Enantioselective microbial synthesis of the indigenous natural product (-)-α-bisabolol by a sesquiterpene synthase from chamomile (Matricaria recutita)

Article abstract of DOI:10.1042/BJ20140306

(-)-α-Bisabolol, a sesquiterpene alcohol, is a major ingredient in the essential oil of chamomile (Matricaria recutita) and is used in many health products. The current supply of (-)-α-bisabolol is mainly dependent on the Brazilian candeia tree (Eremanthus erythropappus) by distillation or by chemical synthesis. However, the distillation method using the candeia tree is not sustainable, and chemical synthesis suffers from impurities arising from undesirable α-bisabolol isomers. Therefore enzymatic synthesis of (-)-α-bisabolol is a viable alternative. In the present study, a cDNA encoding (-)-α-bisabolol synthase (MrBBS) was identified from chamomile and used for enantioselective (-)-α-bisabolol synthesis in yeast. Chamomile MrBBS was identified by Illumina and 454 sequencing, followed by activity screening in yeast. When MrBBS was expressed in yeast, 8mg of α-bisabolol was synthesized de novo per litre of culture. The structure of purified α-bisabolol was elucidated as (S,S)- α-bisabolol [or (-)-α-bisabolol]. Although MrBBS possesses a putative chloroplast-targeting peptide, it was localized in the cytosol, and a deletion of its N-terminal 23 amino acids significantly reduced its stability and activity. Recombinant MrBBS showed kinetic properties comparable with those of other sesquiterpene synthases. These data provide compelling evidence that chamomile MrBBS synthesizes enantiopure (-)-α-bisabolol as a single sesquiterpene product, opening a biotechnological opportunity to produce (-)-α-bisabolol.

Full text of DOI:10.1042/BJ20140306

Biochem. J. (2014) 463, 239–248 (Printed in Great Britain) doi:10.1042/BJ20140306
239
Enantioselective microbial synthesis of the indigenous natural product
( − )-α-bisabolol by a sesquiterpene synthase from chamomile (Matricaria
recutita)
1
1
Young-Jin SON*, Moonhyuk KWON†, Dae-Kyun RO† and Soo-Un KIM*‡
*Department of Agricultural Biotechnology and Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921, South Korea
†Department of Biological Sciences, University of Calgary, Calgary, Canada, T2N 1N4
‡School of Gardening and Horticulture, Yangtze University, Jingzhou, Hubei 434023, China
( − )-α-Bisabolol, a sesquiterpene alcohol, is a major ingredient
in the essential oil of chamomile (Matricaria recutita) and is used
in many health products. The current supply of ( − )-α-bisabolol
is mainly dependent on the Brazilian candeia tree (Eremanthus
erythropappus) by distillation or by chemical synthesis. However,
the distillation method using the candeia tree is not sustainable,
and chemical synthesis suffers from impurities arising from
undesirable α-bisabolol isomers. Therefore enzymatic synthesis
of ( − )-α-bisabolol is a viable alternative. In the present
study, a cDNA encoding ( − )-α-bisabolol synthase (MrBBS)
was identified from chamomile and used for enantioselective
( − )-α-bisabolol synthesis in yeast. Chamomile MrBBS was
identified by Illumina and 454 sequencing, followed by activity
screening in yeast. When MrBBS was expressed in yeast, 8 mg
of α-bisabolol was synthesized de novo per litre of culture.
The structure of purified α-bisabolol was elucidated as (S,S)-
α-bisabolol [or ( − )-α-bisabolol]. Although MrBBS possesses
a putative chloroplast-targeting peptide, it was localized in
the cytosol, and a deletion of its N-terminal 23 amino acids
significantly reduced its stability and activity. Recombinant
MrBBS showed kinetic properties comparable with those of other
sesquiterpene synthases. These data provide compelling evidence
that chamomile MrBBS synthesizes enantiopure ( − )-α-bisabolol
as a single sesquiterpene product, opening a biotechnological
opportunity to produce ( − )-α-bisabolol.
Key words: bisabolol, candeia, chamomile, metabolic engineer-
ing, terpene synthase, yeast.
added to yield three prenyl diphosphate molecules: C10 GPP
(geranyl diphosphate), C15 FPP (farnesyl diphosphate) and C20
GGPP (geranylgeranyl diphosphate). These prenyl diphosphates
are converted by TPS (terpene synthase) into various terpene
hydrocarbons [8,9]. Isoprenoids are classified according to the
number of carbons as monoterpenes (C10), sesquiterpenes (C15)
and diterpenes (C20). As terpenes have multiple chiral centres and
complex hydrocarbon backbones, chemical synthesis of terpenes
is not usually practical, and hence the identification and utilization
of unique TPSs are central in contemporary pharmaceutical and
chemical industries [10].
Chamomile (Matricaria recutita) is one of the most commonly
consumed herbal medicines [11]. The therapeutic values of
chamomile come from its essential oil component, ( − )-α-
bisabolol [12]. ( − )-α-Bisabolol, a sesquiterpene alcohol, is
naturally occurring in the Brazilian candeia tree (Eremanthus
erythropappus) and also in German chamomile (Matricaria
recutita) [13,14]. This compound has been shown to possess
various pharmaceutical activities (e.g. antibacterial, antiseptic
and anti-inflammatory) and skin-soothing and -moisturizing
properties [15–18]. At present, the majority of ( − )-α-bisabolol,
sold as ‘natural α-bisabolol’, is produced by distillation of
candeia tree leaves [14]. However, sustainability of this Brazilian
indigenous plant has raised an environmental issue in recent years
INTRODUCTION
Terpenoids (or isoprenoids) are the largest and structurally
most diverse group of secondary metabolites, with more than
55000 listed compounds [1]. In Nature, terpenoids have essential
roles, such as those involved in protein prenylation (e.g.
RAS prenylation), plant hormonal regulation (e.g. gibberellin,
brassinosteroids, cytokinin and abscisic acid), photosynthetic
light harvesting (e.g. carotenoid and chlorophyll), and respiratory
electron transport (e.g. ubiquinone) [2–4]. Terpenoids often
function as toxins, growth inhibitors or deterrents to protect the
producers from competing plants or herbivores [5]. Terpenoids
also have been extensively exploited by humans for their
beneficial functions as pharmaceuticals (e.g. paclitaxel and
artemisinin), flavours and fragrance compounds (e.g. menthol,
patchoulol and nootkatone) [6].
In Nature, terpenoids are synthesized from successive
condensations of five-carbon building units. These are IPP
(isopentenyl diphosphate) and its isomer, DMAPP (dimethyl allyl
diphosphate), both of which are synthesized in two independent
pathways: the cytosolic MVA (mevalonate) pathway and the
plastidic MEP (2-C-methyl-D-erythritol 4-phosphate) pathway
[3,7]. Starting with DMAPP, the head to tail condensation reaction
is catalysed by prenyltransferase, and one to three IPP units are
Abbreviations: DMAPP, dimethyl allyl diphosphate; EI, electron impact; FPP, farnesyl diphosphate; FPPS, FPP synthase; IPP, isopentenyl diphosphate;
LdBBS, ( + )-epi-α-bisabolol synthase from Lippia dulcis; MBP, maltose-binding protein; mono-TPS, monoterpene synthase; MrBBS, chamomile (Matricaria
recutita) α-bisabolol synthase; MrTPS, chamomile (Matricaria recutita) TPS; MVA, mevalonate; NPP, nerolidyl diphosphate; qRT-PCR, quantitative reverse
transcription–PCR; SC, synthetic complete; sesqui-TPS, sesquiterpene synthase; TPS, terpene synthase; TRX, thioredoxin.
1
Correspondence may be addressed to either of these authors (email soounkim@snu.ac.kr or daekyun.ro@ucalgary.ca).
®
Nucleotide sequence of identified Matricaria recutita sesquiterpene synthases have been submitted to the DDBJ, EMBL, GenBank and GSDB
Nucleotide Sequence Databases with accession numbers: KJ020282 [MrTPS1, ( − )-α-bisabolol synthase], KJ020284 (MrTPS4, bicyclogermacrene
synthase) and KJ020283 (MrTPS6, β-farnesene synthase).
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

240
Y.-J. Son and others
grown for 5–6 weeks in a phyto-chamber with a 16 h light/8 h
dark photoperiod at 23◦C.
DNA construct for yeast expression
Six TPS clones were amplified from 20 ng of cDNA using the
primers listed in Supplementary Table S1 (http://www.biochemj.
org/bj/463/bj4630239add.htm) (1–12). Amplified PCR products
were cloned into pMD-20 (TaKaRa Bio), and cDNA sequences
were confirmed by sequencing. The TPS cDNAs were digested
using restriction enzymes and ligated into the respective
restriction digestion sites of pESC-Leu2d vector. For fused
MrBBS, MBP (maltose-binding protein), GST and TRX
(thioredoxin) were amplified using primers 28–33 using templates
of pMAL-c2X (NEB) pGEX-2T (GE Healthcare) and pET32a
(Novagen) respectively. Amplified PCR products were digested
appropriately and ligated to the N-terminus of MrBBS in pESC-
Leu2d vector. To characterize each sesqui-TPS, the constructs and
empty vector were separately transformed into the EPY300 yeast
strain by the lithium acetate/PEG transformation method [27–29].
Figure 1 Structures of four α-bisabolol isomers
[19]. ( − )-α-Bisabolol can be chemically synthesized, but the
synthetic ( − )-α-bisabolol contains other diastereomers [( + )-
α-bisabolol and ( + / − )-epi-α-bisabolol] and undesirable by-
products from chemical synthesis procedures. Therefore synthetic
production of ‘natural identical’ ( − )-α-bisabolol requires an
economically unfavourable purification procedure to achieve a
high optical purity. Nonetheless, the synthetic supply of ( − )-α-
bisabolol and its stereoisomers have recently been replacing the
natural ( − )-α-bisabolol production from the Brazilian candeia
tree.
α-Bisabolol possesses two chiral centres at C1 and C7
(Figure 1). Depending on the configuration of these two chiral
carbons, four possible stereoisomers of α-bisabolols, ( + / − )-
α-bisabolol and ( + / − )-epi-α-bisabolol, can be formed [20].
Previously, two α-bisabolol synthase genes were identified from
Aztec herb (Lippia dulcis) and bacterium Streptomyces citricolor,
and the products from their recombinant enzymes were elucidated
as ( + )-epi-α-bisabolol and ( − )-epi-α-bisabolol respectively
[21,22]. Although a specific configuration was not elucidated, one
other α-bisabolol synthase was also found from Artemisia annua
[23], and dual-functional bisabolene/α-bisabolol synthases which
synthesize only a trace amount of α-bisabolol were isolated from
Arabidopsis and Santalolum spp. [24,25]. To date, a sesqui-TPS
(sesquiterpene synthase) synthesizing pure ( − )-α-bisabolol as a
single terpene product has not been identified.
In vivo yeast characterization and bisabolol quantification
Transgenic yeast were inoculated in 2 ml of SC (synthetic
complete) medium (supplemented with 2% glucose and lacking
methionine, histidine and leucine) and grown overnight at 30◦C.
The transgenic yeast culture was diluted 50-fold into 30 ml
of SC medium (with 1.8% galactose, 0.2% glucose, 2 mM
methionine and lacking histidine and leucine). To sequester the
volatile sesquiterpene product, 3 ml of dodecane was overlaid on
to the culture, and incubated at 30◦C and 200 rev./min for 3 days.
Cultures were transferred to a 50 ml Falcon tube and centrifuged
at 3000 g for 5 min. The dodecane layer was separated and diluted
100-fold in hexane for GC–MS analysis. For quantification, the
cultured medium was extracted with ethyl acetate and analysed
by GC–FID (flame ionizer detector) (Shimadzu) against the
calibration curve constructed from commercial ( − )-α-bisabolol
(Sigma) using the following temperature programme: initial
temperature 60◦C (2 min hold), increase to 300◦C at 5◦C·min− 1
,
and 300◦C held for 10 min. The analysis was conducted using a
ZB-5 GC column (0.25 μm film thickness, 0.25 mm×30 m) and
nitrogen as a carrier gas at a flow rate of 1 ml·min− 1
.
Protein expression in Escherichia coli and purification
To obtain recombinant MrBBS–His6, the ORFs of full-length
MrBBS, 23- or 52-residue-deleted MrBBS were cloned into
pET21 vector (Novagen), using the Gibson assembly cloning
kit (NEB) and the primers listed in Supplementary Table
S1 (13–16). Recombinant pET21-MrBBS-His6 construct was
transformed into E. coli BL21 codon plus-RIL cells (Stratagene)
and selected with ampicillin (100 μg·ml− 1) and chloramphenicol
(36 μg·ml− 1). A single transformed colony was cultured in LB
medium to a D600 of 0.5. MrTPS (chamomile TPS) expression
was then induced with 0.4 mM IPTG by incubation at 17◦C for
16 h. The cells were harvested by centrifugation and resuspended
in lysis buffer [20 mM Hepes (pH 7.6), 10 mM MgCl2, 500 mM
NaCl, 5 mM 2-mercaptoethanol, 20 mM imidazole, 10% (w/v)
glycerol and 1 mM PMSF]. After cell lysis by sonication and
centrifugation at 4000 g for 10 min at 4◦C, the clear supernatant
was loaded on to a 1 ml HisTrap HP column (GE Healthcare),
which was pre-equilibrated with wash buffer [20 mM sodium
phosphate (pH 7.4), 10 mM MgCl2, 500 mM NaCl, 5 mM 2-
mercaptoethanol, 20 mM imidazole and 15% (w/v) glycerol].
From chamomile, five TPSs have recently been characterized
[26]. However, ( − )-α-bisabolol synthase was not included
among the TPSs characterized from chamomile. In the present
study, we identified a gene encoding chamomile α-bisabolol
synthase (MrBBS) using next-generation (Illumina and 454)
sequencing. This enzyme can synthesize enantiopure ( − )-α-
bisabolol as a single terpene product. Furthermore, as proof-of-
concept, microbial and in planta production of ( − )-α-bisabolol
was demonstrated.
EXPERIMENTAL
Plant material
Chamomile (M. recutita) was grown in a phyto-chamber
maintained with a 16 h light/8 h dark photoperiod at 23◦C. Stem,
leaf, root and flower were harvested from 6-week-old M. recutita.
Nicotiana benthamiana for transient expression experiments was
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

( − )-α-bisabolol synthase from chamomile
241
programme: initial temperature of 50◦C (5-min hold), increased
to 200◦C at 2◦C·min− 1, and ramped to 300◦C at 50◦C·min− 1
(15 min hold). The GC column was TG-5MS (0.25 μm film
thickness, 0.25 mm×30 m, Thermo Scientific). Retention times
of the products were compared with those of authentic ( − )-α-
bisabolol, and the fragmentation pattern was searched against the
NIST11 database. To identify the in vitro enzymatic product of
MrBBS, 2 μl of pentane extract was directly analysed by GC–MS
(Agilent 6890N gas chromatography system and Agilent 5975B
mass spectrometer) with an authentic standard in the following
temperature program: injection at 250◦C, and ramped from 40◦C
to 250◦C at a rate of 10◦C·min− 1. The column used was DB1-MS
(0.25 μm film thickness, 250 μm×30 m) and helium was used as
a carrier gas with a flow rate of 1 ml·min− 1. For chiral analysis,
a previously published GC–MS method and chiral column were
used [21].
After the column was washed with a 10-fold column volume
of the wash buffer, the bound protein was eluted by a linear
gradient of imidazole up to 500 mM. Protein in each fraction was
confirmed using SDS/PAGE. Fractions containing the sesqui-TPS
were pooled and dialysed at 4◦C for 24 h to remove imidazole.
In vitro enzyme assay and kinetics
For the in vitro enzyme assay, 500 μl of reaction mixture was
prepared with 20 μg of purified recombinant protein, 100 μM
FPP (Echelon Biosciences), 50 mM Tris/HCl (pH 7.5) and 10 mM
MgCl2. The mixture was incubated at 30◦C for 2 h, followed by
extraction with 500 μl of pentane (vortex-mixed and centrifuged
at 4000 g for 2 min). The aqueous layer was extracted twice more
with 500 μl of pentane each. The collected pentane layer was
concentrated and directly injected into GC–MS. To determine
kinetic parameters, 1 μg of protein was used in a 100 μl reaction
mixture containing 25 mM Hepes (pH 7.4), 10 mM MgCl2 and
0.5–25 μM FPP. The FPP was prepared by diluting 23 Ci·mmol− 1
[1-3H]FPP (PerkinElmer) 100-fold with unlabelled FPP. The
mixture was incubated at 30◦C for 10 min, after which the
mixture was mixed with 100 μl of stop solution (4 M NaOH
and 1 M EDTA). After quenching for 10 min, 900 μl of pentane
was added, vortex-mixed for 10 s and centrifuged at 15000 g
for 1 min. Then, 400 μl of the pentane layer was taken and
RNA isolation and expression analysis
Harvested plant material was ground in liquid nitrogen and
extracted using TRIzol® reagent (Invitrogen). A 1 μg sample
of total RNA was used to synthesize first-strand cDNA with
the cDNA synthesis kit (J&M). Bisabolol synthase transcript
level was determined using qRT-PCR (quantitative reverse
transcription–PCR) on a Rotor-Gene 2000 instrument (Corbett
Research) using 50 ng of cDNA with 2× QuantiMix SYBR kit
(J&M) and primers 17/18. All qRT-PCRs were performed in
triplicate. The endogenous actin gene was used as internal control
with primers 19/20. qRT-PCR primers are listed in Supplementary
Table S1. Relative gene expression was calculated using the
ꢀꢀCT method.
3
mixed with 3.5 ml of scintillation cocktail. The H radioactivity
was monitored using a Beckman LS6500 liquid scintillation
counter. The Michaelis–Menten plot was created and the kinetic
parameters were calculated by using the Enzyme Kinetics module
in SigmaPlot 12 (Systat).
α-Bisabolol purification
Transient expression in N. benthamiana leaves
For α-bisabolol purification, MrBBS-expressing transgenic yeast
was cultured in a total of 5 litres of culture without dodecane
overlay. After 3 days of culture at 30◦C, the culture medium
was decanted to a separatory funnel and extracted twice with
1 litre of ethyl acetate. The combined ethyl acetate fraction was
concentrated on a rotary evaporator to 2 ml, which was loaded on
to a silica column (24 mm×225 mm, 15 g of silica gel 60, 40–
63 μm) pre-washed with five column volumes of hexane. Then
the column was eluted stepwise with 60 ml each of 0%, 5% and
10% ethyl acetate in hexane. Each fraction was analysed by TLC
with hexane and ethyl acetate (9:1, v/v) as elution solvent and
was visualized under iodine vapour. The fractions containing α-
bisabolol were combined and loaded on to a pre-coated silica gel
60 F254 plate (175–225 μm, Merck), which was eluted by hexane
and ethyl acetate (9:1, v/v). The α-bisabolol-containing fraction
was extracted with ethyl acetate. Evaporation of the solvent gave
34 mg of purified bisabolol suitable for spectrometric analyses.
MrBBS and its N-terminally deleted versions were PCR-
amplified with specific primers (21–24) and cloned into
pDONR221, and then transferred to pK7WG2D using the
Gateway system (Invitrogen). The recombinant vectors were
transformed into Agrobacterium tumefaciens LBA4404, and
transformed cells were cultured overnight at 28◦C in 50 ml of LB
medium containing rifampicin (20 μg·ml− 1) and spectinomycin
(100 μg·ml− 1). The cultures were centrifuged at 3500 g for
10 min, and resuspended in buffer (10 mM Mes, 10 mM MgCl2
and 150 μM acetosyringone, pH 5.6) to adjust the D600 to 0.5.
The suspension was incubated further at room temperature for
8 h. The culture was infiltrated into the abaxial side of 6-week-old
N. benthamiana leaves with a 1 ml syringe. After 4 days, leaves
were harvested and ground in liquid nitrogen with a pestle and
mortar, followed by vortex-mixing in ethyl acetate and sonication
for 15 min. The extracts were centrifuged at 3500 g for 10 min
and dehydrated with Na2SO4. GC–MS analysis conditions were
the same as above for in vivo yeast characterization except for the
temperature programme (1 min hold at 130◦C, linear increase to
230◦C at 10◦C·min− 1 and subsequent linear increase to 310◦C
at 20◦C·min− 1 with a 10 min hold).
Chemical analyses
1
1D and 2D NMR [1H, 13C, H-1H COSY, DEPT (distortionless
enhancement by polarization transfer), HSQC and HMBC
(heteronuclear multiple bond correlation)] experiments were
conducted on
a JNM-LA400 spectrometer (Jeol) with
Subcellular localization of bisabolol synthase
[2H]chloroform CDCl3 as solvent. The optical rotation was
determined by using a Jasco P-1020 polarimeter (Jasco).
Authentic ( − )-α-bisabolol was used as standard (Sigma). To
analyse sesquiterpene products from MrBBS-expressing yeast,
the diluted dodecane layer was directly injected into GC–MS
(PerkinElmer Clarus 680 GC system coupled to a PerkinElmer
600T mass spectrometer) with the following temperature
Full-length MrBBS and a DNA fragment encoding its N-terminal
52 residues were amplified by PCR (primers 21–27). The PCR
products were cloned into pEAQ-GFP vector [30], and infiltration
experiments were performed as described above. Confocal
microscopy was performed with a multi-photon confocal laser-
scanning microscope (DE/LSM 510 NLO, Carl Zeiss). Infiltrated
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

242
Y.-J. Son and others
N. benthamiana leaves were excited with a 488 nm laser at 10%.
Emission was detected between 500 and 530 nm. The chlorophyll
autofluorescence was detected at 560 nm.
MrTPS1, MrTPS4 and MrTPS6 synthesize terpene products
different from those of the vector control, demonstrating the
synthesis of novel terpenes by these chamomile sesqui-TPS
enzymes (Figure 2A). However, volatile product profiles of the
yeast expressing MrTPS2, MrTPS7 and MrTPS8 were the same
as the control (results not shown). The EI (electron impact)
spectral matches of the new volatiles against the MS database
suggested that the MrTPS1, MrTPS4 and MrTPS6-expressing
yeast strains synthesize α-bisabolol, bicyclogermacrene and β-
farnesene respectively, as major terpene products (Figures 2C–
2E). Of particular interest is the MrTPS1-expressing yeast strain
showing a dominant peak with an EI–mass spectrum identical with
that of α-bisabolol in the database. To confirm this, an authentic
( − )-α-bisabolol standard was analysed by GC–MS together
with the MrTPS1 product, and the MrTPS1 product showed an
identical mass-fragmenting pattern and comparable retention time
with those of the ( − )-α-bisabolol standard (Figures 2B and 2C).
Aside from the farnesol (Figure 2, peak 4) derived from the FPP
substrate in yeast, α-bisabolol was a single terpene produced
by MrTPS1. On the basis of this result, MrTPS1 was named
chamomile α-bisabolol synthase (MrBBS).
Bioinformatic analysis to identify candidate sesqui-TPS genes
Transcriptome data of M. recutita were obtained from
the publicly available PhytoMetaSyn project (http://www.
phytometasyn.ca). Putative sesquiterpene synthase (sesqui-
TPS) genes were screened from the assembled dataset
using tBLASTn. Subcellular localization of MrBBS was pre-
dicted by ChloroP (http://cbs.dtu.dk/services/ChloroP), TargetP
(http://cbs.dtu.dk/services/TargetP) and PSORT (http://psort.hgc.
jp/form2.html). For quantitative mapping, the ‘Map reads to
reference’ tool in the CLC Genomics Workbench (5.5.1) was
employed using a single read Illumina data. The parameters used
were: mismatch cost, 2; insertion cost, 1; deletion cost, 1; length
fraction, 0.8; similarity fraction, 0.98.
RESULTS
Sesquiterpene synthase isolation from chamomile cDNA
Relative expression of MrBBS in chamomile
The focus of the present study was to identify ( − )-α-bisabolol
synthase from chamomile (Matricaria recutita), an Asteraceae
family plant species known to synthesize ( − )-α-bisabolol as
one of the main floral terpene products. Using chamomile floret
mRNAs, a half plate of 454 and one lane of Illumina sequencing
were carried out to determine deep transcript sequences. From
454 titanium sequencing, 735449 reads with an average length
of 480 bp were generated, and 602979 cleaned reads were
assembled using the MIRA algorithm [31], yielding 44324
contigs. From Illumina GAII sequencing, 64608668 reads at an
average length of 108 bp were sequenced, and 54992498 cleaned
reads with an average length of 81 bp were assembled using the
Velvet algorithm [32], yielding 59718 unique transcripts. The
BLAST-searchable assembled transcript data for both 454 and
Illumina data are accessible through the PhytoMetaSyn website
(http://www.phytometasyn.ca) [33,34].
From these assembled transcripts, eight sesqui-TPS cDNAs
encoding full-length enzymes were identified, and subsequently
all eight cDNAs were PCR-cloned from chamomile floral tissues.
These cDNAs were named MrTPS1–MrTPS8. Of these, two
sesqui-TPS clones, MrTPS3 and MrTPS5, displayed >99%
sequence identity with the previously reported chamomile sesqui-
TPSs, and these were shown to encode ( − )-germacrene D
synthase and germacrene A synthase respectively [26]. Therefore
these two clones were excluded from subsequent functional
analysis, and the remaining six clones (MrTPS1, MrTPS 2, MrTPS
4 and MrTPS 6–MrTPS8) were subjected to functional expression
in yeast.
A recent chemical analysis of chamomile has shown that α-
bisabolol and its oxidized products, bisabolol oxide A and B,
are the most abundant terpenoids in ray and disk florets among
different plant tissues (63–81% of total terpenes) [26]. It is
therefore predicted that the expression of MrBBS is highest in
chamomile florets. To determine whether MrBBS transcripts are
most abundant in floral tissues, qRT-PCR analysis was conducted
in various tissues, including three different developmental stages
of flowers. qRT-PCR results showed that MrBBS transcripts
were 24–58-fold higher in florets than in leaf (Figure 3).
In different floral stages, open flowers had an approximately
2.5-fold higher level of MrBBS expression than in immature
flowers.
In addition to qRT-PCR data, massive Illumina sequencing
enabled us to compare the relative expression levels of eight
MrTPS genes in chamomile floral tissue. To do so, approximately
32.3 million Illumina single reads were quantitatively mapped on
reference sequences of the eight sesqui-TPSs. The abundance of
their transcripts varied between 320 and 5500 reads per million
total reads, with MrBBS being the most abundant transcript
in chamomile floral tissue (Table 1). These expression studies
showed that MrBBS is predominantly expressed in the open floral
tissue, in which MrBBS is the most abundant transcript among the
eight sesqui-TPSs identified.
De novo α-bisabolol production in yeast
To elucidate the stereo-configuration of α-bisabolol, it was
essential to acquire a sufficient amount of MrBBS-produced
α-bisabolol in high purity. Before purification, the level of α-
bisabolol production from the transgenic EPY300 yeast strain
was examined. In a simple shaking flask condition, when the
Activity screening of sesquiterpene synthases in yeast
In order to assess whether ( − )-α-bisabolol synthase is present
among the isolated cDNAs, the ORFs of the six clones were
expressed under the Gal1 promoter of the pESC-Leu2d plasmid
in yeast [28]. The plasmid harbouring each sesqui-TPS cDNA
was used to transform the EPY300 yeast strain engineered to
endogenously produce an elevated level of FPP, a sesqui-TPS
substrate [28,29]. Volatile terpenes produced from the transgenic
yeast cultures were sequestered by dodecane overlaid on the
culture, and terpenes trapped in the dodecane were analysed by
GC–MS. GC–MS analyses showed that yeast strains expressing
+
whole culture was extracted using organic solvent, 8.1 0.4 mg
−
(n = 5) of α-bisabolol was produced from 1 litre of culture
after 4 days of cultivation (Supplementary Figure S1A at
http://www.biochemj.org/bj/463/bj4630239add.htm). Although
this productivity was satisfactory, we further sought yield
improvement. It has been reported that the translational fusion
of soluble protein to the N-terminus of sesqui-TPS can markedly
increase in vivo production of sesquiterpene in yeast, probably
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

( − )-α-bisabolol synthase from chamomile
243
Figure 2 In vivo screening of sesqui-TPSs isolated from chamomile in engineered yeast
(A)Totalionchromatogramsofauthentic( − )-α-bisabololstandard,andtheextractsfromtheyeastexpressingMrTPS1,MrTPS4,MrTPS6 andemptyvector.(B)–(E)Massspectraof( − )-α-bisabolol
standard and peaks 1–3: ( − )-α-bisabolol standard (B), peak 1 from MrTPS1 (C), peak 2 from MrTPS4 (D) and peak 3 from MrTPS6 (E). Peak 4 is farnesol derived from dephosphorylation of FPP.
Rt, retention time.
showed that α-bisabolol production was comparable with that of
non-fused MrBBS, but GST- and TRX-fused MrBBS showed a
lower level of α-bisabolol production (25% and 32% of non-
fused MrBBS respectively) (Supplementary Figure S1C). We
concluded that yeast expressing non-fused native MrBBS was
because of increased protein solubility [35,36]. Therefore
commonly used soluble protein (i.e. MBP, GST or TRX) was
fused to the N-terminus of MrBBS, and the relative α-bisabolol
production from the yeastlines expressing these three fusion genes
were compared (Supplementary Figure S1B). MBP-fused MrBBS
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

244
Y.-J. Son and others
Table 2 1H- and 13C-NMR chemical shift ([2H]chloroform) values of
bisabolol in the present study
Table 1 Estimated expression levels of MrTPS1–MrTPS8 in chamomile
floral tissues
A total of 32304344 Illumina reads were used to quantitatively map MrTPS1–MrTPS8
transcripts. In the informatics conditions used (see the Experimental section), unique and
total read numbers were identical for all eight MrTPSs, indicating that no cross-mapping
occurred in this analysis.
NMR data here were identical with those from ( − )-α-bisabolol standard.
Position
δ1H
δ13C
43.19
1
2a/b
3
1.24 (m)
1.76 (m)/1.95 (m)
5.35 (m)
–
Name
ORF length Unique read number Read number per million total reads
27.15
120.76
134.39
31.25
23.51
74.57
40.32
22.29
124.79
131.98
17.91
25.93
23.58
23.45
MrTPS1 (MrBBS) 1719
5500
320
877
1753
4127
2739
663
170
10
27
54
128
85
4
MrTPS2
MrTPS3
MrTPS4
MrTPS5
MrTPS6
MrTPS7
MrTPS8
1620
1650
1647
1725
1725
1650
1536
5
6a/b
7
1.97 (m)
1.25 (m)/1.89 (m)
–
8
9
1.47 (m)
2.04 (m)
5.1 (m)
21
11
10
11
12
13
14
15
346
–
1.59 (d, J = 1.28Hz)
1.66 (s)
1.08 (s)
1.62 (s)
by optical rotation measurement. In this analysis, the observed
optical rotation value, [α]25 − 65.8 (ethanol), was sufficiently
close to [α]25 − 67.6 from the authentic ( − )-α-bisabolol standard.
This observation conclusively established the stereochemistry
of the MrBBS product as ( − )-α-bisabolol or ( − )-(1S,7S)-
bisabolol, which is currently commercialized as ‘natural identical’
α-bisabolol.
The N-terminal motif in MrBBS influences its catalytic activity
It is well established that sesqui-TPS localizes to the cytosol in
agreement with its utilization of the cytosolic MVA-pathway-
derived FPP. Intriguingly, however, computational prediction
of subcellular location of MrBBS indicated the presence
of chloroplast-targeting sequences. The TargetP and ChloroP
algorithms predicted an N-terminal 52-residue plastid-targeting
peptide, whereas the PSORT algorithm predicted a N-terminal
14-residue plastid-targeting peptide. These in silico predictions
suggested possible plastidic localization of MrBBS. Therefore
we investigated the function of these unusual putative plastid-
targeting peptides.
Figure 3 Relative MrBBS transcript levels by floral developmental stages
and organs
MrBBS expression was measured relative to its transcript level in leaf (set as expression level
one) by qRT-PCR (n = 3). Actin was used as an internal control. F-1, flower at opening stage;
F-2, flower at disc floret formation stage; F-3, flower at full bloom. Statistical significance of
measurements was determined by using a Student’s t test (*Pꢀ0.05, **Pꢀ0.01) compared
with F-1.
optimal for α-bisabolol production, and hence it was used for
subsequent α-bisabolol purification.
First, to examine whether the N-terminal motif affects
MrBBS activity in planta, two truncated versions of MrBBS
were constructed and transiently expressed in N. benthamiana
leaves. The ꢀ23MrBBS version lacked 23 residues in the
characteristic signature for plastidic localization, including 11
serine and threonine amino acids. The second ꢀ52MrBBS
version lacked the 52 residues containing the plastid-targeting
transit peptide predicted by TargetP and ChloroP. When ( − )-
α-bisabolol was measured from tobacco leaves 4 days after
infiltration, full-length MrBBS-expressing leaves accumulated
∼10 μg of ( − )-α-bisabolol per g of fresh weight (Figure 4A,
and Supplementary Figure S2 at http://www.biochemj.org/bj/
463/bj4630239add.htm). However, the leaves expressing
ꢀ23MrBBS accumulated a 41-fold lower level of ( − )-α-
bisabolol than those expressing full MrBBS. From the leaves
expressing ꢀ52MrBBS, no ( − )-α-bisabolol was detected. These
results suggested that a short N-terminal 23-residue peptide
of MrBBS influenced in planta ( − )-α-bisabolol-synthesizing
activity either by targeting MrBBS to plastid or by directly
affecting MrBBS activity.
Purification and structural elucidation of ( − )-α-bisabolol
GC–MS data strongly suggested that the MrBBS product is
α-bisabolol. To unambiguously distinguish between the four
stereoisomers of α-bisabolol (Figure 1), 34 mg of α-bisabolol
was purified from the whole yeast culture using a silica column,
and the purified product was subjected to 1D and 2D NMR
and optical rotation analysis in comparison with the authentic
( − )-α-bisabolol standard. It is known that α-bisabolol and
its diastereomer, epi-α-bisabolol, have slight but consistent
1
differences in their 13C- and H-chemical shifts. In particular,
signals of H3 and H15, and C2, C4, C6, C8 and C14 are sufficiently
different between these two isomers [20,21,37]. In 13C- and H-
1
NMR analyses, the chemical shift values of the MrBBS-product
were shown to coincide completely with those of ( − )-α-bisabolol
1
standard [full 13C- and H-NMR signal assignments of MrBBS-
product and ( − )-α-bisabolol are given in Table 2]. Thus the
MrBBS-product was clearly determined to be α-bisabolol and not
epi-α-bisabolol. Since α-bisabolol has two enantiomers, ( + )- and
( − )-α-bisabolol, with identical chemical shifts, determination
of the absolute configuration of MrBBS product was addressed
Next, the plastidic localization of MrBBS was investigated
by expressing the protein as a GFP fusion. Full-length MrBBS
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

( − )-α-bisabolol synthase from chamomile
245
Figure 4 Characterization of truncated forms of the MrBBS enzyme
(A) Synthesis of ( − )-α-bisabolol in tobacco leaves by transient expression of full-length MrBBS, 23 N-terminal residue-deleted MrBBS (ꢀ23), and 52 N-terminal residue-deleted MrBBS (ꢀ52).
n.d., not detectable. (B) SDS/PAGE analysis of purified MrBBS and truncated form (ꢀ23). To compare purification yield, the same volume of cell culture and purification buffer were used. The arrow
indicates purified ꢀ23MrBBS enzyme, and a protein band above the arrow is a contaminant from E. coli. ꢀ52MrBBS enzyme could not be detected after purification. (C) Specific activities of MrBBS
+
and ꢀ23MrBBS in in vitro assays using 100 μM FPP. Results are means S.D. (n = 3).
−
at http://www.biochemj.org/bj/463/bj4630239add.htm). Kinetic
parameters of ꢀ23MrBBS, however, could not be determined
because of its negligible activity. The in vitro MrBBS-synthesized
α-bisabolol was more carefully examined using a chiral column
and the GC programme previously tuned to clearly separate
different α-bisabolol isomers [21]. Besides ( − )-α-bisabolol,
only one other terpene, putatively assigned as β-farnesene
by database search (91% spectral match), was identified
in the GC–MS analysis, but this minor terpene constituted
only 2% of the total terpenoids (Supplementary Figure
S4 at http://www.biochemj.org/bj/463/bj4630239add.htm). No
evidence of another isomer formation, other than ( − )-
α-bisabolol, was obtained in this chiral GC–MS analysis
(Supplementary Figure S4). Therefore the MrBBS enzyme in vitro
synthesizes enantiopure ( − )-α-bisabolol with 98% terpene
purity, consistent with in vivo data in yeast and tobacco.
or its N-terminal 52 residues was fused to GFP by C-terminal
tagging, followed by transient expression in N. benthamiana
leaves. Confocal microscopy, however, showed that the GFP
signal did not overlap with chloroplastic autofluorescence in both
the full and 52-residue-fused constructs (Figure 5). Therefore
MrBBS is not localized to the plastid, but rather is localized
to cytosol similarly to other sesqui-TPS enzymes despite the
presence of the putative plastid-targeting motif on its N-terminus.
Furthermore, it can be inferred that a short N-terminal peptide
directly influences MrBBS catalytic activity.
Finally, in order to probe the role of the short N-terminal
peptide on MrBBS activity, full-length MrBBS, ꢀ23MrBBS or
ꢀ52MrBBS was expressed and purified from E. coli by its His6 tag
appended to the C-terminus of MrBBS. During the purification
procedure, it was apparent that the truncated forms of MrBBS
were either unstable or prone to aggregation in E. coli since
significantly less recombinant enzyme could be purified from
ꢀ23MrBBS-expressing bacterial cells (Figure 4B). ꢀ52MrBBS
recombinant enzyme could not be purified from the soluble frac-
tion, although it was present in the insoluble fraction (results not
shown). When the specific activities of the full-length MrBBS and
ꢀ23MrBBS were measured using the same amount of enzyme,
ꢀ23MrBBS specific activity was two orders of magnitude lower
than that of full-length MrBBS, indicating that the catalytic
activity of ꢀ23MrBBS was severely compromised (Figure 4C).
Taken together, these data suggest that the N-terminal transit-
peptide-like motif does not have a role in localizing MrBBS to
plastids, but directly influences MrBBS stability and/or catalytic
activity. A small deletion as short as 23 residues was sufficiently
detrimental to MrBBS activity in vitro and in planta.
DISCUSSION
( − )-α-Bisabolol, a widely added component of cosmetic
products owing to its tissue-healing and -moisturizing properties,
is isolated from the Brazilian candeia tree. Recent concerns over
the sustainability of the candeia tree populations in Brazil have
resulted in calls for the chemical synthesis of the bisabolol to
meet commercial demands. However, the chemically synthesized
α-bisabolol requires a costly purification process to obtain natural
identical ( − )-α-isomer. Therefore sustainable and economic
production of ( − )-α-bisabolol has become an important issue in
the speciality chemical industry. In the present study, we identified
a novel stereoselective ( − )-α-bisabolol synthase (MrBBS) from
chamomile and demonstrated its use for microbial and in planta
( − )-α-bisabolol synthesis.
MrBBS enzyme characterization
Using purified full-length MrBBS-His6 recombinant enzyme,
kinetic properties of MrBBS were examined. MrBBS kinetic
MrBBS is a unique enzyme of enantioselective ( − )-α-bisabolol
synthesis
parameters were determined to have
a
Km of 3.6 μM
for FPP and
a
kcat of 4.6×10− 3
.
This is comparable
One key characteristic of chamomile MrBBS, relevant
to biotechnological uses, is its exclusive synthesis of
with other reported sesqui-TPSs (Supplementary Figure S3
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

246
Y.-J. Son and others
Figure 5 Subcellular localization of MrBBS in N. benthamiana mesophyll cells
Full-length MrBBS or first 52-residue fragment was C-terminally fused to GFP, and these fusion constructs were transiently expressed in N. benthamiana leaves. Scale bar, 10 μm.
( − )-α-bisabolol as a single terpene product. Only a negligible
amount of farnesene was detected as a co-product. It has been
reported that some TPSs can synthesize dozens of products.
In some extreme cases, Medicago truncatula TPS generated 27
products and Abies grandis TPS generated 52 products [38,39].
With regard to TPS-mediated bisabolol synthesis, α-bisabolene
synthases from Sandalwood and Arabidopsis synthesize α-
bisabolol as a minor co-product [24,25]. Therefore, before the
present study, it was reasonably postulated that ( − )-α-bisabolol
in chamomile was synthesized by one or more multifunctional
TPSs, which could make it difficult to utilize ( − )-α-bisabolol
TPS for biotechnological purposes. Our MrBBS characterization
data, however, showed that a single enzyme, MrBBS, is sufficient
to produce a single enantioselective ( − )-α-bisabolol as a major
catalytic product (>98%). Although sesqui-TPSs synthesizing
α-bisabolol as a single major product have been cloned and
characterized previously, these enzymes synthesized structurally
different undesirable isomers (Lippia dulcis and Streptomyces
citricolor) or α-bisabolol of unknown stereochemistry (Artemisia
annua) [21–23]. At present, the catalytic feature of MrBBS [i.e.
formation of a single enantiopure ( − )-α-bisabolol] is unique and
suitable for biotechnological synthesis of natural identical ( − )-α-
bisabolol. As a proof-of-concept, MrBBS cDNA was expressed in
yeast and tobacco, and we confirmed that ( − )-α-bisabolol titres
of 8 mg/l of yeast culture and 10 μg/g of tobacco fresh weight
can be reached. These are the first demonstrations of enantiopure
( − )-α-bisabolol synthesis beyond that observed by the candeia
tree and chamomile.
assume the correct conformation for the initial formation of a six-
membered ring so that the overlap of the p-orbital at the C6 Re face
with the C1 p-orbital would result in the formation of carbocation
with (1S)-configuration. Quenching of this carbocation by a
water molecule approached from the Si face at C7 completes
the generation of ( − )-α-bisabolol. We have previously cloned
LdBBS [( + )-epi-α-bisabolol synthase from Lippia dulcis] [21].
For the synthesis of ( + )-epi-α-bisabolol by LdBBS, NPP would
fold in such a way that the C1 p-orbital overlaps with the p-orbital
of the C6 Si face to result in an intermediate carbocation with (1R)-
configuration (Figure 6). Addition of water to the cationic C7 Si
face would lead to (1R,7S)-configuration. Therefore a comparison
of 3D structures of active sites of MrBBS and LdBBS would
provide a unique opportunity to identify structural elements that
guide the correct folding of FPP (or NPP) required to arrive at
different configurations at C1 of bisabolol.
The N-terminal motif of MrBBS influences its catalytic activity
Computational analyses of MrBBS predicted the N-terminal
52 amino acid residues to be a chloroplast-targeting transit
peptide. There is precedence of chloroplast-targeted sesqui-TPS
in wild tomato (Solanum habrochaites) [41]. In this case, the
chloroplast-localized FPPS (FPP synthase) that contained the
predicted plastid-localizing motif synthesizes Z,Z-FPP (or cis,cis-
FPP), which is an isomer of common E,E-FPP (or trans,trans-
FPP). Subsequently, chloroplast-localized sesqui-TPS catalyses
the formation of santalene and bergamotene from Z,Z-FPP. Since
in silico analyses of MrBBS sequences consistently predicted
it to be a plastid-localizing enzyme, we suspected that MrBBS
could also localize to the chloroplast; however, no evidence
of chloroplast localization was obtained by expression of a
GFP fusion to MrBBS, and MrBBS appears to localize in the
cytosol. Moreover, in contrast with the S. habrochaites FPPS,
the chamomile FPPS, identified from 454 and Illumina transcript
datasets, does not possess a plastid-localizing transit peptide
(results not shown). On the basis of these lines of evidence, we
Proposed mechanism of ( − )-α-bisabolol synthesis by MrBBS
The (1S)-configuration of ( − )-α-bisabolol is reminiscent of the
cyclization mechanism of amorphadiene synthase, in which the
initial formation of (1S)-bisabolyl carbocation is followed by
hydride shifts to form amorphadiene skeleton [40]. On the basis of
this relationship, the mechanism of action of MrBBS is proposed
in Figure 6. FPP is isomerized to NPP (nerolidyl diphosphate) to
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

( − )-α-bisabolol synthase from chamomile
247
Figure 6 Proposed mechanism of MrBBS
( − )-α-Bisabolol is formed putatively via a bisabolyl cation resulting from a cyclization of neryl diphosphate isomerized from FPP by MrBBS. Addition of water to the Si face of bisabolyl C7
completes the reaction. The pathway leading to ( + )-epi-α-bisabolol is shown to mark the stereochemical consequence of different NPP-folding in LdBBS as a comparison.
conclude that the computational analysis incorrectly predicted the
MrBBS localization in this case.
farnesene synthase) and MrTPS6/MrFAS (chamomile farnese
synthase), see Supplementary Figure S5], indicating that this N-
terminal signature may be retained in a small subset of sesqui-
TPSs. We attempted to model the N-terminal peptide of MrBBS
using the known crystal structure of 5-epi-aristolochene synthase
in hopes to understand its role. However, X-ray crystallographic
analyses of 5-epi-aristolochene synthases gave an indication of
structural flexibility of the N-terminal region [43], which makes
it difficult to implicate the role of the N-terminal region of sesqui-
TPS atthis moment. On the basisof our results, we propose thatthe
serine/threonine-rich motif positioned upstream of the (RX)X8W
motif does not encode a plastid-targeting transit peptide, but rather
is critical for proper MrBBS function.
Interestingly, the deletion of short 23 N-terminal residues in
MrBBS effectively abolished its catalytic activity. On one hand,
this result reinforced that the serine/threonine-rich motif is not
a transit peptide since it is known that the transit peptide does
not affect catalytic activity of TPS (see below). On the other
hand, such a dramatic loss of sesqui-TPS activity is unexpected
because the serine/threonine-rich 23-residue peptide is distal to
the highly conserved (RX)X8W motif in sesqui-TPS. In mono-
TPS (monoterpene synthase), this (RX)X8W motif is more refined
to the RRX8W motif, and changing the RR motif to RP or RA,
or removing the RR residues in limonene synthase (mono-TPS)
results in a complete loss of catalytic activity [42]. Although
this RRX8W motif has functional significance in mono-TPS, a
long peptide (50–90 residues, part of which is a transit peptide)
proceeding the RRX8W motif is not required for mono-TPS
catalytic activity. Hence entire residues can be removed without
altering mono-TPS enzyme activity. In contrast, typical sesqui-
TPS has a much shorter peptide in front of the (RX)X8W motif.
For example, only five amino acids are present in front of the
(RX)X8W motif in LdBBS [21] (Supplementary Figure S5 at
http://www.biochemj.org/bj/463/bj4630239add.htm). Because of
such an ambiguous status, the functional implication of the N-
terminal sequence of sesqui-TPS has so far been overlooked.
Our data indicated that a short 23-residue peptide of MrBBS has
a direct impact on its activity and may also influence the stability
and/or solubility of the enzyme. It is not clear how the short
peptide confers increased catalytic activity to MrBBS, although
the N-terminal peptide could impose proper protein-folding and
substrate-binding capability of the enzyme. Curiously, we have
found that some sesqui-TPSs from the Asteraceae family also
display this signature in their N-terminus [e.g. AaFAS (A. annua
AUTHOR CONTRIBUTION
Young-Jin Son characterized MrBBS in yeast, purified ( − )-α-bisabolol, and examined
MrBBS localization. Moonhyuk Kwon characterized recombinant MrBBS from E. coli and
plants. Dae-Kyun Ro performed in silico analysis, and Soo-Un Kim elucidated ( − )-
α-bisabolol structure. Dae-Kyun Ro and Soo-Un Kim designed the study. All authors
contributed to the preparation of the paper.
ACKNOWLEDGEMENTS
We thank Mohamed Attia (University of Calgary) for in silico identification of MrTPS
cDNAs and Dr Douglas Muench (University of Calgary) for help with revision of the paper.
FUNDING
This work was supported by the Next-Generation BioGreen 21 Program [Systems and
Synthetic Agrobiotech Center grant number PJ009549032014], Rural Development
Administration, Republic of Korea to S.-U.K. and by Genome Canada [grant number
PP780422], Genome Alberta, Government of Alberta [grant number PP789067], Genome
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

248
Y.-J. Son and others
24 Jones, C. G., Moniodis, J., Zulak, K. G., Scaffidi, A., Plummer, J. A., Ghisalberti, E. L.,
Barbour, E. L. and Bohlmann, J. (2011) Sandalwood fragrance biosynthesis involves
sesquiterpene synthases of both the terpene synthase (TPS)-a and TPS-b subfamilies,
including santalene synthases. J. Biol. Chem. 286, 17445–17454 CrossRef PubMed
25 Ro, D. K., Ehlting, J., Keeling, C. I., Lin, R., Mattheus, N. and Bohlmann, J. (2006)
Microarray expression profiling and functional characterization of AtTPS genes:
duplicated Arabidopsis thaliana sesquiterpene synthase genes At4g13280 and
At4g13300 encode root-specific and wound-inducible (Z)-γ -bisabolene synthases. Arch.
Biochem. Biophys. 448, 104–116 CrossRef PubMed
26 Irmisch, S., Krause, S. T., Kunert, G., Gershenzon, J., Degenhardt, J. and Kollner, T. G.
(2012) The organ-specific expression of terpene synthase genes contributes to the terpene
hydrocarbon composition of chamomile essential oils. BMC Plant Biol. 12, 84 PubMed
27 Gietz, R. D. and Schiestl, R. H. (2007) High-efficiency yeast transformation using the
LiAc/SS carrier DNA/PEG method. Nat. Protoc. 2, 31–34 CrossRef PubMed
28 Ro, D. K., Ouellet, M., Paradise, E. M., Burd, H., Eng, D., Paddon, C. J., Newman, J. D.
and Keasling, J. D. (2008) Induction of multiple pleiotropic drug resistance genes in yeast
engineered to produce an increased level of anti-malarial drug precursor, artemisinic acid.
BMC Biotechnol. 8, 83 CrossRef PubMed
29 Ro, D. K., Paradise, E. M., Ouellet, M., Fisher, K. J., Newman, K. L., Ndungu, J. M., Ho, K.
A., Eachus, R. A., Ham, T. S., Kirby, J. et al. (2006) Production of the antimalarial drug
precursor artemisinic acid in engineered yeast. Nature 440, 940–943 CrossRef PubMed
30 Sainsbury, F., Thuenemann, E. C. and Lomonossoff, G. P. (2009) pEAQ: versatile
expression vectors for easy and quick transient expression of heterologous proteins in
plants. Plant Biotechnol. J. 7, 682–693 CrossRef PubMed
31 Chevreux, B., Pfisterer, T., Drescher, B., Driesel, A. J., Muller, W. E., Wetter, T. and Suhai,
S. (2004) Using the miraEST assembler for reliable and automated mRNA transcript
assembly and SNP detection in sequenced ESTs. Genome Res. 14, 1147–1159
CrossRef PubMed
´
Quebec, McGill Innovation Centre, MDEIE (Ministe´re du De´veloppement Economique,
Innovation et Exportation) and Canada Research Chair programme to D.-K.R.
REFERENCES
1
2
Buckingham, J. (2011) Dictionary of Natural Products, Chapman and Hall/CRC, London
Berndt, N., Hamilton, A. D. and Sebti, S. M. (2011) Targeting protein prenylation for
cancer therapy. Nat. Rev. Cancer 11, 775–791 CrossRef PubMed
Chappell, J. (1995) Biochemistry and molecular biology of the isoprenoid biosynthetic
pathway in plants. Annu. Rev. Plant Biol. 46, 521–547 CrossRef
Umehara, M., Hanada, A., Yoshida, S., Akiyama, K., Arite, T., Takeda-Kamiya, N.,
Magome, H., Kamiya, Y., Shirasu, K. and Yoneyama, K. (2008) Inhibition of shoot
branching by new terpenoid plant hormones. Nature 455, 195–200 CrossRef PubMed
Gershenzon, J. and Dudareva, N. (2007) The function of terpene natural products in the
natural world. Nat. Chem. Biol. 3, 408–414 PubMed
3
4
5
6
7
8
Bohlmann, J. and Keeling, C. I. (2008) Terpenoid biomaterials. Plant J. 54, 656–669
CrossRef PubMed
Tholl, D. (2006) Terpene synthases and the regulation, diversity and biological roles of
terpene metabolism. Curr. Opin. Plant Biol. 9, 297–304 CrossRef PubMed
Bohlmann, J., Meyer-Gauen, G. and Croteau, R. (1998) Plant terpenoid synthases:
molecular biology and phylogenetic analysis. Proc. Natl. Acad. Sci. U.S.A. 95,
4126–4133 CrossRef PubMed
9
Cane, D. E. (1990) Enzymic formation of sesquiterpenes. Chem. Rev. 90, 1089–1103
CrossRef
10 Kirby, J. and Keasling, J. D. (2009) Biosynthesis of plant isoprenoids: perspectives for
microbial engineering. Annu. Rev. Plant Biol. 60, 335–355 CrossRef PubMed
11 Singh, O., Khanam, Z., Misra, N. and Srivastava, M. K. (2011) Chamomile (Matricaria
chamomilla L.): an overview. Pharmacogn. Rev. 5, 82–95 CrossRef PubMed
12 Jakovlev, V., Isaac, O., Thiemer, K. and Kunde, R. (1979) Pharmacological investigations
with compounds of chamomile. ii. New investigations on the antiphlogistic effects of
( − )-α-bisabolol and bisabolol oxides. Planta Med. 35, 125–140 CrossRef PubMed
13 Vuorela, H., Holm, Y., Hiltunen, R., Harvala, T. and Laitinen, A. (2006) Extraction of the
volatile oil in chamomile flowerheads using supercritical carbon dioxide. Flavour
Fragrance J. 5, 81–84 CrossRef
32 Zerbino, D. R. and Birney, E. (2008) Velvet: algorithms for de novo short read assembly
using de Bruijn graphs. Genome Res. 18, 821–829 CrossRef PubMed
33 Facchini, P. J., Bohlmann, J., Covello, P. S., De Luca, V., Mahadevan, R., Page, J. E., Ro,
D. K., Sensen, C. W., Storms, R. and Martin, V. J. (2012) Synthetic biosystems for the
production of high-value plant metabolites. Trends Biotechnol. 30, 127–131
CrossRef PubMed
34 Xiao, M., Zhang, Y., Chen, X., Lee, E. J., Barber, C. J., Chakrabarty, R., Desgagne-Penix,
I., Haslam, T. M., Kim, Y. B., Liu, E. et al. (2013) Transcriptome analysis based on
next-generation sequencing of non-model plants producing specialized metabolites of
biotechnological interest. J. Biotechnol. 166, 122–134 CrossRef PubMed
35 Gopfert, J. C., Macnevin, G., Ro, D. K. and Spring, O. (2009) Identification, functional
characterization and developmental regulation of sesquiterpene synthases from sunflower
capitate glandular trichomes. BMC Plant Biol. 9, 86 PubMed
36 Nguyen, T. D., MacNevin, G. and Ro, D. K. (2012) De novo synthesis of high-value plant
sesquiterpenoids in yeast. Methods Enzymol. 517, 261–278 CrossRef PubMed
37 Hashidoko, Y., Endoh, K., Kudo, T. and Tahara, S. (2000) ( + )-4-epi-α-bisabolol as a
major sesquiterepene constituent in the leaves of two Rosa rugosa hybrids, Martin
Frobisher and Vanguard. Biosci. Biotechnol. Biochem. 64, 907–910 CrossRef PubMed
38 Garms, S., Kollner, T. G. and Boland, W. (2010) A multiproduct terpene synthase from
Medicago truncatula generates cadalane sesquiterpenes via two different mechanisms. J.
Org. Chem. 75, 5590–5600 CrossRef PubMed
39 Steele, C. L., Crock, J., Bohlmann, J. and Croteau, R. (1998) Sesquiterpene synthases
from grand fir (Abies grandis): comparison of constitutive and wound-induced activities,
and cDNA isolation, characterization, and bacterial expression of δ-selinene synthase and
γ -humulene synthase. J. Biol. Chem. 273, 2078–2089 CrossRef PubMed
40 Kim, S.-H., Heo, K., Chang, Y.-J., Park, S.-H., Rhee, S.-K. and Kim, S.-U. (2006)
Cyclization mechanism of amorpha-4,11-diene synthase, a key enzyme in artemisinin
biosynthesis. J. Nat. Prod. 69, 758–762 CrossRef PubMed
41 Sallaud, C., Rontein, D., Onillon, S., Jabes, F., Duffe, P., Giacalone, C., Thoraval, S.,
Escoffier, C., Herbette, G., Leonhardt, N. et al. (2009) A novel pathway for sesquiterpene
biosynthesis from Z,Z-farnesyl pyrophosphate in the wild tomato Solanum habrochaites.
Plant Cell 21, 301–317 CrossRef PubMed
14 de Souza, A. T., Benazzi, T. L., Grings, M. B., Cabral, V., da Silva, E. A., Cardozo-Filho, L.
and Antunes, O. A. C. (2008) Supercritical extraction process and phase equilibrium of
Candeia (Eremanthus erythropappus) oil using supercritical carbon dioxide. J. Supercrit.
Fluids 47, 182–187 CrossRef
15 Bhatia, S. P., McGinty, D., Letizia, C. S. and Api, A. M. (2008) Fragrance material review
on α-bisabolol. Food Chem. Toxicol. 46, S72–S76 CrossRef PubMed
16 Brehm-Stecher, B. F. and Johnson, E. A. (2003) Sensitization of Staphylococcus aureus
and Escherichia coli to antibiotics by the sesquiterpenoids nerolidol, farnesol, bisabolol,
and apritone. Antimicrob. Agents Chemother. 47, 3357–3360 CrossRef PubMed
17 Forrer, M., Kulik, E. M., Filippi, A. and Waltimo, T. (2013) The antimicrobial activity of
α-bisabolol and tea tree oil against Solobacterium moorei, a Gram-positive bacterium
associated with halitosis. Arch. Oral Biol. 58, 10–16 CrossRef PubMed
18 Russell, K. and Jacob, S. E. (2010) Bisabolol. Dermatitis 21, 57–58 PubMed
19 Clark, A., Khweiss, N., Salazar, L. and Verdadero, L. (2011) Promoting sustainability in
the value chain of natural bisabolol, a Brazilian rainforest product
http://www.iri.usp.br/documentos/rel_Columbia_11.pdf
20 Chen, X. J., Archelas, A. and Furstoss, R. (1993) The first examples for preparative-scale
enantioselective or diastereoselective epoxide hydrolyses using microorganisms: an
unequivocal access to all four bisabolol stereoisomers. J. Org. Chem. 58, 5528–5532
CrossRef
21 Attia, M., Kim, S. U. and Ro, D. K. (2012) Molecular cloning and characterization of
( + )-epi-α-bisabolol synthase, catalyzing the first step in the biosynthesis of the natural
sweetener, hernandulcin, in Lippia dulcis. Arch. Biochem. Biophys. 527, 37–44
CrossRef PubMed
22 Nakano, C., Kudo, F., Eguchi, T. and Ohnishi, Y. (2011) Genome mining reveals two novel
bacterial sesquiterpene cyclases: ( − )-germacradien-4-ol and ( − )-epi-α-bisabolol
synthases from Streptomyces citricolor. ChemBioChem 12, 2271–2275
CrossRef PubMed
23 Li, J. X., Fang, X., Zhao, Q., Ruan, J. X., Yang, C. Q., Wang, L. J., Miller, D. J., Faraldos, J.
A., Allemann, R. K., Chen, X. Y. and Zhang, P. (2013) Rational engineering of plasticity
residues of sesquiterpene synthases from Artemisia annua: product specificity and
catalytic efficiency. Biochem. J. 451, 417–426 CrossRef PubMed
42 Williams, D. C., McGarvey, D. J., Katahira, E. J. and Croteau, R. (1998) Truncation of
limonene synthase preprotein provides a fully active ‘pseudomature’ form of this
monoterpene cyclase and reveals the function of the amino-terminal arginine pair.
Biochemistry 37, 12213–12220 CrossRef PubMed
43 Starks, C. M., Back, K., Chappell, J. and Noel, J. P. (1997) Structural basis for cyclic
terpene biosynthesis by tobacco 5-epi-aristolochene synthase. Science 277, 1815–1820
CrossRef PubMed
Received 5 March 2014/16 July 2014; accepted 22 July 2014
Published as BJ Immediate Publication 22 July 2014, doi:10.1042/BJ20140306
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

Biochem. J. (2014) 463, 239–248 (Printed in Great Britain) doi:10.1042/BJ20140306
SUPPLEMENTARY ONLINE DATA
Enantioselective microbial synthesis of the indigenous natural product
( − )-α-bisabolol by a sesquiterpene synthase from chamomile (Matricaria
recutita)
1
1
Young-Jin SON*, Moonhyuk KWON†, Dae-Kyun RO† and Soo-Un KIM*‡
*Department of Agricultural Biotechnology and Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921, South Korea
†Department of Biological Sciences, University of Calgary, Calgary, Canada, T2N 1N4
‡School of Gardening and Horticulture, Yangtze University, Jingzhou, Hubei 434023, China
Table S1 Primers used in the present study
Number
Primer
Sequence (5ꢀ→3ꢀ)
Usage
1
2
3
4
5
6
7
8
MrTPS1-F
MrTPS1-R
MrTPS2-F
MrTPS2-R
MrTPS4-F
MrTPS4-R
MrTPS6-F
MrTPS6-R
MrTPS7-F
MrTPS7-R
MrTPS8-F
MrTPS8-R
MrTPS1-F
ꢀ23aa-F
ꢀ52aa-F
MrTPS1-R
MrTPS1-F
MrTPS1-R
Actin-F
GACCGGATCCAACATGTCAACTTTATCAGTTTCTACTCCTTCC
GGTCTCTAGACTAGACAATCATAGGGTGAACGAAGAG
GACCGGATCCAACATGGTTTCGATGTTTGCCCAAC
GGTCCTCGAGTCAGACACTTCCACGACTATGATCAC
GACCGGGCCCAACATGGCTCCACAACAAGAGGAAGTC
GGTCTCTAGATCAAATAGTCATAGGGTGAACGAATGAG
GACCGGGCCCAACATGTCAACTATTCCTGTTTCTAGTGTTTCTTTC
GGTCTCTAGATTAGATAACCATAGGGTGAACGAAGTACG
GACCGGGCCCAACATGAGCACAAAACAAGAAGAGAATATCC
GGTCTCTAGATCAGACGATCATAGGATGAACGAG
GACCGGATCCAACATGATGATCAACAACTGTGTTACACGGA
GGTCCTCGAGTTAAAACATGTAGTTTATATATTCCTCGATGAAAGG
TAAGAAGGAGATATACATATGTCAACTTTATCAGTTTCTACTCCTTC
TAAGAAGGAGATATACATATGACGAAGCAACATGTTACTCGC
TAAGAAGGAGATATACATATGGTAGCTACTGAGAAACAGCTAATCG
TCAGTGGTGGTGGTGGTGGTGCTCGAGGACAATCATAGGGTGAACGAAGAG
TTATGTTGCCCGGGATGACG
pESC-Leu2d
pESC-Leu2d
pESC-Leu2d
pESC-Leu2d
pESC-Leu2d
pESC-Leu2d
pESC-Leu2d
pESC-Leu2d
pESC-Leu2d
pESC-Leu2d
pESC-Leu2d
pESC-Leu2d
pET21
pET21
pET21
pET21
qPCR
qPCR
qPCR
qPCR
pK7WG2D
pK7WG2D
pK7WG2D
pK7WG2D
pEAQ-HT-GFP
pEAQ-HT-GFP
pEAQ-HT-GFP
pESC-Leu2d
pESC-Leu2d
pESC-Leu2d
pESC-Leu2d
pESC-Leu2d
pESC-Leu2d
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
TTGTTCCTCCTTGTGGGTGG
GCTAACAGGGAAAAGATGACTC
ACTGGCATAAAGAGAAAGCACG
Actin-R
MrTPS1-F
ꢀ23aa-F
ꢀ52aa-F
MrTPS1-R
MrTPS1-F
MrTPS1-R
52aa-R
MBP-F
MBP-R
GST-F
GST-R
AAAAAAGCAGGCTCTATGTCAACTTTATCAGTTTCTACTCCTTCC
AAAAAAGCAGGCTCTATGACGAAGCAACATGTTACTCGCA
AAAAAAGCAGGCTCTATGGTAGCTACTGAGAAACAGCTAATCGAG
CAAGAAAGCTGGGTCCTAGACAATCATAGGGTGAACGAAGAGC
TTCTGCCCAAATTCGCGACCGGTATGTCAACTTTATCAGTTTCTACTCCTTC
TCTCCTTTGCTAGTCATACCGGTGACAATCATAGGGTGAACGAAGAG
TCTCCTTTGCTAGTCATACCGGTATTGGATTTCTCCTTATATTCAAGAAA
CCGGATCCAACATGAAAATCGAAGAAGGTAAACTG
TTACGGATCCTTCCGAGCTCGAATTAGTCTG
CCGGATCCAACATGTCCCCTATACTAGGTTATTGG
TTACGGATCCATCCGATTTTGGAGGATGG
CTATAGGGCCCATGAGCGATAAAATTATTCACC
GCTTACTCGAGGGCCAGGTTAGCGTCGAGGAAC
Trx-F
Trx-R
1
Correspondence may be addressed to either of these authors (email soounkim@snu.ac.kr or daekyun.ro@ucalgary.ca).
®
Nucleotide sequence of identified Matricaria recutita sesquiterpene synthases have been submitted to the DDBJ, EMBL, GenBank and GSDB
Nucleotide Sequence Databases with accession numbers: KJ020282 [MrTPS1, ( − )-α-bisabolol synthase], KJ020284 (MrTPS4, bicyclogermacrene
synthase) and KJ020283 (MrTPS6, β-farnesene synthase).
ꢁ
c
ꢁ
c
The Authors Journal compilation 2014 Biochemical Society

Y.-J. Son and others
Figure S1 In vivo ( − )-α-bisabolol production in yeast
(A) Quantitative synthesis of ( − )-α-bisabolol from transgenic yeast over 4 days. (B) Schematic
representation of fusion constructs. (C) ( − )-α-bisabolol productions from the yeast expressing
+
various MrBBS species fused with soluble proteins at its N-terminus. Results are means S.D.
(n = 3).
−
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

( − )-α-bisabolol synthase from chamomile
Figure S2 Synthesis of ( − )-α-bisabolol by transient expression of MrBBS in tobacco leaves
(A) GC–MS detection of ( − )-α-bisabolol from the tobacco leaves expressing MrBBS in comparison with standard and empty vector control. (B) Comparison of ion fragmenting patterns of the
standard and MrBBS product.
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

Y.-J. Son and others
Figure S3 In vitro kinetic analysis of MrBBS recombinant enzyme
(A) GC–MS analysis of MrBBS product from in vitro assays. (B) Michaelis–Menten kinetics plot for MrBBS recombinant enzyme with FPP substrate ranging from 0.5 to 25 μM. Results are
+
means S.D.
−
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

( − )-α-bisabolol synthase from chamomile
Figure S4 Chiral column analysis of in vitro MrBBS product
GC–MS separation of (A) MrBBS enzymatic product, (B) 1:1 mixture of MrBBS product and ( − )-α-bisabolol standard, and (C) ( − )-α-bisabolol standard. The chiral GC–MS method was optimized
to separate α-bisabolol isomers [1]. The peak labelled with an arrow was identified as β-farnesene by a database spectral search. However, the peak labelled with an asterisk was not identifiable
using the database and did not display the mass fragmenting pattern characteristic to sesquiterpenes.
Figure S5 Comparison of N-terminal sequences of the sesquiterpene synthases related to MrBBS
The conserved (RX)X8W motif is labelled in red with asterisks to indicate RX and W; the 23-residue N-terminal domain is marked by a black line; the first 52-residue peptide is marked by an arrow.
®
®
MrFAS, chamomile β-farnesene synthase (MrTPS6) (GenBank accession number KJ020283); AaFAS, Artemisia annua β-farnesene synthase (GenBank accession number ADT64306); MrBBS,
®
®
chamomile ( − )-α-bisabolol synthase (MrTPS1) (GenBank accession number KJ020282); LdBBS, Lippia dulcis ( + )-epi-α-bisabolol synthase (GenBank accession number JQ731636).
REFERENCE
1
Attia, M., Kim, S. U. and Ro, D. K. (2012) Molecular cloning and characterization of
( + )-epi-α-bisabolol synthase, catalyzing the first step in the biosynthesis of the natural
sweetener, hernandulcin, in Lippia dulcis. Arch. Biochem. Biophys. 527, 37–44
CrossRef PubMed
Received 5 March 2014/16 July 2014; accepted 22 July 2014
Published as BJ Immediate Publication 22 July 2014, doi:10.1042/BJ20140306
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

Copyright of Biochemical Journal is the property of Portland Press Ltd. and its content may
not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's
express written permission. However, users may print, download, or email articles for
individual use.