Microbial glycosyltransferases for carbohydrate synthesis: α-2,3-sialyltransferase from Neisseria gonorrheae

Article abstract of DOI:10.1021/ja011382r

The α-2,3-sialyltransferase from Neisseria gonorrheae was overproduced in E. coli for exploitation of its substrate specificity and synthetic utility. Several potential acceptor substrates were synthesized in this study, including mono- and oligosaccharid

Full text of DOI:10.1021/ja011382r

J. Am. Chem. Soc. 2001, 123, 10909-10918
10909
Microbial Glycosyltransferases for Carbohydrate Synthesis:
R-2,3-Sialyltransferase from Neisseria gonorrheae
Masayuki Izumi, Gwo-Jenn Shen, Shirley Wacowich-Sgarbi, Takuji Nakatani,
Oliver Plettenburg, and Chi-Huey Wong*
Contribution from the Department of Chemistry and the Skaggs Institute for Chemical Biology,
The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, California 92037
ReceiVed June 5, 2001
Abstract: The R-2,3-sialyltransferase from Neisseria gonorrheae was overproduced in E. coli for exploitation
of its substrate specificity and synthetic utility. Several potential acceptor substrates were synthesized in this
study, including mono- and oligosaccharides, glycolipids, and glycopeptides and their sulfate derivatives. Some
CMP-sialic acid derivatives with modification at the C-5 position were also prepared for evaluation as donor
substrates. It was found that the enzyme exhibits a broader acceptor substrate specificity when compared to
other sialyltransferases, though the donor specificity is quite limited. Application of the enzyme to the preparative
synthesis of representative sialyl glycoconjugates has been demonstrated. On the basis of this work and the
work of others, this enzyme is the most versatile and synthetically useful among all sialyltransferases known
to date, especially for the synthesis of sulfate-containing glycoconjugates.
Introduction
glycosyltransferases may have more relaxed specificity and are
thus useful as synthetic catalysts. Studies of these enzymes in
vitro are, however, very limited due to the lack of TDP-sugars
available for the experiment.4b-d As a part of our effort to exploit
and expand the synthetic utility of glycosyltransferases, we
report our study of the R-2,3-sialyltransferase from Neisseria
gonorrheae. Sialyltransferases catalyze the transfer of sialic acid
(N-acetylneuraminic acid, Neu5Ac) from the activated sugar
nucleotide CMP-Neu5Ac to an acceptor sugar to form a sialoside
(eq 1). Glycosidic linkages of sialic acid are predominantly
Many sugar nucleotide-dependent glycosyltransferases have
been extensively used as glycosylation catalysts in oligosac-
charide synthesis.1 Enzymatic glycosylation is stereospecific,
free of protecting group manipulation, and in general, more
practical than the chemical glycosylation. Most of these enzymes
are prepared from mammalian tissues by isolation or by gene
cloning and expression in microbial or baculoviral systems.2
Glycosyltransferases are, however, very specific for the sugar
nucleotide substrate, though some can accept analogues with
very small changes in structure.1,3 Regarding the acceptor sugar
specificity, most glycosyltransferases are specific for the terminal
sugar moiety of accptor but are able to accommodate modifica-
1,3
tions at the group linked to the anomeric center
(i.e. the
aglycon moiety). In addition to this relatively narrow substrate
specificity, little is known with regard to the structures of
glycosyltransferases complexed with substrates, making it very
difficult to engineer the substrate specificity of these enzymes.
Most of the synthetic applications of glycosyltransferases are
therefore centered on the assembly of naturally occurring
oligosaccharides found in mammalian systems. A recent study
on TDP-sugar dependent microbial glycosyltransferases in vivo
has shown that the enzymes accept a number of sugar nucleotide
analogues as donor substrates,4a suggesting that some microbial
(1) (a) Koeller, K. M.; Wong, C.-H. Chem ReV. 2000, 100, 4465-4493.
(b) Flitsch, S. L. Curr. Opin. Chem. Biol. 2000, 4, 619-625. (c) Guo, Z.;
Wang, P. G. Appl. Biochem. Biotechnol. 1997, 68, 1-19. (d) Ichikawa, Y.
In Glycopeptides and related compounds; Large, D. G., Warren, C. D.,
Eds.; Marcel Dekker: New York, 1997; pp 29-205. (e) Koeller, K. M.;
Wong, C.-H. Nature 2001, 409, 233-240. (f) Sears, P.; Wong, C.-H. Science
2001, 291, 2344-2350.
found in four forms, R-(2,3) or R(2,6) linkage to the C-3 or
C-6 hydroxyl of galactose and R(2,8) or R(2,9) linkage to
another sialic acid.5 Sialyl glycosides are often found in
glycoproteins, glycolipids, or polysaccharides and are associated
with important biological functions.5 Due to the hindered tertiary
anomeric center and the lack of a participating auxiliary,
(2) (a) Field, M. C.; Wainwright, L. J. Glycobiology 1995, 5, 463-472.
(b) Tsuji, S. J. Biochem. 1996, 120, 1-13.
(3) (a) Baisch, G.; Ohrlein, R.; Streiff, M. Bioorg. Med. Chem. Lett. 1998,
8, 157-160. (b) Sujino, K.; Uchoyama, T.; Hindsgaul, O.; Seto, N. O. L.;
Wakarchuk, W. W.; Palcic, M. M. J. Am. Chem. Soc. 2000, 122, 1261-
1269. (c) Qian, X.; Sujino, K.; Otter, A.; Palcic, M. M.; Hindsgaul, O. J.
Am. Chem. Soc. 1999, 121, 12063-12072. (d) Nishida, Y.; Tamakoshi,
H.; Kobayashi, K. J.; Thiem, J. Angew. Chem., Int. Ed. 2000, 39, 2000-
2003.
(4) (a) Thorson, J. S.; Hosted, T. J., Jr.; Jiang, J.; Biggins, J. B.; Ahlert,
J.; Ruppen, M. Curr. Org. Chem. 2001, 5, 89-111. (b) Jiang, J.; Biggins,
J. B.; Thorson, J. S. J. Am Chem. Soc. 2000, 122, 6803-6804. (c) Jiang,
J.; Biggins, J. B.; Thorson, J. S. Angew. Chem., Int. Ed. 2001, 40, 1502-
1505. (d) Solenberg, P. J.; Matsushima, P.; Stack, D. R.; Wilkie, S. C.;
Thompson, R. C.; Baltz, R. H. Chem. Biol. 1997, 4, 195-202.
(5) Sears, P.; Wong, C.-H. Cell, Mol. Life Sci. 1998, 54, 223-252.
10.1021/ja011382r CCC: $20.00 © 2001 American Chemical Society
Published on Web 10/10/2001

10910 J. Am. Chem. Soc., Vol. 123, No. 44, 2001
Izumi et al.
Table 1. One-Step Purification of R-2,3-Sialyltransferase from 1 L
chemical sialylation reaction often results in low yields and low
stereoselectivity, and thus remains one of the most difficult
glycosylation reactions.6-12 Enzymatic sialylation using sialyl-
transferases therefore has been considered to be an attractive
alternative.1 The narrow substrate specificity of mammalian
sialyltransferases, however, limits the usefulness of these en-
zymes in synthesis. The commercially available mammalian
R-2,3-sialytransferase from rat liver, for example, only accepts
N-acetyllactosamine as substrate; monosaccharides, sulfate-
containing oligosaccharides, and glycopeptides are not accept-
able.1e Bacterial sialyltransferases appear to have a broader
substrate specificity. The R-2,6-sialyltransferase from Photo-
bacterium damse, for example, has been shown to catalyze the
transfer of sialic acid to a terminal galactose which is fucosylated
or sialylated at the 2 or 3 position, respectively.13 The R-2,3
sialytransferase from Neisseria meningitidis has been shown to
sialylate the terminal galactose of N-acetyllactosamine, lactose,
and R- or â-galactosides.14a,b A viral R-2,3-sialyltransferase was
shown to sialylate fucosylated acceptors such as Lewis a and
Lewis x.14c A bacterial R-2,8/2,9-sialyltransferase was shown
to accept various oligosialic acids with alternate R-2,8 and R-2,9
linkages.14d Other microbial transferases have also been
reported.14e However, the donor and acceptor specificities of
all these microbial sialyltransferases, except the one from N.
meningitidis, have not been well studied and their synthetic
usefulness has not been well demonstrated. In this work, we
exploit the substrate specificity of this microbial sialyltransferase
using synthetic donor and acceptor analogues and derivatives,
with particular emphasis on the development of enzymatic
sialylation methods for the synthesis of important sialyl
conjugates which are difficult or impractical to synthesize by
other means.
of Culture by Affinity Column Chromatography
total
protein
(mg)
total
specific
activity
(U/mg)
activity
yield
(%)
step
(µmol/ h)a
cell free ext.
pellet
after affinity column
3600
12100
60.5
1587
921
181
0.44
0.08
3.00
100
11.4
(from supernatant)
a The activity was measured based on the acceptor lactose (1 mM
CMP-sialic acid, 1 mM acceptor, 10 mM MgCl2, 50 mM Tris buffer,
pH 7.5). One unit (U) of the enzyme activity is the formation of 1
µmol of product per hour.
The expressed protein was active, but was not able to bind to
the Ni-affinity colunm. Using pET vector we are able to express
the R-2,3-sialyltransferase with the histidine tag at the C-
terminus. The expressed protein was more active and able to
bind to the Ni-colunm. To purify the enzyme, the cells were
passed through a french press followed by centrifugation. The
supernatant was found to contain about 60% of the enzyme
activity and the remaining activity was found in the cell pellet.
The supernatant was passed through the Ni-colunm and eluted
with 100 mM imidazole. The enzyme isolated through this
simple procedure was shown to be quite homogeneous on SDS-
page electrophoresis. It was thus used directly for determination
of its specific activity and substrate specificity (Table 1).
Enzymatic Analysis. In general, the assay for acceptor
specificity was carried out with CMP-[14C]Neu5Ac as donor
substrate. Sialylated products were separated from CMP-[14C]-
Neu5Ac by passing through Dowex 1×8 resin (phosphate form)
and the isotope content was counted by scintillation counter.
This method is, however, not effective for the analysis of
acceptors containing negative charges or hydrophobic groups
due to the problem of separation. Alternative methods were used
for qualitative analysis to find synthetically acceptable substrates.
Thus, for evaluation of acceptors carrying a hydrophobic
aglycon, cold CMP-Neu5Ac was used and the product was
isolated with a SepPak 18 solid-phase extraction cartridge and
analyzed by electrospray mass spectrometry (ESI-MS). For
evaluation of sulfate-containing oligosaccharides as acceptors,
the reaction was analyzed by TLC with use of resorcinol to
visualize the sialylated product. For compounds carrying a long
aliphatic chain, the assay was carried out in the presence of
0.02% Triton X-100. To make sure that these qualitative
methods are reliable, the sialylated product was further char-
acterized by ESI-MS to ensure that sialylation does occur. The
relative intensity of the sialylated product was then used to
estimate the enzyme activity. Alternatively, the relative rates
can be determined by using a pH indicator (e.g. phenol red, ∆ꢀ
) 5.6 × 104 M-1 cm-1) in a minimal concentration of buffer
(∼2 mM). Several saccharides and derivatives were quickly
surveyed by using one of these methods to determine their
relative acceptor specificity. All numbers are based on lactose
acceptor, the specific activity of which was determined to be 3
U/mg (1 U ) 1 µmol product formed per hour).
Results and Discussion
Preparation of r-2,3-Sialyltransferase. The gene coding for
the enzyme from Neisseria gonorrheae was initially cloned into
pRSET vector (Invitrogen Co., Carlsbad, CA) for expression
of the protein containing a hexahistidine tag at the N-terminus.
(6) Boons, G.-J.; Demchenko, A.-V. Chem. ReV. 2000, 100, 4539-4565.
(7) Okamoto, K.; Goto, T. Tetrahedron 1990, 46, 5835-5857.
(8) DeNinno, M. P. Synthesis 1991, 583-593.
(9) Kanie, O.; Hindsgaul, O. Curr. Opin. Struct. Biol. 1992, 2, 674-
681.
(10) (a) Erce´govic, T.; Magnusson, G. J. Org. Chem. 1995, 60, 3378-
3384. (b) Erce´govic, T.; Magnusson, G. J. Org. Chem. 1996, 61, 179-
184. (c) Hossain, N.; Magnusson, G. Tetrahedron Lett. 1999, 40, 2217-
2220. (d) Ito, Y.; Nunomura, S.; Shibayama, S.; Ogawa, T. J. Org. Chem.
1992, 57, 1821-1831.
(11) Castro-Palomino, J. C.; Tsvetkov, Y. E.; Schneider, R.; Schmidt,
R. R. Tetrahedron Lett. 1997, 38, 6837-6840.
(12) Wang, Z.; Zhang, X.-F.; Ito, Y.; Nakahara, Y.; Ogawa, T. Bioorg.
Med. Chem. 1996, 4, 1901-1908.
(13) Kajihara, Y.; Yamamoto, T.; Nagae, H.; Nakashizuka, M.; Sakak-
ibara, T.; Terada, I. J. Org. Chem. 1996, 61, 8632-8635.
(14) (a) Gilbert, M.; Cunningham, A.-M.; Watson, D. C.; Martin, A.;
Richards, J. C.; Wakarchuk, W. W. Eur. J. Biochem. 1997, 249, 187-194.
(b) Wakarchuk, W. W.; Martin, A.; Jennings, M. P.; Moxon, E. R.; Richards.
J. C. J. Biol. Chem. 1996, 271, 19166-19173. (c) Sujino, K.; Jackson, R.
J.; Chan, N. W. C.; Tsuji, S.; Palcic, M. Glycobiology 2000, 10, 313-320.
(d) Shen, G.-J.; Datta, A. K.; Izumi, M.; Koeller, K. M.; Wong, C.-H. J.
Biol. Chem. 1999, 274, 35139-35146. (e) Bozue, J. A.; Tullius, M. V.;
Wang, J.; Gibson, B. W.; Munson, R. S., Jr. J. Biol. Chem. 1999, 274,
4106-4114. Gilbert, M.; Watson, D. C.; Cunningham, A.-M.; Jennings,
M. P.; Young, N. M.; Wakarchuk, W. W. J. Biol. Chem. 1996, 271, 28271-
28276. Gilbert, M.; Brisson, J. R.; Karwaski, M. F.; Michniewicz, J.;
Cunningham, A.-M.; Wu, Y.; Young, N. M.; Wakarchuk, W. W. J. Biol.
Chem. 2000, 275, 3896-3909. Gilbert, M.; Bayer, R.; Cunningham, A.-
M.; DeFees, S.; Gao, Y.; Watson, D.; Young, N. M.; Wakarchuk, W. W.
Nat. Biotechnol. 1998, 16, 769-772. Wakarchuk, W. W.; Watson, D.; St.
Michael, F.; Li, J.; Wu, Y.; Brisson, J. R.; Young, N. M.; Gilbert, M. J.
Biol. Chem. 2001, 276, 12785-12790.
Synthesis of Substrates. We are particularly interested in
developing enzymatic methods for the sialylation of sulfate-
containing oligosaccharides, glycopeptides, and glycolipids, as
these sialosides exhibit important functions1e,5 but are difficult
to synthesize with traditional glycosylation methods. The
phenolic sulfate group is too acid sensitive to be compatible
with other protecting groups manipulations. The preparations
of potential substrates shown in Table 2 were performed as
follows. Allyl 6-O-sulfo-N-acetyllactosaminide (7) was synthe-
sized as shown in Scheme 1. Glycosylation of allyl 6-O-

Microbial Glycosyltransferases for Carbohydrate Synthesis
J. Am. Chem. Soc., Vol. 123, No. 44, 2001 10911
Table 2. Substrate Specificiy of the R-2,3-Sialyltransferase

10912 J. Am. Chem. Soc., Vol. 123, No. 44, 2001
Table 2 (Continued)
Izumi et al.
a Based on the isotope assay as described in the Experimental Section. b Based on the TLC and/or ESI-MS analysis. Conditions for the assays
are the same as that described in Table 1. All relative activities are based on lactose, the specific activity of which is 3 U/mg (1 U ) 1 µmol product
formed per hour). Compounds 7-11 and 28 were sialylated at the terminal galactose 3-position on a preparative scale.
Scheme 1a
a Reagents and conditions: (a) TMSOTf/CH2Cl2/-48 °C; (b) Zn/AcOH then Ac2O/Py; (c) 70% AcOH/70 °C; (d) SO3‚pyridine/THF; (e) NaOMe/
MeOH.
TBDMS-N-Troc-â-D-glucosaminide (2) with 1.1 equiv of tet-
raacetylgalactosyl trichloroacetimidate 1 in CH2Cl2 at -48 °C
in the presence of TMS triflate as an activator gave the â(1 f
4) linked disaccharide 3 regioselectively in 73% yield. The
N-Troc group of 3 was removed with zinc in acetic acid, and
the liberated amine was subsequently acetylated to give 4 in
90% yield. The TBDMS group was deprotected and the exposed
hydroxyl group was converted to the sulfate group in nearly
quantitative yield. Deacetylation with methanolic sodium meth-
oxide gave 7. Galactosyl chitooligosaccharides 8-10 containing
a sulfate group at the reducing end 6-position were synthesized
from chitooligosaccharides with use of Nod factor sulfotrans-
ferase coupled with regeneration of PAPS and â-1,4-galacto-
syltransferase as reported previously.15a The Tyr-O-sulfate-
containing PSGL-1 glycopeptide 11 was prepared according to
the procedure reported.15b
(15) (a) Burkart, M. O.; Izumi, M.; Chapman, E.; Lin, C.-H.; Wong,
C.-H. J. Org. Chem. 2000, 65, 5565-5574. (b) Koeller, K. M.; Smith, M.
E. B.; Huang, R.-F.; Wong, C.-H. J. Am. Chem. Soc. 2000, 122, 4241-
4242.

Microbial Glycosyltransferases for Carbohydrate Synthesis
J. Am. Chem. Soc., Vol. 123, No. 44, 2001 10913
Scheme 2a
a Reagents and conditions: (a) BF3‚OEt2/MS 4 Å/CH2Cl2/-20 °C; (b) NaOMe/MeOH/CH2Cl2; (c) TFA/CH2Cl2 then C17H35CO2H/EDC/CH2Cl2.
Scheme 3a
a Reagents and conditions: (a) H2, Pd/C, EtOH; (b) 16, NIS, TfOH, CH2Cl2, -50 °C; (c) NaOMe, MeOH; (d) H2, Pd/C, EtOH.
Scheme 4a
a Reagents and conditions: (a) p-MeOC6H4CH(OMe)2, TsOH; (b) BzCl, py, 0 °C; (c) CCl3CN, DBU, CH2Cl2; (d) 12, BF3‚OEt2, 1:1 Diox-THF,
-20 °C, R/â ) 8:1; (e) 80% AcOH; (f) NaOMe, MeOH; (g) 10%TFA in CH2Cl2; (h) polymer based acylation, NEt3, CH2Cl2.
The synthesis of â-linked lactosyl sphingosines is illustrated
in Scheme 2. Starting from the known compound 1,1-dimethyl
[R-[R*,S*-(E)]]-2,2-dimethyl-4-(1-hydroxy-2-hexadecenyl)-3-
oxazolidinecarboxylate,16 we obtained N-(tert-butoxycarbonyl)-
3-O-benzoyl-D-erythro-sphingosine (12) by benzoylation and
subsequent mild hydrolysis of the isopropylidene acetal with
acidic resin. Glycosylation of 12 with peracetylated lactosyl
trichloroacetimidate (13) in CH2Cl2 at -20 °C in the presence
of MS 4 Å and BF3‚OEt2 as an activator gave the â-lactoside
which was deprotected to give 14, or further transformed to
15. The physical data of 14 and 15 are consistent with the
reported values.17
shown to activate killer T-cells through CD1 presentation.18 The
syntheses of 20 and 26 were shown in Schemes 3 and 4. It is
noted that, even in the presence of a neighboring participating
N-acetyl group, the BF3 mediated glycosylation of 23 in dioxane
gave mainly the R-product. A predominant â-product was
obtained in other nonpolar solvents such as CH2Cl2. Perhaps
the initial glycosyl cation generated formed an adduct with the
lone-pair of the solvent through the neighboring group as-
sistance, followed by a nucleophilic attack from the axial
position to form the R-glycosidic linkage.
Acceptor Specificity and Representative Synthesis of Sialyl
Conjugates. The synthetic acceptors and their relative activities
tested as substrates for R-2,3-sialyltransferase are summarized
in Table 2. The benzyl and methoxycarbonylpentyl glycosides
of â-N-acetyllactosamine were excellent substrates, and addition
of an extra â-galactosyl residue to the 4′-position was still
Two R-linked sphingolipids (20 and 26) were also exploited
as substrates, as these types of unusual linkages have been
(16) (a) Koskinen, P. M.; Koskinen, A. M. P. Synthesis 1998, 1075-
1091. (b) Hoffman, R. V.; Tao, J. Tetrahedron Lett. 1998, 39, 3953-3956.
(c) Herold, P. HelV. Chim. Acta 1988, 71, 354-361. (d) Hoffman R. V.;
Tao, J. J. Org. Chem. 1998, 63, 3979-3985. (e) Koskinen, A.; Koskinen,
P. United States Patent 5426228, 1995.
(17) Fiore, S.; Nicolaou, K. C.; Caufield, T.; Kataoka, H.; Serhan, C. N.
Biochem. J. 1990, 266, 25-31.
(18) (a) Prigozy, T. I.; Naidenko, O.; Qasba, P.; Elewaut, D.; Brossay,
L.; Khurana, A.; Natori, T.; Koezuka, Y.; Kulkarni, A.; Kronenberg, M.
Science 2001, 291, 664-667. (b) Burdin, M.; Kronenberg, M. Curr. Opin.
Immunol. 1999, 11, 326-331.

10914 J. Am. Chem. Soc., Vol. 123, No. 44, 2001
Izumi et al.
Scheme 5a
a Reagents and conditions: (a) (i) Boc2O/DMAP/THF/50 °C, (ii) NH2NH2‚H2O/MeOH, (iii) Ac2O/pyridine; (b) (i) PhOH/TMSCl/CH2Cl2, (ii)
AcGcCl/DABCO/CH2Cl2; (c) NBS/aqueous acetone; (d) (i) NaOMe/MeOH, (ii) NaOH; (e) TfN3/CuSO4/K2CO3; (f) CH3COCO2Na/NeuAc aldolase
(46 U/mmol); (g) CH3COCO2Na /NeuAc aldolase (9.2 U/mmol).
acceptable. Regarding sulfate-containing oligosaccharides, allyl
6-O-sulfo-N-acetyllactosaminide, galactosyl 6-O-sulfo-chito-
biose and the corresponding chitotriose and chitotetraose, and
the PSGL-1 glycopeptide carrying a sulfotyrosine residue were
examined, and each gave the sialylated product in excellent
yield. The commercially available rat R-2,3-sialyltransferase,
however, can only accept galactosyl 6-O-sulfo-chitotetraose as
a weak substrate.15b
The lactosides with allyl, phenylthio, octadecyl, N-Boc-
sphingosine, or ceramide as an aglycon were good substrates.
In addition, 4-methylphenylthio-â-galactoside, R-galactosyl and
R-N-acetylgalactosaminyl N-Boc-sphingosine, lactose, allyl
â-lactoside and phenylthio-â-lactoside, and lactosides with a
long aliphatic chain were accepted as weak substrates. The
mammalian sialyltransferase,15b however, cannot accept these
monosaccharide derivatives, nor can the lactose derivatives.
Among these, R-galactosyl sphingosine is the weakest substrate
and is impractical for preparative synthetic application. The
phenylthio sialyllactoside prepared here, however, can be used
directly for the synthesis of such gangliosides or for condensa-
tion with another saccharide fragment since it can be easily
protected and activated as a glycosyl donor in chemical
glycosylation.
Additional preparative enzymatic syntheses were then carried
out with use of allyl 6-O-sulfo-N-acetyllactosaminide (7) and
phenylthio lactoside (28) as substrates, and 6-O-sulfo-sialyl-N-
acetyllactosaminide (27) and phenylthio sialyllactoside (29) were
isolated in quantitative and 63% yield, respectively. The
chemical shift of δ 4.11 is characteristic of the H-3 of the
galactosyl residue.19 In addition, compounds 8-11 were also
sialylated enzymatically on a preparative scale as shown in the
previous communications.15 It is noted that our attempts to
sialylate compounds 7-11 and 28 with the mammalian sialyl-
transferase from rat liver failed.15b
â-galactoside, and sulfated N-acetyllactosamine derivatives as
well as their sphingolipid and sulfo-peptide conjugates. The
compounds prepared in this study are biologically interesting
and synthetically challenging.1a,6 The sulfate-containing deriva-
tives have not been prepared by any other sialyltransferase. With
regard to other microbial sialyltransferases, the most studied is
the one from N. meningitidis which has been shown to accept
several galactooligosaccharides.14a Another potentially useful
sialyltransferase is the one from myxoma virus,14c which accepts
∼6 galactosaccharides, including Lewis x, but monosaccharides
are not substrates. Both of these sialyltransferases have not been
shown to sialylate any glycolipids, sulfo-glycopeptides, and
sulfo-oligosaccharides. Thus, compared to other known mam-
malian and microbial R-2,3-sialyltransferases, this enzyme
appears to exhibit a broader acceptor specificity.
CMP-Neuraminic Acids as Donors. Cytidine-5′-monophos-
pho-neuraminic acid (CMP-Neu5Ac) derivatives, especially
those with a change of the NHAc group, were first examined
as donor substrates since several 5-modified neuraminic acids
exist in nature, i.e., N-glycolylneuraminic acid (Neu5Gc) and
2-keto-3-deoxy-nonulosonic acid (KDN), which carries an OH
group instead of NHAc.20 The unusual ganglioside N-glycolyl-
GM3 was found in breast tumors and might be useful for
immunological diagnosis and vaccine therapy.21 Syntheses of
these derivatives were exploited chemically and enzymatically
by using CMP-neuraminic acid synthase. The synthesis of
Neu5Gc and N-tert-butoxycarbonylamino-neuraminic acid
(Neu5Boc) was first carried out from thioglycoside 30 (Scheme
5). We chose Neu5Boc as a candidate as it can be easily
converted to other derivatives through exchange of the Boc
group. To prepare this compound, the N-acetyl group of Neu5Ac
has to be removed first. The procedures for the de-N-acetylation
of Neu5Ac were fully documented in the literature,22-30 and
(20) Varki, A. Glycobiology 1992, 2, 25-40.
Overall, as shown in Table 2, Neisseria gonorrheae R-2,3-
sialyltransferase can sialylate N-acetyllactosamine, lactose,
(21) Marquina, G.; Waki, H.; Fernandez, L. E.; Kon, K.; Carr, A.;
Valiente, O.; Perez, R.; Ando, S. Cancer Res. 1996, 56, 5165-5171.
(22) Roy, R.; Pon, R. A. Glycoconj. J. 1990, 7, 3.
(19) Sabesan, S.; Paulson, J. C. J. Am. Chem. Soc. 1986, 108, 2068-
2080.
(23) Tanaka, M.; Kai, T.; Sun, X.-L.; Takayanagi, H.; Uda, Y.; Furuhata,
K. Chem. Pharm. Bull. 1995, 43, 1844-1848.

Microbial Glycosyltransferases for Carbohydrate Synthesis
J. Am. Chem. Soc., Vol. 123, No. 44, 2001 10915
Scheme 6a
among these conditions, the amide to carbamate conversion
reported by Burk et al. seemed compatible with the acetyl and
methyl ester protecting groups.30 As shown in Scheme 5,
introduction of the Boc group to 30 with di-tert-butyl dicar-
bonate (Boc2O) and 4-(dimethylamino)pyridine (DMAP) in
refluxing THF gave the N-acetyl-N-Boc derivative. The N-acetyl
group was removed with hydrazine hydrate and MeOH at room
temperature. Since partial de-O-acetylation was observed along
with de-N-acetylation, the mixture of products was reacetylated
to give the N-Boc derivative 31 in 72% yield. Deprotection of
the Boc group was carried out by using TMSCl-PhOH in
31
CH2Cl2 to give the free amine derivative with minimal acyl
migration after short column chromatography to remove phenol.
Acylation with acetoxyacetyl chloride and DABCO gave the
fully protected Neu5Gc derivative 32 in 90% yield. Hydrolysis
of the thioglycoside with NBS in aqueous acetone gave
hemiacetal 33 in 98% yield. Deacetylation followed by saponi-
fication gave Neu5Gc (34) in 33% yield after purification by
DEAE-sephadex A-25 chromatography. Neu5Boc was also
prepared in the same way from thioglycoside 31. Hydrolysis
with NBS in aqueous acetone gave 35 in 81% yield. Another
two-step deprotection gave Neu5Boc in 56% yield.
5-Azido-neuraminic acid (Neu5N3)32-34 and KDN were
prepared with Neu5Ac aldolase. 2-Azido-mannose (37) was
prepared from D-mannosamine hydrochloride via diazotransfer35
in 80% yield. The Neu5Ac aldolase reaction with 4 equiv of
sodium pyruvate without buffer34 worked out very well to give
Neu5N3 (38) in 80% yield after purification by DEAE-sephadex
A-25 chromatography. KDN (39) was prepared from D-mannose
in quantitative yield with the same enzyme.33 Alternatively, 37
was generated in situ from 2-azidoglucose at pH 11. Without
isolation, the mixture was adjusted to pH 7.5 followed by
addition of the aldolase and 4 equiv of pyruvate. This procedure
is interesting as 2-azido-glucose is inexpensive and is more
easily epimerized than N-acetyl-glucosamine.
The N-acetylneuraminic acid dimer with R(2f9) linkage
[Neu5AcR(2f9)Neu5Ac (47)] was synthesized as shown in
Scheme 6. Chloride 40 was converted to the R-thioglycoside
with use of 4-methylthiophenol and benzyltriethylammonium
chloride in 1 M NaOH and CHCl3.36 Vigorous stirring for 30
min under reflux gave the desired R-thioglycoside 41 in 75%
yield. The acetyl groups were removed by treatment with
methanolic sodium methoxide, and then the 8- and 9-OH groups
were protected as an isopropylidene acetal.37 The remaining free
OH groups were acetylated, subsequently, to give the fully
protected 42 in 91% yield. Acid hydrolysis of the 8,9-
a Reagents and conditions: (a) TolSH/NaOH/ BnEt3NCl/CHCl3; (b)
(i) NaOMe/MeOH, (ii) Me2C(OMe)2/CSA/acetone, (iii) Ac2O/Py; (c)
90% AcOH/70 °C; (d) TMSOTf/MS AW-300/MeCN/-40 °C; (e)
Ac2O/Pyr; (f) NBS/ aqueous acetone; (g) (i) NaOMe/MeOH, (ii) NaOH.
isopropylidene group in 90% acetic acid at 70 °C gave diol 43
in 76% yield. Sialylation of the diol 43 with sialyl phosphite
44 in acetonitrile38 in the presence of molecular sieves AW-
300 gave the 2f9 linked disaccharide as an anomeric mixture
(R:â ∼ 2:1). After acetylation, the R-linked disaccharide 45 was
isolated in 33% yield. Hydrolysis of the thioglycoside with NBS
in aqueous acetone gave the hemiacetal 46 in 66% yield.
Deacetylation and subsequent saponification gave Neu5AcR-
(2f9)Neu5Ac (47) in 21% yield.
Synthesis of CMP-Neu5Ac Derivatives. Enzymatic synthesis
of CMP-Neu5Ac derivatives with the commercially available
E. coli CMP-Neu5Ac synthetase39,40 was first examined. The
Neu derivative (6 mM) and CTP (10 mM) were dissolved in
100 mM Tris-HCl buffer (pH 9.0) in the presence of MgCl2
(20 mM), and the solution was mixed with CMP-Neu5Ac
synthetase and inorganic pyrophosphatase and gently stirred at
25 °C for 15 h. The product formation was analyzed by anion-
(24) Yamamoto, T.; Teshima, T.; Saitoh, U.; Hoshi, M.; Shiba, T.
Tetrahedron Lett. 1994, 35, 2701-2704.
(25) Ogura, H.; Furuhata, K. Tetrahedron Lett. 1981, 22, 4265-4268.
(26) Ikeda, K.; Kawai, K.; Achiwa, K. Chem. Pharm. Bull. 1991, 39,
1305-1309.
(27) Sugata, T.; Hibuchi, R. Tetrahedron Lett. 1996, 37, 2613-2614.
(28) Hanessian, S. Tetrahedron Lett. 1967, 16, 1549-1552.
(29) Garvey, J.; Flaherty, T. M.; Nguyen, C. Tetrahedron Lett. 1997,
38, 1493-1496.
(30) Burk, M. J.; Allen, J. G. J. Org. Chem. 1997, 62, 7054-7057.
(31) Kaiser, E., Sr.; Tam, J. P.; Kubiak, T. M.; Merrifield, R. B.
Tetrahedron Lett. 1988, 29, 303-306.
(32) Auge´, C.; David, S.; Malleron, A. Carbohydr. Res. 1989, 188, 201-
205.
(33) Lin, C.-H.; Sugai, T.; Halcomb, R. L.; Ichikawa, Y.; Wong, C.-H.
J. Am. Chem. Soc. 1992, 114, 10138-10145.
(34) Kragl, U.; Go¨dde, A.; Wandrey, C.; Kinzy, W.; Cappon, J. J.;
Lugtenburg, J. Tetrahedron Asymm. 1993, 4, 1193-1202.
(35) Alper, P. B.; Hung, S.-C.; Wong, C.-H. Tetrahedron Lett. 1996,
37, 6029-6032.
(36) Reinhard, B.; Faillard, H. Liebigs Ann. Chem. 1993, 193-203.
(37) Tanaka, M.; Kai, T.; Sun, X.-L.; Takayanagi, H.; Furuhata, K. Chem.
Pharm. Bull. 1995, 43, 2095-2098.
(38) Kondo, H.; Ichikawa, Y.; Wong, C.-H. J. Am. Chem. Soc. 1992,
114, 8748-8750.
(39) Shames, S. L.; Simon, E. S.; Christopher, W. C.; Schmid, W.;
Whitesides, G. M.; Yang, L.-L. Glycobiology 1991, 1, 187-191.
(40) Lin, J.; Shen, G.-J.; Ichikawa, Y.; Rutan, J. F.; Zapata, G.; Vann,
W. F.; Wong, C.-H. J. Am. Chem. Soc. 1992, 114, 3901-3910.

10916 J. Am. Chem. Soc., Vol. 123, No. 44, 2001
Izumi et al.
Scheme 7a
a Reagents and conditions: (a) (i) 1H-tetrazole/MeCN, (ii) tBuOOH/MeCN or DMD/CH2Cl2, (iii) DBU/THF or (Ph3P)4Pd/iPr2NH/MeCN, (iv)
NaOMe/MeOH, (v) NaOH; (b) (i) DMF/MeCN, (ii) NaOMe/MeOH, (iii) NaOH.
Scheme 8a
a Reagents and conditions: (a) MeOH/Dowex (H+); (b) Ac2O/Py; (c) TolSH/BF3‚OEt2/CH2Cl2; (d) NBS/aqueous acetone.
exchange HPLC with UV detection at 270 nm. To our surprise,
Neu5Gc, Neu5Boc, Neu5N3, KDN, and Neu5AcR(2f9)-
Neu5Ac did not show any new product formation, with the
exception of Neu5Ac, which gave CMP-Neu5Ac. Although this
enzyme can accept Neu derivatives with modification at the
9-position with a large aromatic group,41 it can neither accept
the 9-phosphonate analogue of Neu5Ac42 nor the disaccharide
Neu5AcR(2f9)Neu5Ac.
Since enzymatic synthesis of CMP-Neu5Ac derivatives was
unsuccessful, chemical synthesis of CMP-Neu5Ac and its
analogues was carried out (Scheme 7). Coupling of a protected
sialic acid hemiacetal (48) with a protected cytidine 5′-phos-
phoramidite (49, 50) was first carried out with use of the
2-cyanoethyl phosphite43 or the allyl phosphite method.44
Another approach based on sialic acid phosphite (51) and pro-
tected cytidine 5′-monophoshoric acid (52)45 was also examined.
Both methods worked well for the preparation of CMP-sialic
acid 53. We then proceeded to prepare analogues.
with 4-methylthiophenol and BF3‚OEt2 in 89% yield. Hydrolysis
of thioglycoside 56 with NBS in aqueous acetone gave
hemiacetal 57 in 84% yield. The hemiacetal of KDN (60)48 was
prepared from 59 in a similar manner.
As shown in Scheme 9, Neu5Ac, Neu5Gc, Neu5Boc, and
Neu5N3 react with the amidite to give their corresponding
products in 25%, 27%, 26%, and 9% yield, respectively, but
the KDN and Neu5AcR(2f9)Neu5Ac derivatives did not give
the desired products. The hemiacetals of Neu5Ac, Neu5Boc,
and KDN were then phosphitylated with diethyl chlorophosphite
in the presence of DIEA to give the glycosyl phosphites in 93%
and 51% yield, respectively. Phosphitylation of disaccharide 46
under the same conditions gave no reaction and only 2,3-
elimination was observed with an increase of chlorophosphite
and DIEA. On the other hand, phosphitylation of 46 with
dibenzyl diethylphosphoramidite and 1H-tetrazole gave the
desired disaccharide glycosyl phosphite 69 in good yield.
Coupling of the phosphite of Neu5Ac, Neu5Boc, KDN, or
Neu5AcR(2f9)Neu5Ac with triacetylcytidine 5′-phosphoric
acid (52) gave the corresponding protected CMP-Neu5Ac
derivatives in 65%, 59%, 39%, and 47%, respectively. Depro-
tection of each CMP-Neu5Ac derivative with methanolic sodium
methoxide and subsequent saponification gave the desired CMP-
Neu derivative after purification by gel permeation chromatog-
raphy and lyophilization.
Donor Substrate Specificity. The synthetic CMP-Neu5Ac
derivatives were tested as donor for the sialyltransferase reaction.
A CMP-Neu5Ac derivative and phenylthio lactoside or meth-
oxycarbonylpentyl N-acetyllactosaminide were incubated with
the R-2,3-sialyltransferase in 0.1 M HEPES buffer (pH 7.5) in
(47) Kuznik, G.; Ho¨rsch, B.; Kretzschmar, G.; Unverzagt, C. Bioorg.
Med. Chem. Lett. 1997, 7, 577-580.
(48) Kajihara, Y.; Akai, S.; Nakagawa, T.; Sato, R.; Ebata, T.; Kodama,
H.; Sato, K. Carbohydr. Res. 1999, 315, 137-141.
Treatment of Neu5N3 (38) with MeOH and an acidic resin
gave methyl ester 54 in good yield (Scheme 8). Acetylation of
54 with acetic anhydride and perchloric acid,46 however, gave
a mixture of 2,3- and 3,4-ene compounds. Methyl ester 54 was
then acetylated with acetic anhydride and pyridine to give
peracetate 55,47 which was converted to the thioglycoside 56
(41) Gross, H. J.; Bu¨nsch, A.; Paulson, J. C.; Brossmer, R. Eur. J.
Biochem. 1987, 168, 595-602.
(42) Martin, R.; Witte, K. L.; Wong, C.-H. Bioorg. Med. Chem. 1998,
6, 1283-1292.
(43) Kajihara, Y.; Ebata, T.; Koseki, K.; Kodama, H.; Matsushita, H.;
Hashimoto, H. J. Org. Chem. 1995, 60, 5732-5735.
(44) Chappell, M. D.; Halcomb, R. L. Tetrahedron 1997, 53, 11109-
11120.
(45) Martin, T. J.; Braun, H.; Schmidt, R. R. Bioorg. Med. Chem. 1994,
2, 1203-1208.
(46) Marra, A.; Sinay¨, P. Carbohydr. Res. 1989, 190, 317-322.

Microbial Glycosyltransferases for Carbohydrate Synthesis
J. Am. Chem. Soc., Vol. 123, No. 44, 2001 10917
Scheme 9a
a Reagents and conditions: (a) (i) 1H-tetrazole/MeCN, (ii) tBuOOH/MeCN or DMD/CH2Cl2, (iii) DBU/ THF or (Ph3P)4Pd/iPr2NH/MeCN, (iv)
NaOMe/MeOH, (v) NaOH; (b) ClP(OEt)2/iPr2NEt/MeCN; (c) DMF/MeCN/-20 °C to room temperature; (d) (i) NaOMe/MeOH, (ii) NaOH; (e)
(BnO)2PNEt2/1H-tetrazole/MeCN.
the presence of 10 mM MgCl2, 0.2 mM DTT, and alkaline
phosphatase at 25 °C for 2 days. The sialyloligosaccharide was
isolated from the reaction mixture with use of a SepPak 18 solid-
phase extraction cartridge and was examined by using anion-
exchange HPLC and/or electrospray mass spectrometry (ESI-
MS) in a negative mode. Under the assay conditions, CMP-
Neu5Ac gave quantitatively the sialylated product. CMP-
Neu5Gc, CMP-Neu5Boc, and CMP-KDN gave a detectable
product by HPLC and ESI-MS, and most of the acceptor was
unreacted. No detectable sialylated oligosaccharide was pro-
duced with CMP-Neu5N3 and CMP-Neu5AcR(2f9)Neu5Ac.
These results indicate that the sialyltransferase is quite specific
for CMP-Neu5Ac as the donor substrate, similar to other known
sialyltransferases.
In conclusion, the recombinant R-2,3-sialyltransferase from
Neisseria gonorrheae was overexpressed in E. coli and purified
by Ni-agarose affinity chromatography for the study of its
synthetic utility. Chemo-enzymatic synthetic methods have also
been developed to prepare potential substrates for the sialyl-
transferase. The enzyme was shown to catalyze the transfer of
sialic acid to galactose and N-acetylgalactosamine with a variety
of aglycon; to lactose, N-acetyllactosamine, and the glycolipid
derivatives; to sulfated N-acetyllactosamine, 6-O-sulfo-chito-
triose, and tetrose; and to tyrosine-sulfate containing glycopep-
tides and lactosides with a short aliphatic or aromatic aglycon.
The R-linked galactosides with a long aliphatic aglycon are poor
acceptors. Regarding the donor substrate specificity, the enzyme
accepts Neu5Ac as an excellent substrate; Neu5Ac, Neu5Gc,
Neu5Boc, and KDN are very weak substrates; Neu5N3 and
Neu5AcR(2f9)Neu5Ac are not substrates.
The sulfate-containing sialylated saccharides and conjugates
prepared in this study are potentially useful as selectin blockers
or as immunomodulators.1a These compounds are difficult or
impractical to synthesize by other means, as the sulfate group
is sensitive to acids and cannot sustain the condition of pro-
tecting group manipulation.15b,49 In addition, enzymatic sialy-
lation is stereospecific and free of protecting group manipulation
and thus more practical than the chemical counterpart.6 Com-
pared with other sialyltransferases, this enzyme exihibits a
broader substrate specificity and is the most versatile and
synthetically useful sialyltransferase demonstrated to date. Work
is in progress to use this expression system to prepare the
enzyme for X-ray crystal structural study and to engineer the
enzyme specificity.
(49) Kitagawa, K.; Aida, C.; Fujiwara, H.; Yagami, T.; Futaki, S.; Kogire,
M.; Ida, J.; Inoue, K. J. Org. Chem. 2001, 66, 1-7. Komba, S.; Galustian,
C.; Ishida, H.; Feizi, T.; Kannagi, R.; Kiso, M. Angew. Chem., Int. Ed.
Engl. 1999, 38, 1131-1133.

10918 J. Am. Chem. Soc., Vol. 123, No. 44, 2001
Izumi et al.
Allyl O-(5-Acetamido-3,5-dideoxy-D-glycero-r-D-galacto-2-nonu-
lopyranosidonic acid)-(2f3)-O-(â-D-galactopyranosyl)-(1f4)-2-
acetamido-2-deoxy-6-O-sulfo-â-D-glucopyranoside (27). A solution
of 7 (10 mg, 19 mmol) and CMP-Neu5Ac (21 mg, 23 mmol) in 100
mM HEPES buffer (pH 7.5, 3.8 mL) containing 20 mM MgCl2, 0.2
mM DTT, 10 U alkaline phosphatase, and Neisseria R(2,3)-sialyltrans-
ferase was incubated for 2 days at 25 °C. TLC analysis (n-PrOH-
H2O-NH4OH 7/2/1) showed that all donor was consumed. The solution
was directly applied to a column of DEAE-sephadex (AcO-), washed
with water, and the product was eluted with 0.2 M NH4OAc. Fractions
containing the product were collected and passed through a column of
Dowex HCR (H+). The residue was concentrated and purified by size-
exclusion chromatography (BioGel P4, 0.03 M NH4HCO3) and lyoph-
ilized to give 27 (18 mg, quant) as a white foam: 1H NMR (600 MHz,
D2O) δ 5.92-5.85 (1H, m), 5.31-5.24 (2H, m), 4.60 (1H, d, J ) 7.9
Hz), 4.58 (1H, d, J ) 8.3 Hz), 4.40 (1H, d, J ) 11.0 Hz), 4.34-4.31
(2H, m), 4.17-4.14 (1H, m), 4.11 (1H, dd, J ) 3.1, 9.7 Hz), 3.95 (1H,
d, J ) 3.1 Hz), 3.92-3.58 (14H, m), 3.54 (1H, dd, J ) 7.9, 9.7 Hz),
2.73 (1H, dd, J ) 4.8, 12.3 Hz), 2.02 (6H, s, Ac×2), 1.80 (1H, t, J )
12.3 Hz); HR-MALDI-FTMS calcd for C28H44N2O22SNa [M - 2H
+ Na]- 815.2004, found 815.1973.
Experimental Section
Cloning of r-2,3-Sialytransferase from Neisseria gonorrheae. The
DNA isolated from N. gonorrheae (ATCC 33084) was used for
amplification of the gene coding for the R-2,3-sialyltansferase. The PCR
was performed in a 100 µL reaction mixture containing 100 ng of DNA
as template, 300 nmol of primers, 200 mM dNTPs, 50 mM KCl, 10
mM Tris-HCl (pH 8.3), 5 mM MgCl2, 0.01% gelatin, 0.1% Triton
X-100, and 1 U of Tag DNA polymerase. The forward primer
(5-ATATTCATATGGGGTTGAAAAAAGTCTGTTT) containing an
NdeI site and the reverse primer containg a HindIII site with the six
His tag sequence (5-GGCGCCGAAGCTTAGTGGTGATGGTGGT-
GAGCTTGTCATCGTCATCATTTTTATCGTCAAATGT) were used.
The amplification was carried out in the following conditions: 94 °C,
1 min; 55 °C, 1 min; and 72 °C, 2 min for 35 cycles. The amplified
fragment (1.2 Kb) was subcloned into pET23a vector (Novagen Co.
Madison, WI). The ligation mixture was then transformed into the
BL21(DE3) strain of E. coli. The insert was further confirmed by
restriction enzyme digestion (NdeI and HindIII restricted cutting) and
sequence analysis at the TSRI Core facility.
Preparation of r-2,3-Sialyltransferase. The transformed cells were
inoculated in LB medium containing 30 µg/mL Kanamycin at 37 °C
until OD600 reached 0.7-0.9 (about 2-3 h), then IPTG (1 mM) was
added. The culture was then cultivated at lower temperature (25-30
°C) and incubation was continued overnight (18 h). The cells were
harvested by centrifugation at 5000 × g for 5 min at 4 °C. The cell
paste (3.2 g/L, wet cell) was suspended in a Tris-HCl buffer (20 mM,
pH 7.8) containing 0.3 M NaCl, 1% Triton X-100, and 5 mM imidazole.
Cells were then lysed three times by using a French press (Aminco
Co., 1500 psi). The cell debris was removed by centrifugation at 27000
× g and the supernatant was collected and filtered through a 0.45 µm
Millipore filter. The cleared lysate supernatant was loaded onto an
equilibrated Ni-NTA agarose column and washed with a buffer
containing 30 mM imidazole. The protein was eluted with 100 and
180 mM imidazole and was analyzed by 12% SDS-PAGE gel. The
partially purified protein was dialyzed (overnight at 4 °C) against 4 L
of cold Tris-HCl buffer (25 mM, pH 7.6) containing 0.2% Triton X-100,
10 mM MgCl2 and 1 mM DTT.
Acknowledgment. The authors thank Flora Huang for the
preparation of the sialyltransferase. This research was supported
by the NIH (GM44154). Oliver Plettenburg acknowledges a
fellowship of the Deutsche Forschungsgemeinschaft.
Supporting Information Available: Procedures for en-
zyme assay, synthesis, and characterization of compounds 2-7,
12-47, and 54-71, and general procedures for the prep-
aration of CMP-sialic acid derivatives (PDF). This material is
available free of charge via the Internet at http://pubs.acs.org.
JA011382R