Marine and semi-synthetic hydroxysteroids as new scaffolds for pregnane X receptor modulation

Article abstract of DOI:10.3390/md12063091

In recent years many sterols with unusual structures and promising biological profiles have been identified from marine sources. Here we report the isolation of a series of 24-alkylated-hydroxysteroids from the soft coral Sinularia kavarattiensis, acting as pregnane X receptor (PXR) modulators. Starting from this scaffold a number of derivatives were prepared and evaluated for their ability to activate the PXR by assessing transactivation and quantifying gene expression. Our study reveals that ergost-5-en-3β-ol (4) induces PXR transactivation in HepG2 cells and stimulates the expression of the PXR target gene CYP3A4. To shed light on the molecular basis of the interaction between these ligands and PXR, we investigated, through docking simulations, the binding mechanism of the most potent compound of the series, 4, to the PXR. Our findings provide useful functional and structural information to guide further investigations and drug design.

Full text of DOI:10.3390/md12063091

Mar. Drugs 2014, 12, 3091-3115; doi:10.3390/md12063091
OPEN ACCESS
marine drugs
ISSN 1660-3397
www.mdpi.com/journal/marinedrugs
Article
Marine and Semi-Synthetic Hydroxysteroids as New Scaffolds
for Pregnane X Receptor Modulation
Valentina Sepe 1, Francesco Saverio Di Leva 1, Claudio D’Amore 2, Carmen Festa 1,
Simona De Marino 1, Barbara Renga 2, Maria Valeria D’Auria 1, Ettore Novellino 1,
Vittorio Limongelli 1, Lisette D’Souza 3, Mahesh Majik 3, Angela Zampella 1,* and
Stefano Fiorucci 2
1
Department of Pharmacy, University of Naples ―Federico II‖, Via D. Montesano, 49,
I-80131 Napoli, Italy; E-Mails: valentina.sepe@unina.it (V.S.); fr.dileva@gmail.com (F.S.D.L.);
carmen.festa@unina.it (C.F.); sidemari@unina.it (S.D.M.); madauria@unina.it (M.V.D.);
ettore.novellino@unina.it (E.N.); vittoriolimongelli@gmail.com (V.L.)
2
Department Experimental and Clinical Medicine, University of Perugia, Via Gambuli 1, S. Andrea
delle Fratte, Perugia 06132, Italy; E-Mails: claudiodamore1983@gmail.com (C.D.);
barbara.renga@unipg.it (B.R.); stefano.fiorucci@unipg.it (S.F.)
3
CSIR-National Institute of Oceanography, Dona Paula, Goa 403004, India;
E-Mails: lisette@nio.org (L.D.); mmajik@nio.org (M.M.)
* Author to whom correspondence should be addressed; E-Mail: angela.zampella@unina.it;
Tel.: +39-081-678525; Fax: +39-081-678552.
Received: 8 April 2014; in revised form: 29 April 2014 / Accepted: 30 April 2014 /
Published: 27 May 2014
Abstract: In recent years many sterols with unusual structures and promising biological
profiles have been identified from marine sources. Here we report the isolation of a series
of 24-alkylated-hydroxysteroids from the soft coral Sinularia kavarattiensis, acting as
pregnane X receptor (PXR) modulators. Starting from this scaffold a number of derivatives
were prepared and evaluated for their ability to activate the PXR by assessing
transactivation and quantifying gene expression. Our study reveals that ergost-5-en-3β-ol
(4) induces PXR transactivation in HepG2 cells and stimulates the expression of the PXR
target gene CYP3A4. To shed light on the molecular basis of the interaction between these
ligands and PXR, we investigated, through docking simulations, the binding mechanism of
the most potent compound of the series, 4, to the PXR. Our findings provide useful
functional and structural information to guide further investigations and drug design.

Mar. Drugs 2014, 12
3092
Keywords: soft coral; Sinularia kavarattiensis; pregnane X receptor (PXR); hydroxysteroids;
docking simulations
1. Introduction
The pregnane X receptor (PXR, NR1I2) belongs to the nuclear receptor (NR) family and is well
recognized for its pivotal role as a ―xenobiotic sensor‖ that transcriptionally regulates the expression
of Phase I and Phase II drug/xenobiotic metabolizing enzymes and transporters. The PXR has
been detected in various tissues including kidney, colon, brain capillaries, small intestine, and
predominantly in liver [1], and it can be activated by various ligands that can bind to the ligand binding
domain (LBD). The pronounced flexibility of this ligand-binding pocket allows it to bind host
molecules of different sizes and chemical structure. Thus, many prescription drugs, such as antibiotics,
antineoplastic, anti-inflammatory and antihypertensive drugs [2] and several natural products [3,4] or
herbal remedies have been reported to act as PXR agonists.
Activators of the PXR play a therapeutic role in the treatment of intestinal inflammation and of
other immune-mediated dysfunctions in humans [5]. PXR agonists have been shown to attenuate
inflammatory bowel disease by reducing nuclear factor-κB target gene expression that mediates colon
inflammation [6–10].
Recent studies in our group led to the discovery of several molecules of marine origin with
interesting profiles as NR modulators [3,11–13]. Among these, solomonsterols [14], truncated chain
sulfated steroids, malaitasterol A [15], an unusual bis-secosterol, and gracilioethers [16] were endowed
with selective activation action on the PXR, whereas theonellasterols and conicasterols showed a dual
modulatory profile on the PXR and FXR [17–21]. The in vivo evaluation of a synthetic sample of
solomonsterol A in a colitis model using transgenic mice expressing hPXR demonstrated the
effectiveness of this PXR agonist in protecting the mouse against the development of the disease [7,8].
Pursuing our interest in the discovery of nuclear receptor (NR) modulators from marine sources, we
analyzed the apolar extracts of the soft coral Sinularia kavarattiensis, collected in the Indian Ocean,
that have afforded a family of conventional 3β-hydroxysteroids characterized by a differentiated
pattern of alkylation on the side chain. Interestingly, transactivation assays on hPXR indicated that
compound 4, ergost-5-enol, was endowed with potent agonistic activity and its binding mechanism to
PXR was elucidated through docking simulations. These findings prompted us to develop a library of
simple mono hydroxylated steroidal derivatives, thus providing for the first time the structural basis of
PXR modulation by conventional 3β-hydroxysteroid chemical scaffold.
2. Results and Discussion
2.1. Isolation of Cholesterol Derivatives with C-24 Alkylation from Indian Ocean Collection
of Sinularia
The n-hexane extract (3.0 g) obtained by a solvent partitioning of the crude methanol extracts of
Sinularia kavarattiensis was chromatographed by MPLC over silica gel, eluting with a gradient system

Mar. Drugs 2014, 12
3093
of increasing polarity from dichloromethane to methanol, and the obtained fractions were further
purified by analytical HPLC in MeOH/H2O (99:1) to afford 24-methylenecholesterol (1),
ergosta-5,22,24(28)-trien-3β-ol (2), (24R)-ergosta-5,22-dien-3β-ol (3), (24S)-ergost-5-en-3β-ol (4) [22],
and gorgosterol (5) [23]. The structures of the known compounds as reported in Figure 1 were assigned
through comparison of their spectral data with those reported in the literature.
Figure 1. Cholesterol derivatives with C-24 alkylation from the soft coral Sinularia kavarattiensis.
HO
HO
HO
2
3
1
H
HO
HO
5
4
2.2. Preparation of 24-Methyl Stanols
Recently we demonstrated, that 4-methylenesteroids from Theonella sponges genus are endowed
with peculiar pharmacological profiles on metabolic nuclear receptors, FXR and PXR [15]. All these
molecules possess the unusual exocyclic double bound at C4 and the rare Δ8,14 on the tetracyclic
nucleus and a 24-alkyl side chain with a 24S-ethyl group in the theonellasterol family or a 24R-methyl
group in the conicasterol family. Indeed conicasterol, the ideal biomarker of Theonella conica [24],
was proven to be a potent PXR agonist [14].
Thus, we decided to explore the influence of the stereochemistry of the C-24 methyl group and of
the rare 8,14 double bound on the activation of PXR. As depicted in Scheme 1, 24R- and
24S-methylcholestan-3β-ols (6,7) were obtained by hydrogenation of a sample of natural
24-methylenecholesterol (1) under platinum oxide (PtO2) catalyst. The obtained equimolar mixture of
24-methyl epimers was fractionated by reverse phase HPLC to afford pure 24R-methylcholestan-3β-ol
(6) and 24S-methylcholestan-3β-ol (7).
1
The C-24 configuration was assigned by comparison of H chemical shifts with those of epimeric
steroidal side chain reported in the literature [25]. As a control sample in the evaluation of PXR
modulation by 24-methyl sterol in transactivation assays, also cholestanol (8) was prepared through
hydrogenation of a small sample of cholesterol (Scheme 1). Selective room temperature hydrogenation
under platinum oxide catalyst of ergosterol acetate (9), afforded 3β-acetoxy-ergost-8(14)-ene (10) in
95% chemical yield [26]. As depicted in Scheme 2, removal of the acetyl protecting group led to
ergost-8(14)-en-3β-ol (11), the Δ8(14) derivative of 24S-stanol (7).

Mar. Drugs 2014, 12
Scheme 1. Reagent and conditions. (a) H2, PtO2, hexane dry (43% 6, 57% 7, 90% 8).
3094
a
+
HO
HO
HO
HO
H
H
1
6
7
a
HO
H
cholesterol
8
Scheme 2. Reagent and conditions. (a) acetic anhydride, pyridine, quantitative yield; (b) H2,
PtO2, AcOEt dry/AcOH 95:5 v/v, 95%; (c) pTsOH, CHCl3 dry/MeOH dry 5:3 v/v, 87%.
b
c
HO
RO
AcO
H
H
10
ergosterol
9
R=H
R=Ac
11
a
2.3. Preparation of Polar Side Chain Modified 3β-Hydroxy Steroids
As extensively demonstrated [27], PXR plays a key role in maintenance of bile acid (BAs)
homeostasis. In fact, PXR is activated by the toxic bile acid lithocholic acid (LCA) and its 3-keto
derivative thus functioning as physiological sensor of LCA and protecting the liver against severe
damage induced by toxic bile acids [27]. Invariably BAs possess a carboxyl group at the C-24 position
on their side chains and differ in the hydroxylation pattern of the A/B cis tetracyclic nucleus. Thus the
introduction of a carboxy functional group on the side chain of tetracyclic nuclei with the A/B trans
ring junction could be instrumental in the evaluation of PXR modulation by 3β,5α-hydroxy steroid
scaffolds. Moreover, steroids with a polar group in the side chain should be conjugated with suitable
carriers in the perspective to develop pro-drugs useful in tissue specific drug delivery [28]. First C-24
derivatives were prepared starting from methyl 3β-hydroxychol-5-en-24-oate (12) [18,29,30], whose
Δ5 double bond was reduced affording the 5α-cholan methyl ester derivative 13 (Scheme 3).
LiBH4 treatment furnished the alcoholic function at C-24 in the derivative 14. Methyl
3β-hydroxychol-5-en-24-oate (12) was also used as starting material to obtain carboxyl acid
derivatives 15 and 16 through LiOH hydrolysis and then hydrogenation on palladium catalyst
(Scheme 3).

Mar. Drugs 2014, 12
Scheme 3. Reagent and conditions. (a) H2, Pd/C, THF dry/MeOH dry 1:1 v/v, quantitative
3095
yield; (b) LiBH4, MeOH dry, THF dry, 0 °C, 78%. (c) LiOH, THF/H2O 1:1 v/v, 80%;
(d) H2, Pd/C, THF dry/MeOH dry 1:1 v/v, 93%.
CH2OH
COOCH3
b
COOCH3
a
HO
HO
HO
H
H
14
12
13
c
COOH
COOH
d
HO
HO
H
16
15
The synthesis of C-26 3β-hydroxy steroids started from commercially available hyodeoxycholate
(17) which was protected at C-3 and C-6 to give the corresponding 3,6-disilyl derivative 18
(Scheme 4). LiBH4 reduction of the C-24 ester function in dry methanol afforded the C-24 primary
alcohol (19) in nearly quantitative yield. One pot Swern oxidation to aldehyde followed by Horner C-2
homologation led to trans-α,β-unsaturated ester (20) that was hydrogenated to the corresponding
saturated ester (21) in 98% yield. Removal of the silyl protective groups and further tosylation with
tosyl chloride in pyridine afforded the C-26 3,6-ditosylate derivative 23 used as key intermediate for
the synthesis of C-26 polar side chain derivatives. As previously reported [25], strong base treatment
of the tosylated derivative proceeded with simultaneous elimination at C-6 and to inversion at C-3 to
give ethyl 3β-hydroxy-5-cholen-26-oate (24). The corresponding carboxy acid derivative (25) was
obtained by alkaline hydrolysis of 24 with LiOH in THF/H2O 1:1. Hydrogenation of the Δ5 double
bond allowed installation of the desired trans A/B junction and proceeded with concomitant
trans-esterification induced by methanolic solvent. The so obtained methyl ester (26) was
hydrolyzed to the carboxy derivative (27), or, alternatively reduced to the primary alcohol (28) by
treatment with LiBH4.
2.4. Pharmacological Evaluation
The natural derivatives 1–5, the 24-methyl stanols (6–8, 11) and the 3β-hydroxy steroids with polar
side chains (12–16 and 24–28) were evaluated as PXR modulators in a luciferase reporter assay, in the
presence and absence of rifaximin (10 μM), a well characterized PXR agonist [31] on a human
hepatocyte cell line (HepG2 cells) transiently transfected with pSG5-PXR, pSG5-RXR, pCMV-β
galactosidase, and p(CYP3A4)-TK-Luc vectors.
Data shown in Figure 2 are quite interesting. As expected, cholestanol (8) was not able to
transactivate PXR at 10 μM, when administrated alone. At variance with 8, both derivatives 1 and 4,
obtained through the substitution at C-24 on the side chain of a Δ5 cholesten nucleus with an
exomethylene functionality and a (S)-methyl group, respectively, show PXR agonistic activity with
compound 4 the most potent activator identified in this study.

Mar. Drugs 2014, 12
Scheme 4. Reagent and conditions. (a) TBSOTf, lutidine, CH2Cl2 dry, quantitative yield;
3096
(b) LiBH4, MeOH dry, THF dry, 0 °C, 93%; (c) oxalyl chloride, DMSO, TEA dry, CH2Cl2
dry, −78 °C; (d) LiOH, triethyl phosphonoacetate, THF dry, reflux, 95% over two steps;
(e) H2, Pd/C, THF dry/MeOH dry 1:1 v/v, 98%; (f) HCl 37%, EtOH dry; (g) TsCl, pyridine
dry, 90% over two steps; (h) AcOK, DMF/H2O 7:1 v/v, reflux then pTsOH, CHCl3
dry/MeOH dry 5:3 v/v, 78% over two steps; (i) H2, Pd/C, THF dry/MeOH dry 1:1 v/v,
91%; (j) NaOH 10% in MeOH/H2O 2:1 v/v, quantitative yield; (k) LiBH4, MeOH dry,
THF dry, 0 °C, 78%; (l) LiOH, THF/H2O 1:1 v/v, quantitative yield.
COOCH3
a
COOCH3
CH2OH
b
c, d
HO
TBSO
TBSO
H
17
H
18
H
19
OH
OTBS
OTBS
COOEt
COOEt
f
COOEt
e
h
TBSO
TBSO
RO
H
H
21
H
OTBS
OTBS
OR
20
22 R=H
23 R=Ts
g
COOCH3
HO
COOH
COOEt
i
j
HO
HO
H
H
24
26
27
k
l
CH2OH
COOH
HO
HO
H
28
25
On the contrary, the introduction of an additional unsaturation on the side chain (Δ22 in 2 and 3) or a
cyclopropane ring as in 5 caused a dramatic loss in the biological activity, thus suggesting a relevant
role of the ligand side chain during the binding to the PXR-LBD. Of interest, regardless of the
stereochemistry at C-24, the 24-methyl cholestanol derivatives, 6 and 7, transactivated the PXR with a
potency comparable to rifaximin. Comparing the different activity of derivative 11 (Scheme 2) and 7
(Scheme 1) and looking at their chemical structures, it can be observed that the introduction of
a double bond in ring C, as in the case of 11, causes a drastic decrease of the agonistic activity, that can
be explained by the different conformation assumed by the tetracyclic nucleus. Even steroids with
different polar side chains (12–16 and 24–28 in Figures 2) were almost inactive with the exception of
the C-24 carboxyl acid derivative, 16, and the C-26 methyl ester derivative, 26, that retain a slight
agonism towards PXR.

Mar. Drugs 2014, 12
Figure 2. Pregnane X receptor (PXR) transactivation assay in HepG2 cells; 24 h post
3097
transfection with pSG5-PXR, pSG5-RXR, pCMV-βgal, and p(CYP3A4)TKLUC vectors,
HepG2 cells were incubated with rifaximin (R) 10 μM or compounds 1–8, 11–16 and
24–28 10 μM for 18 h. * p < 0.05 vs. not treated (NT).
40000000
*
30000000
*
*
*
*
20000000
*
*
10000000
0
NT
R
1
2
3
4
5
6
7
8 11 12 13 14 15 16 24 25 26 27 28
Data from cell stimulation in presence of rifaximin (Figure 3) reveal that none of the tested
compounds was relatively effective in inhibiting PXR transactivation caused by rifaximin, thus none of
them showed an antagonistic profile.
Figure 3. PXR transactivation assay in HepG2 cells; 24 h post transfection with pSG5-PXR,
pSG5-RXR, pCMV-β-galactosidase, and p(CYP3A4)TKLUC vectors, HepG2 cells were
incubated with rifaximin (R) 10 μM in combination with compounds 1–8, 11–16 and
24–28 50 μM for 18 h. * p < 0.05 vs. not treated (NT); # p < 0.05 vs. R.
40000000
#
#
30000000
20000000
10000000
0
#
#
#
*
NT
R
1
2
3
4
5
6
7
8 11 12 13 14 15 16 24 25 26 27 28

Mar. Drugs 2014, 12
3098
Pharmacologial Evaluation on 4
A concentration-response curve was then obtained for the most potent derivative 4. As shown in
Figure 4, Panels A and B, we found that this compound transactivates the PXR with an EC50 of ~2 μM
with an efficacy of 140% with respect to rifaximin, thus confirming that this compound is a potent
PXR agonist. To give support to the agonism of 4, we then tested its effect on the expression of
CYP3A4 that is targeted by rifaximin in a PXR dependent manner. Results shown in Figure 4, Panels
C, demonstrate that compound 4 is a potent inductor of the expression of CYP3A4, a canonical PXR
target gene, thus confirming 4 as a PXR agonist.
Figure 4. (A,B) Dose-response curve; HepG2 cells, transfected for PXR transactivation
assay as described above, were stimulated with increasing concentration of compound 4
(0.1, 1 and 10 μM). Data obtained from transactivation experiments (A) were used
for determination of compound 4 EC50 value (B), * p < 0.05 vs. not treated (NT);
(C) Real-Time PCR analysis of CYP3A4 gene expression. HepG2 cells were treated for
18 h with rifaximin (R) 10 μM or with compound 4 10 μM, * p < 0.05 vs. not treated (NT);
(D) Chromatin immunoprecipitation assay carried out to detect the interaction of PXR,
SRC-1 with the CYP3A4 promoter.
A
B
*
100
75
50
25
0
40000000
30000000
20000000
10000000
0
*
4 EC50: 2.3 M
*
NT
R
0.1
1
10
0
0.1
1
10
4 (M)
[4], M
RT-PCR
ChIP SRC
C
D
*
2.5
2.0
1.5
1.0
0.5
0.0
4
3
2
1
0
IgG
*
*
NT
R
4
NT
R
4

Mar. Drugs 2014, 12
3099
To gain further insights into the molecular mechanism mediating the agonistic activity of 4, we then
investigated the effect of this agent on the recruitment of SRC-1, a well characterized PXR
co-activator [32], in chromatin immunoprecipitation (ChIP) experiments. As shown in Figure 4, Panel
D, we found that exposure of HepG2 cells to rifaximin induces the recruitment of SRC-1 to a PXR
responsive element in the CYP3A4 promoter. Of relevance, a similar positive interaction was detected
in cells exposed to compound 4 (Figure 4D).
2.5. Binding Mode of Compound 4
Prompted by the promising pharmacological data, we decided to elucidate the binding mode of
compound 4, the most potent derivative of the series, through docking simulations. For these
calculations, we used the crystal structure of the PXR-LBD in complex with the inhibitor SR-12813
(PDB code 3hvl), which has been successfully employed to investigate the binding of ligands with
steroidal scaffold to PXR [33,34]. In the best-scored docking pose, the ligand occupies the binding site
pointing its polar head towards the activation function-2 domain (AF-2, colored in orange in Figure 5).
Here, the hydroxyl group on the ring A of 4 is involved in H-bonds with the hydroxyl group of
Thr408, while the steroidal scaffold engages hydrophobic contacts with residues such as Leu240,
Met243, Phe281, Leu411, Phe420, Met425 and Phe429. It is worth noting that Met425 and Phe429 are
on a small helix of the AF-2 domain. This domain undergoes large conformational changes upon
ligand binding, changing the receptor binding affinity for co-activator and co-repressor peptides and
thus regulating the transcription of target genes [35,36]. In the present case, 4 engages a network of
lipophilic interactions involving residues Met425 and Phe429 on the AF-2 helix in the PXR-LBD. This
hydrophobic cluster stabilizes the receptor conformation competent for the recruitment of co-activator
peptides, thus enhancing the transcription of target genes.
Figure 5. Binding mode of the PXR agonist 4 (cyan sticks) in the PXR-LBD crystal
structure (PBD code 3hvl). PXR is shown as gray cartoon, while the AF-2 helix is colored
in orange. Amino acids involved in ligand binding are shown as orange sticks. Residues
from Pro268 to Arg287, from Gln316 to His336 and Asn380 to His407, and all hydrogens
are omitted for clarity.

Mar. Drugs 2014, 12
3100
A similar functional mechanism was very recently reported by us and other authors for different
nuclear receptors [37–41]. On the other side of the binding site, the flexible tail of 4 deepens into a
narrow pocket where it establishes a series of hydrophobic contacts with residues such as Leu206,
Leu209, Val211, Met243, Met246, Phe288, Trp299 and Tyr306. These favorable interactions further
stabilize the ligand binding mode.
3. Experimental Section
3.1. Chemistry
3.1.1. General Procedures
Specific rotations were measured on a Jasco P-2000 polarimeter (Jasco, Inc. Easton, MD, USA).
High-resolution ESI-MS spectra were performed with a Micromass Q-TOF mass spectrometer (Waters
Corporation, Milford, MA, USA). NMR spectra were obtained on Varian Inova 400 and Varian Inova
700 NMR spectrometers (Varian Medical System, Inc., Palo Alto, CA, USA) (1H at 400 and 700 MHz,
13C at 100 MHz) equipped with a Sun hardware and recorded in CDCl3 (δH = 7.26 and δC = 77.0 ppm),
CD3OD (δH = 3.30 and δC = 49.0 ppm) and C6D6 (δH = 7.16 and δC = 128.4 ppm). J are in hertz and
chemical shifts (δ) are reported in ppm and referred to CHCl3, CHD2OD and C6HD5 as internal
standards. HPLC was performed using a Waters Model 510 pump (Waters corporation, Milford, MA,
USA) equipped with Waters Rheodine injector (Waters corporation, Milford, MA, USA) and a
differential refractometer, model 401 (Waters corporation, Milford, MA, USA). Reaction progress was
monitored via thin-layer chromatography (TLC) on Alugram® silica gel G/UV254 plates
(Macherey-Nagel, GmbH & Co. KG, Düren, Germany). Silica gel MN Kieselgel 60 (70–230 mesh)
from Macherey-Nagel Company, Düren, Germany was used for column chromatography. All
chemicals were obtained from Sigma-Aldrich, Inc., St. Louis, MO, USA. Solvents and reagents were
used as supplied from commercial sources with the following exceptions. Hexane, ethyl acetate,
chloroform, dichloromethane, tetrahydrofuran and triethylamine were distilled from calcium hydride
immediately prior to use. Methanol was dried from magnesium methoxide as follow. Magnesium
turnings (5 g) and iodine (0.5 g) are refluxed in a small (50–100 mL) quantity of methanol until all of
the magnesium has reacted. The mixture is diluted (up to 1 L) with reagent grade methanol, refluxed
for 2–3 h then distilled under nitrogen. All reactions were carried out under argon atmosphere using
flame-dried glassware.
The purity of all of the intermediates, checked by 1H NMR, was greater than 95%.
3.1.2. Isolation Procedures
Sinularia kavarattiensis Alderslade & Prita, collected off the coast of Rameshwaram, Tamil Nadu,
India (Latitude: 9°16′60″ N Longitude: 79°17′60″ E) in December 2010, was frozen at −20 °C and
transferred to the Council of Scientific and Industrial Research-National Institute of Oceanography
(CSIR-NIO) Laboratory, Goa, India. The organism was identified by Dr. P. A. Thomas, Emeritus
Scientist, Vizhingam Research Center, Central Marine Fisheries Research Institute, Kerala, India. A
voucher specimen (14S021) is deposited at the CSIR-NIO.

Mar. Drugs 2014, 12
3101
Freeze-dried organism (400 g) was extracted with 80% methanol (500 mL × 4) to obtain 23 g of the
crude methanolic extract that was subjected to a modified Kupchan’s partitioning procedure as
follows. The methanol extract was dissolved in a mixture of MeOH/H2O containing 10% H2O and
partitioned against n-hexane to give 2.9 g of the crude extract. The water content (% v/v) of the MeOH
extract was adjusted to 30% and partitioned against CHCl3 to give 3.2 g of the crude extract The
aqueous phase was concentrated to remove MeOH and then extracted with n-BuOH (1.6 g of crude
extract). The n-hexane extract (2.9 g) was fractionated by silica gel MPLC using a solvent gradient
system from CH2Cl2 to MeOH. The fractions eluted with CH2Cl2/MeOH 995:5 and 992:8 (198 mg)
were further purified by HPLC on a Nucleodur 100-5 C18 (5 μm; 4.6 mm i.d. × 250 mm,
Macherey-Nagel, GmbH & Co. KG, Düren, Germany) with MeOH/H2O 99:1 as eluent (flow rate
1 mL/min) to give 1.3 mg of ergosta-5,22,24(28)-trienol (2) (tR = 16 min), 6.9 mg of
24-methylenecholesterol (1) (tR = 24 min), 2.6 mg of (24R)-ergosta-5,22-dienol (3) (tR = 26 min),
5.3 mg of (24S)-ergost-5-enol (4) (tR = 32 min) and 4.2 mg of gorgosterol (5) (tR = 42.5 min).
24-methylenecholesterol (1): white amorphous solid; [α]25 −16.6 (c 0.04, CHCl3); HRMS-ESI m/z
D
1
399.3625 [M + H]+, C28H47O requires 399.3627. Selected H NMR (C6D6): δH 5.36 (br d, J = 5.0 Hz,
1H), 4.92 (s, 1H), 4.90 (s, 1H), 3.40 (m, 1H), 1.09 (d, J = 6.8 Hz, 3H), 1.07 (d, J = 6.8 Hz, 3H), 1.01
(d, J = 6.8 Hz, 3H), 0.95 (s, 3H), 0.66 (s, 3H).
25
Ergosta-5,22,24(28)-trien-3β-ol (2): white amorphous solid; [α] −38.7 (c 0.05, CHCl3);
D
1
HRMS-ESI m/z 397.3464 [M + H]+, C28H45O requires 397.3470. Selected H NMR (C6D6): δH 6.07
(d, J = 15.6 Hz, 1H), 5.63 (dd, J = 8.7, 15.6 Hz, 1H), 5.36 (br d, J = 3.9 Hz, 1H), 5.03 (s, 1H), 4.96
(s, 1H), 3.40 (m, 1H), 1.14 (d, J = 7.0 Hz, 6H), 1.10 (d, J = 7.0 Hz, 3H), 0.95 (s, 3H), 0.66 (s, 3H).
25
D
(24R)-ergosta-5,22-dien-3β-ol (3): white amorphous solid; [α]
−23.6 (c 0.04, CHCl3);
HRMS-ESI m/z 399.3622 [M + H+], C28H47O requires 399.3627. Selected H NMR (C6D6): δH 5.36
(br d, J = 5.0 Hz, 1H), 5.29 (ovl, 1H), 5.27 (ovl, 1H), 3.39 (m, 1H), 1.12 (d, J = 7.0 Hz, 3H), 1.01 (d,
J = 7.0 Hz, 3H), 0.95 (s, 3H), 0.92 (d, J = 6.8 Hz, 6H), 0.68 (s, 3H).
1
(24S)-ergost-5-en-3β-ol (4): white amorphous solid; [α]25 −42.5 (c 0.04, CHCl3); HRMS-ESI
D
m/z 401.3778 [M + H]+, C28H49O requires 401.3783. NMR data as previously reported [19].
Gorgosterol (5): white amorphous solid; [α]25 −29.5 (c 0.06, CHCl3); HRMS-ESI m/z 443.4249
D
[M + H]+, C31H55O requires 443.4253. NMR data as previously reported [20].
3.1.3. Synthesis
24R-methylcholestan-3β-ol and 24S-methylcholestan-3β-ol (6, 7). A solution of ergosta-5,22,24
(28)-trienol (1) (5 mg, 0.01 mmol) in hexane dry (5 mL) was hydrogenated in the presence of platinum
(IV) oxide (2 mg). The flask was evacuated and flushed first with argon and then with hydrogen. The
reaction was stirred at room temperature under H2 for 5 min. The catalyst was filtered through silice,
and the filtrate was concentrated under vacuum. The mixture was purified by HPLC on a Nucleodur
Isis 100-5 C18 (5 μm; 4.5 mm i.d. × 250 mm, Macherey-Nagel, GmbH & Co. KG, Düren, Germany)
with MeOH/H2O (999.5:0.5) as eluent (flow rate 1 mL/min) to give 1.8 mg (43% from 1) of 6
(tR = 27 min) and 2.4 mg (57% from 1) of 7 (tR = 28 min) as amorphous solids.

Mar. Drugs 2014, 12
3102
25
1
24R-methylcholestan-3β-ol (6). [α]D +0.4 (c 0.09, CH3OH); selected H NMR (700 MHz, C6D6):
δH 3.37 (m, 1H), 2.99 (d, J = 5.0 Hz, 1H), 1.02 (d, J = 6.8 Hz, 3H), 0.93 (d, J = 6.8 Hz, 3H), 0.91 (d,
J = 6.8 Hz, 3H), 0.87 (d, J = 6.8 Hz, 3H), 0.70 (s, 3H), 0.66 (s, 3H). HRMS-ESI m/z 403.3937
[M + H]+, C28H51O requires 403.3940.
25
1
24S-methylcholestan-3β-ol (7). [α]D +0.6 (c 0.12, CH3OH); selected H NMR (700 MHz, C6D6):
δH 3.40 (m, 1H), 3.01 (d, J = 5.0 Hz, 1H), 1.02 (d, J = 6.8 Hz, 3H), 0.92 (d, J = 6.8 Hz, 3H), 0.87 (d,
J = 6.8 Hz, 3H), 0.85 (d, J = 6.8 Hz, 3H), 0.70 (s, 3H), 0.66 (s, 3H). HRMS-ESI m/z 403.3935
[M + H]+, C28H51O requires 403.3940.
Cholestanol (8). The same reaction was carried out on cholesterol (10 mg, 0.025 mmol) to give
25
1
cholestanol 8 (8.7 mg, 0.022 mmol, 90%). [α]D +11.8 (c 0.27, CHCl3); selected H NMR (400 MHz,
CDCl3): δH 3.58 (m, 1H), 0.89 (d, J = 6.0 Hz, 3H), 0.85 (d, J = 6.0 Hz, 6H), 0.79 (s, 3H), 0.64 (s, 3H).
13C NMR (100 MHz, CDCl3): δC 71.7, 56.8, 56.5, 54.6, 45.1, 42.8, 40.3, 39.8, 38.5, 37.2, 36.4, 36.1,
35.8, 35.7, 32.4, 31.8, 29.0, 28.5, 28.2, 24.5, 24.0, 23.0, 22.8, 21.5, 18.9, 12.6, 12.3; HRMS-ESI m/z
389.3781 [M + H]+, C27H49O requires 389.3783.
3β-O-acetyl-ergosterol (9). To a solution of ergosterol (100 mg, 0.25 mmol) in dry pyridine (5 mL)
was added acetic anhydride (250 μL, 2.5 mmol). The mixture was left to stand at room temperature for
3 h. Then the solvent was evaporated. Purification by silica gel eluting with n-hexane/ethyl acetate
995:5 gave the acetyl ester 9 as an amorphous solid (108 mg, quantitative yield). An analytic sample
was obtained by silica gel chromatography eluting with CH2Cl2. [α]25 −86.0 (c 0.07, CHCl3); selected
D
1H NMR (400 MHz, CDCl3): δH 5.56 (m, 1H), 5.37 (m, 1H), 4.70 (m, 1H), 2.50 (m, 1H), 2.36 (m, 1H),
2.04 (s, 3H), 1.03 (d, J = 6.8 Hz, 3H), 0.95 (s, 3H), 0.91 (d, J = 6.8 Hz, 3H), 0.84 (d, J = 6.4 Hz, 3H),
13
0.82 (d, J = 6.4 Hz, 3H), 0.62 (s, 3H). C NMR (100 MHz, CDCl3): δC 170.5, 141.7, 138.8, 135.6,
132.0, 120.2, 116.2, 72.7, 55.7, 54.5, 46.0, 42.7 (2C), 40.4, 38.9, 37.8, 37.0, 36.6, 33.0, 28.2, 28.0,
22.9, 21.3, 21.0, 20.9, 19.8, 19.6, 17.5, 16.0, 12.0; HRMS-ESI m/z 439.6920 [M + H]+, C30H47O2
requires 439.6924.
3β-acetoxy-ergost-8(14)-ene (10). Compound 9 (100 mg, 0.23 mmol) in a mixture of ethyl acetate
and glacial acetic acid 95:5 v/v (10 mL) was hydrogenated under H2 in Parr apparatus at 3 atm for 48 h
in the presence of a PtO2 catalyst (10 mg).The mixture was filtered through Celite, and the recovered
filtrate was concentrated to give 96.5 mg of pure 10 as an amorphous solid (95%). An analytic sample
was obtained by silica gel chromatography eluting with n-hexane/ethyl acetate 99:1.
25
1
[α]D +1.23 (c 0.19, CHCl3); selected H NMR (400 MHz, CDCl3): δH 4.71 (m, 1H), 2.02 (s, 3H),
0.92 (d, J = 6.7 Hz, 3H), 0.84 (d, J = 6.7 Hz, 3H), 0.83 (s, 3H), 0.77 (d, J = 6.5 Hz, 6H), 0.69 (s, 3H).
13C NMR (100 MHz, CDCl3): δC 170.7, 143.0, 126.2, 73.7, 56.7, 49.2, 44.1, 42.7, 39.1, 37.3, 36.7,
36.3, 34.8, 34.1, 33.5, 31.5, 30.4, 29.5, 28.7, 27.5, 27.0, 25.8, 21.5, 20.5, 19.9, 19.3, 18.2, 17.6, 15.4,
12.7. HRMS-ESI m/z 443.3885 [M + H]+, C30H51O2 requires 443.3889.
5α-ergost-8(14)-en-3β-ol (11). Compound 10 (95 mg, 0.21 mmol) was dissolved in 8 mL of
mixture CHCl3 dry/MeOH dry (5:3). Then to a solution was added p-toluensulfonic acid (pTsOH)
(190 mg, 1 mmol). The mixture was quenched by addition of NaHCO3 solution (30 mL) and then
concentrated in vacuo. Ethyl acetate and water were added and the separated aqueous phase was
extracted with ethyl acetate (3 × 50 mL). The combined organic phases were washed with water, dried

Mar. Drugs 2014, 12
3103
(Na2SO4) and concentrated. Purification by silica gel eluting with n-hexane/ethyl acetate (8:2) gave the
25
1
alcohol 11 as a white solid (73 mg, 87%). [α]D +10.2 (c 0.13, CHCl3); selected H NMR (400 MHz,
CDCl3): δH 3.62 (m, 1H), 0.93 (d, J = 6.5 Hz, 3H), 0.85 (d, J = 6.4 Hz, 3H), 0.84 (s, 3H), 0.78 (d,
13
J = 6.5 Hz, 6H), 0.63 (s, 3H); C NMR (100 MHz, CDCl3): δC 142.6, 126.3, 71.2, 56.6, 49.2, 44.2,
42.7, 39.0, 38.2, 37.2, 36.7, 36.5, 34.8, 33.5, 31.5, 30.3, 29.6, 28.8, 27.0 (2C), 25.8, 20.5, 19.9, 19.2,
18.2, 17.5, 15.4, 12.8; HRMS-ESI m/z 401.3780 [M + H]+, C28H49O requires 401.3783.
Methyl 3β-hydroxychol-5-en-24-oate (12). [α] 25 −9.0 (c 0.73, CHCl3); selected H NMR
1
D
(400 MHz CDCl3): δH 5.34 (d, J = 5.0 Hz, 1H), 3.66 (s, 3H), 3.50 (m, 1H), 1.00 (s, 3H), 0.92 (d,
13
J = 6.5 Hz, 3H), 0.67 (s, 3H); C NMR (100 MHz CDCl3): δC 175.1, 141.0, 121.8, 71.9, 57.0, 56.0,
51.7, 50.4, 42.4 (2C), 39.9, 37.5, 35.6 (2C), 32.1 (2C), 31.7, 31.3 (2C), 28.3, 24.5, 21.3, 19.7, 18.5,
12.1; HRMS-ESI m/z 389.3053 [M + H]+, C25H41O3 requires 389.3056.
Methyl 3β-hydroxy-5α-cholan-24-oate (13). A solution of methyl 3β-hydroxychol-5-en-24-oate
12 (100 mg, 0.26 mmol) in THF dry/MeOH dry (10 mL/10 mL, v/v) was hydrogenated in the presence
of palladium 5% wt on activated carbon (5 mg). The flask was evacuated and flushed first with argon
and then with hydrogen. The reaction was stirred at room temperature under H2 for 48 h. The catalyst
was filtered through Celite, and the recovered filtrate was concentrated under vacuum to give 13
(100 mg, quantitative yield). An analytic sample was obtained by silica gel chromatography eluting
with n-hexane/ethyl acetate 8:2 and 0.5% of triethylamine. [α]25 +3.4 (c 0.54, CHCl3); selected
D
1H NMR (400 MHz, CDCl3): δH 3.64 (s, 3H), 3.56 (m, 1H), 0.89 (d, J = 6.0 Hz, 3H), 0.78 (s, 3H), 0.63
(s, 3H).13C NMR (100 MHz, CDCl3): δC 175.3, 71.5, 56.7, 56.1, 54.6, 51.8, 45.1, 42.9, 40.3, 38.3,
37.2, 35.7 (2C), 35.6, 32.3, 31.6, 31.3, 31.2, 28.9, 28.4, 24.4, 21.5, 18.5, 12.5, 12.3. HRMS-ESI m/z
391.3210 [M + H]+, C25H43O3 requires 391.3212.
5α-cholan-3β,24-diol (14). To a solution of 13 (50 mg, 0.13 mmol) in dry THF (15 mL) at 0 °C were
added, under argon, dry methanol (15 μL, 0.39 mmol) and LiBH4 (200 μL, 2M in THF, 0.39 mmol). The
resulting mixture was stirred for 2 h at 0 °C. The mixture was quenched by addition of NaOH (1 M,
260 μL) and then allowed to warm to room temperature. Ethyl acetate was added and the separated
aqueous phase was extracted with ethyl acetate (3 × 30 mL). The combined organic phases were
washed with water, dried (Na2SO4) and concentrated. Purification by silica gel (n-hexane/ethyl acetate
8:2) gave C24 alcohol 14 as a colorless oil (36 mg, 78%).
25
1
[α]D +21 (c 0.08, CH3OH); selected H NMR (400 MHz, CD3OD): δH 3.50 (m, ovl, 2H), 3.50 (m,
13
ovl, 1H), 0.94 (d, J = 6.4 Hz, 3H), 0.82 (s, 3H), 0.69 (s, 3H). C NMR (100 MHz, CDCl3): δC 71.4,
63.7, 56.4, 56.1, 54.3, 44.8, 42.3, 40.0, 38.2 (2C), 36.9 (2C), 35.5, 35.4, 32.1, 32.0, 31.7, 29.3, 28.6,
24.2, 21.2, 18.6, 12.3, 12.0; HRMS-ESI m/z 363.3260 [M + H]+, C24H43O2 requires 362.3263.
3β-hydroxy-5-cholen-24-oic acid (15). A portion of compound 12 (100 mg, 0.26 mmol) was
hydrolyzed with lithium hydroxide (18 mg, 0.78 mmol) in a solution of THF/H2O 1:1 v/v (5 mL). The
resulting solution was then acidified with HCl 6N and extracted with ethyl acetate (3 × 50 mL).
The collected organic phases were washed with brine, dried over Na2SO4 anhydrous and evaporated
under reduced pressure to give 15 (77 mg, 80%). An analytic sample was obtained by silica gel
chromatography eluting with CH2Cl2/MeOH 95:5. [α]2D5 −13.6 (c 0.1, CH3OH); selected 1H NMR (400
MHz, CD3OD): δH 5.35 (d, J = 5.0 Hz, 1H), 3.50 (m, 1H), 1.00 (s, 3H), 0.96 (d, J = 6.4 Hz, 3H), 0.71

Mar. Drugs 2014, 12
3104
(s, 3H). 13C NMR (100 MHz, CD3OD): δC 177.0, 142.5, 122.5, 72.5, 58.2, 57.3, 51.7, 43.5, 43.0, 41.1,
38.6, 36.7, 33.3, 33.0 (2C), 32.3 (2C), 32.0, 29.1, 25.3, 22.2, 19.8, 18.8, 12.3. HRMS-ESI m/z
375.2895 [M + H]+, C24H39O3 requires 375.2899.
3β-hydroxy-5α-cholan-24-oic acid (16). The same procedure of hydrogenation was carried out on
a portion of compound 15 (20 mg, 0.05 mmol) to give compound 16 (18 mg, 93%).
25
1
[α]D +4.16 (c 1.6, CH3OH); selected H NMR (400 MHz, CDCl3): δH 3.57 (m, 1H), 0.94 (d,
13
J = 6.4 Hz, 3H), 0.81 (s, 3H), 0.66 (s, 3H). C NMR (100 MHz, CD3OD): δC 178.1, 72.0, 57.9, 57.5,
55.8, 46.2, 43.8, 41.4, 38.9, 38.3, 36.9, 36.7, 36.6, 33.3, 32.3, 32.2, 32.0, 30.0, 29.1, 25.3, 22.4, 18.7,
12.8, 12.6. HRMS-ESI m/z 377.3053 [M + H]+, C24H41O3 requires 419.3161.
Methyl 3α,6α-di-(tert-butyldimethylsilyloxy)-5β-cholan-24-oate (18). To a solution of methyl
hyodeoxycholic-24-oate 17 (1 g, 2.5 mmol) in 30 mL of CH2Cl2 at 0 °C were added 2,6-lutidine
(25 mmol, 2.9 mL) and tert-butyldimethylsilyltrifluoromethanesulfonate (7.5 mmol, 1.7 mL). After 2 h
stirring at 0 °C, the reaction was quenched by addition of aqueous NaHSO4 (1 M, 50 mL). The layers
were separated and the aqueous phase was extracted with CH2Cl2 (3 × 50 mL). The combined organic
layers were washed with NaHSO4, water, saturated aqueous NaHCO3, and brine. Purification by flash
chromatography on silica gel, using n-hexane/ethyl acetate 95:5 v/v and 0.5% of triethylamine as
eluent, gave 18 (1.6 g, quantitative yield) as a clear, colorless oil.
[α]2D5 +2.2 (c 0.55, CHCl3); selected 1H NMR (400 MHz, CDCl3): δH 3.98 (dt, J = 3.8, 8.0 Hz, 1H),
3.67 (s, 3H), 3.52 (m, 1H), 0.90 (d, J = 6.4 Hz, 3H), 0.88 (s, 9H), 0.87 (s, 9H), 0.86 (s, 3H), 0.62
(s, 3H), 0.04 (s, 6H), 0.02 (s, 6H). 13C NMR (100 MHz, CDCl3): δC 175.0, 73.0, 68.6, 56.0, 55.8, 51.4,
49.5, 42.8, 39.9, 39.5 (2C), 35.9 (2C), 35.3 (2C), 34.8, 31.0 (2C), 30.9, 30.8, 29.7, 28.0, 25.9 (3C),
25.5 (3C), 24.2, 23.5, 20.7, 18.2, 12.0, −4.5, −4.7, −4.8, −4.9; HRMS-ESI m/z 635.4893 [M + H]+,
C37H71O4Si2 requires 635.4891.
3α,6α-di-(tert-butyldimethylsilyloxy)-5β-cholan-24-ol (19). Dry methanol (680 μL, 16.8 mmol)
and LiBH4 (8.4 mL, 2M in THF, 16.8 mmol) were added to a solution of 18 (1.5 g, 2.4 mmol) in dry
THF (30 mL) at 0 °C under argon and the resulting mixture was stirred for 1 h at 0 °C. The mixture
was quenched by addition of NaOH (1 M, 5 mL). Ethyl acetate was added and the separated aqueous
phase was extracted with ethyl acetate (3 × 30 mL). The combined organic phases were washed with
water, dried (Na2SO4) and concentrated. Purification by silica gel (n-hexane/ethyl acetate 95:5 and
0.5% of triethylamine) gave alcohol derivative 19 as a colorless oil (1.35 g, 93%).
[α]2D5 +6.3 (c 0.4, CHCl3); selected 1H NMR (400 MHz, CDCl3): δH 3.95 (dt, J = 3.4, 11.2 Hz, 1H),
3.57 (t, J = 6.6 Hz, 2H), 3.50 (m, 1H), 1.92 (m, 1H), 1.83 (m, 1H), 0.90 (d, J = 6.6 Hz, 3H), 0.86
(s, 9H), 0.85 (s, 9H), 0.85 (s, 3H), 0.60 (s, 3H), 0.03 (s, 6H), 0.01 (s, 6H). 13C NMR (100 MHz,
CDCl3): δC 73.0, 68.5, 63.3, 56.0 (2C), 49.5, 42.7, 39.9, 39.5 (2C), 35.8 (2C), 35.5, 35.3, 34.7, 31.7,
30.8 (2C), 29.8, 29.3, 28.1, 25.9 (3C), 25.8 (3C), 24.1, 23.4, 20.7, 18.5, 12.0, −4.5, −4.7, −4.8, −4.9;
HRMS-ESI m/z 607.4940 [M + H]+, C36H71O3Si2 requires 607.4942.
Ethyl 3α,6α-di-(tert-butyldimethylsilyloxy)-5β-chol-24-en-26-oate (20). DMSO (568 μL, 8.0 mmol)
was added dropwise over 5 min to a solution of oxalyl chloride (2.0 mL, 4.0 mmol) in dry
dichloromethane (10 mL) at −78 °C under argon atmosphere. After 30 min a solution of the alcohol 19
(1.0 g, 1.6 mmol) in dry CH2Cl2 (5 mL) was added dropwise and the mixture was stirred at –78 °C.

Mar. Drugs 2014, 12
3105
After another 30 min, Et3N (1.1 mL, 8.0 mmol) was added dropwise to the solution. The reaction after
2 h was quenched by addition of aqueous NaHSO4 (1 M, 50 mL). The layers were separated and the
aqueous phase was extracted with CH2Cl2 (3 × 50 mL). The combined organic layers were washed
with saturated aqueous NaHSO4, saturated aqueous NaHCO3 and brine. The organic phase was then
dried over Na2SO4 and concentrated to give the corresponding aldehyde (950 mg) as colorless oil,
which was used without any further purification. To a solution of aldehyde (1.57 mmol) in THF dry
(10 mL) were added LiOH (41 mg, 1.7 mmol) and TEPA (triethylphosphonoacetate, 342 μL, 1.7 mmol).
The reaction mixture was stirred for 1h at room temperature and then quenched with water (10 mL).
The mixture was then extracted with ethylacetate (3 × 30 mL), and the organic phase was concentrated
in vacuo. Flash chromatography (n-hexane and 0.5% of triethylamine) afforded compound 20 (1.02 g,
95% over two steps).
[α]2D5 −0.46 (c 0.3, CHCl3); selected 1H NMR (400 MHz, CDCl3): δH 6.97 (dt, J = 5.1, 15.6 Hz, 1H),
5.81 (d, J = 15.6 Hz, 1H), 4.19 (q, J = 7.5 Hz, 2H), 3.99 (m, 1H), 3.53 (m, 1H), 1.29 (t, J = 7.6 Hz, 3H),
0.93 (d, J = 6.5 Hz, 3H), 0.90 (s, 9H), 0.90 (s, 3H), 0.89 (s, 9H), 0.64 (s, 3H), 0.06 (s, 6H), 0.04
13
(s, 6H). C NMR (100 MHz, CDCl3): δC 166.8, 149.8, 121.0, 72.9, 68.6, 60.0, 56.0 (2C), 49.5, 42.8,
39.9, 39.6, 35.9, 35.8, 35.4 (2C), 34.8, 34.2, 31.0 (3C), 29.8, 28.9, 28.1, 25.9 (3C), 25.8 (3C), 24.2,
23.5, 20.7, 18.4, 14.3, 12.0, −4.5, −4.6, −4.7, −4.8; HRMS-ESI m/z 675.5200 [M + H]+, C40H75O4Si2
requires 675.5204.
Ethyl 3α,6α-di-(tert-butyldimethylsilyloxy)-5β-cholan-26-oate (21). Compound 20 (1.0 g,
1.48 mmol) and THF dry (25 mL) were mixed and deoxygenated with flowing nitrogen for 5 min. The
catalyst Pd 20% wt on carbon (10 mg) was added. The mixture was transferred to a standard PARR
apparatus and flushed with nitrogen and then with hydrogen several times. The apparatus was shacked
under 50 psi of hydrogen. After 8 h, the reaction was complete. The catalyst was filtered through
Celite, and the recovered filtrate was concentrated under vacuum to afford 980 mg of ethyl ester 21
(98%). An analytic sample was obtained by silica gel chromatography, eluting with n-hexane/ethyl
25
1
acetate 95:5. [α]D −9.0 (c 0.05, CHCl3); selected H NMR (400 MHz, CDCl3): δH 4.14 (q, J = 7.1 Hz,
2H), 4.01 (m, 1H), 3.55 (m, 1H), 2.31 (t, J = 7.6 Hz, 2H), 1.28 (t, J = 7.1 Hz, 3H), 0.93 (d, J = 7.0 Hz,
3H), 0.91 (s, 9H), 0.89 (s, 9H), 0.90 (s, 3H), 0.64 (s, 3H), 0.07 (s, 6H), 0.05 (s, 6H). 13C NMR (100 MHz,
CD3OD): δC 174.0, 73.0, 68.6, 60.2, 56.2 (2C), 49.6, 42.8, 40.0, 39.8, 39.6, 35.9, 35.6, 35.5, 34.9, 34.4,
31.0 (2C), 30.4, 29.8, 29.6, 28.9, 28.2, 26.0, 25.9 (3C), 25.8 (3C), 24.2, 23.5, 20.8, 18.6, 14.3, 12.0,
−4.5, −4.6, −4.7, −4.8. HRMS-ESI m/z 677.5357 [M + H]+, C40H77O4Si2 requires 677.5360.
Ethyl 3α,6α-dihydroxy-5β-cholan-26-oate (22). To the ethyl ester 21 (900 mg, 2 mmol), dissolved
in ethanol (30 mL), was added 1 mL of HCl 37% v/v and the mixture was stirred for 4 h at room
temperature. At the end of reaction, silver carbonate was added to precipitate chloride. Then the
reaction mixture was centrifuged and the supernatant was concentrated in vacuo to give the desired
ethyl ester 22 (900 mg) as a colorless amorphous solid. An analytic sample was obtained by silica gel
chromatography eluting with CH2Cl2/MeOH 95:5.
25
1
[α]D −3.78 (c 0.38, CH3OH); selected H NMR (400 MHz, CDCl3): δH 4.12 (q, J = 7.3 Hz, 2H),
4.04 (m, 1H), 3.63 (m, 1H), 2.10 (t, J = 7.3 Hz, 2H), 1.25 (t, J = 7.3 Hz, 3H), 0.90 (s, 3H), 0.89 (d,
J = 6.6 Hz, 3H), 0.62 (s, 3H).13C NMR (100 MHz, CDCl3): δC 174.2, 71.0, 67.5, 60.2, 56.1, 56.0, 48.4,

Mar. Drugs 2014, 12
3106
42.6, 39.8 (2C), 39.7, 35.7, 35.5, 35.4, 35.3, 34.7, 34.6, 33.9, 29.8, 29.2, 28.1, 25.5, 24.0, 23.5, 20.6,
18.4, 14.3, 12.0. HRMS-ESI m/z 449.3629 [M + H]+, C28H49O4 requires 449.3631.
Ethyl 3α,6α-ditosyloxy-5β-cholan-26-oate (23). To a solution of ethyl ester 22 (850 mg, 1.9 mmol)
in dry pyridine (15 mL), a solution of tosylchloride (362 mg, 9.5 mmol) in dry pyridine (15 mL) was
added, and the mixture was stirred at room temperature for 4 h. CH2Cl2 was added and the separated
aqueous phase was extracted with CH2Cl2 (3 × 30 mL). The combined organic phases were washed
with water, dried (Na2SO4) and concentrated. The yellow oily residue was purified through a short
column of silica gel (80 g) and eluted with n-hexane/ethyl acetate 95:5 and 0.5% of triethylamine. The
ditosylate 23 was pure according to the TLC and NMR analyses: 1.3 g (90% over two steps).
25
1
[α]D +6.36 (c 0.34, CH3OH); H NMR (400 MHz, CDCl3): δH 7.78 (d, J = 8.0 Hz, 2H), 7.72 (d,
J = 8.0 Hz, 2H), 7.35 (d, J = 8.0 Hz, 2H), 7.33 (d, J = 8.0 Hz, 2H), 4.78 (m, 1H), 4.30 (m, 1H), 4.12 (q,
J = 7.1 Hz, 2H), 2.28 (t, J = 7.5 Hz, 2H), 1.26 (t, J = 7.2 Hz, 3H), 0.86 (d, J = 6.6 Hz, 3H), 0.80 (s,
3H), 0.60 (s, 3H). 13C NMR (100 MHz, CDCl3): δC 173.7, 149.0, 144.2, 135.8, 134.0, 129.3 (2C),
128.6, 127.0, 126.9, 124.9, 123.4, 123.3, 81.4, 79.3, 59.7, 55.4, 55.3, 49.7, 45.8, 42.2, 39.1, 38.9, 35.6,
34.9, 34.8, 34.3, 33.9, 31.6, 27.5, 26.8, 25.9, 25.0, 24.8, 23.4 (2C), 22.3, 21.1, 19.9, 18.0, 13.8, 11.4;
HRMS-ESI m/z 757.3805 [M + H]+, C42H61O8S2 requires 757.3808.
Ethyl 3β-hydroxy-5-cholen-26-oate (24). A solution of ethyl 3,6-ditosyloxy-5β-cholan-26-oate 23
(1.0 g, 1.3 mmol) and CH3COOK (129 mg, 1.3 mmol) dissolved in water (2 mL) and
N,N′-dimethylformamide (DMF, 14 mL) was refluxed for 4 h. The solution was cooled at room
temperature and then ethyl acetate and water were added. The separated aqueous phase was extracted
with ethyl acetate (3 × 30 mL). The combined organic phases were washed with water, dried (Na2SO4)
and evaporated to dryness to give 650 mg of mixture, that was subjected to the next step without any
purification. This compound was dissolved in 32 mL of mixture CHCl3/MeOH (5:3). Then to a
solution was added p-toluensulfonic acid (pTsOH) (500 mg, 2.6 mmol). The mixture was quenched by
addition of NaHCO3 solution (30 mL) and then concentrated in vacuo. Ethyl acetate and water were
added and the separated aqueous phase was extracted with ethyl acetate (3 × 50 mL). The combined
organic phases were washed with water, dried (Na2SO4) and concentrated. Purification by silica gel
eluting with n-hexane/ethyl acetate 7:3 and 0.5% of triethylamine gave the alcohol 24 as a white solid
25
1
(436 mg, 78% over two steps). [α]D −8.5 (c 0.28, CH3OH); selected H NMR (400 MHz, CDCl3): δH
5.31 (d, J = 4.2 Hz, 1H), 4.09 (q, J = 7.0 Hz, 2H), 3.48 (m, 1H), 2.26 (t, J = 7.5 Hz, 2H), 1.23 (t,
13
J = 7.0 Hz, 3H), 0.98 (s, 3H), 0.88 (d, J = 6.2 Hz, 3H), 0.65 (s, 3H); C NMR (100 MHz CDCl3): δC
174.0, 140.8, 121.6, 71.7, 60.2, 56.7, 55.9, 50.0, 42.2 (2C), 39.7, 37.2, 36.4, 35.5, 35.4, 34.3, 31.8
(3C), 28.1, 25.5, 25.4, 24.2, 21.0, 19.3, 18.6, 14.2, 11.8; HRMS-ESI m/z 431.3250
[M + H]+, C28H47O requires 431.3252.
3β-Hydroxy-5-cholen-26-oic acid (25). Fifty mg of compound 24 (0.12 mmol) was hydrolyzed
with lithium hydroxide (14 mg, 0.6 mmol) in a solution of THF/H2O 1:1 v/v (4 mL) as described
25
1
before, to give compound 25 in quantitative yield (48 mg). [α]D −8.0 (c 0.10, CH3OH); selected H
NMR (400 MHz, CD3OD): δH 5.33 (d, J = 4.3 Hz, 1H), 3.40 (m, 1H), 2.20 (t, J = 7.5 Hz, 1H), 1.02 (s,
13
3H), 0.94 (d, J = 6.3 Hz, 3H), 0.71 (s, 3H). C NMR (100 MHz, CD3OD): δH 177.8, 142.3, 122.5,
72.6, 58.2, 57.6, 51.8, 43.5, 43.0, 41.2, 38.6, 37.7, 37.0, 36.8, 35.0, 33.3, 33.1, 32.3, 29.3, 26.7, 26.5,
25.3, 22.2, 19.9, 19.2, 12.3; HRMS-ESI m/z 403.3210 [M + H]+, C26H49O3 requires 403.3212.

Mar. Drugs 2014, 12
3107
Methyl 3β-hydroxy-5α-cholen-26-oate (26). An oven-dried 100 mL flask was charged with 10%
palladium on carbon (10 mg) and compound 24 (300 mg, 0.7 mmol) and the flask was evacuated and
flushed with argon. Absolute methanol (50 mL) and dry THF (50 mL) were added, and the flask was
flushed with hydrogen. The reaction was stirred at room temperature under H2 for 4 h. The mixture
was filtered through Celite, and the recovered filtrate was concentrated to give g of crude product. The
residue was subjected to column chromatography on silica gel eluting with n-hexane/ethyl acetate 8:2
25
1
and 0.5% of triethylamine to give 260 mg of pure 26 (91%). [α]D +0.6 (c 0.1, CHCl3); H NMR
(400 MHz, CDCl3): δH 3.61 (s, 3H), 3.52 (m, 1H), 2.25 (t, J = 7.5 Hz, 2H), 0.84 (d, J = 6.3 Hz, 3H),
13
0.75 (s, 3H), 0.59 (s, 3H). C NMR (100 MHz, CDCl3): δC 174.5, 71.0, 56.3, 56.0, 54.2, 51.3, 44.8,
42.5, 39.9, 38.0, 36.9, 35.4 (2C), 35.3 (2C), 34.0, 31.9, 31.3, 31.0, 28.6, 25.5, 25.3, 24.1, 21.1, 18.5,
12.2, 12.0; HRMS-ESI m/z 419.3520 [M + H]+, C27H47O3 requires 419.3525.
3β-Hydroxy-5α-cholan-26-oic acid (27). Compound 26 (50 mg, 0.12 mmol) was hydrolyzed with
a methanol solution of sodium hydroxide (5%, 5 mL) in H2O (1 mL) overnight under reflux. The
resulting solution was then concentrated under vacuum, diluted with water, acidified with HCl 6N and
extracted with ethyl acetate (3 × 50 mL). The collected organic phases were washed with brine, dried
over Na2SO4 anhydrous and evaporated under reduced pressure to give 27 in a quantitative yield
(47 mg). An analytic sample was obtained by silica gel chromatography eluting with CH2Cl2/MeOH
25
1
95:5. [α]D +4.2 (c 0.2, CHCl3); selected H NMR (400 MHz, CD3OD): δH 3.50 (m, 1H), 2.28 (t,
13
J = 7.6 Hz, 2H), 0.93 (d, J = 6.7 Hz, 3H), 0.83 (s, 3H), 0.70 (s, 3H). C NMR (100 MHz, CD3OD):
δC 177.8, 71.9, 57.9, 57.6, 55.8, 46.2, 43.8, 41.4, 38.9, 38.3, 37.0, 36.9, 36.8, 36.6, 35.0, 33.3, 32.2,
30.0, 29.3, 26.7, 26.5, 25.2, 22.4, 19.2, 12.8, 12.6. HRMS-ESI m/z 405.3367 [M + H]+, C26H45O3
requires 405.3369.
5α-Cholan-3β,26-diol (28). Dry methanol (15 μL, 0.36 mmol) and LiBH4 (180 μL, 2 M in THF,
0.36 mmol) were added to a solution of the methyl ester 26 (50 mg, 0.12 mmol) in dry THF (10 mL) at
0 °C under argon and the resulting mixture was stirred for 4 h at 0 °C. The mixture was quenched by
addition of NaOH (1 M, 240 μL) and then allowed to warm to room temperature. Ethyl acetate was
added and the separated aqueous phase was extracted with ethyl acetate (3 × 15 mL). The combined
organic phases were washed with water, dried (Na2SO4) and concentrated. Purification by silica gel
eluting with CH2Cl2/MeOH (9:1) gave the alcohol 28 as a white solid (36 mg, 78%). [α]25 +3.6
D
1
(c 0.85, CHCl3); H NMR (400 MHz CD3OD): δH 3.53 (t, J = 7.2 Hz, 2H), 3.48 (m, 1H), 0.92
(d, J = 6.1 Hz, 3H), 0.83 (s, 3H), 0.69 (s, 3H); HRMS-ESI m/z 391.3573 [M + H]+, C26H47O2
requires 391.3576.
3.2. Transfection and Luciferase Assays
For PXR mediated transactivation, 5 × 104 HepG2 cells were plated in a 24-well plate and
transfected, using Fugene HD transfection reagent (Hoffmann La Roche, Basel, Switzerland), with
75 ng of pSG5-PXR, 75 ng of pSG5-RXR, 125 ng of pCMV-β-galactosidase, and with 250 ng of the
reporter vector containing the PXR target gene promoter (CYP3A4 gene promoter) cloned upstream of
the luciferase gene (pCYP3A4promoter-TKLuc). At 24 h post-transfection, cells were stimulated with
Rifaximin 10 μM (as positive control) and compounds 1–8, 11–16 and 24–28 10 μM, or with the

Mar. Drugs 2014, 12
3108
combination of 10 μM of Rifaximin and compounds 1–8, 11–16 and 24–28 50 μM. In another
experimental settings, HepG2 cells were trasfected as described above and primed with increasing
doses of 4 (0.1, 1 and 10 μM).
After treatments, cells were lysed in 100 μL Lysis Buffer (25 mM TRIS-phosphate pH 7.8; 2 mM
DTT; 10% glycerol; 1% Triton X-100) and 20 μL cellular lysate was assayed for Luciferase activity
using the Luciferase Assay System (Promega corporation, Madison, WI, USA). Luminescence was
measured using Glomax 20/20 luminometer (Promega corporation, Madison, WI, USA). Luciferase
activities were normalized for transfection efficiencies by dividing the Luciferase relative light units
(RLU) by β-galactosidase activity (βgal) expressed from cells co-transfected with pCMVβgal. All
experiments were performed in triplicate.
3.3. Real Time PCR
HepG2 cells were stimulated 18 h with rifaximin (10 μM) or compound 4 (10 μM). Total RNA was
extracted using the TRIzol reagent (Invitrogen, Life technology, Carlsband, CA, USA), and
reverse-transcribed using random hexamer primers and Super Script-II reverse transcriptase
(Invitrogen, Invitrogen, Life technology, Carlsband, CA, USA). mRNA was quantified by Real-Time
quantitative PCR on iCycler apparatus (Bio-rad laboratories, Inc., Hercules, CA, USA) using specific
primers (hGAPDH: gaaggtgaaggtcggagt and catgggtggaatcatattggaa; hCYP3A4: caagacccctttgtggaaaa
and cgaggcgactttctttcatc). For quantitative RT-PCR, 10 ng of template was dissolved in a 20 μL
solution containing 200 nM of each primer and 10 μL of KAPA SYBR FAST Universal qPCR Kit
(KAPA BIOSYSTEMS, Woburn, MA, USA). All reactions were performed in triplicate, and the
thermal cycling conditions were as follows: 3 min at 95 °C, followed by 40 cycles of 95 °C for 15 s,
58 °C for 20 s and 72 °C for 30 s. The relative mRNA expression was calculated accordingly with the
Ct method.
PCR primers were designed using the software PRIMER3 [42] using published sequence data
obtained from the NCBI database.
3.4. CHiP
HepG2 cells (107) were serum starved for 24 h and then treated for 18 h with rifaximin
(10 μM), and with compound 4 (10 μM). After treatment cells were cross-linked with 1%
formaldehyde for 10 min at room temperature and then the reaction was stopped by glycine addition,
to a final concentration of 125 mM. Cells were washed twice in ice-cold PBS and lysed with 500 μL
Swelling Buffer (25 mM Hepes, pH 7.8; 1.5 mM MgCl2; 10 mM KCl; 0.1% NP-40; 1 mM DTT)
containing protease inhibitors. Cells were centrifuged 2000 rpm for 10 min at +4 °C, re-suspended in
Sonication Buffer (50 mM Hepes, pH 7.8; 140 mM NaCl; 1 mM EDTA; 1% Triton X-100; 0.1% SDS)
plus protease inhibitors and then sonicated four times for 30″ using Bandelin SONOPULS ultrasonic
homogenizers (cycle 8, power 70%). Fifty μL of each supernatant (Input DNA) were reverse-cross-linked
by the addition of 150 μL Elution Buffer (1% SDS; 0.1 M NaHCO3) and 12 μL NaCl 5 M and by
heating the mixture to 65 °C overnight. DNA was recovered from Input by proteinase K treatment at
65 °C for 4 h, followed by phenol/chloroform (1:1) extraction, ethanol precipitation and dissolving in
50 μL TE1x. Thus, 150 μL of Input DNA was diluted in 850 μL of Sonication Buffer containing

Mar. Drugs 2014, 12
3109
protease inhibitors and then 20 μL of Sonication Buffer equilibrated Protein A Sepharose (Invitrogen,
Life technology, Carlsband, CA, USA)/Salmon Sperm DNA (Invitrogen, Life technology, Carlsband,
CA, USA)/1% BSA (PAS/SS/BSA) were added to each sample. After mixing at +4 °C for 1 h,
mixtures were centrifuged 2000 rpm for 5 min to obtain supernatants, that were subsequently
immunoprecipitated overnight at +4 °C with specific antibodies: anti-SRC1 (sc-32789X, Santa Cruz
Biotechnology, Inc., Dallas, TX, USA) or anti-IgG (SA1-36098, Pierce, Thermo Fischer Scientific,
Inc., Rockford, IL, USA). Then 40 μL PAS/SS/BSA were added to each mixture, which was incubated
at +4 °C for 2 h and then centrifuged 13000 rpm for 1 min. Immunoprecipitates were washed twice
with Low Salt Buffer (0.1% SDS; 1% Triton X-100; 2 mM EDTA, pH 8.0; 20 mM Tris–HCl, pH 8.0;
150 mM NaCl), twice with High Salt Buffer (0.1% SDS; 1% Triton X-100; 2 mM EDTA, pH 8.0;
20 mM Tris-HCl, pH 8.0; 500 mM NaCl) and finally once in TE 1× (10 mM Tris-HCl, pH 8.0; 1 mM
EDTA, pH 8.0). DNA was eluted by addition of 250 μL Elution Buffer and the cross-linking reactions
were reversed by heating the mixture to 65 °C overnight. The DNA was recovered from
immunoprecipitated material by proteinase K treatment at 65 °C for 4 h followed by
phenol/chloroform (1:1) extraction, ethanol precipitation and dissolving in 20 μL TE1x. Two
microliters chromatin was used for quantitative real-time PCR for the amplification of the CYP3A4
promoter. The sequences of primers used for the amplification of the proximal promoter region of the
CyP3A4 gene were: ATGCCAATGGCTCCACTTGAG and CTGGAGCTGCAGCCAGTAGCAG.
Raw data analysis was performed as follows: ΔCt was calculated vs. the input DNA concentration; ΔΔCt
was vs. unstimulated cells immunoprecipitated with the anti-IgG antibody (experimental condition set
as 1.0); the relative expression was calculated as 2−(ΔΔCt)
.
3.5. Statistical Analysis
All values are expressed as the mean ± SD. Comparisons of more than two groups were made with
a one-way analysis of variance with post-hoc Tukey tests. Differences were considered statistically
significant if p was <0.05.
3.6. Computational Methods
3.6.1. Ligand and Protein Preparation
The tridimensional structures of compound 4 was generated with the Maestro Build Panel [43] and
then submitted to Polak-Ribiere conjugate gradient minimization (0.0005 kJ/(Å mol) convergence)
using MacroModel (version 9.9) [44]. The crystal structure of the PXR-LBD (PDB code 3hvl) was
prepared using the ―Protein Preparation Wizard‖ panel of the Schrödinger 2012 molecular modeling
package [36]. Thus, the bond orders and disulfide bonds were assigned, all the hydrogen atoms were
added, and all the water molecules were deleted. An optimization of the hydrogen-bonding network
was performed using the ―H-bond assignment‖ tool. Finally, using the ―impref utility‖, the positions of
the hydrogen atoms were optimized by keeping all the heavy atoms in place.

Mar. Drugs 2014, 12
3110
3.6.2. Docking Calculations
Docking studies were carried out with Glide v. 5.8 (Schrödinger) [45]. Glide is a grid-based ligand
docking with energetics approach and searches for favorable interactions between ligands and
receptors. The shape and properties of the receptor are represented on a grid by different sets of fields
that provide progressively more accurate scoring of the ligand pose. These fields are generated as
preprocessing steps in the calculation and hence need to be computed only once for each receptor. For
the grid generation, a box centered on the PXR ligand binding cavity was created. This box gives a
more precise measure of the effective size of the search space. However, ligands can move outside this
box during grid minimization. The Cartesian coordinates of the outer box, X, Y, and Z length were set
to 20 Å. The conformational space of the ligand is defined by Glide by several lowest-energy poses
that are subjected to a Monte Carlo procedure that examines nearby torsional minima. This procedure
is needed in some cases to properly orient peripheral groups and occasionally alters internal torsion
angles. The default value (1.00) for the van der Waals radii scaling factor was chosen, which means no
scaling for the nonpolar atoms was performed. In the present study, the extra precision (XP) mode of
GlideScore function was used to score the obtained binding poses. The force field used for the docking
was the OPLS-2005 [46].
All of the pictures were rendered with PyMOL [47].
4. Conclusions
The peculiar property of nuclear receptors is the ability to directly interact with genomic DNA and
control the expression of specific genes. As a consequence, nuclear receptors play key roles in both
embryonic development and adult homeostasis. In this study we report the pharmacological evaluation
of five hydroxysteroids, isolated from Sinularia kavarattiensis, and several newly synthesized
hydroxysteroid derivatives, endowed with different side chains. The subsequent biochemical
characterization of these analogues allowed us to identify (24S)-ergosta-5-en-3β-ol, compound 4, as a
new potent PXR agonist. In particular, this ligand was tested through transactivation assays using
HepG2 cells transiently transfected with a PXR vector. Prompted by the promising biological results
we decided to investigate the binding mechanism of 4 to the PXR through docking simulations.
Our results elucidate the most relevant ligand/receptor interactions, allowing to detect the ligand
structural requirements for PXR agonism. Compound 4, also known as dihydrobrassicasterol, is
together with its 24R epimer, campesterol, β-Sitosterol, and stigmasterol, one of the main components
of the phytosterol mixtures of vegetables and vegetable products, such as vegetable oil, olive oil, fruit
and nuts [48]. Plant sterols are proven to exert health benefits via the lowering of low density
lipoprotein cholesterol concentration [49]. Our study reports the first example of a plant sterol acting
as a potent PXR agonist. Although variability in plasma concentration of plant sterols is large across
and within different population groups, concentrations of campesterol and dehydrobrassicasterol also
referred to as ―campesterol fraction‖ were reported to range from 6.9 to 27.9 μM [50], values that
make the calculated EC50 in the in vitro transactivation assays of physiological relevance, thus opening
new opportunities for further investigations.

Mar. Drugs 2014, 12
3111
Acknowledgments
This work was supported by grants from MAREX-Exploring Marine Resources for Bioactive
Compounds: From Discovery to Sustainable Production and Industrial Applications (Call
FP7-KBBE-2009-3, Project nr. 245137), and the Italian Ministry of Education (MIUR—PRIN 2010/2011).
Author Contributions
S. Fiorucci, A. Zampella and M.V. D’Auria designed the project, analyzed the results, organized
and wrote the manuscript. S. De Marino and C. Festa achieved isolation, NMR analysis and structure
investigation on natural compounds. V. Sepe performed whole synthetic protocols, structural
characterization of intermediates and final products, and contributed to the organization of the
manuscript. B. Renga and C. D’Amore performed whole pharmacological experiments and analyzed
the results. L. D’Souza and M. Majik performed collection, preliminary extraction and taxonomic
identification of the soft coral. F.S. Di Leva, E. Novellino and V. Limongelli designed, performed and
analyzed the computational studies and wrote the manuscript.
Conflicts of Interest
The authors declare no conflict of interest.
References
1. Lehmann, J.M.; McKee, D.D.; Watson, M.A.; Willson, T.M.; Moore, J.T.; Kliewer, S.A. The
human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene
expression and cause drug interactions. J. Clin. Investig. 1998, 102, 1016–1023.
2. Chang, T.K.H.; Waxman, D.J. Synthetic drugs and natural products as modulators of constitutive
androstane receptor (CAR) and pregnane X receptor (PXR). Drug Metab. Rev. 2006, 38, 51–73.
3. D’Auria, M.V.; Sepe, V.; Zampella, A. Natural ligands for nuclear receptors: Biology and
potential therapeutic applications. Curr. Top. Med. Chem. 2012, 12, 637–669.
4. Kittayaruksakul, S.; Zhao, W.; Xu, M.; Ren, S.; Lu, J.; Wang, J.; Downes, M.; Evans, R.M.;
Venkataramanan, R.; Chatsudthipong, V.; et al. Identification of three novel natural product
compounds that activate PXR and CAR and inhibit inflammation. Pharm. Res. 2013, 30,
2199–2208.
5. Cheng, J.; Shah, Y.M.; Gonzalez, F.J. Pregnane X receptor as a target for treatment of
inflammatory bowel disorders. Trends Pharmacol. Sci. 2012, 33, 323–330.
6. Gu, X.; Ke, S.; Liu, D.; Sheng, T.; Thomas, P.E.; Rabson, A.B.; Gallo, M.A.; Xie, W.; Tian, Y.
Role of NF-kappaB in regulation of PXR-mediated gene expression: A mechanism for the
suppression of cytochrome P-450 3A4 by proinflammatory agents. J. Biol. Chem. 2006, 281,
17882–17889.
7. Sepe, V.; Ummarino, R.; D’Auria, M.V.; Mencarelli, A.; D’Amore, C.; Renga, B.; Zampella, A.;
Fiorucci, S. Total synthesis and pharmacological characterization of solomonsterol A, a potent
marine pregnane-X-receptor agonist endowed with anti-inflammatory activity. J. Med. Chem.
2011, 54, 4590–4599.

Mar. Drugs 2014, 12
3112
8. Dou, W.; Zhang, J.; Zhang, E.; Sun, A.; Ding, L.; Chou, G.; Wang, Z.; Mani, S. Chrysin
ameliorates chemically induced colitis in the mouse through modulation of a PXR/NF-κB
signaling pathway. J. Pharmacol. Exp. Ther. 2013, 345, 473–482.
9. Cheng, J.; Shah, Y.M.; Ma, X.; Pang, X.; Tanaka, T.; Kodama, T.; Krausz, K.W.; Gonzalez, F.J.
Therapeutic role of rifaximin in inflammatory bowel disease: Clinical implication of human
pregnane X receptor activation. J. Pharmacol. Exp. Ther. 2010, 335, 32–41.
10. Mencarelli, A.; Renga, B.; Palladino, G.; D’Amore, C.; Ricci, P.; Distrutti, E.; Barbanti, M.;
Baldelli, F.; Fiorucci, S. Inhibition of NF-κB by a PXR-dependent pathway mediates
counter-regulatory activities of rifaximin on innate immunity in intestinal epithelial cells.
Eur. J. Pharmacol. 2011, 668, 317–324.
11. Fiorucci, S.; Distrutti, E.; Bifulco, G.; D’Auria, M.V.; Zampella, A. Marine sponge steroids as
nuclear receptor ligands. Trends Pharmacol. Sci. 2012, 33, 591–601.
12. Fiorucci, S.; Zampella, A.; Distrutti, E. Development of FXR, PXR and CAR agonists and
antagonists for treatment of liver disorders. Curr. Top. Med. Chem. 2012, 12, 605–624.
13. Festa, C.; Lauro, G.; de Marino, S.; D’Auria, M.V.; Monti, M.C.; Casapullo, A.; D’Amore, C.;
Renga, B.; Mencarelli, A.; Petek, S.; et al. Plakilactones from the marine sponge Plakinastrella
mamillaris. Discovery of a new class of marine ligands of peroxisome proliferator-activated
receptor γ. J. Med. Chem. 2012, 55, 8303–8317.
14. Festa, C.; de Marino, S.; D’Auria, M.V.; Bifulco, G.; Renga, B.; Fiorucci, S.; Petek, S.; Zampella,
A. Solomonsterols A and B from Theonella swinhoei. The first example of C-24 and C-23
sulfated sterols from a marine source endowed with a PXR agonistic activity. J. Med. Chem.
2011, 54, 401–405.
15. De Marino, S.; Sepe, V.; D’Auria, M.V.; Bifulco, G.; Renga, B.; Petek, S.; Fiorucci, S.; Zampella, A.
Towards new ligands of nuclear receptors. Discovery of malaitasterol A, an unique bis-secosterol
from marine sponge Theonella swinhoei. Org. Biomol. Chem. 2011, 9, 4856–4862.
16. Festa, C.; D’Amore, C.; Renga, B.; Lauro, G.; de Marino, S.; D’Auria, M.V.; Bifulco, G.;
Zampella, A.; Fiorucci, S. Oxygenated polyketides from Plakinastrella mamillaris as a new
chemotype of PXR agonists. Mar. Drugs 2013, 11, 2314–2327.
17. Chini, M.G.; Jones, C.R.; Zampella, A.; D’Auria, M.V.; Renga, B.; Fiorucci, S.; Butts, C.P.;
Bifulco, G. Quantitative NMR-derived interproton distances combined with quantum mechanical
calculations of 13C chemical shifts in the stereochemical determination of conicasterol F, a nuclear
receptor ligand from Theonella swinhoei. J. Org. Chem. 2012, 77, 1489–1496.
18. De Marino, S.; Ummarino, R.; D’Auria, M.V.; Chini, M.G.; Bifulco, G.; Renga, B.; D’Amore, C.;
Fiorucci, S.; Debitus, C.; Zampella, A. Theonellasterols and conicasterols from Theonella swinhoei.
Novel marine natural ligands for human nuclear receptors. J. Med. Chem. 2011, 54, 3065–3075.
19. De Marino, S.; Ummarino, R.; D’Auria, M.V.; Chini, M.G.; Bifulco, G.; D’Amore, C.; Renga, B.;
Mencarelli, A.; Petek, S.; Fiorucci, S.; et al. 4-Methylenesterols from Theonella swinhoei sponge
are natural pregnane-X-receptor agonists and farnesoid-X-receptor antagonists that modulate
innate immunity. Steroids 2012, 77, 484–495.

Mar. Drugs 2014, 12
3113
20. Sepe, V.; Ummarino, R.; D’Auria, M.V.; Chini, M.G.; Bifulco, G.; Renga, B.; D’Amore, C.;
Debitus, C.; Fiorucci, S.; Zampella, A. Conicasterol E, a small heterodimer partner sparing
farnesoid X receptor modulator endowed with a pregnane X receptor agonistic activity, from the
marine sponge Theonella swinhoei. J. Med. Chem. 2012, 55, 84–93.
21. Renga, B.; Mencarelli, A.; D’Amore, C.; Cipriani, S.; D’Auria, M.V.; Sepe, V.; Chini, M.G.;
Monti, M.C.; Bifulco, G.; Zampella, A.; et al. Discovery that theonellasterol a marine sponge
sterol is a highly selective FXR antagonist that protects against liver injury in cholestasis.
PLoS One 2012, 7, e30443.
22. Koizumi, N.; Fujimoto, Y.; Takeshita, T.; Ikekawa, N. Studies on steroids. Part 49. Carbon-13
nuclear magnetic resonance of 24-substituted steroids. Chem. Pharm. Bull. 1979, 27, 38–42.
23. Ling, N.C.; Hale, R.L.; Djerassi, C. The structure and absolute configuration of the marine sterol
gorgosterol. J. Am. Chem. Soc. 1970, 92, 5281–5282.
24. Kho, E.; Imagawa, D.K.; Rohmer, M.; Kashman, Y.; Djerassi, C. Sterols in marine invertebrates.
22. Isolation and structure elucidation of conicasterol and theonellasterol, two new 4-methylene
sterols from the Red Sea sponges Theonella conica and Theonella swinhoei. J. Org. Chem. 1981,
46, 1836–1839.
25. Rubinstein, I.; Goad, L.J.; Clague, A.D.H.; Mulheirn, L.J. The 220 MHz NMR spectra of
phytosterols. Phytochemistry 1976, 15, 195–200.
26. Lee, W.-H.; Lutsky, B.N.; Schroepfcr, G.J. 5 Alpha-cholest-8(14)-en-3 beta-ol, a possible
intermediate in the biosynthesis of cholesterol. Enzymatic conversion to cholesterol and isolation
from rat skin. J. Biol. Chem. 1969, 244, 5440–5448.
27. Trottier, J.; Milkiewicz, P.; Kaeding, J.; Verreault, M.; Barbier, O. Coordinate regulation of
hepatic bile acid oxidation and conjugation by nuclear receptors. Mol. Pharm. 2006, 3, 212–222.
28. Sepe, V.; Ummarino, R.; D’Auria, M.V.; Lauro, G.; Bifulco, G.; D’Amore, C.; Renga, B.;
Fiorucci, S.; Zampella, A. Modification in the side chain of solomonsterol A: Discovery of cholestan
disulfate as a potent pregnane-X-receptor agonist. Org. Biomol. Chem. 2012, 10, 6350–6362.
29. Iida, T.; Kakiyama, G.; Hibiya, Y.; Miyata, S.; Inoue, T.; Ohno, K.; Goto, T.; Mano, N.; Junichi Goto,
J.; Nambara, T.; et al. Chemical synthesis of the 3-sulfooxy-7-N-acetylglucosaminyl-24-amidated
conjugates of 3β,7β-dihydroxy-5-cholen-24-oic acid, and related compounds: Unusual, major
metabolites of bile acid in a patient with Niemann-Pick disease type C1. Steroids 2006, 71, 18–29.
30. Iida, T.; Momose, T.; Tamura, T.; Matsumoto, T.; Chang, F.C.; Goto, J.; Nambara, T. Potential bile
acid metabolites. 13. Improved routes to 3,6 and 3,6-dihydroxy-5-cholanoic acids. J. Lipid. Res.
1988, 29, 165–171.
31. Ma, X.; Shah, Y.M.; Guo, G.L.; Wang, T.; Krausz, K.W.; Idle, J.R.; Gonzalez, F.J. Rifaximin is a
gut-specific human pregnane X receptor activator. J. Pharmacol. Exp. Ther. 2007, 322, 391–398.
32. Watkins, R.E.; Davis-Searles, P.R.; Lambert, M.H.; Redinbo, M.R. Coactivator binding promotes
the specific interaction between ligand and the pregnane X receptor. J. Mol. Biol. 2003, 331,
815–828.
33. Chianese, G.; Sepe, V.; Limongelli, V.; Renga, B.; D’Amore, C.; Zampella, A.;
Taglialatela-Scafati, O.; Fiorucci, S. Incisterols, highly degraded marine sterols, are a new
chemotype of PXR agonists. Steroids 2014, 83, 80–85.

Mar. Drugs 2014, 12
3114
34. Sepe, V.; D’Amore, C.; Ummarino, R.; Renga, B.; D’Auria, M.V.; Novellino, E.; Sinisi, A.;
Taglialatela-Scafati, O.; Nakao, Y.; Limongelli, V.; et al. Insights on pregnane-X-receptor
modulation. Natural and semisynthetic steroids from Theonella marine sponges. Eur. J. Med.
Chem. 2014, 12, 126–134.
35. Glass, C.K.; Rosenfeld, M.G. The coregulator exchange in transcriptional functions of nuclear
receptors. Genes Dev. 2000, 14, 121–141.
36. Brzozowski, A.M.; Pike, A.C.; Dauter, Z.; Hubbard, R.E.; Bonn, T.; Engström, O.; Ohman, L.;
Greene, G.L.; Gustafsson, J.A.; Carlquist, M. Molecular basis of agonism and antagonism in the
oestrogen receptor. Nature 1997, 389, 753–758.
37. Di Leva, F.S.; Festa, C.; D’Amore, C.; de Marino, S.; Renga, B.; D’Auria, M.V.; Novellino, E.;
Limongelli, V.; Zampella, A.; Fiorucci, S. Binding mechanism of the farnesoid X receptor marine
antagonist suvanine reveals a strategy to forestall drug modulation on nuclear receptors. Design,
synthesis, and biological evaluation of novel ligands. J. Med. Chem. 2013, 56, 4701–4717.
38. D’Amore, C.; di Leva, F.S.; Sepe, V.; Renga, B.; del Gaudio, C.; D’Auria, M.V.; Zampella, A.;
Fiorucci, S.; Limongelli, V. Design, synthesis, and biological evaluation of potent dual agonists of
nuclear and membrane bile acid receptors. J. Med. Chem. 2014, 57, 937–954.
39. Ekins, S.; Chang, C.; Mani, S.; Krasowski, M.D.; Reschly, E.J.; Iyer, M.; Kholodovych, V.; Ai, N.;
Welsh, W.J.; Sinz, M.; et al. Human pregnane X receptor antagonists and agonists define
molecular requirements for different binding sites. Mol. Pharmacol. 2007, 72, 592–603.
40. Wagner, B.L.; Pollio, G.; Giangrande, P.; Webster, J.C.; Breslin, M.; Mais, D.E.; Cook, C.E.;
Vedeckis, W.V.; Cidlowski, J.A.; McDonnell, D.P. The novel progesterone receptor antagonists
RTI 3021–012 and RTI 3021–022 exhibit complex glucocorticoid receptor antagonist activities:
Implications for the development of dissociated antiprogestins. Endocrinology 1999, 140, 1449–1458.
41. Link, J.T.; Sorensen, B.; Patel, J.; Grynfarb, M.; Goos-Nilsson, A.; Wang, J.; Fung, S.; Wilcox, D.;
Zinker, B.; Nguyen, P.; et al. Antidiabetic activity of passive nonsteroidal glucocorticoid receptor
modulators. J. Med. Chem. 2005, 48, 5295–5304.
42. Primer3 (v. 0.4.0). Available online: http://frodo.wi.mit.edu/primer3/ (accessed on
16 November 2011).
43. Maestro, Version 9.3; Schrodinger, LLC: New York, NY, USA, 2012.
44. MacroModel, Version 9.9; Schrodinger, LLC: New York, NY, USA, 2012.
45. Glide, Version 5.8; Schrodinger, LLC: New York, NY, USA, 2011.
46. Jorgensen, W.L.; Maxwell, D.S.; Tirado-Rives, J. Development and testing of the OPLS all-atom
force field on conformational energetics and properties of organic liquids. J. Am. Chem. Soc.
1996, 118, 11225–11236.
47. The PyMOL Molecular Graphics System, Version 1.5.0.4. Schrödinger, LLC. Available online:
http://www.pymol.org (accessed on 14 September 2010).
48. Weihrauch, J.L.; Gardner, J.M. Sterol content of foods of plant origin. J. Am. Diet. Assoc. 1978,
73, 39–47.
49. Plat, J.; Kerckhoffs, D.A.J.M.; Mensink, R.P. Therapeutic potential of plant sterols and stanols.
Curr. Opin. Lipidol. 2000, 11, 571–576.

Mar. Drugs 2014, 12
3115
50. Chan, Y.M.; Varady, K.A.; Lin, Y.; Trautwein, E.; Mesnsink, R.P.; Plat, J.; Jones, P.J.
Plasma concentrations of plant sterols: Physiology and relationship with coronary heart disease.
Nutr. Rev. 2006, 64, 385–402.
© 2014 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article
distributed under the terms and conditions of the Creative Commons Attribution license
(http://creativecommons.org/licenses/by/3.0/).