A new steroidal saponin, furotrilliumoside from Trillium tschonoskii inhibits lipopolysaccharide-induced inflammation in Raw264.7 cells by targeting PI3K/Akt, MARK and Nrf2/HO-1 pathways

Article abstract of DOI:10.1016/j.fitote.2016.09.012

A new steroidal saponin, furotrilliumoside (FT) was isolated from the roots and rhizomes of Trillium tschonoskii Maxim. Its structure was elucidated on the basis of 1D- and 2D-NMR spectroscopic data as well as HR-ESI-MS analysis. FT showed superior activity of inhibiting NO production of RAW264.7 cells induced by lipopolysaccharide (LPS) in the preliminary biological screening. In order to develop novel therapeutic drug for acute and chronic inflammatory disorders, the anti-inflammatory activity and underlying mechanism of FT were investigated in LPS-induced RAW264.7 cells. The results showed that FT could reduce LPS-induced expression of inducible nitric oxide synthase (iNOS) and then resulted in the decrement of NO production. More meaningful, FT could down-regulate the expression of cyclooxygenase-2 (COX-2) and decrease the expressions of pro-inflammatory cytokines, tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-1β (IL-1β), in both gene and protein levels. In mechanism study, FT blocked the LPS-induced upregulation of phosphorylated phosphoinositide-3-kinase and Akt (PI3K/Akt). Furthermore, FT inhibited the translocation of nuclear factor-kappa B (NF-κB) through the prevention of inhibitory factor kappa B alpha (IκBα) phosphorylation and degradation and also suppressed the mitogen-activated protein kinases (MAPK) signaling pathway in LPS-stimulated RAW264.7 macrophages. In addition, FT upregulated heme oxygenase-1 (HO-1) expression via nuclear translocation of nuclear factor E2-related factor 2 (Nrf2). Taken together, FT might act as a natural agent to treat some inflammatory diseases by targeting PI3K/Akt, MARK and Nrf2/HO-1 pathways.

Full text of DOI:10.1016/j.fitote.2016.09.012

Fitoterapia 115 (2016) 37–45
Contents lists available at ScienceDirect
Fitoterapia
journal homepage: www.elsevier.com/locate/fitote
A new steroidal saponin, furotrilliumoside from Trillium tschonoskii
inhibits lipopolysaccharide-induced inflammation in Raw264.7 cells by
targeting PI3K/Akt, MARK and Nrf2/HO-1 pathways
a,
Ting Yan a,b, Xiangyong Yu a, Xianduo Sun c, Dali Meng a, , Jing-ming Jia
⁎
⁎
a
School of Traditional Chinese Materia Medica, Shenyang Pharmaceutical University, Shenyang 110016, China
b
School of Pharmacy, Jinzhou Medical University, Jinzhou 121001, China
c
School of Traditional Chinese Medicines, Guangdong Pharmaceutical University, Guangzhou 510006, China
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 29 July 2016
Received in revised form 23 September 2016
Accepted 26 September 2016
Available online 28 September 2016
A new steroidal saponin, furotrilliumoside (FT) was isolated from the roots and rhizomes of Trillium tschonoskii
Maxim. Its structure was elucidated on the basis of 1D- and 2D-NMR spectroscopic data as well as HR-ESI-MS
analysis. FT showed superior activity of inhibiting NO production of RAW264.7 cells induced by lipopolysaccha-
ride (LPS) in the preliminary biological screening. In order to develop novel therapeutic drug for acute and chron-
ic inflammatory disorders, the anti-inflammatory activity and underlying mechanism of FT were investigated in
LPS-induced RAW264.7 cells. The results showed that FT could reduce LPS-induced expression of inducible nitric
oxide synthase (iNOS) and then resulted in the decrement of NO production. More meaningful, FT could down-
regulate the expression of cyclooxygenase-2 (COX-2) and decrease the expressions of pro-inflammatory cyto-
kines, tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-1β (IL-1β), in both gene and protein
levels. In mechanism study, FT blocked the LPS-induced upregulation of phosphorylated phosphoinositide-3-ki-
nase and Akt (PI3K/Akt). Furthermore, FT inhibited the translocation of nuclear factor-kappa B (NF-κB) through
the prevention of inhibitory factor kappa B alpha (IκBα) phosphorylation and degradation and also suppressed
the mitogen-activated protein kinases (MAPK) signaling pathway in LPS-stimulated RAW264.7 macrophages.
In addition, FT upregulated heme oxygenase-1 (HO-1) expression via nuclear translocation of nuclear factor
E2-related factor 2 (Nrf2). Taken together, FT might act as a natural agent to treat some inflammatory diseases
by targeting PI3K/Akt, MARK and Nrf2/HO-1 pathways.
Keywords:
Trillium tschonoskii
Furotrilliumoside
Anti-inflammatory
RAW264.7
PI3K/Akt
Nrf2/HO-1
© 2016 Published by Elsevier B.V.
1. Introduction
activity. For example, dioscin could inhibit the inflammatory reaction of
collagen arthritis rats [8], and trillenoside A displayed remarkable inhibi-
Trillium tschonoskii Maxim. (Liliaceae) is a herbaceous plant in mid-
western China, known as ‘Yan Ling Cao’ locally [1]. Its dried roots and
rhizomes were used as a folk medicine for the treatment of neurasthe-
nia, headache, cancer, and ameliorating pains, and various inflammato-
ry diseases, such as sore, ulcer, fever and rheumatic pain [2]. The anti-
inflammatory activity of the extract from T.tschonoskii had been report-
ed [3,4], but its active principle had not been identified yet and the
detailed molecular mechanisms remained largely unclear. Previous phy-
tochemical and pharmacological investigations had shown that the
main active components of T. tschonoskii were steroidal saponins [5–7].
Moreover, some steroidal saponins exhibited obvious anti-inflammatory
tory action towards COX-2 production in macrophagocytes of the mouse
abdominal cavity stimulated by LPS at 10 mg/mL [9], which provided sci-
entific foundation to our research.
In the anti-inflammatory compound screening, it was found
furotrilliumoside (FT, Fig. 1),
a new compound isolated from
T.tschonoskii, showed the strongest activity. In order to reveal the anti-
inflammatory potential of FT, the inhibitory activity on LPS-induced in-
flammatory mediator production in RAW264.7 cells and underlying
mechanism were investigated in this study.
2. Experimental
2.1. General experiment procedure
Abbreviations: FT, furotrilliumoside; LPS, lipopolysaccharide; NO, nitric oxide; iNOS,
inducible nitric oxide synthase; COX-2, cyclooxygenase-2; TNF-α, tumor necrosis factor-
α; IL-6, interleukin-6; IL-1β, interleukin-1β; PI3K, phosphoinositide-3-kinase; MARK,
mitogen-activated protein kinases; HO-1, heme oxygenase-1; Nrf2, nuclear factor E2-
related factor 2; NF-κB, nuclear factor-κB; IκBα, inhibitory factor kappa B alpha.
Optical rotations were determined using a MCP-200 (Anton Paar,
Germany). UV spectra were recorded on a Shimadzu-2201 (Kyoto,
Japan). The IR spectrum was obtained from a Bruker IFS-55 spectropho-
tometer (Karlsruhe, Germany) using KBr pellet. HR-ESI-MS data were
⁎
Corresponding authors.
E-mail addresses: mengdl@163.com (D. Meng), jiajingming@163.com (J. Jia).
http://dx.doi.org/10.1016/j.fitote.2016.09.012
0367-326X/© 2016 Published by Elsevier B.V.

38
T. Yan et al. / Fitoterapia 115 (2016) 37–45
HO
26
27
O
4
HO
O
G II
25
HO
OH 1
22
21
18
20
17
O
11
16
19
H
1
9
14
8
10
HO
4
H
H
3
O
5
O
O
G I
HO
1
1
R II
O
O
4
O
HO
1
OH
HO
1
R III O
O
R I
4
HO
4
HO
HO
OH
OH
Fig. 1. The structure of FT.
performed on a Xevo G2 QTof (Waters MS Technologies, Manchester,
UK). NMR spectra were run on a Bruker AV-400 spectrometer (Karlsru-
he, Germany). Semi- preparative HPLC was performed on a YMC-Pack
ODS-A column(10 × 250 mm, 5 μm; YMC-Pack, Japan), equipped with
a LC-3000 A pump (Beijing Chuang Xin Tong Heng Science and Technol-
ogy Co., Ltd., China) and a 3000 UV–vis detector (Beijing Chuang Xin
Tong Heng Science and Technology Co., Ltd., China). Sugars analytical
HPLC was carried out on a Jasco PU-4180 pump (Kyoto, Japan) and a
OR-4090 detector (Kyoto, Japan). HPLC was performed with an
Asahipak NH2P-50 4E column (4.6 mm × 250 mm, 5 μm, Shodex,
Japan).
80:20 and 100:0, v/v) as eluent to give ten subfractions J1–J10.
Subfraction J8 was followed by semi-preparative RP-HPLC with the mo-
bile phase of MeOH-H2O (69:21, v/v, 3.0 mL/min) to afford FT (27.4 mg,
tR 33.4 min).
Furotrilliumoside (FT): white amorphous power; [α]20D – 73.8 (c 0.60,
C5H5N); UV (MeOH) λmax 225 nm; IR (KBr) νmax 3395, 2924, 2852, 2127,
1646, 1570, 1456, 1415, 1384, 1262, 1130, 1097, 1042, 983, 912, 884, 804
and 634 cm−1; HRESIMS m/z 1175.5809[M + H]+ (calcd. for C57H91O25
,
1175.5849). 1H NMR and 13C NMR (C5H5N) data see Table 2.
2.4. Acid hydrolysis of FT and determination of absolute configuration of
monosaccharides
2.2. Plant material and reagents
FT (2.0 mg) was hydrolysed with 2 M HCl (2 mL) at 90 °C for 3 h. The
reaction mixture was extracted with CHCl3 (2 mL × 3). The aqueous
layer was neutralized with 1 M NaOH and then concentrated to give a
residue [10,11]. The residue was analyzed by HPLC under the following
conditions: column, Asahipak NH2P-50 4E column (4.6 mm × 250 mm,
5 μm, Shodex); flow rate, 1.0 mL/min; solvent, 75% MeCN-H2O; detec-
tion, OR (Jasco OR-4090) detector. Identification of D-glucose and L-
rhamnose was carried out by a comparison of the retention times and
polarities with those of authentic samples. D-glucose (tR 9.0 min, posi-
tive polarity), L-rhamnose (tR 5.7 min, negative polarity).
The dried roots and rhizomes were collected in July 2014 from
Shennongjia, Hubei Province, China, and were identified by associate
professor Jia Lingyun (School of Traditional Chinese Materia Medica,
Shenyang Pharmaceutical University, Shenyang, China). The voucher
sample (JTZ-20140712) had been deposited in the Department of Natu-
ral Products Chemistry, Shenyang Pharmaceutical University, Shenyang,
China.
LPS (Escherichia coli serotype 055: B5) and 3-(4, 5-dimethylthiazol-
2-yl)-2, 5-diphenyltetrazolium bromide (MTT) were purchased from
Sigma-Aldrich (St. Louis, MO, USA). Dulbecco's modified Eagle's medi-
um (DMEM), fetal bovine serum (FBS), penicillin and streptomycin
were bought from Gibco BRL (Gaithersburg, MD, USA). All antibodies,
except for COX-2, JNK and lamin B (Proteintech Group, Inc., Chicago,
USA) and PI3K, iNOS (Abcam, Cambridge, MA, USA) were obtained
from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Primers for
Real-time PCR were synthesized by Sangon Biotech (Shanghai) Co.,
Ltd. (Shanghai, China). All other chemicals were obtained from Sigma-
Aldrich unless otherwise stated.
2.5. Cell culture and cell viability for assay
RAW264.7, a mouse macrophage cell line, was purchased from the
Cell Bank of the Shanghai Institute of Cell Biology and Biochemistry, Chi-
nese Academy of Sciences (Shanghai, China) and cultured in high glu-
cose DMEM supplemented with 10% heat-inactivated FBS, 100 U/mL
penicillin and 100 μg/mL streptomycin in a 37 °C humidified incubator
containing 5% CO2. FT was dissolved in dimethyl sulfoxide (DMSO) to
a concentration of 100 mM and further diluted in cell culture media so
that the final DMSO concentration was below 0.1% v/v.
2.3. Extraction an isolation
MTT assay was used to evaluate the effect of FT on cell viability [12].
In Brief, RAW264.7 cells were seeded in 96-well plates (Corning Inc.,
Corning, NY, USA) at a density of 5 × 104 cells/well. After overnight
growth, cells were treated with various concentrations of FT (1–
160 μM) for 1 h, followed in the presence or absence of LPS (100 ng/
mL) for the next 24 h. 20 μL of MTT solution (5 mg/mL) was added
and the cells were further cultured for 4 h. After that, the supernatant
was carefully removed and then the resulting formazan crystals were
dissolved in 100 μL DMSO with horizontal shaking. The absorbance at
570 nm (ref 630 nm) was measured with a microplate reader (Molecu-
lar Devices, California, USA).
The dried roots and rhizomes (1.7 kg) of T. tschonoskii were powered
and extracted three times with 70% EtOH (each 2 h) and the combined
solution evaporated to dryness by a vacuum rotary evaporator to afford
a syrup (600 g). The crude extract was suspended with H2O (1.0 L) and
successively partitioned with petroleum ether, ethyl acetate and n-bu-
tanol to yield three layers of extracts. The n-butanol extract (210 g)
was fractionated by silica gel column chromatography eluting with
CH2Cl2-MeOH (100:0–0:100, v/v) to obtain thirteen fractions (Fr. A–
M) based on TLC analyses. Fr. J was subjected to ODS CC eluted with
MeOH-H2O (10:90, 20:80, 30:70, 35:65, 40:60, 50:50, 60:30, 70:30,

T. Yan et al. / Fitoterapia 115 (2016) 37–45
39
2.6. Measurement of NO, TNF-α and IL-6 release
the Enhanced BCA Protein Assay Kit (Beyotime institute of Biotechnolo-
gy, Jiangsu, China). Aliquots of protein samples were mixed in loading
buffer, boiled for 5 min and then stored at ‐80 °C [16].
RAW264.7 cells were seeded into 96-well plates at a density of 2.5 ×
105 cells/mL and cultured overnight. After pretreatment with FT of vari-
ous concentrations for 1 h, the cells were stimulated with LPS (100 ng/
mL) for 24 h. The concentration of NO in the conditioned culture medium
was examined with the Nitric Oxide Assay Kit (Beyotime institute of Bio-
technology, Jiangsu, China) and the release of TNF-α and IL-6 in the cell
supernatants were assayed using ELISA kits (Shanghai Joyee Biotechnics
Co., Ltd., Shanghai, China) according to the manufacturer's instructions
[13]. The concentrations were calculated from the standard curves.
Nitrite accumulation, an indicator of NO synthesis, was measured in
the culture medium by Griess reaction (Beyotime, China). Briefly, 50 μL
of cell culture medium was mixed with 50 μL of Griess reagent [equal
volumes of 1% (w/v) sulfanilamide in 5% (v/v) phosphoric acid and
0.1% (w/v) naphtylethylenediamine-HCl] and incubated at room tem-
perature for 10 min [14]. The absorbance at 540 nm was then measured
using an automated microplate spectrophotometer (Bio-Tek Instru-
ments, Winooski, VT). Fresh culture medium was used as a blank in all
experiments. The amount of nitrite in the test samples was calculated
from a sodium nitrite standard curve.
2.9. Western blot analysis
Aliquots of the protein samples were separated on acrylamide gel by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
and electrophoretically transferred into a polyvinylidene fluoride
(PVDF) membranes (Millipore, Billerica, MA, USA). After blocking with
5% skimmed milk the membranes were incubated with specific primary
antibodies overnight at 4 °C. After rinsing, the membranes were incu-
bated with a HRP-labelled secondary antibody containing a blocking so-
lution for 1 h at room temperature. Immunodetection was performed
using an enhanced chemiluminescence EasySee Western Blot Kit
(TransBionovo Co., Ltd., Beijing, China). The immunosignals were cap-
tured using the Gel DOC™ XR+ system (BioRad Laboratories, Hercules,
CA, USA) and densitometric data were studied following normalization
to the house-keeping loading control.
2.10. Statistical analysis
2.7. Quantitative real-time polymerase chain reaction (qRT-PCR)
All experiments were performed at least three times unless otherwise
stated. Statistical significance was determined using GraphPad Prism 5
Software (GraphPad Software, San Diego, CA, USA). The results were an-
alyzed using one-way ANOVA with Tukey multiple comparison test. The
data were given as the means SD. P b 0.05 was considered as significant.
RAW264.7 cells (2.5 × 105 cells in a 24-well plate) were treated with
FT for 1 h and then were stimulated with LPS for 4 h. Total RNA was ex-
tracted with TRIzol Reagent and 1 μg total RNA was reverse-transcribed
using a HiScript II Q RT SuperMix for qPCR according to the
manufacturer's instructions [15]. Aliquots of diluted cDNA (1:5) were
amplified with TransStart Top Green qPCR SuperMix in a final volume
of 20 μL. QRT-PCR was carried out using the Thermo Scientific PikoReal
(Thermo Fisher Scientific, MA, USA). PCR cycles consisted of initial dena-
turation at 94 °C for 30 s, followed by 40 cycles of 94 °C for 5 s, 60 °C for
15 s, and 72 °C for 10 s. The Δ cycle threshold method was used for the
calculation of relative differences in mRNA abundance with the Thermo
Scientific PikoReal. Data were normalized to the expression of β-actin.
The results were expressed as fold-changes. The normalized value of
the target mRNA of the LPS control group was arbitrarily presented as
1. The sequences of primers used were listed in Table 1.
3. Results and discussion
3.1. Structure elucidation
FT (Fig. 1) was obtained as amorphous powder with molecular for-
mula of C57H90O25 determined by its HRESI-MS at m/z 1175.5809
[M + H]+ (calc. for 1175.5849) and 13C NMR data (Table 2). The 1
H
Table 2
1H and 13C NMR spectroscopic data for FT in pyridine-d5.
No.
δH
δC
No.
δH
δC
1
2
3
4
5
6
7
8
0.96 (m), 1.71 (m)
1.85 (m), 2.06 (m)
3.87 (m)
2.72 (m), 2.81 (m)
―
5.32 (br d, 3.2)
1.54 (m), 1.84 (m)
1.65 (m)
1.03 (m)
―
1.46–1.59 (m)
1.56 (m), 2.01 (m)
―
1.89 (m)
2.28 (dd, 13.9, 11.2) 27.0 (t)
2.47 (dd, 13.9, 6.3)
―
―
0.89 (s)
1.08 (s)
―
1.97 (s)
37.4 (t)
30.2 (t)
78.1 (d)
39.1 (t)
141.2 (s) R I-1
121.7 (d) R I-2
32.0 (t)
30.5 (d)
51.1 (d)
37.4 (s)
20.7 (t)
35.7 (t)
41.3 (s)
60.9 (d)
G I-3
G I-4
G I-5
G I-6
3.60 (m)
4.41 (m)
4.22 (m)
77.1 (d)
77.8 (d)
77.9 (d)
2.8. Protein samples preparation
RAW264.7 cells (2.5 × 105 cells/mL) were pretreated or left untreat-
ed with FT (10, 20 and 40 μM) for 1 h and stimulated with LPS for indi-
cated time. Then cells were rinsed, scraped off and collected in ice-PBS.
After centrifugation, the PBS was pipetted completely and Cell lysis buff-
er for Western and IP (Beyotime institute of Biotechnology, Jiangsu,
China) was added in for total proteins extraction. While nuclear and cy-
tosolic proteins were prepared using Nuclear and Cytoplasmic Extrac-
tion Reagents (Active Motif, Carlsbad, CA, USA) according to the
manufacturer's protocol. Protein concentration was determined using
4.04 (m), 4.19 (m) 61.3 (t)
6.39 (br s)
4.85 (br s)
4.64 (dd, 9.4, 3.0)
4.36 (m)
102.2 (d)
72.6 (d)
72.9 (d)
74.2 (d)
69.6 (d)
18.7 (q)
102.3 (d)
73.3 (d)
72.9 (d)
80.5 (d)
68.4 (d)
R I-3
R I-4
R I-5
R I-6
R II-1
R II-2
R II-3
R II-4
R II-5
9
4.95 (m)
10
11
12
13
14
15
1.76 (d, 6.1)
5.83 (br s)
4.55 (m)
4.50 (dd, 9.4, 2.9)
4.43 (t, 9.4)
4.94 (m)
Table 1
Primers used for the qRT-PCR study.
16
17
18
19
20
21
22
23
24
25
26
155.3 (s) R II-6
137.2 (s) R III-1 6.28 (br s)
18.3 (q)
19.4 (q)
112.0 (s) R III-4 4.29 (t, 9.4)
9.0 (q) R III-5 4.34 (m)
153.8 (s) R III-6 1.59 (d, 5.8)
24.4 (t)
33.2 (t)
33.6 (d)
75.0 (t)
1.58 (d, 5.8)
18.5 (q)
103.3 (d)
72.7 (d)
72.9 (d)
74.0 (d)
70.5 (d)
18.9 (q)
104.9 (d)
75.3 (d)
78.6 (d)
71.8 (d)
Gene
iNOS
Sequence (5′ to 3′)
R III-2 4.90 (br s)
R III-3 4.54 (m)
F: AGCCAAGCCCTCACCTACTT
R: GCCTCCAATCTCTGCCTATC
F: CCAGCACTTCACCCATCAGT
R: GGGATACACCTCTCCACCAA
F: CAGACCCTCACACTCAGATCATCTT
R: CAGAGCAATGACTCCAAAGTAGACCT
F: CACGGCCTTCCCTACTTCAC
R: TGCAAGTGCATCATCGTTGT
F: GTTGACGGACCCCAAAAGAT
R: CCTCATCCTGGAAGGTCCAC
F: ATGTGGATCAGCAAGCAGGA
R: AAGGGTGTAAAACGCAGCTCA
COX-2
TNF-α
IL-6
―
2.59–2.74 (m)
1.55 (m), 1.93 (m)
1.94 (m)
3.57 (dd, 9.4, 5.5)
3.94 (m)
0.98 (d, 6.3)
G II-1 4.81 (d, 7.8)
G II-2 4.02 (m)
G II-3 3.95 (m)
G II-4 4.24 (m)
IL-1β
27
17.3 (q)
G II-5 4.25 (m)
78.7 (d)
β-actin
G I-1 4.94 (d, 7.8)
G I-2 4.20 (m)
100.4 (d) G II-6 4.40 (m), 4.56 (m) 62.9 (t)
78.1 (d)

40
T. Yan et al. / Fitoterapia 115 (2016) 37–45
Fig. 2. Significant HMBC correlations of FT.
NMR spectrum of FT showed signals for three tertiary methyls at δH
0.89, 1.08 and 1.97 (each 3H, s); four secondary methyls at δH 0.98
(3H, d, J = 6.3 Hz), 1.58 (3H, d, J = 5.8 Hz), 1.59 (3H, d, J = 5.8 Hz),
1.76 (3H, d, J = 6.1 Hz); five anomeric protons at δH 4.81 (1H, d, J =
7.8 Hz), 4.94 (1H, d, J = 7.8 Hz), 5.83 (1H, br s), 6.28 (1H, br s) and
6.39 (1H, br s); and an olefinic proton at δH 5.32 (1H, br d, J = 3.2 Hz).
The characteristic signals at δH 1.58, 1.59 and 1.76 were due to the meth-
yl group of rhamnose. The 13C NMR spectrum of FT showed a total of 57
resonance lines, and 30 of which were attributed to five monosaccha-
ride units. This implied a molecular formula C27H40O3 for the aglycone
moiety, which suggested the aglycone to be a steroid with three oxygen
atoms on the skeleton. The 1H NMR signals (Table 2) at δH 3.87 (1H, m),
Fig. 4. Effect of FT on TNF-α (A) and IL-6 (B) production in LPS-induced RAW264.7
macrophages. RAW264.7 cells were treated with FT (10, 20 and 40 μM) and then
incubated with LPS (100 ng/mL) for 24 h. The culture supernatant was subjected to
ELISA kits. Data shown are the means
SD from three independent experiments.
***p b 0.001 vs control, #p b 0.05 and ##p b 0.01 vs LPS-treated group.
δ
H 3.57 (1H, dd, J = 9.4, 5.5 Hz) and 3.94 (1H, m) and six olefinic carbon
Acid hydrolysis of FT with 2 M HCl obtained D-glucose and L-rham-
nose as carbohydrate moieties, which were characterized by compari-
son of the retention times in HPLC analysis with their corresponding
authentic samples.
signals (Table 2) at δC 112.0 (s), 121.7 (d), 137.2 (s), 141.2 (s), 153.8 (s)
and 155.3 (s) in its 13C NMR spectrum suggested the aglycone of FT to be
a Δ5,16,20(22)-furostatriene-3,26-diol. The structure of the aglycone was
further confirmed by HMBC correlations (Fig. 2) from δH 1.08 (3H, s,
Me-19) to C-1 (δC 37.4), C-5 (δC 141.2) and C-9 (δC 51.1), from δH 5.32
(1H, br d, J = 3.2 Hz, H-6) to C-4 (δC 39.1), C-8 (δC 30.5) and C-10 (δC
37.4), from δH 0.89 (3H, s, Me-18) to C-12 (δC 35.7), C-14 (δC 60.9)
and C-17 (δC 137.2), from δH 1.97 (3H, s, Me-21) to C-17 (δC 137.2), C-
20 (δC 112.0) and C-22 (δC 153.8), and from δH 0.98 (3H, d, J = 6.3 Hz,
Me-27) to C-24 (δC 33.2), C-25 (δC 33.6), and C-26 (δC 75.0). The β-ori-
entation of OH-3 was deduced from the typical peak shape of H-3 and
13C NMR data of ring A. The H-atom resonances of CH2 (26) showed a
Δ (δH26b − δH26a) = 0.37 ppm which is b0.48, allowed us to assign
the 25R configuration [17]. Thus, the aglycone of FT was elucidated as
(25R)-Δ5,16,20(22)-furostatriene-3β,26-diol.
The 1H and 13C NMR spectra (Table 2) of FT showed five anomeric
proton signals, three distinct methyl doublets, and five anomeric car-
bons at δC 100.4, 102.2, 102.3, 103.3, and 104.9, revealing the presence
of two glucose and three rhamnose units. The glucopyranoside was β-
configuration on the ground of the coupling constants (3J1,2 N 7.0 Hz)
of the anomeric protons. The α-configuration for the rhamnopyranoside
was deduced by comparing the 13C NMR spectroscopic data for C-3 (δC-
RI 72.9, δC-RII 72.9 and δC-RIII 72.9) and C-5 (δC-RI 69.6, δC-RII 68.4 and δC-RIII
70.5) of rhamnopyranoside with those reported in the literature [18].
Carefully analysis of the 1D and 2D NMR spectra of FT suggested that
the sequence and linkage positions of the sugars were exactly the
Fig. 3. Cell viability and effect of FT on NO production in LPS-induced RAW264.7 macrophages. (A) Cell viability. RAW264.7 cells were treated with LPS (100 ng/mL) without or with FT (1–
160 μM) for 24 h. Cell viability was determined by MTT assay. (B) Level of nitrite. RAW264.7 cells were pretreated with FT (10, 20 and 40 μM) for 1 h prior to LPS (100 ng/mL) treatment for
24 h. The concentrations of nitrite in the medium of RAW264.7 macrophages were monitored by Griess reaction. Data shown are the means SD from three independent experiments.
***p b 0.001 vs control, ###p b 0.001 vs LPS-treated group.

T. Yan et al. / Fitoterapia 115 (2016) 37–45
41
same as those of parispseudoside C [17], which were verified by detailed
analysis of long-rang HMBC correlations (Fig. 2). Furthermore, in the
HMBC spectrum, the correlations of δH 4.94 (1H, d, J = 7.8 Hz) with
δC 78.1 (C-3) and δH 4.81 (1H, d, J = 7.8 Hz) with δC 75.0 (C-26)
were observed, which hinted that the tetrasaccharide and the β-
glucopyranoside were attached to C-3 and C-26 of the aglycone,
respectively. Therefore, the structure of FT was elucidated as (25R)-3β-
O-{α-L-rhamnopyranosyl-(1 → 4)-α-L-rhamnopyranosyl-(1 → 4)-[α-L-
rhamnopyranosyl-(1 → 2)]-β-D-glucopyranosyl}furosta-5,16,20(22)-
triene-26-O-β-D-glucopyranoside and named as furotrilliumoside.
Therefore, the inhibition of LPS-induced nitrite production by FT was
not the result of a cytotoxic effect on these cells.
3.3. Effects of FT on levels of TNF-α and IL-6 in RAW264.7 macrophages
To investigate whether FT could inhibit the inflammatory response,
ELISA assay was used to test the levels of TNF-α and IL-6, which are con-
sidered as classical inflammatory factors, in LPS-stimulated RAW264.7
cells. RAW264.7 cells were treated with various concentrations of FT
and stimulated with LPS for 24 h, the RAW264.7 cell secretion of two
pro-inflammatory cytokines was strongly increased compared with
the untreated control cells. As expected, FT (10–40 μM) significantly re-
duced the production of TNF-α and IL-6 in dose-dependent manner
(Fig. 4). The inhibition following treatment with 40 μM FT was 60.90%
for TNF-α and 30.91% for IL-6, respectively. However, none of these cy-
tokine levels returned to the basal level of the untreated group.
3.2. Effects of FT on cell viability and LPS-induced nitric oxide (NO) produc-
tion in RAW264.7 macrophages
To evaluate the anti-inflammatory effect of FT, the effect of FT on
NO production was determined by measuring the level of nitrite ac-
cumulation (the stable metabolite of NO) in culture media. LPS (100
ng/mL) induced significant nitrite production as compared with the
naive control. Meanwhile, the induction of nitrite production by LPS
was inhibited by a FT treatment in a dose-dependent manner with an
IC50 value of 17.78 μM (Fig. 3B). An examination of the cytotoxicity of
FT in RAW 264.7 macrophages by the MTT assay indicated that even
160 μM FT did not affect the viability of the RAW 264.7 cells (Fig. 3A).
3.4. Effects of FT on LPS-induced iNOS, COX-2 protein and mRNA expres-
sions in RAW264.7 macrophages
In view of the involvement of iNOS in the inflammatory process, the
levels of iNOS protein and mRNA gene expression in the macrophages
exposed to FT were monitored. As shown in Fig. 5A, the expression of
Fig. 5. Effects of FT on iNOS, COX-2 protein and gene expressions in LPS-stimulated RAW264.7 cells. RAW264.7 macrophages were pretreated with various concentrations of FT for 1 h prior
to LPS (100 ng/mL) treatment. (A and B) iNOS and COX-2 protein expressions. iNOS (A) and COX-2 (B) protein expressions were monitored 24 h after treatment of cells with LPS
(100 ng/mL) using β-actin expression as an internal control. (C and D) iNOS and COX-2 mRNA expressions. The mRNA expression levels of iNOS (C) and COX-2 (D) were
quantitated by qRT-PCR. in RAW264.7 macrophages exposed to LPS for 4 h. Data shown are the means
SD from three independent experiments. ***p b 0.001 vs control,
##p b 0.01 and ###p b 0.001 vs LPS-treated group.

42
T. Yan et al. / Fitoterapia 115 (2016) 37–45
Fig. 6. Effect of FT on TNF-α, IL-6 and IL-1β mRNA expression in LPS-induced RAW264.7 macrophages. RAW264.7 cells were treated with various concentrations (10, 20 and 40 μM) of FT
and stimulated with LPS (100 ng/mL) for 4 h, the mRNA expression levels of TNF-α (A), IL-6 (B) and IL-1β (C) were quantitated by qRT-PCR. Data shown are the means SD from three
independent experiments. ***p b 0.001 vs control, #p b 0.05, ##p b 0.01 and ###p b 0.001 vs LPS-treated group.
the iNOS protein was barely detected in the non-stimulated cells. How-
ever, the level increased markedly 24 h after the LPS treatment. FT
exerted a concentration-dependent inhibition of iNOS protein expres-
sion in the LPS-stimulated RAW264.7 macrophages. To assess the effect
of FT on iNOS mRNA expression, the mRNA level was quantitated by
qRT-PCR. iNOS mRNA expression was also hardly detectable in non-
stimulated cells. On the other hand, the RAW264.7 macrophages
expressed high levels of iNOS mRNA when stimulated with LPS for a
Fig. 7. Effects of FT on LPS-induced NF-κB activation and IκBα degradation and phosphorylation in RAW264.7 cells. The cells were treated with FT (10, 20 and 40 μM) in the presence of
100 ng/mL LPS for 1 h. (A) Effect of FT on LPS-induced NF-κB activation. Protein samples for nuclear (N) and cytosol (C) extract of RAW264.7 cells were analyzed by Western blot using
anti-p65 antibody. Lamin B and β-actin were used as the internal control for normalization. (B) Effects of FT on LPS-induced IκBα degradation and phosphorylation. The effect of FT on IκBα
degradation and phosphorylation was immunochemically assessed using phospho-specific anti-IκBα for cytosol extract of RAW264.7 cells. β-Actin was used as the internal control for
normalization. The data represent the means SD from three independent experiments. ***p b 0.001 vs control, #p b 0.05, ##p b 0.01 and ###p b 0.001 vs LPS-treated group.

T. Yan et al. / Fitoterapia 115 (2016) 37–45
43
4 h period. Consistent with protein expression, FT inhibited the LPS-
stimulated expression of iNOS mRNA in a dose-dependent manner
(Fig. 5C). The results suggested that FT significantly reduced the iNOS
expression at concentration-dependent manner, which was in line
with NO production.
COX-2 was induced by a wide variety of stimuli such as LPS, certain
serum factors, cytokines, and growth factors and was expressed pre-
dominantly at the sites of inflammation [19]. Therefore, there is increas-
ing interest in the use of COX-2 inhibitors for treating inflammatory
diseases. The effects of FT on the LPS-induced expression of the COX-2
mRNA gene and protein in macrophages were then evaluated in a fur-
ther step. The expression of COX-2 mRNA was monitored in
RAW264.7 macrophages exposed to LPS for 4 h. FT could effectively sup-
press the induction of COX-2 mRNA by LPS in a dose dependent manner
(Fig. 5D). Consistent with mRNA expression, FT inhibited the LPS-stim-
ulated expression of COX-2 protein in a dose-dependent manner (Fig.
5B).
Fig. 6, FT (10, 20 and 40 μM) had strong concentration-dependent re-
ducing effects on the relative expressions of TNF-α, IL-6 and IL-1β
mRNA in LPS-induced RAW264.7 cells. The high dosage of FT
(40 μM) showed the best inhibitory effect, compared with those of
other groups. The percent inhibition of 40 μM FT was 44.90% for
TNF-α, 50.38% for IL-6 and 45.86% for IL-1β, respectively (Fig. 6A, B
and C). Although there were high levels of inhibition of cytokine pro-
duction, none of them returned to their basal level, compared to the
control group.
3.6. Effect of FT on NF-κB activation and IκBα degradation in LPS-induced
RAW264.7 macrophages
The NF-κB pathway played a critical role in the inflammatory re-
sponse by regulating the expression of inflammatory cytokines, includ-
ing IL-1β, IL-6, and TNF-α [20,21]. Hence, it was necessary to investigate
whether FT could suppress the phosphorylation of IκB-α and transloca-
tion of NF-κB (active subunit p65) into the nucleus (Fig. 7). It was ob-
served that p65 was mostly distributed in the cytoplasm and hardly
translocated into the nucleus in unstimulated cells; while treatment
with LPS increased p65 protein level in the nucleus. Interestingly, FT
suppressed the nuclear translocation of p65 in a concentration-depen-
dent manner compared with LPS-induced cells. Furthermore, FT also
significantly suppressed IκB-α phosphorylation and degradation,
3.5. Effect of FT on TNF-α, IL-6 and IL-1β mRNA expression in RAW264.7
macrophages
FT efficiently inhibited LPS-induced production of proinflamma-
tory cytokines in RAW264.7 cells. Furthermore, the effects of FT on
TNF-α, IL-6 and IL-1β mRNA level were investigated. According to
Fig. 8. Effect of FT on LPS-induced phosphorylation of PI3K/Akt (A and B) and MAPKs (C) in RAW264.7 cells. RAW264.7 cells were stimulated with LPS (100 ng/mL) alone or LPS plus FT
(40 μM) for the indicated time points. The whole-cell lysates were analyzed by immunoblot analysis using various antibodies against specific antibodies. The data represent the means
SD from three independent experiments. **p b 0.01 and ***p b 0.001 vs control, ###p b 0.001 vs LPS-treated group.

44
T. Yan et al. / Fitoterapia 115 (2016) 37–45
which can regulate NF-κB activity, compared with LPS-induced
RAW264.7 cells.
and HO-1 protein in macrophages at a dose-dependent manner
(Fig. 9).
In the current study, parispseudoside C, which was not presented in
this paper due to its worse effect towords RAW264.7 macrophages cells
(IC50 N 100 μM), also had the same skeleton as FT, excepted the exis-
tence of furan ring moiety. Therefore it was initially speculated that
furan ring fragments might play an important role for anti-inflammato-
ry activity.
In conclusion, FT significantly attenuated LPS-induced production of
NO, TNF-α and IL-6, and reduced their relevant gene expression in pro-
tein and mRNA levels in RAW264.7 murine macrophages. Mechanisms
study further elucidated that FT might exert these effect via inhibition
of PI3K/Akt and MARK signaling, and activation of Nrf2/HO-1 signaling.
FT exhibited great potential to be developed into therapeutic drug for
acute and chronic inflammatory disorders. Nevertheless, the therapeu-
tic effect of FT in vivo need further studies.
3.7. Effect of FT on phosphorylation of PI3K/Akt and MAPKs pathways in
LPS-induced RAW264.7 cells
LPS-stimulated activation of PI3K/Akt signaling played an important
part in the progress of inflammation [22]. As shown in Fig. 8B, LPS pow-
erfully enhanced phosphorylation of Akt protein in RAW264.7 cells, and
Akt phosphorylation was distinctly inhibited by FT. Similarly, the upreg-
ulation of PI3K was also reduced by FT (Fig. 8A). This result indicated
that FT had an important repressor effect on the LPS-stimulated PI3K/
Akt pathway signaling.
The MAPKs played an important role in regulating cell growth and
differentiation as well as in the control of the cellular responses to cyto-
kines and various stresses [23]. Moreover, they were also important for
activating NF-κB. The effects of FT on the LPS-stimulated phosphorylation
of Erk1/2, SAPK/JNK, and p38 MAPK in RAW264.7 cells were examined
using Western blot analyses to determine whether the FT-induced inhi-
bition of NF-κB activation was mediated by the MAPKs pathway. As
shown in Fig. 8C, LPS treatment induced strong increases in the levels
of phosphorylated ERK, JNK, and p38 at different indicated times. Mean-
while, FT significantly suppressed the LPS-induced phosphorylation of
p38 MAPK and Erk1/2 MAPKS, and SAPK/JNK was also slightly affected
by the FT treatment.
Conflict of interest
The authors declare that there are no conflicting interest.
Acknowledgements
The work was supported by National Natural Science Foundation of
China (NO. 81473423).
3.8. Effect of FT on Nrf2 and HO-1 protein expressions in RAW264.7 cells
Appendix A. Supplementary data
Nuclear factor erythroid 2-related factor 2 (Nrf2) was a tran-
scription factor that binds to the promoter of the hemeoxygenase
(HO)-1 gene leading to anti-inflammation and anti-oxidation re-
sponses [24,25]. FT significantly promoted the expression of Nrf2
The NMR, IR and HR-ESI-MS spectra of FT were available as
supporting information in the Supplementary data. Supplementary
data associated with this article can be found in the online version, at
http://dx.doi.org/10.1016/j.fitote.2016.09.016.
Fig. 9. Effects of FT on LPS-induced Nrf2 and HO-1 protein expressions in RAW264.7 cells. (A) Effects of FT on Nrf2 protein expression in RAW264.7cells. The cells were treated with FT (10,
20 and 40 μM) in the presence of 100 ng/mL LPS for 1 h. Protein samples for nuclear (N) and cytosol (C) extract of RAW264.7 cells were analyzed by Western blot using anti-Nrf2 antibody.
Lamin B and β-actin were used as the internal control for normalization. (B) Effects of FT on HO-1 protein expression in RAW264.7cells. The cells were treated with FT (10, 20 and 40 μM) in
the presence of 100 ng/mL LPS for 24 h. HO-1 protein expression was immunochemically assessed using anti-HO-1 antibody. β-Actin was used as the internal control for normalization.
The data represent the means SD from three independent experiments. **p b 0.01 and ***p b 0.001 vs control, ##p b 0.01 and ###p b 0.001 vs LPS-treated group.

T. Yan et al. / Fitoterapia 115 (2016) 37–45
45
[14] X.X. Wang, D. Hu, L.J. Zhang, G.N. Lian, S.Q. Zhao, C.M. Wang, J. Yin, C.F. Wu, J.Y. Yang,
Gomisin A inhibits lipopolysaccharide-induced inflammatory responses in N9 mi-
croglia via blocking the NF-κB/MAPKs pathway, Food Chem. Toxicol. 63 (2014)
119–127.
[15] J.Y. Tao, G.H. Zheng, L. Zhao, J.G. Wu, X.Y. Zhang, S.L. Zhang, Z.J. Huang, F.L. Xiong,
C.M. Li, Anti-inflammatory effects of ethyl acetate fraction from Melilotus suaveolens
Ledeb on LPS-stimulated RAW 264.7 cells, J. Ethnopharmacol. 123 (2009) 97–105.
[16] Q.Z. Li, S.R. Yang, S.L. Yang, F.Z. Xin, M.J. Wang, Anti-inflammatory activity of
References
[1] Q. Li, M. Xiao, L. Guo, L. Wang, L. Tang, Y. Xu, Genetic diversity and genetic structure
of an endangered species, Trillium tschonoskii, Biochem. Genet. 43 (2005) 445–458.
[2] L. Fu, China Plant Red Data Book, Volume 1 Rare and Endangered Plants, Science
Publishing House Press, Beijing, 1992.
[3] B.J. Xiao, G.D. Chen, Z.X. Tan, Studies on anti-inflammatory and immune effect of
tschonoskii maxim, Anhui Med. Pharma. J. 9 (2005) 246–248.
[4] L.L. Yu, K. Zou, J.Z. Wang, L.B. Zhu, Y. Zhou, J. Yang, Study on the anti-inflammatory,
analgesic and thrombosis effects of extract of Trillium tschonoskii Maxim, Lishizhen
Med. Mater. Med. Res. 19 (2008) 1178–1180.
[5] J.C. Wei, S.L. Man, W.Y. Gao, X. Chai, W.S. Zhao, Y. Wang, S.S. Jing, Steroidal saponins
from the rhizomes of Trillium tschonoskii maxim, Biochem. Syst. Ecol. 44 (2012)
112–116.
[6] J. Chai, X.M. Song, X. Wang, Q.B. Mei, Z. Li, J.C. Cui, Z.S. Tang, Z.G. Yue, Two new com-
pounds from the roots and rhizomes of Trillium tschonoskii Maxim, Phytochem. Lett.
10 (2014) 113–117.
[7] X. Gao, W.J. Sun, Q. Fu, X.F. Niu, Rapid identification of steroidal saponins in Trillium
Tschonoskii Maxim. by ultraperformance liquid chronmatography coupled to
electrospray lonisation quadrupole time-of-flight tandem mass spectrometry,
Phytochem. Anal. 26 (2015) 269–278.
[8] C.M. Chu, H.Q. Zhang, P. Bu, Experimental study on the therapeutic effect of dioscin
on rats with collagen-induced arthritis, Chin. Pharma. Bull. 28 (2012) 1464–1467.
[9] J.Z. Wang, K. Zou, Y.M. Zhang, C. Liu, J. Wu, Y. Zhou, F.J. Dan, Y.X. Zhang, An 18-
norspirostanol saponin with inhibitory action against COX-2 production from the
underground part of Trillium tschonoskii, Chem. Pharm. Bull. 55 (2007) 679–681.
[10] P. Hu, D.H. Lia, X. Hua, S.G. Lia, C.M. Sai, X.C. Sun, T. Su, J. Bai, Z.H. Wang, Z.L. Li, H.M.
Hua, Lignans and triterpenoids from Vitex negundo var. heterophylla and their bio-
logical evaluation, Fitoterapia 111 (2016) 147–153.
phlomisoside
F
isolated from Phlomis younghusbandii Mukerjee, Int.
Immunopharmacol. 28 (2015) 724–730.
[17] C.M. Xiao, J. Huang, X.M. Zhong, X.Y. Tan, P.C. Deng, Two new homo-aro-cholestane
glycosides and a new cholestane glycoside from the roots and rhizomes of Paris
polyphylla var. pseudothibetica, Helv. Chim. Acta 92 (2009) 2587–2595.
[18] R. Kasai, M. Okihara, J. Asakawa, K. Mizutani, O. Tanaka, 13C NMR study of α- and β-
anomeric pairs of D-mannopyranosides and L-rhamnopyranosides, Tetrahedron 35
(1979) 1427–1432.
[19] D.J. Wadleigh, S.T. Reddy, E. Kopp, S. Ghosh, H.R. Herschman, Transcriptional activa-
tion of the cyclooxygenase-2 gene in endotoxin-treated RAW264.7 macrophages, J.
Biol. Chem. 275 (2000) 6259–6266.
[20] A.R. Brasier, The NF-kappaB regulatory network, Cardiovasc. Toxicol. 6 (2006)
111–130.
[21] Y.S. Kim, C.B. Ahn, J.Y. Je, Anti-inflammatory action of high molecular weight Mytilus
edulis hydrolysates fraction in LPS-induced RAW264.7 macrophage via NF-κB and
MAPK pathways, Food Chem. 202 (2016) 9–14.
[22] C. Guo, L. Yang, J. Luo, C. Zhang, Y.Z. Xia, T. Ma, L.Y. Kong, Sophoraflavanone G from
Sophora alopecuroides inhibits lipopolysaccharide-induced inflammation in
RAW264.7 cells by targeting PI3K/Akt, JAK/STAT and Nrf2/HO-1 pathways, Int.
Immunopharmacol. 38 (2016) 349–356.
[23] Z.X. Zhu, Y.F. Gu, Y.F. Zhao, Y.L. Song, J. Li, P.F. Tu, GYF-17, a chloride substituted 2-
(2-phenethyl)-chromone, suppresses LPS-induced inflammatory mediator produc-
tion in RAW264.7 cells by inhibiting STAT1/3 and ERK1/2 signaling pathways, Int.
Immunopharmacol. 35 (2016) 185–192.
[24] X. Zhu, W.G. Fan, D.P. Li, H. Kung, M.C. Lin, Heme oxygenase-1 system and gastroin-
testinal inflammation: a short review, World J. Gastroenterol. 17 (2011) 4283–4288.
[25] L. An, C.T. Liu, M.J. Yu, Z.H. Chen, X.G. Guo, W. Peng, J.F. Wang, X.Q. Fang, Y.H. Gao,
S.Y. Yu, Heme oxygenase-1 system, inflammation and ventilator-induced lung inju-
ry, Eur. J. Pharmacol. 677 (2012) 1–4.
[11] D. Zhao, B.M. Feng, S.F. Chen, G. Chen, Z.F. Li, X.J. Lu, X.N. Sang, X. An, H.F. Wang, Y.H.
Pei, C21 steroidal glycosides from the roots of Cynanchum paniculatum, Fitoterapia
113 (2016) 51–57.
[12] O.K. Kwon, M.Y. Lee, J.E. Yuk, S.R. Oh, Y.W. Chin, H.K. Lee, K.S. Ahn, Anti-inflamma-
tory effects of methanol extracts of the root of Lilium lancifolium on LPS-stimulated
raw264.7 cells, J. Ethnopharmacol. 130 (2010) 28–34.
[13] J.M. Kim, H.A. Jung, J.S. Choi, N.G. Lee, Identification of anti-inflammatory target
genes of Rhizoma coptidis extract in lipopolysaccharide-stimulated RAW264.7 mu-
rine macrophage-like cells, J. Ethnopharmacol. 130 (2010) 354–362.