Nucleic Acid Analysis Using an Expanded Genetic Alphabet to Quench Fluorescence

Article abstract of DOI:10.1021/ja0315558

Organic chemistry has made possible the synthesis of molecules that expand on Nature's genetic alphabet. Using the previously described nonstandard DNA base pair constructed from isoguanine and 5-methylisocytosine, we report a highly specific and sensitiv

Full text of DOI:10.1021/ja0315558

Published on Web 03/20/2004
Nucleic Acid Analysis Using an Expanded Genetic Alphabet
to Quench Fluorescence
Christopher B. Sherrill, David J. Marshall, Michael J. Moser, Christine A. Larsen,
Lygia Daude´-Snow, and James R. Prudent*
Contribution from Eragen Biosciences, Inc., 918 Deming Way, Madison, Wisconsin 53717
Received December 5, 2003; E-mail: jprudent@eragen.com
Abstract: Organic chemistry has made possible the synthesis of molecules that expand on Nature’s genetic
alphabet. Using the previously described nonstandard DNA base pair constructed from isoguanine and
5-methylisocytosine, we report a highly specific and sensitive method that allows for the fast and specific
quantitation of genetic sequences in a closed tube format. During PCR amplification, enzymatic site-specific
incorporation of a quencher covalently linked to isoguanine allows for the simultaneous detection and
identification of multiple targets. The specificity of method is then established by analysis of thermal
denaturation or melting of the amplicons. The appropriate functions of all reactions are further verified by
incorporation of an independent target into the reaction mixture. We report that the method is sensitive
down to the single copy level, and specificity is demonstrated by multiplexed end-point genotypic analysis
of four targets simultaneously using four separate fluorescent reporters. The method is general enough for
quantitative and qualitative analysis of both RNA and DNA using previously developed primer sets. Though
the method described employs the commonly used PCR, the enzymatic incorporation of reporter groups
into DNA site-specifically should find broad utility throughout molecular biology.
Introduction
mentarity: size (large purines pair with smaller pyrimidines)
and hydrogen bonding (hydrogen bond donors from one
Since the publication of the polymerase chain reaction (PCR)
in 1987, applications involving this technology have revolution-
ized molecular medicin.1 Advanced technologies such as real-
time PCR, facilitated by developments in fluorogenic molecule
chemistries, are rapidly replacing traditional post-amplification
analysis methods. Because of the inherent benefits of real-time
PCR technology, namely, enhancements in specificity, robust-
ness, and quantitation potential, it is rapidly becoming the
preferred approach for nucleic acid based tests in diagnostic
laboratories. In an attempt to simplify real-time analysis, we
employed an expanded genetic alphabet.
nucleobase pair with hydrogen bond acceptors from the other).
The former is necessary to permit the structure that underlies
enzyme recognition. The latter achieves the specificity that gives
rise to the simple rules for base pairing (“A pairs with T, G
pairs with C”) that underlie genetics and molecular biology.
No other class of natural products has reactivity that obeys such
simple rules. Nor is it obvious how one designs a class of
chemical substances that does so much so simply. The synthetic
base pair formed by isoguanine (iG) and 5′-methylisocytosine
(iC) has been successfully employed for both molecular
recognition6-8 and for site-specific enzymatic incorporation.2,9,10
We have covalently coupled a diverse list of reporter groups to
2′-deoxyisoguanosine triphosphate (diGTP), through a modifica-
tion of the N-6. The list includes dabcyl, a smal-molecule
fluorescent quencher used in this report to quench a wide range
of fluorescent molecules attached to DNA (Figure 1). We have
It was previously observed that the DNA alphabet need not
be limited to the four standard nucleotides known in Nature.2,3
Rather, 12 nucleobases forming six base pairs joined by mutually
exclusive hydrogen bonding patterns might be possible within
the geometry of the Watson-Crick base pair. In natural DNA,
two complementary strands are joined by a sequence of
Watson-Crick base pairs.4,5 These obey two rules of comple-
(6) Kern, D.; Collins, M.; Fultz, T.; Detmer, J.; Hamren, S.; Peterkin, J. J.;
Sheridan, P.; Urdea, M.; White, R.; Yeghiazarian, T.; Todd, J. An enhanced-
sensitivity branched-DNA assay for quantification of human immunode-
ficiency virus type 1 RNA in plasma. J. Clin. Microbiol. 1996, 34 (12),
3196-3202.
(1) Mullis, K. B.; Faloona, F. A. Specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction. Methods Enzymol. 1987, 155, 335-
50.
(2) Piccirilli, J. A.; Krauch, T.; Moroney, S. E.; Benner, S. A. Enzymatic
incorporation of a new base pair into DNA and RNA extends the genetic
alphabet. Nature 1990, 343 (6253), 33-37.
(3) Switzer, C. Y.; Moroney, S. E.; Benner, S. A. Enzymatic incorporation of
a new base pair into DNA and RNA. J. Am. Chem. Soc. 1989, 111, 8322-
8323.
(4) Watson, J. D.; Crick, F. H. Molecular structure of nucleic acids. A structure
for deoxyribose nucleic acid. 1953. Ann. N. Y. Acad. Sci. 1995, 758, 13-
14.
(5) Watson, J. D.; Crick, F. H. Genetical implications of the structure of
deoxyribonucleic acid. 1953. JAMA 1993, 269 (15), 1967-1969.
(7) Moser, M. J.; Marshall, D. J.; Grenier, J. K.; Kieffer, C. D.; Killeen, A.
A.; Ptacin, J. L.; Richmond, C. S.; Roesch, E. B.; Scherrer, C. W.; Sherrill,
C. B.; Van Hout, C. V.; Zanton, S. J.; Prudent, J. R. Exploiting the
enzymatic recognition of an unnatural base pair to develop a universal
genetic analysis system. Clin. Chem. 2003, 49 (3), 407-414.
(8) Sherrill, C. B.; Marshall, D. J.; Richmond, C. S.; Scherrer, C. W.; Prudent,
J. R. Molecular Recognition on Demand. Nanotech 2003, 1, 52-54.
(9) Switzer, C. Y.; Moroney, S. E.; Benner, S. A. Enzymatic recognition of
the base pair between isocytidine and isoguanosine. Biochemistry 1993,
32 (39), 10489-96.
(10) Moser, M. J.; Prudent, J. R. Enzymatic repair of an expanded genetic
information system. Nucleic Acids Res. 2003, 31 (17), 5048-53.
9
4550
J. AM. CHEM. SOC. 2004, 126, 4550-4556
10.1021/ja0315558 CCC: $27.50 © 2004 American Chemical Society

Nucleic Acid Analysis Using an Expanded Genetic Alphabet
A R T I C L E S
Scheme 1. Synthesis of Dabcyl-diGTPa
a Key: (i) 3, DMF; (ii) NaH, BnOH, DMF; (iii) DMT-Cl, Ac2O, pyridine; (iv) MeOH, iodine; (v) TFA2O, pyridine; (vi) POCl3, (Bu)3N pyrophosphate,
MeCN; (vii) NH4COO, Pd/C, MeOH; (viii) NH4OH; (ix) Dabcyl-OSu, DMF, H2O.
was then highly purified by HPLC. This served as a convenient
source of starting material to introduce a variety of reporter
groups into the diGTP structure for systematic enzymology and
assay development experiments. In this case, dabcyl was
introduced through its succinimidyl ester and HPLC purified
to provide the target compound, dabcyl-diGTP (1).
In an attempt to simplify real-time PCR analysis, we
postulated that the accumulation of PCR amplicons could be
monitored by the incorporation of a quencher close to a
fluorophore-labeled primer. To do this efficiently, we employed
Figure 1. Structure of dabcyl-diGTP (1).
iC:iG base pairing to site specifically place the quencher in direct
proximity to the fluorophore. A nuclease minus Thermus
aquaticus polymerase was used to carry out the PCR and
incorporate the dabcyl-diGTP opposite the iC (Figure 2A). To
minimize the distance between the quencher and the fluorophore,
one primer flanking the target was labeled at the 5′-end with
fluorescein adjacent to a single iC nucleotide. In this model,
the quenching effect of the dabcyl-diGTP incorporated into the
amplicons could be used to monitor the progress of the PCR.
Not only was the fluorescence of the amplicon quenched, but
also the quenching was directly proportional to the level of
product formation (Figure 2B). This is the first report demon-
strating efficient incorporation of a labeled diGTP into a DNA
duplex by a DNA polymerase.
found that these labeled diGTP molecules make excellent
substrates for a number of thermal stable polymerases incor-
porating efficiently opposite iC.
The synthesis of a modified diGTP has not been reported
previously. Synthesis of a similar compound (modified iGTP)
has been described, yet the strategy described here is notably
different (Scheme 1).11 Exploiting the higher reactivity of the
6 position, the monoprotected diaminohexane is introduced in
the first step to the known ditoluoyldichlorodeoxyriboside (2).12
The benzyloxy group is then introduced at the 2 position,
simultaneously removing the sugar protecting groups, to provide
5. Differential protection of the 5′ and 3′ hydroxyls is achieved
in one step as the dimethoxytrityl ether and the acetyl ester,
respectively. To effect the deprotection of the 5′-hydroxyl and
the amine of the tether, without also cleaving the rather acid
sensitive gylcosyl bond, an unusual method utilizing HI gener-
ated in situ was employed; the tethered amine was then
reprotected as the TFA-amide to provide 8.13 After introduction
of the triphosphate in a two-step process using POCl3 followed
by pyrophosphate, the benzyl protection of the 2-oxo group and
the acetyl protecting groups were removed to provide 11, which
To determine the range of quenching using this approach, a
number of reporter groups were tested and the percent quenching
determined (Table 1). The data indicated that a wide spectral
range of fluorescent dyes can be quenched, most likely due to
the close proximity of the dye-quencher pair. Based on the
diameter of the double helix and the length of the linkers used,
we estimate that the average distance between the pair ranges
from 0 to 50 Å Quenching efficiency was variable, as expected.
To examine the method’s ability to quantify naturally
occurring nucleic acid sequences, the HIV gag gene was used
as a model system. DNA and RNA sequences matching a region
found within the nucleocapsid portion of the HIV gag gene were
synthesized and 10-fold dilutions were generated. Previously
(11) Tor, Y.; Dervan, P. B. Site-Specific Enzymatic Incorporation of an
Unnatural Base, N6-(6-Aminohexyl)isoguanosine, into RNA. J. Am. Chem.
Soc. 1993, 115 (11), 4461-4467.
(12) Commercially available.
(13) Wahlstrom, J. L.; Ronald, R. C. Detritylation of Ethers Using Iodine-Alcohol
Reagents: An Acid-Catalyzed Reaction. J. Org. Chem. 1998, 63 (17),
6021-6022.
9
J. AM. CHEM. SOC. VOL. 126, NO. 14, 2004 4551

A R T I C L E S
Sherrill et al.
Figure 2. Principles of site-specific incorporation of a quencher during amplification. (A) Site-specific quencher incorporation: A target is amplified
containing a single isocytosine nucleotide and a 5/6-carboxy fluorescein (FAM) label. An unlabeled standard base reverse primer is used. Amplification is
performed in the presence of dabcyl-diGTP. Site-specific incorporation places the quencher in close proximity to the fluorophore. (B1) PCR reactions were
performed in the presence (filled circles) or absence (open squares) of dabcyl-diGTP. Based on model design, the only position where diGTP was allowed
to incorporate was at the 3′ end of the reverse primer. After every fifth round of cycling a 5 µL aliquot was removed and analyzed using a Cytofluor 4000
flourescence plate reader. (B2) The 5 µL aliquots were then used for PAGE analysis. The gel was stained with EtBr and scanned for fluorescence. Fluorescence
imaging detects PCR primers (•) and the PCR product (*) from reactions containing dabcyl-diGTP.
Table 1. Percent Quenching of a List of Dyes by Dabcyl Using a
the Tm appears to be approximately 76.5 °C (Figure 3, parts
A2 and B2).
Model Experiment Mimicking the Approach Describeda
fluorophore
% quenching
emission peak (nm)
The capability of performing post-reaction melt analysis based
on the thermodynamics also enables genotypic end-point
analysis. To determine the efficiency of end-point analysis and
to demonstrate the multiplexed ability of this method, we chose
to simultaneously analyze two single base changes within the
HFE gene (H63D and C282Y). These mutations have been
shown to be linked to the majority of hemochromatosis disease
cases, a common autosomal recessive disorder of iron metabo-
lism characterized by increased iron absorption.17 We first
designed PCR primer sets for the H63D and the C282Y sites
(four forward and two reverse). Each forward primer had a
specific fluorescent dye attached to its 5′ end (FAM, HEX,
ROX, or LC640) and was made specific for either the wild-
type or mutation sequence by changing the 3′-end base. The
reverse primers were region specific and designed to create
amplicons that would have differing thermodynamic properties.
The amplicon generated for H63D had a melting temperature
of approximately 83 °C, and the C282Y amplicon had a melting
temperature of approximately 86 °C. The reaction conditions
were identical to those used for analyzing the HIV-specific
DNA, but this time there were six primers targeting to regions
in each reaction. Human genomic DNAs with known HFE
mutations were used to test the system. When no DNA was
added, the post-reaction melt results indicate that no amplicons
were generated. When specific DNA was added, the results
indicate that correct genotypes could be determined after the
cycling was complete (Figure 4). The results were tabulated
and the findings indicate that this approach can be broadly used
to analyze genotypes (Table 2).
FAM
TET
HEX
ROX
LC640
Cy5
62
53
71
64
48
35
518
536
554
606
640
667
a FAM ) fluorescein, TET ) tetrachlorofluorescein, HEX ) hexachlo-
rofluorescein, ROX ) rhodamine, and Cy5 ) cyanine 5.
designed PCR primers SK38 and SK39 were constructed which
amplify a 115 bp region of the HIV gag gene.14 To detect both
RNA and DNA, Moloney murine leukemia virus reverse
transcriptase (M-MuLV-RT) was included while in its absence
only DNA targets were amplified. We observed that the target
number added to each reaction correlated to the cycle number
where signal decrease crossed a fixed fluorescent threshold
(Figure 3, parts A1 and B1). These findings indicate that this
approach allows for a linear quantitation of both RNA and DNA
targets (Figure 3, parts A3 and B3).
Since the amplicon contains quencher and fluorophore on
opposite strands of the DNA duplex, slow heating and optical
analyses provide valuable product melting temperature (Tm)
information. The correct product possesses a unique Tm that is
dependent on base composition.15 Melt profiles from target
specific products typically differ from those of target indepen-
dent products.16 For the HIV gag-related sequence experiments,
(14) Ou, C. Y.; Kwok, S.; Mitchell, S. W.; Mack, D. H.; Sninsky, J. J.; Krebs,
J. W.; Feorino, P.; Warfield, D.; Schochetman, G. DNA amplification for
direct detection of HIV-1 in DNA of peripheral blood mononuclear cells.
Science 1988, 239 (4837), 295-7.
In this paper, we introduce a novel approach for the detection
of DNA or RNA targets. Using an optimized reagent mixture
(15) SantaLucia, J., Jr.; Allawi, H. T.; Seneviratne, P. A. Improved nearest-
neighbor parameters for predicting DNA duplex stability. Biochemistry
1996, 35 (11), 3555-62.
(16) Morrison, L. E.; Stols, L. M. Sensitive fluorescence-based thermodynamic
and kinetic measurements of DNA hybridization in solution. Biochemistry
1993, 32 (12), 3095-3104.
(17) Lyon, E.; Frank, E. L. Hereditary hemochromatosis since discovery of the
HFE gene. Clin. Chem. 2001, 47 (7), 1147-56.
9
4552 J. AM. CHEM. SOC. VOL. 126, NO. 14, 2004

Nucleic Acid Analysis Using an Expanded Genetic Alphabet
A R T I C L E S
Table 2. Fourplex Genotype Determination of Human Genomic DNA Samplesa
sample
NTC
NA14897
NA135891
NA16000
NA14640
WT
C282Y Mut.
N/A
85.5
N/A
NA14641
H63 genotype
C282 genotype
C282C
C282Y
H63D
N/A
N/A
N/A
N/A
N/A
N/A
WT
WT
86.0
N/A
N/A
83.0
H63D Mut.
WTjt
86.0
N/A
83.5
H63D Het.
WT
86.0
N/A
84.0
H63D Het.
C282Y Het.
85.5
85.5
83.5
Dye
FAM
HEX
ROX
LC640
H63H
N/A
83.5
83.5
83.5
a Tm and genotypes were assigned on the basis of the following criteria: FAM Tm from 85.5 to 86.0 °C indicates the presence of HFE C282C wild-type
(WT) allele, HEX Tm from 85.5 to 86.0 °C indicates the presence of C282Y allele, ROX Tm from 83.5 to 84.0 °C indicates the presence of HFE H63D allele,
LC640 Tm from 83.5 to 84.0 °C indicates the presence of HFE H63H (WT) allele; and dRFU greater than 30% of maximum dRFU for all samples. All
genotype assignments are 100% concordant with previously determined HFE mutation status (Coriell Cell Repositories, NJ).
Figure 3. DNA (A) and RNA (B) quantitation and melt analysis. Ten-fold dilution series of the targets from 1 to 107 copies of DNA (A) or RNA (B) were
quantified using 55 cycles of PCR or single-tube RT-PCR reaction (NTC ) no target control). Fluorescence signals for each target concentration over the
course of the reaction (A1 and B1). Negative first-derivative analyses of post-reaction thermodynamic melt curve (-dRFU/dT) versus temperature (in °C)
(A2 and B2). Third standard curve of log copy number versus cycle threshold with equation, R2, and linear fit (A3 and B3).
containing a modified nonstandard base to enzymatically
incorporate a quencher opposite a variety of fluorophores,
fluorescent change can be monitored in real-time to specifically
quantify nucleic acids. Unlike all other real-time technologies,
the incorporation results in a decrease in signal that is
proportional to amplicon formation. This decrease can be
analyzed using developed software to obtain a standard quan-
titation curve, similar to that of other methodologies that use
an increase in signal. Multiple targets can be analyzed in a single
reaction by simply using multiple fluorescent dye substitutions.
We also demonstrated that previously designed primers can be
utilized in our approach and believe that the method can be
applied to most any nucleic acid target.
There are many real-time PCR technologies currently avail-
able with TaqMan, Molecular Beacons, and hybridization probes
being the three most widely used.18-21 However, these systems
are somewhat difficult to design since they share an indirect
detection mechanism: hybridization of a probe to a PCR
product. Probe design may be complicated by the inherent fact
the single-stranded DNA target forms intramolecular structures
that interfere with probe binding.22 Alternative systems that do
not require probes include Amplifluor, LUX primers, and
Scorpion primers.23-25 Compared to these systems, our method
does not require incorporation of hairpins in the primer design
(18) Holland, P. M.; Abramson, R. D.; Watson, R.; Gelfand, D. H. Detection
of specific polymerase chain reaction product by utilizing the 5′ f 3′
exonuclease activity of Thermus aquaticus DNA polymerase. Proc. Natl.
Acad. Sci. U.S.A. 1991, 88 (16), 7276-7280.
(19) Livak, K. J.; Flood, S. J.; Marmaro, J.; Giusti, W.; Deetz, K. Oligonucle-
otides with fluorescent dyes at opposite ends provide a quenched probe
system useful for detecting PCR product and nucleic acid hybridization.
PCR Methods Appl 1995, 4 (6), 357-62.
(20) Tyagi, S.; Kramer, F. R. Molecular beacons: probes that fluoresce upon
hybridization. Nat. Biotechnol. 1996, 14 (3), 303-308.
(21) Wittwer, C. T.; Ririe, K. M.; Andrew, R. V.; David, D. A.; Gundry, R. A.;
Balis, U. J. The LightCycler: a microvolume multisample fluorimeter with
rapid temperature control. Biotechniques 1997, 22 (1), 176-181.
(22) Dong, F.; Allawi, H. T.; Prudent, J. R.; Anderson, T.; Neri, B. P.;
Lyamichev, V. I. Secondary structure prediction and structure-specific
sequence analysis of single-stranded DNA. Nucleic Acids Res 2001, 29
(15), 3248-3257.
(23) Nazarenko, I. A.; Bhatnagar, S. K.; Hohman, R. J. A closed tube format
for amplification and detection of DNA based on energy transfer. Nucleic
Acids Res. 1997, 25 (12), 2516-2521.
9
J. AM. CHEM. SOC. VOL. 126, NO. 14, 2004 4553

A R T I C L E S
Sherrill et al.
nor does it require special base sequence makeup near the 3′
ends. Probably the simplest method available for real-time PCR
detection uses SYBR Green to detect PCR amplicon genera-
tion.26 For SYBR Green as with our system, design is not an
issue. With SYBR green the dye is simply added to the PCR
reaction. The major drawback to SYBR green technology is
that it cannot be multiplexed in real-time, though melt analysis
has been shown to be capable of detecting product mixtures at
the end of the reaction.
Since our method does not require an extra probe and
specificity concerns may be raised, we compared our method
to Taq-Man by designing a multiplexed assay for human GAPD
and â-actin transcribed messages. There are over thirty pseudo-
genes for each target within the human genome. In the presence
of 30,000 of copies of genomic DNA containing those psue-
dogenes, results from our method indicate that single copies of
the specific transcripts could be detected.27 This was similar to
the results obtained using a highly optimized Taq-Man system.
Today, most molecular biologists have experience designing
PCR reactions and should have little difficulty using this novel
real-time methodology.
The methodology described here offers many advantages over
these other technologies. For example, since probes are not
required, the method simplifies design issues and allows for
rapid development. Also, the method directly measures amplicon
generation permitting large dynamic range quantitation and
postreaction melt analysis that is similar to results obtained by
performing PAGE. Since multiplexing can be accomplished,
multiple targets can be analyzed in a single reaction saving time
and resources. In addition, internal controls can be implemented
to guarantee proper reaction conditions.
We report here the use of four dyes simultaneously for end
point genotypic analysis of genomic DNAs. To date, the
maximum number of targets simultaneously queried in a single
reaction using this method has been four using the dye
combination fluorescein, hexachlorofluorescein, rhodamine and
LC640. Previous reports using molecular beacons demonstrated
that dabcyl could efficiently quench a large array of fluoro-
phores.28 It is conceivable that by using a combination of dyes
and thermal melts, one could examine additional targets all
within the same reaction. And as instrumentation and expanded
base chemistry advance, it is likely that this approach will allow
for even further real-time multiplexing capability.
More generally, for the first time we demonstrated that labeled
diGTP can be efficiently synthesized and incorporated enzy-
matically. This will allow for broad use of such compounds in
molecular biology. Any time a reporter group is required at a
specific site within an amplicon, transcript or extension product,
the use of an additional base pair may be helpful. Therefore,
the use of expanded base methodology is surely not limited to
PCR. Indeed, there are other detection methods that may benefit
Figure 4. Four-color multiplex genotype determination by incorporation
of dabcyl-diGTP. Five samples of human genomic DNA with known
hemachromatosis (HFE) gene mutation status and a no target control (NTC)
were analyzed using this method. Following amplification, PCR reaction
products were melted from 75 to 95 °C in 0.5 °C increments, and four
fluorescence channels were monitored at each increment. The first derivative
of the rate of fluorescence change with temperature (dRFU/dTemp) is plotted
vs temperature (in °C). HFE allele-specific primers were labeled with the
following fluorophores: H63H, FAM (green line); C282Y, HEX (orange
line); H63D, ROX (red line); C282C, LC640 (blue line). Coriell Cell
Repository target designations used to obtain results for each graph were
as follows: A, NTC; B, NA14897; C, NA135891; D, NA16000; E,
NA14640; F, NA14641.
(24) Winn-Deen, E. S. Direct Fluorescence Detection of Allele-Specific PCR
Products Using Novel Energy-Transfer Labeled Primers. Mol. Diagn. 1998,
3 (4), 217-221.
(25) Whitcombe, D.; Theaker, J.; Guy, S. P.; Brown, T.; Little, S. Detection of
PCR products using self-probing amplicons and fluorescence. Nat. Bio-
technol. 1999, 17 (8), 804-7.
(26) Wittwer, C. T.; Herrmann, M. G.; Moss, A. A.; Rasmussen, R. P.
Continuous fluorescence monitoring of rapid cycle DNA amplification.
Biotechniques 1997, 22 (1), 130-1, 134-8.
(27) Manuscript in preparation.
(28) Marras, S. A.; Kramer, F. R.; Tyagi, S. Efficiencies of fluorescence
resonance energy transfer and contact-mediated quenching in oligonucle-
otide probes. Nucleic Acids Res. 2002, 30 (21), e122.
9
4554 J. AM. CHEM. SOC. VOL. 126, NO. 14, 2004

Nucleic Acid Analysis Using an Expanded Genetic Alphabet
A R T I C L E S
pyridine (117 equiv) in a flame-dried flask containing a stir bar under
argon. Trifluoroacetic anhydride (2 equiv) was added and the reaction
stirred until no starting material was detectable by TLC. Additional
trifluoroacetic anhydride was added (1 equiv) as necessary. MeOH
(5 equiv) was added before the reaction mixture was concentrated
by rotary evaporation. The residue was dissolved in CHCl3 and extracted
with brine. The CHCl3 was dried and evaporated, and the product
was purified by silica gel chromatography with 1.5% MeOH/CHCl3
as the eluent. TLC: 7.5% MeOH/ CHCl3, Rf ) 0.53. Yield: 40%
from 6.
2-Benzyloxy-6-(6-trifluoroacetamidohexyl)aminopurine-3′-O-
acetyl-5′-triphosphoryl-2′-deoxyriboside (9). Freshly recrystallized
imidazole (3.2 equiv) was dissolved in acetonitrile (15 equiv) under
argon and chilled (0 °C). POCl3 (1 equiv) and anhydrous triethylamine
(3.2 equiv) were then added, and the mixture was stirred (0 °C, 0.5 h)
before addition of a portion (1.3 equiv POCl3) to 8. This mixture was
stirred (rt, 0.5 h) before addition of DMF (242 equiv) containing
tributylammonium pyrophosphate (2 equiv). The reaction was then
quenched (10% NH4COO) 24 h later and lyophilized. Product was
purified by anion-exchange chromatography (Dionex ProPac SAX-10)
using 20% MeCN and a gradient of (NH4)2CO3/20% MeCN. Collected
product was repetitively lyophilized to remove excess salt. Yield: 20%,
white solid.
6-(6-Aminohexyl)-5′-triphosphoryl-2′-deoxyisoguanosine (10). Com-
pound 9 was dissolved in methanol (9 kequiv) before addition of Pd/C
(10%, 0.02% w/v) and NH4COO (7 equiv). The suspension was refluxed
(1 h) before filtering off the catalyst and evaporating the solvent. The
residue was then treated with ammonium hydroxide (30%, 3 kequiv, 3
h, room temperature). The product was purified by anion-exchange
chromatography (Dionex ProPac SAX-10) using 20% MeCN and a
gradient of (NH4)2CO3/20% MeCN. Collected product was repetitively
lyophilized to remove excess salt. Yield: 90%, white solid.
6-(N-(Dabcyl)-6-aminohexyl)-5′-triphosphoryl-2′-deoxyisogua-
nosine (1). To 10 (0.88 µmol, triethylammonium salt) in H2O (40 µL)
was added sodium borate buffer (10.5 µL, 1 M, pH 8.5) followed by
DMF (216 µL) containing dabcyl N-hydroxysuccinimide ester (6 equiv).
The reaction proceeded (8 h, 55 °C) before it was diluted with 20%
MeCN and the product purified by anion-exchange chromatography
(Dionex ProPac SAX-10) using 20% MeCN and a gradient of (NH4)
2CO3/20% MeCN. Collected product was repetitively lyophilized to
remove excess salt. Yield: 50%.
from this chemistry. With such a fundamental paradigm shift,
we envision that additional base pairs will change the way
scientists build new testing systems and construct novel organ-
isms.
Methods
Synthesis of Dabcyl-diGTP: 1-Tritylhexamethylenediamine (3).
Hexamethylenediamine (10 equiv) was dried two times from pyridine
and dissolved in pyridine (15 equiv). DMAP (0.1 equiv) was added
and the reaction flask placed in an ice bath. Trityl chloride (1 equiv),
dissolved in pyridine (15 equiv), was added dropwise over 2 h. It was
stirred at room temperature for 4 h, MeOH (3.3 equiv) added, the
reaction mixture concentrated, and the remaining residue extracted with
aqueous NaHCO3/ethyl acetate. The organic layer was washed twice
with aqueous NaHCO3 solution and dried and the solvent evaporated.
The obtained product was used in the next step without further
purification. Yield: 95%, sticky oil.
2-Chloro-6-(6tritylaminohexyl)aminopurine-2′-deoxy-3′,5′-di-
toluylriboside (4). Compound 3 (1.3 equiv) was dried from DMF and
dissolved in DMF (40 equiv). Diisopropylethylamine (3.9 equiv) and
2,6-dichloropurine-2′-deoxy-3′,5′-ditoluoylriboside (2) (1 equiv), dis-
solved in DMF (40 equiv), were added, and the mixture was stirred at
room temperature for 3 h. It was concentrated by rotary evaporation,
the residue extracted with aqueous NaHCO3/ethyl acetate, the organic
layer dried, and the solvent evaporated. The residue was triturated with
ether twice and the obtained solid product used further after drying
under vacuum without further purification.
2-Benzyloxy-6-(6tritylaminohexyl)aminopurine-2′-deoxyribo-
side (5). NaH (60% in mineral oil, 10 equiv) was slowly added to benzyl
alcohol (67 equiv) with stirring at room temperature under argon. After
the mixture was stirred for another 20 min at room temperature,
compound 4 (1 equiv) was added. After the mixture was stirred for 20
min at room temperature, the reaction flask was transferred to a heated
oil bath (100 °C). After 30 min, the reaction flask was cooled and the
mixture added to ethyl acetate/NaHCO3. The aqueous phase was
extracted with ethyl acetate once more, and the pooled ethyl acetate
layers were dried and concentrated by rotary evaporation. TLC: 4%
MeOH/CHCl3, Rf ) 0.19. Product was purified by Et3N-neutralized
silica gel chromatography with 3% MeOH/CHCl3 as the eluent. Yield:
71%.
2-Benzyloxy-6-(6-tritylaminohexyl)aminopurine-3′-O-acetyl-2′-
deoxy-5′-O-p,p′-dimethoxytritylriboside (6). In a flame-dried flask,
under argon, was dissolved compound 5 (1 equiv) in anhydrous pyridine
(31 equiv). DMT chloride (0.6 equiv) was added and the mixture stirred
for 30 min before a second addition of DMT chloride (0.6 equiv).
Additional DMT chloride (0.2 equiv) was added as needed. TLC: 5%
MeOH/CHCl3, Rf ) 0.06. When the DMT reaction was complete, acetic
anhydride was added (2 equiv) and the reaction continued stirring 1 h.
Additional acetic anhydride (2 equiv) was added as needed before
addition of MeOH to quench excess reagent. TLC: 1.5% MeOH/
CHCl3, Rf ) 0.88. The reaction mixture was concentrated and extracted
(chloroform/5% NaHCO3), and the pooled organic layers were dried
and evaporated. Product was purified by Et3N-neutralized silica gel
chromatography with 0.3% MeOH/CHCl3 as the eluent. Yield: 61%.
2-Benzyloxy-6-(6-aminohexyl)aminopurine-3′-O-acetyl-2′-deox-
yriboside (7). Compound 6 (1 equiv) was added to a sealed-reaction
flask containing a stir bar. A solution of iodine (0.9 equiv) in methanol
(99% v/w) was added to the flask, and it was sealed. The flask was
placed in an oil bath (60 °C) and stirred (8 h). The reaction was cooled
to room temperature, and the volatiles were removed by rotary
evaporation followed by high vacuum. Cleaved DMT and trityl
protecting groups were removed from the product by trituration with
diethyl ether. TLC: 2.5% MeOH/ CHCl3, Rf ) 0.00. Material was used
in the next step without further purification.
Synthesis of Oligonucleotides. PCR oligonucleotides were manu-
factured with a 48-column DNA Synthesizer (Northwest Engineering,
Alameda, CA), using standard â-cyanoethyl phosphoramidite chemistry.
The isoC phosphoramidites, N2-(dimethylamino)methylidene-5′-O-
dimethoxytrityl-5-methyl-2′-deoxyisocytidine and 3′-O-cyanoethoxy-
diisopropylphosphoramidite (Glen Research, Sterling, VA), were
coupled and deprotected under the conditions used for the standard
base phosphoramidites. Postsynthesis workup consisted of ammonium
hydroxide deprotection followed by ethanol precipitation. When
required, oligonucleotides were further purified by anion exchange
HPLC and desalting using C-18 resin.
Fluorescence Quenching during PCR. A PCR reaction was
performed to demonstrate fluorescence quenching by site-specific
incorporation in PCR. PCR conditions: 0.2 µM first primer; 0.2 µM
second primer A; 0.4 pM template nucleic acid; 50 µM each dATP,
dGTP, dTTP, and dCTP; 10 mM Tris-HCl pH 8; 0.1% BSA; 0.1%
Triton X-100; 0.1 µg/µLdegraded herring sperm DNA; 40 mM
potassium acetate; 2 mM magnesium chloride; 1 unit of Klentaq DNA
polymerase (Ab Peptides, St. Louis, MO); and 0 or 3.0 µM dabcyl-
diGTP in a 25 µL reaction volume. Reactions were analyzed by a
Cytofluor 4000 fluorescence plate reader (485 nm excitation/530 nm
emission) and by gel electrophoresis. PCR reactions were analyzed by
10% native polyacrylamide gel electrophoresis and fluorescence
imaging using a Typhoon fluorescence scanner (Molecular Dynamics,
Sunnyvale, CA).
2-Benzyloxy-6-(6-trifluoroacetamidohexyl)aminopurine-3′-O-
acetyl-2′-deoxyriboside (8). Compound 7 was dissolved in anhydrous
9
J. AM. CHEM. SOC. VOL. 126, NO. 14, 2004 4555

A R T I C L E S
Sherrill et al.
Percent Quenching of Fluorescent Dyes. Synthetic DNA templates
were amplified in 25 rounds of PCR as described above. Target
concentration was 20 pM and the dye-labeled PCR primers contained
a single 5′ iC adjacent to various fluorophores including 6-carboxy
fluorescein (FAM), tetrachlorofluorscein (TET), hexachlorofluorescein
(HEX), rhodamine (ROX)µ, LightCycler 640 (LC640) (Roche), and
cyanine 5 (Cy5). The FAM, TET, HEX, and Cy5 fluorophores were
coupled to dye-labeled PCR primers during oligonucleotide synthesis
by phosphoramidite addition, while LC640 and ROX were added
postsynthetically by succinimidyl ester reaction with a 5′ amine added
as a phosphoramidite during synthesis. All primers were purified by
denaturing anion-exchange HPLC prior to use. PCR cycling parameters
were 5 s at 95 °C, 5 s at 55 °C; 20 s at72 °C with optics on. Decrease
in PCR reaction fluorescence was monitored in real-time using the
iCycler IQ (BioRad). The percent quenching was calculated as the
((initial reaction fluorescence - final reaction fluorescence)/ initial
reaction fluorescence) × 100.
Multiplex Genotype Determination by End-Point Thermal Melt.
Primers were designed for simultaneous multiplex genotyping of two
mutations in the human hemochromatosis (HFE) gene.17 The following
primer sequences were used in 5′ to 3′ order: LC640-NH2-TX-
ACACGGCGACTCTCATG, ROX-NH2-TXACACGGCGACTCT-
CATC, TTGTTTGAAGCTTTGGGCTAC, FAM-TXGGGAAGAG-
CAGAGATATACGTG, HEX-TXGGGAAGAGCAGAGATATACGTA,
TCAGCTCCTGGCTCTCA. PCR conditions were similar to those used
to analyze the HIV gag gene with the following modifications: PCR
cycling parameters were 2 min denature at 95 °C followed by 45 cycles
of 1 s at 95 °C, 1 s at 58 °C, 24 s at72 °C. Primers were at 200 nM.
Ten nanograms of human genomic DNA templates containing known
HFE mutations (Coriell Cell Repositories, Haddon, NJ) were used as
targets for amplification. Following amplification, the reactions were
subjected to a thermal melt from 75 to 95 °C in 0.5 °C increments on
the iCycler iQ (BioRad, Hercules, CA), with optical read for FAM,
HEX, ROX, and LC640 fluorophores at each 0.5 °C step. Negative
first derivative of the rate of change in relative fluorescence (RFU) vs
temperature (°C) (-dRFU/dT) was exported from the iCycler iQ
software. The minimum of dRFU/dT was set to zero for each
fluorophore. The data were then normalized by dividing by the
maximum dRFU/dT value (set dRFU/dT maximum ) 1.0). The Tm
value for each quenched, fluorophore-labeled PCR product was
identified by the temperature at which dRFU/dT was maximum and
the normalized dRFU/dT was greater than 0.3.
Real-Time PCR and RT-PCR by Site-Specific Incorporation of
Dabcyl-diGTP. Previously described PCR primers SK38 and SK39
which amplify a 115 bp region of the HIV gag gene were modified to
allow fluorescence monitoring and incorporation of dabcyl-diGTP.14
Primer length was reduced by 5′ truncation to achieve a predicted Tm
of 60 °C. The reverse primer used to transcribe the RNA transcript
into cDNA was all standard deoxynucleotides while the forward primer
contained a single 5′-iC adjacent to a terminal FAM fluorophore. DNA
plasmid containing HIV gag gene isolated from pNL4-3 was used as
a template for PCR and for in vitro transcription to RNA template by
T7 RNA polymerase. PCR and RT-PCR reactions were performed using
from zero to 1 × 107 copies of DNA and RNA target as estimated by
absorbance at 260 nm. PCR conditions were 1× ISOlution buffer
(EraGen, Madison, WI) with PCR primers at a concentration of 300
nM, dithiothreitol added at 5 mM, and Titanium Taq DNA polymerase
(Clontech, CA) at the manufacturer’s recommended concentration. PCR
cycling parameters were 2 min denature at 95 °C followed by 50 cycles
of 5 s at 95 °C, 5 s at 55 °C; 20 s at 72 °C with optical read on the
Prism 7700 (Applied Biosystems Inc., Foster City, CA) real-time
thermal cycler. A thermal melt with optical read from 60 to 95 °C was
performed directly following the last 72 °C step of thermal cycling.
For RNA templates, M-MuLV RT (Promega, Madison, WI) was added
at 0.5 units/µL, and an initial 5 min incubation at 50 °C was performed
prior to PCR amplification to reverse transcribe RNA to DNA. Omission
of M-MuLV RT eliminates signal decrease for RNA templates (data
not shown). Raw FAM component fluorescence data was exported from
SDS 1.9 (Applied Biosystems, Inc.) software and analyzed with the
analysis software discussed below.
Software. Commercially available real-time cyclers use software
designed to analyze reactions where fluorescence increases with PCR
product accumulation. To analyze the results of real-time fluorescence
quenching PCR reactions using this technology, novel software was
developed. The software imports raw data from most real-time cyclers
and performs cycle threshold and melt curve analyses to determine
signal decrease during the amplification and signal change during the
melt.
Acknowledgment. Funding was provided in part by NIAID
NIH Grant No. R43 AI52898 (J.R.P.) and NIGMS NIH R44
GM055471 (G.S.). Abbreviations: Ac2O, acetic anhydride;
DMF, N,N-dimethylformamide; DMAP, 4,4′-(dimethylamino)-
pyridine; DMT, 4,4′-dimethoxytrityl; Et3N, triethylamine; MeCN,
acetonitrile; MeOH, methyl alcohol; Tol, p-toluyl.
JA0315558
9
4556 J. AM. CHEM. SOC. VOL. 126, NO. 14, 2004