jawed and jawless vertebrates (34), has become
inactive in primates is puzzling. This claim
eliminates an important metabolic pathway for
carotenoid homeostasis and vitamin A production
in human physiology (25,37). The question
whether humans encode an enzymatically active
BCO2 protein also is of clinical relevance. Many
nutritionists and clinicians advocate for higher
carotenoid intake because of their beneficial
health effects (3,5,38). The establishment of such
recommendations is based on the relationships
between carotenoid intake, blood, and tissue
concentrations. This relation is not linear and is
influenced by many host and environmental
Additionally, BCO2c displays a six amino acid
deletion in the coding region when compared to
BCO2a and BCO2b (Fig. S1). We performed RT-
PCR analysis with total RNA preparations
isolated from retinas of human donor eyes with
intron-spanning PCR primer sets. These primer
sets were designed to specifically amplify each
splice variant of human BCO2 gene. This analysis
detected PCR products for the mRNA splice
variants encoding BCO2a and BCO2b in both
retinas (Fig. 1A). Under the applied conditions,
no PCR product for BCO2c was amplified from
the RNA preparations of the retinas of the donor
eyes. As controls, RT-PCR products for RHO
mRNA encoding rhodopsin, GAPDH encoding
glyceraldehyde 3-phosphate dehydrogenase, and
ACTB encoding β-actin were amplified from the
same RNA preparations and resulted in products
of the expected sizes (Fig. 1B).
Recombinant human BCO2a is inactive
We found that mRNAs encoding BCO2a and
BCO2b were expressed in the human retina. To
test whether they encode functional enzymes, we
took advantage of a cell-based assay (42). In this
assay, BCO2 and other members of the CCD
superfamily are expressed in an E. coli strain
which can synthesize carotenoids. This synthesis
is achieved by transformation of the bacteria with
plasmids harboring genes for carotenoid
synthesis from Erwina uredovora (43). The
accumulation of zeaxanthin confers a yellow
color to the bacteria. Expression of an
factors
(11,39).
Additionally,
excessive
enzymatically active BCO2 leads to
a
accumulation of carotenoids is a risk factor for
detrimental health outcomes in smokers in
clinical studies (40,41). Therefore, we here
wished to scrutinize whether humans express an
active BCO2 enzyme that can control tissue
homeostasis of carotenoids and its metabolites.
discoloration of the bacteria because of the
cleavage of zeaxanthin into apocarotenoids with
blue shifted spectra and lower absorption
coefficient. We employed this assay for the
human BCO2a and BCO2b as outlined in the
material and method section. The pellets of the
zeaxanthin producing bacteria expressing BCO2a
showed a bright yellow color. The pellet of the
bacteria expressing BCO2b had a lighter color,
indicating an enzymatic turnover of zeaxanthin
(Fig. 2A). Zeaxanthin turnover by the BCO2b
was confirmed by HPLC analysis (Fig. 2 B,C). In
bacteria extracts expressing BCO2b, amounts of
β-cryptoxanthin, the direct precursor of
zeaxanthin in the carotenoid synthesis pathway,
and zeaxanthin were significantly reduced when
compared to bacteria expressing BCO2a (Fig.
2A,B).
Results
Expression of BCO2 splice variant in the
human retina
We focused on the three major splice mRNA
variants, encoding respectively 579 (BCO2a),
545 (BCO2b), and 539 (BCO2c) amino acid long
proteins (Fig. S1). Sequence alignment reveals
that these proteins differ in their amino-terminal
parts but otherwise share sequence identity,
including conserved histidine residues for
binding of the cofactor ferrous iron (Fig. S1).
3

S3A). Thus, we next tested it against recombinant
BCO2 protein expressed in E. coli. Again, the
commercial antibody failed to detect BCO2 but
detected an unknown protein of 100 kDa in the
Human BCO2b converts apocarotenoids by
oxidative cleavage
We previously established an in vitro enzyme
assay to measure mouse BCO2 activity with
apocarotenoids as substrates (37). We now
applied this assay to human BCO2s using 3-
bacterial
protein extracts (Fig. S3B),
demonstrating its ineffectiveness for immuno-
detection of mammalian BCO2 protein.
hydroxy-β-12’-apocarotenal as
a
substrate.
Cleavage of the apocarotenoid by BCO2b results
in the formation of 3-hydroxy-β-ionone and
12’,10-diapocarotene-12’,10-dial (Fig. 3A).
HPLC-analysis revealed that the incubation of
protein extracts containing human BCO2b with
this substrate yielded a product that eluted earlier
(Fig. 3B, peak 1) than 3-hydroxy-β-12’-
apocarotenal (Fig. 3B, peak 2) and displayed
spectral characteristic of a C12-apocarotene-
dialdehyde (Fig. 3B, peak 1). Additionally, we
found a product that eluted later at minute 32 with
spectral characteristics of the corresponding di-
alcohol (Fig. 3B, peak 4). Identical products were
obtained when we incubated recombinant
mBCO2 with this substrate (Fig. S2). Incubation
of human BCO2a with the apocarotenoid did not
result in product formation (Fig. 3B). However,
we observed an increase of a peak which
resembled a cis-diastereomer of 3-hydroxy-β-
12’-apocarotenal. The putative cis-diastereomer
was present at lower amounts when we incubated
the substrate in buffer alone (Fig. 3B, peak 3).
Therefore, we cannot exclude that it is formed by
thermal isomerization during the incubation
process.
We next expressed BCO2a and BCO2b as V5
tagged proteins (70.59 and 66.44 kDa,
respectively) in the human retinal pigment
epithelium cell line ARPE-19, to study the
proteins in a natural cellular environment.
Western blot analysis with an antibody directed
against the C-terminal V5 epitopes of the
recombinant proteins revealed single bands for
the BCO2a and BCO2b (Fig. 4A). Notably, the
human BCO2 bands displayed identical electro-
mobility on the SDS-PAGE. Interestingly, the
protein migrated with the same size as the V5-
tagged mBCO2 protein (65.06 kDA), which we
expressed in ARPE-19 cells as a control (Fig.
4A). In contrast, a V5 tagged human BCO2a
(69.16 kDa) displayed a significantly different
mobility on the same SDS-PAGE when
expressed in bacterial cells (Fig. 4A). A
recombinant truncated 522 amino acid long
human BCO2 migrated with a significantly lower
molecular weight when expressed as V5 tagged
protein (62.62 kDa), demonstrating that the SDS
PAGE separated proteins in this molecular size
range (Fig. 4A).
The identical mobility of BCO2a, BCO2b, and
mBCO2 in the ARPE-19 cells suggested that the
proteins were post-translationally truncated to
yield proteins of similar molecular sizes. To
demonstrate that human BCO2a and BCO2b are
localized to the mitochondria of ARPE-19 cells,
Human BCO2s contain a mitochondrial target
sequence
In a previous study, a single 63 kDa BCO2
protein was detected by Western blot analysis of
the human retina protein extracts, likely
corresponding to the 579 amino acid long BCO2a
(32). In the mouse retina, a 60 kDa BCO2 protein
was detected corresponding to the 532 amino acid
long murine BCO2 protein (32). However, no
controls were included in this study to validate
the specificity of the commercial antibody. We
and others previously showed that BCO2 is
highly expressed in the liver (35,44). Therefore,
we used hepatic protein extracts from wild type
mice and mice deficient for BCO2 or its closely
related BCO1 homolog to validate the
commercial antibody. Surprisingly, the antibody
detected a band of approx. 50 kDa, independent
of the BCO2 genotype of the mouse livers (Fig.
we
performed
immunohistochemistry.
Immunostaining for the V5-taged protein and
confocal imaging revealed that the staining for
BCO2a and BCO2b merged with the staining for
a mitochondrial marker in this experiment,
indicative for its mitochondrial localization (Fig.
4B). To demonstrate more directly that the N-
terminal part of BCO2a splice variants serves as
MTS, we cloned the sequence encoding the first
70 amino acids of BCO2a in front of the gene
encoding a green fluorescent protein (GFP) (Fig.
4C). As control, we inserted the sequence
encoding the first 70 amino acids of the N-
terminal part of human BCO1 into the same GFP
4

reporter vector (Fig. 4C). In contrast to BCO2, the
human BCO1 protein resides in the cytoplasm
and is not transported to mitochondria (45). In
both plasmids, GFP is expressed as fusion protein
with an N-terminal part of either BCO1 or BCO2.
We transfected the plasmids into ARPE-19 cells
and microscopically analyzed the subcellular
localization of GFP. The GFP expressed with the
Human BCO2 also contains a four amino acid
(GKAA) insertion (Fig. S1, position 169-172 in
BCO2a) which is absent in rodents (Fig. S1). It
was reported that the insertion abolishes
enzymatic activity when introduced in mBCO2,
but a detailed analysis of the biochemical
properties of the chimeric mouse protein was not
provided in this study (32). To determine the
effects of the GKAA insertion on BCO2
enzymatic activity, we generated mBCO2 with a
GKAA insertion and expressed it as a pMAL
fusion protein. As a control, the mBCO2 was
PCR amplified and cloned into the same vector.
We first applied the cell-based assay to compare
enzymatic activity of mBCO2 and mBCO2-
GKAA. In cells expressing each plasmid the
color shift occurred as a result of zeaxanthin
cleavage (Fig. S7A). Western blot confirmed that
both mBCO2 and the chimeric mBCO2-GKAA
existed in significant amounts in the soluble
fraction (Fig. S7B). After carotenoid extraction,
zeaxanthin turnover was confirmed using HPLC
analysis (Fig. S7C). In both lipid extracts of
mouse BCO2 and mBCO2-GKAA, carotenoids
were at the limit of detection level. In contrast,
bacteria expressing the MBP control displayed
large amounts of β-cryptoxanthin (Fig. S7C, peak
1) and zeaxanthin (Fig. S7C, peak 2).
We next compared enzymatic properties of
mBCO2 and the chimeric mBCO2. For this
purpose, we purified the recombinant proteins by
affinity chromatography (Fig. S8). To
characterize whether the GKAA insertion altered
enzymatic properties of BCO2, we determined
turnover rates with increasing concentrations of
3-hydroxy-β-12’-apocarotenal and 50 µg purified
enzyme (Fig. 6A). We followed the reaction
spectroscopically by measuring the decrease in
absorption at 420 nm as outlined in the
experimental procedure section. 3-Hydroxy-β-
12’-apocarotenal cleavage at position C9, C10
into 12’,10-diapocarotene-12’,10-dial was also
confirmed by HPLC analysis (Fig. S2). The
chimeric BCO2 and mBCO2 displayed
Michaelis-Menten kinetic under the applied
condition. While mBCO2 displayed a higher
Michalis constant for the substrate (36 versus 16
µM), it demonstrated higher maximal velocity for
the substrate when compared to the chimeric
BCO2 enzyme (782 versus 306 pmol x min-1)
(Fig. 6A). From these parameters we calculated
N-terminal BCO2a sequence displayed
a
mitochondrial localization as indicated by co-
localization with Mito Tracker (Fig. 4D). In
contrast, the GFP expressed with the N-terminal
BCO1 sequence displayed a cellular distribution
as expected for the cytoplasmic BCO1 protein
(Fig. 4E).
Removal of mitochondria targeting sequence
results in enzymatic activity of BCO2a
We observed that recombinant BCO2a was
largely insoluble when expressed as pre-protein
in E. coli cells (Fig. S4). Thus, we applied three
modifications to the expression strategy: (i) we
removed the mitochondrial targeting sequence
from the BCO2a pre-protein (Fig. S5); (ii) we
optimized the codon usage to bacterial expression
systems; and (iii) we cloned the synthetic gene
into the pMAL vector and expressed it as a
maltose binding protein (MBP) fusion. The latter
strategy significantly improved the stability of
recombinant mBCO2 and yielded higher amounts
of soluble protein (Fig. S6). Using the established
cell-based assay, the generated BCO2 proteins
were expressed in zeaxanthin-producing E. coli
cells. When compared to the pMAL vector
control, the recombinant 522 and 519 amino acid-
long human BCO2 proteins showed enzymatic
activity as indicated by a color shift from yellow
to pale yellow (Fig. 5A). When compared to the
control cells expressing MBP, cells expressing
the two BCO2 fusion proteins displayed
significantly lower levels of zeaxanthin and its
metabolic precursor β-cryptoxanthin (Fig. 5C).
To demonstrate that the proteins were expressed
in soluble form, an antibody directed against
MBP was used for their detection. The Western
blot showed a sizeable amount of the MBP-fusion
BCO2 proteins in the soluble fraction (Fig. 5B),
even though the majority of the protein still
existed in the insoluble fraction upon cell lysis
(Fig. 5B).
GKAA insertion does not abolish BCO2’s
enzymatic activity
5

the turnover rate (kcat) to be 0.8 and 0.4 sec-1 for
mBCO2 and mBCO2-GKAA, respectively.
Thus, our analysis revealed that the GKAA
insertion did not abolish the catalytic activity of
the mouse protein as previously reported by
others (32,33).
metabolites in tests for enzymatic activity with
recombinant mouse BCO2 variants. As shown in
Fig. 8, mBCO2 and mBCO2-GKAA readily
converted these oxidized metabolites into
apocarotenoids. Thus, the GKAA insertion had
no effect on the binding and turnover of a large
variety of zeaxanthin derivatives which naturally
exits in the retina and other mammalian tissues
(47-49).
To predict whether the GKAA insertion affected
substrate specificity of BCO2, we performed
molecular modeling using crystal structure of an
archaeal CCD from Candidatus Nitrosotalea
devanaterra (NdCCD) (46). This protein shows a
similar arrangement of amino acid side residues
as vertebrate CCDs in the substrate tunnel and its
structure was resolved with a bound carotenoid
substrate (46). As shown in figure 6B, GKAA
insertion is present on the surface of BCO2 and
away from active site. Side view of the model
shows that the GKAA insertion did not hinder
docking of 3-hydroxy-β-12’-apocarotenal into
the substrate tunnel of mBCO2 and the chimeric
mBCO2 (Fig. 6A). Furthermore, modeling
revealed that the arrangement of amino acids in
the substrate tunnel is well conserved between
mBCO2 and human BCO2 (Fig. 6C). To
demonstrate that the structural predictions
translate into catalytic activity, we tested several
carotenoid substrates with mouse BCO2 and the
its chimeric counterpart. In a first set of assays we
incubated the proteins with detergent micelles
that contained 3(R),3’(R)-β,β-carotene-diol,
3(R),3’(S)-β,β-carotene-diol, and 3(S),3’(S)-β,β-
carotene-diol. After the reaction, carotenoids and
apocarotenoids were extracted and separated by
HPLC analysis. All three enantiomers were
converted by the recombinant mBCO2 and its
chimeric variant (Fig. 7 and Fig. S9). The major
cleavage products were 10’,10-diapocarotene-
10,10’-dial and 3-hydroxy-β-ionone. Minor
cleavage product was 3-hydroxy-β-apo-10’-
carotenal. The identity of the different cleavage
products of zeaxanthin enantiomers was
confirmed by the spectral characteristics as well
as by the specific masses of these compounds by
LC-MS analysis (Fig. 7 and Fig. S9).
Discussion
Human genomes encode three members of the
CCD superfamily of non-heme iron oxygenases
(50). These structurally conserved enzymes
catalyze reactions at the aqueous lipid interface
and convert their substrates into more polar
products. The challenging biochemistry of CCDs
had led to many conflicting results about these
enzymes’ functions. For instance, RPE65, the
first member of the vertebrate CCD family
member to be molecularly identified (51), was
initially characterized as retinoid binding protein
rather than an enzyme catalyst (52,53). Other
studies even questioned the existence BCO1
enzyme for vitamin A production (54). Moreover,
two reports concluded that human BCO2 gene
encodes an enzymatically inactive protein
(32,33), indicating that BCO2 functions in
carotenoid catabolism and vitamin A production
are not conserved in primates. We here showed
that human BCO2 variants are expressed as pre-
proteins with MTS. Removal of this sequence
from BCO2a rendered the recombinant enzyme
soluble and active. We further show that a
primate specific GKAA insertion does not
impede substrate specificity and catalytic activity
of a chimeric mBCO2 enzyme. Thus, we
demonstrate that BCO2 biochemistry and
physiological functions are evolutionarily well
conserved in the primate lineage.
Improving the expression of recombinant
CCDs
A critical requirement for the biochemical
characterization of CCDs is a robust and reliable
expression system for the recombinant proteins.
We here established protocols to express human
BCO2 in soluble and enzymatically active form.
With the pTrc expression system, we initially
confirmed that BCO2a (579 aa) is inactive when
expressed in zeaxanthin producing bacteria.
However, human BCO2b (545 aa) was active in
We used mouse liver to isolate oxidized
zeaxanthin metabolites, including ε,ε-Carotene-
3,3′-dione and β,ε-3-hydroxy-carotene-3’-one.
We and others previously showed that these
oxidation products accumulate in mouse tissues
upon zeaxanthin supplementation (25,47). We
then employed the isolated zeaxanthin
6

this test system. We provided evidence that
inactivity of BCO2a is caused by the MTS. We
showed that this N-terminal sequence targets a
GFP reporter into mitochondria of ARPE-19
cells. In contrast, a GFP fused to the N-terminal
part of BCO1 was targeted to the cytoplasm. We
also provided evidence that the MTS of BCO2 is
removed during mitochondrial import since
BCO2a, BCO2b, and mBCO2 displayed the same
molecular size when expressed in in ARPE-19. In
contrast, BCO2a migrated with a significantly
higher molecular weight when expressed in
bacterial cells where this processing does not take
place.
zeaxanthin enantiomers and oxidation products.
Kinetic tests with an apocarotenoid substrate
showed that the chimeric BCO2 enzyme
exhibited a lower turnover rate when compared to
mBCO2 (kcat 0.4 x s-1 versus 0.9 x s-1). In general,
the very low turnover rates of BCO2 makes it
very challenging to characterize this type of
enzyme. In enzyme assays, relatively large
amounts of proteins must be incubated to produce
apocarotenoid product concentrations that
become detectable in colorimetric assays. The
lower extinction coefficient of the apocarotenoid
products and its chemical instability also
complicates its detection. These problems likely
contributed to the difficulties in characterizing of
human BCO2 in previous studies. Improved
expression methods, as presented here,
eventually overcame these challenges. Ultra-
high-performance liquid chromatography and
more sensitive detection systems for the
apocarotenoid products may further improve
biochemical assays in futures studies.
Removal of the MTS increased solubility of the
recombinant BCO2 and resulted in a catalytically
active enzyme. This activity was further
enhanced by the fusion of the BCO2 open reading
frame with MBP that further improved the
solubility of the protein. Similarly, biochemical
characterization of ferret, chicken, and macaque
BCO2 were previously achieved with N-
terminally truncated proteins (23,33,55). Only
human BCO2b (545 aa) and mBCO2 (532 aa)
(25) displayed enzymatic activity when
expressed with their MTS. However, both
proteins exhibit a significantly shorter MTS than
BCO2a, macaque, chicken, and ferret BCO2.
Primate BCO2s also exhibit a four amino acid
long residue GKAA insertion at position169-172
(numbering refers to BCO2a) which is not
present in other mammalian BCO2s. It was
proposed that this insertion inactivates the human
enzyme by sterically interfering with substrate
binding (32). Moreover, it was reported that
introduction of these four amino acids into
mBCO2 inactivates the protein (32). To
investigate the putative structural changes
brought on by the GKAA insertion, we modeled
BCO2s using the recently solved crystal of
NdCCD (46). Upon homology modeling, no
marked structural difference between primate and
rodent BCO2s were observed. The GKAA
insertion did localize away from the substrate
tunnel and did not pose an obstruction to the
substrate tunnel. Additionally, we showed the
atomic structure of the substrate tunnel is well
conserved between the human and the mouse
enzymes. Test for enzymatic activity, revealed
that chimeric mBCO2 is catalytically competent
and displayed broad substrate specificity for
Implications for carotenoid biology
Through our demonstration that human BCO2 is
a catalytically competent enzyme, all of the prior
physiological information on BCO2 becomes
applicable in human biology. The BCO2-
dependent catabolism of carotenoids provides an
explanation for the observation that serum and
tissue levels of xanthophyll reaches steady state
levels during supplementation (56). Additionally,
it provides a mechanism for the catabolism of
oxidized carotenoid metabolites. We and others
have shown that these compounds are produced
from carotenoids and that their accumulation is
associated with adverse health effects in adult
vertebrates (25,57,58) and their offspring (59,60).
We also showed that BCO2 protected human cell
lines from oxidative stress induced by
carotenoids (59). Oxidized carotenoids also exist
in the human retina and their occurrence is
associated with blue light, superoxide anions, and
free radicals (48,61,62). As we showed here,
BCO2 readily converts oxidized zeaxanthin
metabolites into two ionones and a C14-apo-
carotendial by oxidative cleavage at position
C9,C10 and C9’,C10’ of the parent carotenoids.
Conversion of lipids to more polar products is a
textbook example for the catabolism of lipophilic
xenobiotics. One can assume that the formed
apocarotenoid products are available for further
7

enzymatic modifications that eventually lead to
their excretion from the body. Thus, our studies
indicate that BCO2’s role as scavenger of
carotenoids and guardian of lipid homeostasis is
well conserved in humans.
for vitamin A production and carotenoid
homeostasis are well conserved during primate
evolution.
Experimental procedures
A previous study reported that BCO2a is the
major transcript of the BCO2 gene in the retina of
the human eyes (32). We here detected both
BCO2a and BCO2b transcripts in RNA
preparation of retinas of human donor eyes,
indicating that individual differences exists the
expression of BCO2 splice variants. A recent
study showed that BCO2 mRNA is highly
expressed in the peripheral retina and at low level
in the central retina (63), consistent with the
distribution of macula pigments. It remains to be
investigated whether the different BCO2 splice
variants display a differential expression in
central and peripheral parts of the retina.
However, our finding that BCO2a and BCO2b
mRNA encode mature proteins of similar
molecular sizes, indicate that there is no
functional difference between these splice
variants.
Differential expression of BCO2 gene may
contribute to carotenoid biology in mammals. For
instance, rodents with low carotenoid serum and
tissue levels express BCO2 in the gastrointestinal
tract (22,64). In contrast, BCO2 expression is
very low in the gastrointestinal tract of humans
(44). This difference indicate that rodents
catabolize absorbed carotenoids in the gut
whereas humans absorb them intact for the
distribution to peripheral tissues. In chicken, a
polymorphism in the Bco2 promoter region
defines skin color (17) and variability in Bco2
expression contribute to sexual dichromatism
across finches (65). In lizards, skin ornamentation
is also dependent BCO2 expression (66). The
identification of the molecular components which
regulate BCO2 mRNA expression will provide
answers to the molecular basis of this diversity in
vertebrate BCO2 biology.
Materials
All chemicals, unless otherwise stated, were
purchased from Fisher and Sigma Aldrich.
Dulbecco's modified Eagle's medium (DMEM),
fetal bovine serum (FBS), and TRIzol RNA
isolation reagent were obtained from Invitrogen.
The anti-mouse and anti-rabbit horseradish
peroxidase-conjugated secondary antibodies
were purchased from Promega (Madison, WI).
RIPA Buffer was purchased from Cell Signaling
Technology (Danvers, MA). Carotenoids and
apocarotenoids were a gift from DSM (Sisseln,
Switzerland). Plasmid and RNA isolation kits
were purchased from Qiagen (Hilden, Germany).
Human retina samples
Human retina samples were gifted by Dr. Min
Hyung Kang (Ophthalmology, Case Western
Reserve University). Donor eyes were acquired
from Lions Gift of Sight (formerly referred to as
Minnesota Lions Eye Bank) in St. Paul, MN.
They were obtained with the written consent of
the donor or donor’s family for medical research
in compliance with the Declaration of Helsinki.
Lions Gift of Sight is licensed by the Eye Bank
Association of America (accreditation #0015204)
and accredited by the FDA (FDA Established
Identifier 3000718538). The retina was dissected
and used for total RNA preparations using TRIzol
RNA isolation reagent (Invitrogen).
RT-PCR analysis of human BCO2 expression
The following forward primers were used for RT-
PCR analysis of human BCO2 expression: 5’-
AGGAGTCATTCTGCCACTGC-3’ for BCO2a
(579-aa),
GACATGGCAACTGGATCTTGAAGG-3’for
BCO2b (545-aa), and 5’-
CAACTGGATCTTGAAGGATGAG-3’for
BCO2c (539-aa). The reverse primer used for all
human BCO2 isoforms was 5’-
TCTCTGGAGGAACCCGAATAACC-3’.
RHO, GAPDH, and ACTB were used as positive
standards. RHO forward and reverse primers are:
5’-CCATCATGGGCGTTGCCTTC-3’and 5’-
TCGTTGTTGACCTCCGGCTT-3’
respectively. GAPDH forward and reverse
primers
5’-
In conclusion, we established methods to
express recombinant human BCO2 in enzymatic
active form. Removal of a MTS from the
recombinant protein was instrumental in this
endeavor. We also showed that a GKAA insertion
did not render mouse BCO2 enzyme inactive or
impeded its broad substrate specificity. Thus, we
provide evidence that major vertebrate pathways
are:
5'-
8

ACAACTTTGGTATCGTGGAAGG-3’ and 5'-
GCCATCACGCCACAGTTTC-3’ respectively.
ACTB forward and reverse primers are: 5’-
CTGGAACGGTGAAGGTGACA-3’ and 5’-
AAGGGACTTCCTGTAACAATGCA-3’
respectively.
probed with either commercial anti-BCO2
(Proteintech Group, Cat. No 14323-1-AP) or anti-
V5 antibody (Invitrogen, Cat. No R960-25), or
anti-maltose binding protein antibody (New
England Biolabs, Cat. No. E8032S) (1:1000
dilution) overnight at 4°C, followed by
incubation with the appropriate HRP-conjugated
secondary antibody, before being visualized with
the enhanced ECL chemiluminescence detection
system (Pierce or Pharmacia).
BCO2 plasmid constructs for Escherichia coli
expression
Untagged full-length human BCO2a (579-aa) and
human BCO2b (545-aa) isoforms (Fig. 1A) were
previously generated and cloned into the
pTrcHis2 expression vectors (Invitrogen, Grand
Island, NY) (35). Synthetic codon usage
optimized human BCO2 variants, 522-aa and
519-aa, were custom made by GenScript
(Piscataway, NJ). These synthetic BCO2 variants
were sub-cloned into the pMAL-c5x vector (New
England Biolabs, Ipswich, MA). The forward
Cell-based BCO2 enzymatic activity
XL1-Blue strain of E. coli, engineered to produce
the zeaxanthin (43), was transformed with the
different BCO2 expression plasmids. Zeaxanthin
producing E. coli cells were grown in lysogeny
broth (LB) medium at 37°C. Once an optical
density of one absorbance unit at 600 nm (one
OD600) was achieved, bacterial cell cultures were
transferred to 27°C for 1 h to achieve production
of zeaxanthin. To induce expression of BCO2
isoforms, isopropyl-D-1-thiogalactopyranoside
was added to a final concentration of 0.3 mM.
Ferrous sulfate at the concentration of 25mg/L
was added at the time of induction. Expression
continued at 16°C for 24 h. Cells were harvested
by centrifugation at 4000 g for 15 min at 4°C.
Carotenoid extraction from the bacterial pellet
was performed under dim red light (< 600 nm). A
bacteria pellet (20 OD600) were dissolved in 250
µL PBS buffer. Then 400 µL acetone, 400 µL
diethyl ether, and 100 µL petroleum ether was
used to extract carotenoids. Phase separation was
achieved by centrifugation at 4000 x g for 30
seconds. The organic phase was collected and the
extraction was repeated. The combined organic
phases were collected and dried in a Speedvac
(Eppendorf, Hauppauge, NY). Lipids were
dissolved in 150 µL hexane: ethylacetate (70:30
v/v) and subjected to HPLC analysis.
Production o recombinant BCO2 in bacteria
BL21 E. coli cells were transformed with the
respective BCO2 plasmid constructs. E. coli cells
were grown in LB medium at 37°C. Once an
optical density of one absorbance unit (AU) at
600 nm was achieved, expression of BCO2
isoforms were induced with final concentration of
0.3 mM IPTG and transferred to 16°C for 24 h.
Ferrous sulfate at the concentration of 25mg/L
was added at the time of induction. After
expression, cells were collected by centrifugation
at 4000 g for 15 min at 4°C and snap frozen at -
primers
ACCACCGTTGAGGAAGCGC-3’ for 522-aa
isoform and 5’-
used
included:
5’-
GAGGAAGCGCCGCGTGGTATC- 3’ for 519-
aa isoform. The reverse primer used for both
isoforms
is
5’
-
AAAACCTGCAGGAATCGGGATAAAGGTA
CCATGAAAG - 3’ (Invitrogen, Carlsbad, CA).
522-aa and 519-aa variants were cloned using the
Xmn1 and Sbfl restriction sites. Mouse BCO2
was cloned into pMAL-c5x vector (New England
Biolabs) using the forward primer, 5’-
AAAGAAGGAATTGTTGGGACCGAAGCAG
AGCCTGCCATGC-3’ and the reverse primer,
5’-
AAAACCTGCAGGGATAGGCACAAAGGTG
CCATGGAACC-3’ into the Xmn1 and Sbfl
restriction sites. A chimeric mouse BCO2 with
the four amino acid insertion, GKAA, was
custom made by GenScript (Piscataway, NJ).
Mouse BCO2 with the GKAA insert was cloned
into the pMAL-c5x vector using BamHI and
HindIII as the restriction sites. The sequences of
all plasmid constructs were verified by Sanger
sequencing.
Western blotting
Proteins (10-20 μg) were separated on 6–12%
SDS-PAGE gels using the Bio-Rad Mini gel
system and transferred onto polyvinylidene
fluoride membranes (Roche, Basel, Switzerland).
PVDF membranes were blocked with 5% skim
milk prepared in Tris-buffered saline (pH 7.4)
containing 0.1% Tween (TBS-T) for 1 h and then
9

80ºC until further use. Cell pellets of a 500 mL
culture were thawed on ice. The pellet was
dissolved in enzyme assay buffer (20 mM
Tricine, 150 mM NaCl, 1 mM PMSF, 0.5 mM
TCEP, pH7.4). Then, 20 µL lysozyme solution
(10 mg/mL) was added. After mixing, the
solution was incubated for 30 min on ice.
Following incubation, the solution was sonicated
four times at 35% intensity for 1 min with 1 min
break period between each sonication period
using the Q125 Sonicator (QSonica, Newtown,
CT). The lysed bacteria were subjected to
centrifugation (20,000 g) for 1 hour at 4ºC to
separate soluble and insoluble fractions. mBCO2-
GKAA). MBP affinity chromatography was used
to purify murine BCO2-MBP fusion proteins
(mBCO2 and mBCO2-GKAA). Briefly, amylose
resin was packed into a 2.5 X 10 cm column. 5
column volumes of column buffer (20 mM
Tricine, 150 mM NaCl, 0.5 mM TCEP, pH7.4)
was used to wash the column. Crude soluble
fraction was then loaded onto the column at a
flow rate of 2 mL x min-1. Column was then
washed with 12 column volumes of cold column
buffer. Column buffer made with the addition of
10mM maltose was used to elute the fusion
protein. Protein-containing fractions were then
pooled together and analyzed by SDS-PAGE gel
for purity.
the reaction was upscaled to 500 µl and the
decrease of substrate was followed in a
spectrophotometer in real time (Shimadzu,
Kyoto, Japan) at 420 nm. After the reaction,
product formation was verified by lipid extraction
and HPLC analysis.
High-performance liquid chromatography
(HPLC) analysis and mass spectrometry (MS)
analysis
Extracted lipids were separated by HPLC
performed on a 1200 Agilent HPLC series
equipped with a diode array detector and normal-
phase Agilent Zorbax silica column (4.6 mm ID
x 150 mm with 5 µm packing; Agilent, Santa
Clara, CA, USA). Chromatographic separation
was achieved with isocratic flow of 30% ethyl
acetate in hexane at a flow rate of 1.4 mL/min.
The system was scaled with known amounts of
authentic zeaxanthin, β-crytoxanthin, and 3-
hydroxy-12’-β-apocarotenal standards, which
were acquired from DSM (Sisseln, Switzerland).
The products of BCO2 enzymatic activity were
identified based on their elution time,
characteristic UV/Vis spectra and molecular
masses. For MS analysis, separated lipids
extracted from enzymatic reactions were
separated as described above and directed into
LTQ linear ion trap mass spectrometer equipped
with an atmospheric pressure chemical ionization
probe (Thermo Fisher Scientific). The MS signal
acquisition was performed in positive ionization
mode and the MS parameters were optimized for
all-trans-retinol.
Cell-free BCO2 enzyme assay
For enzyme assays with 3-hydroxy-β-12’-
carotenal, 100 µL of soluble cell lysate was
combined with 100 µL enzyme assay buffer
containing 0.2
%
(v/v) Triton X-100.
BCO2 transfection and expression in ARPE19
cells
Alternatively, 50 µg of purified BCO2 protein
was incubated in enzyme assay buffer containing
0.2 % (v/v) Triton X-100. In standard assays
substrate 3-hydroxy-β-12’-carotenal dissolved in
ethanol was added to reach a final concentration
of 10 µM. In kinetic analysis with purified
mBCO2, different concentrations of substrate (4
– 16 µM final concentration) were used. Assay
with carotenoids were performed as previously
described (23). Assays were incubated at 37ºC on
a thermomixer (Eppendorf, Hamburg, Germany)
under constant shaking (600 rpm). In standard
tests, the reaction was stopped after 12 min by
adding 400 µL acetone, 400 µL diethylether, 100
µL petroleum ether and lipids were extracted as
described above and subjected to HPLC analyses.
For kinetic analysis with mouse BCO2 variants,
We used pcDNA3.1 expression plasmid for the
579 (BCO2a) and 545 (BCO2b) amino acid long
human BCO2 proteins as well as the 532 amino
acid mouse BCO2 (mBCO2). The construction of
these plasmids has been previously described
(35). To confirm the function of human BCO2’s
MTS, we used the pcDNA3.1/CT-GFP
(Invitrogen, Grand Island, NY) expression
plasmid to generate a BCO2a-GFP fusion
construct that encoded the first 70 amino acids of
BCO2a fused to GFP. The forward and reserve
primers used for this were the following: 5’-
AGGATGGTTTTTCGAGTCTTTCTCC-3’ and
5’-TAGCAGAGATGCCCCGTGGAGCC-3’,
respectively. A BCO1-GFP construct was used as
a control and generated in the same manner as
10

BCO2a-GFP. The forward and reserve primers
used were the following: 5’-
AGGATGGATATAATATTTGGCAGGAATA
G-3’ and 5’-
TCCTGTAATAGACTTCACCGTCTC-3’,
respectively. ARPE-19 cells were maintained in
DMEM-F12 media with 10% FBS and 10 U/mL
penicillin-streptomycin antibiotics, at 37°C with
5% CO2. For transfection, cells were grown to
50–70% confluence and then transfected with
serum (Cell Signaling, Boston, MA USA) at
1:200 dilution. Cells were then washed and
incubated with anti-mouse and anti-rabbit
secondary antibody conjugated to Alexa 594 and
Alexa 488 (Life Technologies, Grand Island, NY,
USA), respectively, diluted 1:500 in blocking
buffer at room temperature for 1h. DAPI was
used to stain nuclei. For staining of mitochondria,
transfected ARPE-19 cells were incubated with
200 nM MitoTracker® Orange CMTMRos
(Molecular Probes, Invitrogen) for 30 min in PBS
at 37°C, 5% CO2 in CO2 incubator. Cells were
then washed with PBS and fixed in freshly
prepared solution of 4% paraformaldehyde in
PBS for 30 min at room temperature. Cells were
then washed with PBS and mounted with DAPI
fluormount (SouthernBiotech). All confocal
images were acquired with a Leica TCS SP8
HyVolution2 confocal microscope by using a
multiline argon laser (excitation 488 and 594 nm)
or a 405-diode laser (excitation 405) with a 63X
C-Apochromat, NA 1.2-O objective.
purified
plasmid
using
TransIT-X2®
Transfection Reagent (Mirus Bio). At 24 h post-
transfection, cells were either used for in situ
immunocytochemistry or used for protein
isolation. To isolate total protein, cells were
scrapped then centrifuged at 300 g for 5 min at
4°C. Cell pellets were dissolved in NP40-lysis
buffer lysis buffer and incubated on ice for 10
min. The solution was then centrifuged again at
10,000 g for 10 min at 4°C. The supernatant was
stored at −80°C for further analysis.
Confocal Imaging
Transfected ARPE-19 cells grown on polylysine-
treated 8-chamber slides glass coverslips were
washed and fixed with freshly prepared solution
of 4% paraformaldehyde in PBS (137 mM NaCl,
2.7 mM KCl, 4.3 mM Na2HPO4, and 1.4 mM
KH2PO4, pH 7.3) for 30 mins at room
Homology modeling of mouse BCO2
(mBCO2) and humanized mouse BCO2
(mBCO2-GKAA)
Swiss modeling was used to build a
homology model for the different BCO2
enzymes (67). Then, carotenoid and
apocarotenoids were modelled into the
substrate-binding cavity using NdCCD
structure (PDB accession number 6VCH)
(46) and Coot software. Pymol software was
used to align structures and to create figure.
temperature.
Cells
were
washed
and
permeabilized with 0.1% Triton X-100 (Roche)
in PBS and blocked with 4% normal goat serum
(Sigma) in PBS-T (blocking buffer). Cells were
then incubated overnight at 4°C in blocking
buffer containing mouse anti-V5 serum (to detect
BCO2; Invitrogen) and rabbit anti-COX IV
Data availability
All data is included within the manuscript and supporting information.
Support Information
This article contains Figures S1-S9
Acknowledgments
The Leica TCS SP8 confocal used for these studies was made available in the SOM Light Microscopy
Imaging Core by funding from NIH ORIP S10-OD024996. Technical assistance was provided by Richard
Lee. We wish to thank Dr. Min Hyung Kang (Ophthalmology, Case Western Reserve University) for
sharing retinal samples for RNA isolation. We wish to thank Dr. Adrian Wyss (DSM) for the gift of 3-
hydroxy-β-12-apo-carotenal and zeaxanthin enantiomers.
Author contributions
11

L.D.T. contributed to design, acquisition of data, analysis of data, and drafted the manuscript. S.B.
performed acquisition of data and structural modeling, V.M.P. contributed to the acquisition of data and
performed immunohistochemistry, N.K. contributed to the acquisition and analysis of data, S.R.
contributed to the acquisition and analysis of data, M.G. performed mass spectrometry and helped design
experiments, P.D.K. contributed to the design of the study and data analysis, and J.V.L. contributed to the
conception, design, analysis of data, and drafted the manuscript.
Funding and additional information
The research was supported by grants from the National Eye Institute (EY02551, EY028121, EY007157
to J.V.L., and EY023948 to M.G.) and P30 Core grant EY011373 as well as the Department of Veterans
Affairs (I01BX004939 to P.D.K.). The content is solely the responsibility of the authors and does not
necessarily represent the official views of the National Institutes of Health.
Conflict of interest
The authors declare that they have no conflicts of interest with the contents of this article.
References
1.
von Lintig, J., Moon, J., and Babino, D. (2020) Molecular components affecting ocular
carotenoid and retinoid homeostasis. Prog Retin Eye Res, 100864
2.
Miller, A. P., Coronel, J., and Amengual, J. (2020) The role of beta-carotene and vitamin A in
atherogenesis: Evidences from preclinical and clinical studies. Biochim Biophys Acta Mol Cell
Biol Lipids, 158635
3.
Bernstein, P. S., Li, B., Vachali, P. P., Gorusupudi, A., Shyam, R., Henriksen, B. S., and Nolan, J.
M. (2016) Lutein, zeaxanthin, and meso-zeaxanthin: The basic and clinical science underlying
carotenoid-based nutritional interventions against ocular disease. Prog Retin Eye Res 50, 34-66
Mares, J. (2016) Lutein and Zeaxanthin Isomers in Eye Health and Disease. Annu Rev Nutr 36,
571-602
Grune, T., Lietz, G., Palou, A., Ross, A. C., Stahl, W., Tang, G., Thurnham, D., Yin, S. A., and
Biesalski, H. K. (2010) Beta-carotene is an important vitamin A source for humans. J Nutr 140,
2268S-2285S
4.
5.
6.
7.
8.
9.
Johnson, E. J. (2014) Role of lutein and zeaxanthin in visual and cognitive function throughout
the lifespan. Nutr Rev 72, 605-612
Krinsky, N. I., and Johnson, E. J. (2005) Carotenoid actions and their relation to health and
disease. Molecular aspects of medicine 26, 459-516
Widjaja-Adhi, M. A. K., Ramkumar, S., and von Lintig, J. (2018) Protective role of carotenoids
in the visual cycle. FASEB J, fj201800467R
Barker, F. M., 2nd, Snodderly, D. M., Johnson, E. J., Schalch, W., Koepcke, W., Gerss, J., and
Neuringer, M. (2011) Nutritional manipulation of primate retinas, V: effects of lutein, zeaxanthin,
and n-3 fatty acids on retinal sensitivity to blue-light-induced damage. Invest Ophthalmol Vis Sci
52, 3934-3942
10.
Hammond, B. R., Jr., Fletcher, L. M., and Elliott, J. G. (2013) Glare disability, photostress
recovery, and chromatic contrast: relation to macular pigment and serum lutein and zeaxanthin.
Invest Ophthalmol Vis Sci 54, 476-481
11.
12.
13.
von Lintig, J., Moon, J., Lee, J., and Ramkumar, S. (2019) Carotenoid metabolism at the
intestinal barrier. Biochim Biophys Acta Mol Cell Biol Lipids, 158580
Harrison, E. H. (2019) Mechanisms of Transport and Delivery of Vitamin A and Carotenoids to
the Retinal Pigment Epithelium. Mol Nutr Food Res, e1801046
Kiefer, C., Sumser, E., Wernet, M. F., and Von Lintig, J. (2002) A class B scavenger receptor
mediates the cellular uptake of carotenoids in Drosophila. Proc Natl Acad Sci 99, 10581-10586
12

14.
15.
Toomey, M. B., Lopes, R. J., Araujo, P. M., Johnson, J. D., Gazda, M. A., Afonso, S., Mota, P.
G., Koch, R. E., Hill, G. E., Corbo, J. C., and Carneiro, M. (2017) High-density lipoprotein
receptor SCARB1 is required for carotenoid coloration in birds. Proc Natl Acad Sci U S A 114,
5219-5224
Sakudoh, T., Sezutsu, H., Nakashima, T., Kobayashi, I., Fujimoto, H., Uchino, K., Banno, Y.,
Iwano, H., Maekawa, H., Tamura, T., Kataoka, H., and Tsuchida, K. (2007) Carotenoid silk
coloration is controlled by a carotenoid-binding protein, a product of the Yellow blood gene. Proc
Natl Acad Sci U S A 104, 8941-8946
16.
17.
Li, B., Vachali, P., Frederick, J. M., and Bernstein, P. S. (2011) Identification of StARD3 as a
lutein-binding protein in the macula of the primate retina. Biochemistry 50, 2541-2549
Eriksson, J., Larson, G., Gunnarsson, U., Bed'hom, B., Tixier-Boichard, M., Stromstedt, L.,
Wright, D., Jungerius, A., Vereijken, A., Randi, E., Jensen, P., and Andersson, L. (2008)
Identification of the yellow skin gene reveals a hybrid origin of the domestic chicken. PLoS
Genet 4, e1000010
18.
Hessel, S., Eichinger, A., Isken, A., Amengual, J., Hunzelmann, S., Hoeller, U., Elste, V.,
Hunziker, W., Goralczyk, R., Oberhauser, V., von Lintig, J., and Wyss, A. (2007) CMO1
deficiency abolishes vitamin A production from beta-carotene and alters lipid metabolism in
mice. J Biol Chem 282, 33553-33561
19.
20.
Toews, D. P., Taylor, S. A., Vallender, R., Brelsford, A., Butcher, B. G., Messer, P. W., and
Lovette, I. J. (2016) Plumage Genes and Little Else Distinguish the Genomes of Hybridizing
Warblers. Curr Biol 26, 2313-2318
Borel, P., de Edelenyi, F. S., Vincent-Baudry, S., Malezet-Desmoulin, C., Margotat, A., Lyan, B.,
Gorrand, J. M., Meunier, N., Drouault-Holowacz, S., and Bieuvelet, S. (2011) Genetic variants in
BCMO1 and CD36 are associated with plasma lutein concentrations and macular pigment optical
density in humans. Annals of medicine 43, 47-59
21.
Meyers, K. J., Johnson, E. J., Bernstein, P. S., Iyengar, S. K., Engelman, C. D., Karki, C. K., Liu,
Z., Igo, R. P., Jr., Truitt, B., Klein, M. L., Snodderly, D. M., Blodi, B. A., Gehrs, K. M., Sarto, G.
E., Wallace, R. B., Robinson, J., LeBlanc, E. S., Hageman, G., Tinker, L., and Mares, J. A.
(2013) Genetic determinants of macular pigments in women of the Carotenoids in Age-Related
Eye Disease Study. Invest Ophthalmol Vis Sci 54, 2333-2345
22.
23.
24.
25.
26.
27.
Kiefer, C., Hessel, S., Lampert, J. M., Vogt, K., Lederer, M. O., Breithaupt, D. E., and von Lintig,
J. (2001) Identification and characterization of a mammalian enzyme catalyzing the asymmetric
oxidative cleavage of provitamin A. J Biol Chem 276, 14110-14116
Babino, D., Palczewski, G., Widjaja-Adhi, M. A., Kiser, P. D., Golczak, M., and von Lintig, J.
(2015) Characterization of the Role of beta-Carotene 9,10-Dioxygenase in Macular Pigment
Metabolism. J Biol Chem 290, 24844-24857
Mein, J. R., Dolnikowski, G. G., Ernst, H., Russell, R. M., and Wang, X. D. (2010) Enzymatic
formation of apo-carotenoids from the xanthophyll carotenoids lutein, zeaxanthin and beta-
cryptoxanthin by ferret carotene-9',10'-monooxygenase. Arch Biochem Biophys 506, 109-121
Amengual, J., Lobo, G. P., Golczak, M., Li, H. N., Klimova, T., Hoppel, C. L., Wyss, A.,
Palczewski, K., and von Lintig, J. (2011) A mitochondrial enzyme degrades carotenoids and
protects against oxidative stress. FASEB J 25, 948-959
Amengual, J., Widjaja-Adhi, M. A., Rodriguez-Santiago, S., Hessel, S., Golczak, M., Palczewski,
K., and von Lintig, J. (2013) Two carotenoid oxygenases contribute to mammalian provitamin A
metabolism. J Biol Chem 288, 34081-34096
Costabile, B. K., Kim, Y. K., Iqbal, J., Zuccaro, M. V., Wassef, L., Narayanasamy, S., Curley, R.
W., Jr., Harrison, E. H., Hussain, M. M., and Quadro, L. (2016) beta-Apo-10'-carotenoids
Modulate Placental Microsomal Triglyceride Transfer Protein Expression and Function to
Optimize Transport of Intact beta-Carotene to the Embryo. J Biol Chem 291, 18525-18535
Berry, S. D., Davis, S. R., Beattie, E. M., Thomas, N. L., Burrett, A. K., Ward, H. E., Stanfield,
A. M., Biswas, M., Ankersmit-Udy, A. E., Oxley, P. E., Barnett, J. L., Pearson, J. F., van der
28.
13

Does, Y., Macgibbon, A. H., Spelman, R. J., Lehnert, K., and Snell, R. G. (2009) Mutation in
bovine beta-carotene oxygenase 2 affects milk color. Genetics 182, 923-926
Tian, R., Pitchford, W. S., Morris, C. A., Cullen, N. G., and Bottema, C. D. (2009) Genetic
variation in the beta, beta-carotene-9', 10'-dioxygenase gene and association with fat colour in
bovine adipose tissue and milk. Anim Genet 41, 253-259
Vage, D. I., and Boman, I. A. (2010) A nonsense mutation in the beta-carotene oxygenase 2
(BCO2) gene is tightly associated with accumulation of carotenoids in adipose tissue in sheep
(Ovis aries). BMC genetics 11, 10
Strychalski, J., Brym, P., Czarnik, U., and Gugolek, A. (2015) A novel AAT-deletion mutation in
the coding sequence of the BCO2 gene in yellow-fat rabbits. Journal of applied genetics 56, 535-
537
Li, B., Vachali, P. P., Gorusupudi, A., Shen, Z., Sharifzadeh, H., Besch, B. M., Nelson, K.,
Horvath, M. M., Frederick, J. M., Baehr, W., and Bernstein, P. S. (2014) Inactivity of human
beta,beta-carotene-9',10'-dioxygenase (BCO2) underlies retinal accumulation of the human
macular carotenoid pigment. Proc Natl Acad Sci U S A 111, 10173-10178
Dela Sena, C., Sun, J., Narayanasamy, S., Riedl, K. M., Yuan, Y., Curley, R. W., Jr., Schwartz, S.
J., and Harrison, E. H. (2016) Substrate Specificity of Purified Recombinant Chicken beta-
Carotene 9',10'-Oxygenase (BCO2). J Biol Chem 291, 14609-14619
29.
30.
31.
32.
33.
34.
Poliakov, E., Soucy, J., Gentleman, S., Rogozin, I. B., and Redmond, T. M. (2017) Phylogenetic
analysis of the metazoan carotenoid oxygenase superfamily: a new ancestral gene assemblage of
BCO-like (BCOL) proteins. Scientific reports 7, 13192
35.
36.
Palczewski, G., Amengual, J., Hoppel, C. L., and von Lintig, J. (2014) Evidence for
compartmentalization of mammalian carotenoid metabolism. FASEB J 28, 4457-4469
Kim, Y. S., Yeom, S. J., and Oh, D. K. (2011) Production of beta-apo-10'-carotenal from beta-
carotene by human beta-carotene-9',10'-oxygenase expressed in E. coli. Biotechnology letters 33,
1195-1200
37.
Kelly, M. E., Ramkumar, S., Sun, W., Colon Ortiz, C., Kiser, P. D., Golczak, M., and von Lintig,
J. (2018) The Biochemical Basis of Vitamin A Production from the Asymmetric Carotenoid beta-
Cryptoxanthin. ACS Chem Biol 13, 2121-2129
38.
39.
Eggersdorfer, M., and Wyss, A. (2018) Carotenoids in human nutrition and health. Arch Biochem
Biophys 652, 18-26
Bohn, T., Desmarchelier, C., Dragsted, L. O., Nielsen, C. S., Stahl, W., Ruhl, R., Keijer, J., and
Borel, P. (2017) Host-related factors explaining interindividual variability of carotenoid
bioavailability and tissue concentrations in humans. Mol Nutr Food Res 61
Omenn, G. S., Goodman, G., Thornquist, M., Grizzle, J., Rosenstock, L., Barnhart, S., Balmes, J.,
Cherniack, M. G., Cullen, M. R., Glass, A., and et al. (1994) The beta-carotene and retinol
efficacy trial (CARET) for chemoprevention of lung cancer in high risk populations: smokers and
asbestos-exposed workers. Cancer Res 54, 2038s-2043s
Omenn, G. S., Goodman, G. E., Thornquist, M. D., Balmes, J., Cullen, M. R., Glass, A., Keogh,
J. P., Meyskens, F. L., Valanis, B., Williams, J. H., Barnhart, S., and Hammar, S. (1996) Effects
of a combination of beta carotene and vitamin A on lung cancer and cardiovascular disease. N
Engl J Med 334, 1150-1155
40.
41.
42.
43.
von Lintig, J., and Vogt, K. (2000) Filling the gap in vitamin A research. Molecular identification
of an enzyme cleaving beta-carotene to retinal. J Biol Chem 275, 11915-11920
Misawa, N., Nakagawa, M., Kobayashi, K., Yamano, S., Izawa, Y., Nakamura, K., and
Harashima, K. (1990) Elucidation of the Erwinia uredovora carotenoid biosynthetic pathway by
functional analysis of gene products expressed in Escherichia coli. J Bacteriol 172, 6704-6712
Lindqvist, A., He, Y. G., and Andersson, S. (2005) Cell type-specific expression of beta-carotene
9',10'-monooxygenase in human tissues. J Histochem Cytochem 53, 1403-1412
44.
14

45.
46.
47.
Kowatz, T., Babino, D., Kiser, P., Palczewski, K., and von Lintig, J. (2013) Characterization of
human beta,beta-carotene-15,15'-monooxygenase (BCMO1) as a soluble monomeric enzyme.
Arch Biochem Biophys 539, 214-222
Daruwalla, A., Zhang, J., Lee, H. J., Khadka, N., Farquhar, E. R., Shi, W., von Lintig, J., and
Kiser, P. D. (2020) Structural basis for carotenoid cleavage by an archaeal carotenoid
dioxygenase. Proc Natl Acad Sci U S A
Nagao, A., Maoka, T., Ono, H., Kotake-Nara, E., Kobayashi, M., and Tomita, M. (2015) A 3-
hydroxy beta-end group in xanthophylls is preferentially oxidized to a 3-oxo epsilon-end group in
mammals. J Lipid Res 56, 449-462
48.
49.
Khachik, F., Bernstein, P. S., and Garland, D. L. (1997) Identification of lutein and zeaxanthin
oxidation products in human and monkey retinas. Invest Ophthalmol Vis Sci 38, 1802-1811
Khachik, F., de Moura, F. F., Zhao, D. Y., Aebischer, C. P., and Bernstein, P. S. (2002)
Transformations of selected carotenoids in plasma, liver, and ocular tissues of humans and in
nonprimate animal models. Invest Ophthalmol Vis Sci 43, 3383-3392
50.
51.
Daruwalla, A., and Kiser, P. D. (2019) Structural and mechanistic aspects of carotenoid cleavage
dioxygenases (CCDs). Biochim Biophys Acta Mol Cell Biol Lipids, 158590
Hamel, C. P., Tsilou, E., Pfeffer, B. A., Hooks, J. J., Detrick, B., and Redmond, T. M. (1993)
Molecular cloning and expression of RPE65, a novel retinal pigment epithelium-specific
microsomal protein that is post-transcriptionally regulated in vitro. J Biol Chem 268, 15751-
15757
52.
53.
Gollapalli, D. R., Maiti, P., and Rando, R. R. (2003) RPE65 operates in the vertebrate visual
cycle by stereospecifically binding all-trans-retinyl esters. Biochemistry 42, 11824-11830
Mata, N. L., Moghrabi, W. N., Lee, J. S., Bui, T. V., Radu, R. A., Horwitz, J., and Travis, G. H.
(2004) Rpe65 is a retinyl ester binding protein that presents insoluble substrate to the isomerase
in retinal pigment epithelial cells. J Biol Chem 279, 635-643
54.
55.
Hansen, S., and Maret, W. (1988) Retinal is not formed in vitro by enzymatic central cleavage of
beta-carotene. Biochemistry 27, 200-206
Hu, K. Q., Liu, C., Ernst, H., Krinsky, N. I., Russell, R. M., and Wang, X. D. (2006) The
biochemical characterization of ferret carotene-9',10'-monooxygenase catalyzing cleavage of
carotenoids in vitro and in vivo. J Biol Chem 281, 19327-19338
56.
57.
58.
Hartmann, D., Thurmann, P. A., Spitzer, V., Schalch, W., Manner, B., and Cohn, W. (2004)
Plasma kinetics of zeaxanthin and 3'-dehydro-lutein after multiple oral doses of synthetic
zeaxanthin. Am J Clin Nutr 79, 410-417
Lim, J. Y., Liu, C., Hu, K. Q., Smith, D. E., and Wang, X. D. (2018) Ablation of carotenoid
cleavage enzymes (BCO1 and BCO2) induced hepatic steatosis by altering the farnesoid X
receptor/miR-34a/sirtuin 1 pathway. Arch Biochem Biophys 654, 1-9
Wu, L., Guo, X., Lyu, Y., Clarke, S. L., Lucas, E. A., Smith, B. J., Hildebrand, D., Wang, W.,
Medeiros, D. M., Shen, X., and Lin, D. (2017) Targeted Metabolomics Reveals Abnormal
Hepatic Energy Metabolism by Depletion of beta-Carotene Oxygenase 2 in Mice. Scientific
reports 7, 14624
59.
60.
61.
Lobo, G. P., Isken, A., Hoff, S., Babino, D., and von Lintig, J. (2012) BCDO2 acts as a
carotenoid scavenger and gatekeeper for the mitochondrial apoptotic pathway. Development 139,
2966-2977
Spiegler, E., Kim, Y. K., Hoyos, B., Narayanasamy, S., Jiang, H., Savio, N., Curley, R. W., Jr.,
Harrison, E. H., Hammerling, U., and Quadro, L. (2018) beta-apo-10'-carotenoids support normal
embryonic development during vitamin A deficiency. Scientific reports 8, 8834
Bernstein, P. S., Khachik, F., Carvalho, L. S., Muir, G. J., Zhao, D. Y., and Katz, N. B. (2001)
Identification and quantitation of carotenoids and their metabolites in the tissues of the human
eye. Exp Eye Res 72, 215-223
15

62.
63.
64.
Khachik, F., Spangler, C. J., Smith, J. C., Jr., Canfield, L. M., Steck, A., and Pfander, H. (1997)
Identification, quantification, and relative concentrations of carotenoids and their metabolites in
human milk and serum. Anal Chem 69, 1873-1881
Voigt, A. P., Whitmore, S. S., Flamme-Wiese, M. J., Riker, M., Wiley, L. A., Tucker, B. A.,
Stone, E. M., Mullins, R. F., and Scheetz, T. E. (2019) Molecular characterization of foveal
versus peripheral human retina by single-cell RNA sequencing. Exp Eye Res
Raghuvanshi, S., Reed, V., Blaner, W. S., and Harrison, E. H. (2015) Cellular localization of
beta-carotene 15,15' oxygenase-1 (BCO1) and beta-carotene 9',10' oxygenase-2 (BCO2) in rat
liver and intestine. Arch Biochem Biophys 572, 19-27
65.
66.
Chen, N. (2020) A gene for color differences between sexes. Science 368, 1185-1186
Andrade, P., Pinho, C., Perez, I. d. L. G., Afonso, S., Brejcha, J., Rubin, C. J., Wallerman, O.,
Pereira, P., Sabatino, S. J., Bellati, A., Pellitteri-Rosa, D., Bosakova, Z., Bunikis, I., Carretero, M.
A., Feiner, N., Marsik, P., Pauperio, F., Salvi, D., Soler, L., While, G. M., Uller, T., Font, E.,
Andersson, L., and Carneiro, M. (2019) Regulatory changes in pterin and carotenoid genes
underlie balanced color polymorphisms in the wall lizard. Proc Natl Acad Sci U S A 116, 5633-
5642
67.
Waterhouse, A., Bertoni, M., Bienert, S., Studer, G., Tauriello, G., Gumienny, R., Heer, F. T., de
Beer, T. A. P., Rempfer, C., Bordoli, L., Lepore, R., and Schwede, T. (2018) SWISS-MODEL:
homology modelling of protein structures and complexes. Nucleic Acids Res 46, W296-W303
5Abbreviations
CCD: Carotenoid cleavage dioxygenase
BCO1: β-carotene-oxygenase 1
BCO2: β-carotene-oxygenase 2
RPE65: Retinal pigment epithelium-specific 65 kDa protein
RHO: Rhodopsin
ACTB: β-actin
GAPDH: Glyceraldehyde 3-phosphate dehydrogenase
MBP: Maltose-binding protein
MTS: Mitochondrial targeting sequence
NdCCD: Nitrosotalea devanaterra carotenoid cleavage dioxygenase
DMEM: Dulbecco’s Modified Eagle Medium
TCEP: Tris(2-carboxyethyl) phosphine hydrochloride
16

Figures
Figure 1. Expression of BCO2 splice variants in human retina. (A) RT-PCR analysis of the mRNAs of
different human BCO2 splice variants (BCO2a, BCO2b, and BCO2c) in total RNA preparations of two
individual human retinas. mRNA encoding BCO2a and BCO2b are expressed in human retina. (B) RT-
PCR analysis of mRNA expression of Rhodopsin (RHO), Glyceraldehyde 3-phosphate dehydrogenase
(GAPDH), and β-Actin (ACTB). Dashed lines indicate where a single gel image was spliced to exclude
irrelevant lanes.
17

Figure 2. Human BCO2a is enzymatically inactive. Enzymatic activity of human BCO2a and BCO2b
were examined in a cell-based assay. Both human isoforms were expressed in E. coli cells engineered to
produce zeaxanthin. (A) Colors of bacteria pellets expressing BCO2a and BCO2b (B) Quantification of
the amounts of zeaxanthin and β-cryptoxanthin in the bacteria pellets (20 OD600). The whisker plot
represents means +/- SEM from three independent experiments. Asterisks represent p-value of 0.0404 and
0.0168, respectively. (C) Representative HPLC traces at 460 nm of lipid extracts from bacteria pellets
expressing BCO2b (orange) and BCO2a (blue). Peak 1 corresponds to β-cryptoxanthin and peak 2
corresponds to zeaxanthin. Spectral characteristics of each carotenoid are displayed in the lower panel of
(C).
18

Figure 3. Human BCO2b cleaves apocarotenoids. (A) Scheme of the reaction catalyzed by BCO2. 3-
hydroxy-12’-carotenal is cleaved at position C9,C10 into 3-hydroxy-β-ionone and 12’,10-diapocarotene-
12’,10-dial. (B) Representative HPLC traces at 360 nm of assays with BCO2a (blue), BCO2b (orange)
and buffer control (green). 2000 pmol of 3-hydroxy-12’-carotenal were incubated with respective protein
extracts for 12 minutes. Spectral characteristics of peak 1, 12’,10-diapocarotene-12’,10-dial, peak 2, 3-
hydroxy-12’-carotenal; peak 3, putative cis-stereomer of 3-hydroxy-12’-carotenal, and peak 4, 12’,10-
diapocarotene-12’,10-diol are displayed in the lower panel of (B).
19

Figure 4. Human BCO2 is expressed with a mitochondrial target sequence. (A) Western blot of
protein extracts of E. coli and ARPE-19 cells expressing tagged human BCO2 variants. Proteins were
detected with anti-V5 antibody. The empty pcDNA3.1 vector was included as control in ARPE-19 cells.
An amino-terminal truncated version of human BCO2 (522 aa) was included as a control in E. coli
expression analysis. Note that BCO2a displays a slower mobility than that of the 522 amino acid long
truncated variant when expressed in E. coli. In ARPE-19 cells, BCO2a displays a similar mobility as
BCO2b and mBCO2, indicative of post-translational modification. (B) Plasmids for the expression of V5-
tagged BCO2a and BCO2b were transfected into ARPE-19 cells. Immunostaining was performed with
anti-V5 antibody for BCO2a and BCO2b (red), and mitochondria cytochrome oxidase (COXIV) (green).
Nuclei were stained with DAPI (blue). Merged images at the bottom show co-localization of BCO2a and
COXIV as well as BCO2b and COXIV. Scale bar represents 10µm. (C) Scheme of BCO2a-GFP and
BCO1-GFP fusion constructs generated using the pcDNA3.1/CT-GFP plasmid. The first 70 amino acids
of either BCO2a or BCO1 was fused to GFP downstream of the CMV promoter. The BCO2a-GFP
construct contains the first 70aa of BCO2a, which includes the N-terminus leader sequence, fused to GFP
BCO1-GFP was used as a negative control (D, E). Plasmid constructs for the expression of GFP were
transfected into ARPE-19 cells. Cells were stained with Mito Tracker to visualize mitochondria, (D)
Fluorescent images shows that signals for mitochondria and BCO2a-GFP are merged. (E) Fluorescent
images shows that signals for mitochondria and BCO1-GFP are located to distinct subcellular regions
Scale bars represent 10 µm in (B) and 5 µm in (D,E).
20

Figure 5. Removal of the mitochondrial leader sequence renders BCO2a enzymatically active.
Enzymatic activity of the synthetic 519 aa and 522 aa long human BCO2 proteins expressed as maltose
binding protein fusions. The vector expressing the maltose binding protein was used as control. Both
human isoforms were expressed in E. coli cells engineered to produce zeaxanthin. (A) Colors of bacteria
pellets expressing maltose binding protein (control), 519aa, and 522aa (B) Western blot of protein
extracts expressing maltose binding protein (control), 519aa, and 522aa. 10 µg of insoluble (P) and
soluble (S) protein fraction was separated per lane. (C) Quantification of the amounts of zeaxanthin and
β-cryptoxanthin in bacteria (20 OD600) expressing maltose binding protein (control), 519aa, and 522aa.
Values give means +/- SEM. Asterisk indicates significance in unpaired t-test for β-cryptoxanthin levels
between 519aa and control p < 0.0441. Three asterisks represent significance for zeaxanthin levels
between 522aa and control p < 0.0004 and 519aa and control p < 0.0006.
21

Figure 6. Effect of GKAA insertion on catalytic activity and structure of BCO2. (A) Purified
mBCO2-GKAA and mBCO2 (50 µg per assay each) were incubated in the presence of increasing
amounts of 3-hydroxy-β-12’-carotenal as described in the Material and Method section. Velocity vs
concentration graph demonstrates that both mBCO2 and mBCO2-GKAA displayed Michaelis-Menten
kinetics under applied condition with Vmax value of 306 pmol x min-1 and KM value of 16 µM for
mBCO2-GKAA and Vmax value of 783 pmol x min-1 and a Km value of 36 µM for mBCO2. (B)
Homology modeling of mBCO2-GKAA (green) and mBCO2 (gray) were done using the structure of
CCD of Candidatus Nitrosotalea devanaterra as a template. Front view shows that the GKAA insertion is
present on the surface of BCO2 and away from active site. Side view shows that the GKAA does not
hinder docked apocarotenoid molecule in the active site. GKAA insertion (blue); apocarotenoid molecule
(orange); Fe2+ (red circle). (C) Magnified view of the substrate tunnels of human (purple) and mBCO2
(gray). The numbering of the amino acids refers to the human enzyme. The ferrous iron in the active
center is indicated in red. A docked carotenoid molecule is indicated in orange.
22

Figure 7. Conversion of zeaxanthin enantiomers by BCO2. Purified (50 µg) mBCO2 (yellow traces)
and mBCO2-GKAA (green traces) were incubated with substrate. Buffer incubations (navy traces) served
as control. The reactions were carried out for 10 min. Lipids were extracted and subjected to HPLC
analysis. The figure presents HPLC traces at 420 nm for the assays with (A) 3(R),3’(R)-β,β-carotene-diol,
(B) 3(R),3’(S)-β,β-carotene-diol, and (C) 3(S),3’(S)-β,β-carotene-diol. (D) Representative spectra of peak
1, 10’,10-diapocarotene-10’,10-dial (left) and peak 2, 3-hydroxy-β-apo-10’-carotenal with corresponding
representative MS-MS spectra (middle) and peak 3, 3(R),3’(R)-β,β-carotene-diol with the corresponding
MS spectra (right). Note that the spectral characteristics of the zeaxanthin enantiomers are identical.
23

Figure 8. Conversion of oxidized zeaxanthin metabolites by BCO2. Purified (50 µg) mBCO2 (yellow
traces) and mBCO2-GKAA (green traces) were incubated with oxidized zeaxanthin metabolites isolated
from mouse liver. Buffer incubations (navy trace) served as controls. The reactions were carried out for
10 min. Lipids were extracted and subjected to HPLC analysis. The figure presents HPLC traces,
respectively at 420 nm and 360 nm, for the reactions with (A) assays with ε,ε-carotene-3,3’-dione (upper
panel) and spectral characteristics of peak 1, ε,ε-carotene-3,3’-dione and peak 2, 10’,10-diapocarotene-
10’,10-dial (lower panel), and (B) assays with 3-hydroxy-β,ε-carotene-3’-one (upper panel) and spectral
characteristics of peak 1, 3-hydroxy-β,ε-carotene-3’-one and peak 2, 10’,10-diapocarotene-10’,10-dial
(lower panel).
24

The human mitochondrial enzyme BCO2 exhibits catalytic activity towards
carotenoids and apocarotenoids
Linda D Thomas, Sepalika Bandara, Vipul M Parmar, Ramkumar Srinivasagan, Nimesh
Khadka, Marcin Golczak, Philip D Kiser and Johannes von Lintig
J. Biol. Chem. published online September 1, 2020
Access the most updated version of this article at doi: 10.1074/jbc.RA120.015515
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts