Recognition of the DNA minor groove by pyrrole-imidazole polyamides: Comparison of desmethyl- and N-methylpyrrole

Article abstract of DOI:10.1016/S0968-0896(00)00145-0

Polyamides consisting of N-methylpyrrole (Py), N-methylimidazole (Im), and N-methyl-3-hydroxypyrrole (Hp) are synthetic ligands that recognize predetermined DNA sequences with affinities and specificities comparable to many DNA-binding proteins. As derivatives of the natural products distamycin and netropsin, Py/Im/Hp polyamides have retained the N-methyl substituent, although structural studies of polyamide:DNA complexes have not revealed an obvious function for the N-methyl. In order to assess the role of the N-methyl moiety in polyamide:DNA recognition, a new monomer, desmethylpyrrole (Ds), where the N-methyl moiety has been replaced with hydrogen, was incorporated into an eight-ring hairpin polyamide by solid-phase synthesis. MPE footprinting, affinity cleavage, and quantitative DNase I footprinting revealed that replacement of each Py residue with Ds resulted in identical binding site size and orientation and similar binding affinity for the six-base-pair (bp) target DNA sequence. Remarkably, the Ds-containing polyamide exhibited an 8-fold loss in specificity for the match site versus a mismatched DNA site, relative to the all-Py parent. Polyamides with Ds exhibit increased water solubility, which may alter the cell membrane permeability properties of the polyamide. The addition of Ds to the repertoire of available monomers may prove useful as polyamides are applied to gene regulation in vivo. However, the benefits of Ds incorporation must be balanced with a potential loss in specificity. Copyright (C) 2000 Elsevier Science Ltd.

Full text of DOI:10.1016/S0968-0896(00)00145-0

Bioorganic & Medicinal Chemistry 8 (2000) 1947±1955
Recognition of the DNA Minor Groove by Pyrrole-Imidazole
Polyamides: Comparison of Desmethyl- and N-Methylpyrrole
Ryan E. Bremer, Jason W. Szewczyk, Eldon E. Baird and Peter B. Dervan*
Arnold and Mabel Beckman Laboratories of Chemical Synthesis, California Institute of Technology, Pasadena, CA 91125, USA
Received 14 February 2000; accepted 18 April 2000
AbstractÐPolyamides consisting of N-methylpyrrole (Py), N-methylimidazole (Im), and N-methyl-3-hydroxypyrrole (Hp) are syn-
thetic ligands that recognize predetermined DNA sequences with anities and speci®cities comparable to many DNA-binding
proteins. As derivatives of the natural products distamycin and netropsin, Py/Im/Hp polyamides have retained the N-methyl sub-
stituent, although structural studies of polyamide:DNA complexes have not revealed an obvious function for the N-methyl. In
order to assess the role of the N-methyl moiety in polyamide:DNA recognition, a new monomer, desmethylpyrrole (Ds), where the
N-methyl moiety has been replaced with hydrogen, was incorporated into an eight-ring hairpin polyamide by solid-phase synthesis.
MPE footprinting, anity cleavage, and quantitative DNase I footprinting revealed that replacement of each Py residue with Ds
resulted in identical binding site size and orientation and similar binding anity for the six-base-pair (bp) target DNA sequence.
Remarkably, the Ds-containing polyamide exhibited an 8-fold loss in speci®city for the match site versus a mismatched DNA site,
relative to the all-Py parent. Polyamides with Ds exhibit increased water solubility, which may alter the cell membrane permeability
properties of the polyamide. The addition of Ds to the repertoire of available monomers may prove useful as polyamides are
applied to gene regulation in vivo. However, the bene®ts of Ds incorporation must be balanced with a potential loss in speci®city.
# 2000 Elsevier Science Ltd. All rights reserved.
Introduction
each Watson±Crick base pair with a side-by-side pairing
of the Py, Hp, and Im aromatic amino acids (Fig. 1).16 18
An antiparallel pairing of Im opposite Py (Im/Py pair)
distinguishes Gꢀ C from Cꢀ G and both of these from Aꢀ T
and Tꢀ A base pairs.16,18 21 A Py/Py pair binds both Aꢀ T
and Tꢀ A in preference to Gꢀ C and Cꢀ G.13,14,16,18 20,22,23
The discrimination of Tꢀ A from Aꢀ T using Hp/Py and Py/
Hp pairs, respectively, completes the four base pair (bp)
code.17,24,25 The linker amino acid g-aminobutyric acid
(g) connects the polyamide subunits in a `hairpin motif'
and enhances anity >100-fold relative to the unlinked
dimers.26 29 A C-terminal b-alanine (b) increases both
anity and speci®city and facilitates solid-phase syn-
thesis.27,30 The g and b residues both favor recognition
of Aꢀ T and Tꢀ A base pairs.31 Each polyamide subunit
recognizes the minor groove with a N±C orientation rela-
tive to the 50-30 direction of the DNA helix.21,32 Eight-ring
hairpin polyamides with anities and speci®cities com-
parable to those of DNA-binding proteins have been
shown to permeate a variety of cell types in culture and
speci®cally interfere with gene expression.33 35
Cell-permeable small molecules with the ability to target
predetermined DNA sequences and interfere with gene
expression would be valuable tools in molecular biology
and potentially in human medicine. Recent e€orts in our
laboratories have been inspired by the natural products
netropsin and distamycin, crescent-shaped di- and tripep-
tides composed of N-methylpyrrole (Py) carboxamides
that recognize four or ®ve successive Aꢀ T base pairs.1 8
Distamycin and netropsin normally form 1:1 complexes
in the minor groove of DNA.9 12 However, structural stud-
ies have revealed that at high concentrations distamycin
forms an antiparallel side-by-side dimer tightly packed
into the minor groove, with each monomer making
hydrogen bonds from the backbone amides to the bases
on one DNA strand.13,14 Atomic substitutions to the
N-methylpyrrole sca€old of distamycin have provided
new aromatic amino acids, N-methylimidazole (Im) and
N-methyl-3-hydroxypyrrole (Hp), that allow for the
recognition of predetermined DNA sequences.15 17
A
set of pairing rules have been developed that correlate
Extensive biochemical studies have revealed the incre-
mental contributions to DNA anity and speci®city of
many features of polyamides, most importantly the
e€ects of substitutions at the 3-position of the aromatic
*Corresponding author. Tel.: +1-626-356-6002; fax: +1-626-683-
8753; e-mail: dervan@caltech.edu
0968-0896/00/$ - see front matter # 2000 Elsevier Science Ltd. All rights reserved.
PII: S0968-0896(00)00145-0

1948
R. E. Bremer et al. / Bioorg. Med. Chem. 8 (2000) 1947±1955
rings.16 18,22 However, in every case, the N-methyl sub-
stituent present in the distamycin and netropsin has been
retained. Structural studies do not reveal an obvious role
for the N-methyls in polyamide:DNA recognition, as
they make no DNA contacts and point away from the
minor groove, toward the solvent.20,24,29,36 As natural
products, distamycin and netropsin may have faced
selective pressures based on many factors, including
biosynthesis, solubility, permeability, and DNA anity
and speci®city. It remained to be determined if the
N-methyl is a substituent that can be discarded, or if it
plays an important role in polyamide:DNA recognition,
in particular in the side-by-side pairings. This ques-
tion provided the impetus to examine a desmethyl-
(N-methylpyrrole) ring, that replaces the N-methyl group
of the pyrrole with hydrogen. Desmethyl-(N-methylpyr-
role) should follow the polyamide pairing rules similarly
to N-methylpyrrole. The sequence speci®c elements of Py/
Im/Hp polyamides are the two atoms at the C-3 position
of each ring pair, whilst the N-1 position projects out of
the minor groove and does not make sequence speci®c
DNA contacts. For the sake of a two-letter code, we have
routinely referred to N-methylimidazole and N-methyl-
pyrrole residues as imidazole and pyrrole with the abbre-
viations Im and Py, respectively. Thus, for clarity, the
formal desmethyl-(N-methylpyrrole) residue will be
referred to as desmethylpyrrole and it will be represented
in the two-letter code as Ds.
Distamycin analogues with single desmethylpyrrole
substitutions exhibited enhanced antiviral and cytotoxic
properties relative to distamycin.37,38 It was postulated
that the enhanced activity derived from increased cell
permeability for the desmethylpyrrole analogues.37 The
potential bene®ts of desmethylpyrrole substitutions on
biological activity provided further motivation to examine
the DNA binding energetics of Ds-containing hairpin
polyamides.
Here we report the DNA binding properties of two eight-
ring hairpin polyamides: a control polyamide containing
all Im/Py and Py/Py pairs, ImPyPyPy-g-PyPyPyPy-b-
Dp (1), and a polyamide completely substituted with
Ds, ImDsDsDs-g-DsDsDsDs-b-Dp (2) (Fig. 2). Binding
site size and location were determined by MPE foot-
printing, while anity cleavage revealed binding site
orientation and stoichiometry.4,8,39 Quantitative DNase
I footprint titrations were employed to measure the
Figure 1. (Top) Hydrogen bonding model of ImDsDsDs-g-
DsDsDsDs-b-Dp (2) bound in the minor groove to the 50-TGTTAT-30
match site. Circles with two dots represent the lone pairs of N3 of
purines and O2 of pyrimidines. Circles containing an H represent the
N2 hydrogens of guanines. Putative hydrogen bonds are illustrated by
dotted lines. (Bottom) Model of 2 bound to the 50-TGTTAT-30 match
site (bold). N-Methylimidazole and desmethylpyrrole are represented
by black circles and white circles with a `D' inside, respectively. The g-
turn is shown as a curved line. b-Alanine and Dp are depicted as a
diamond and a plus sign, respectively.
Figure 2. Structures of eight-ring hairpin polyamides ImPyPyPy-g-
PyPyPyPy-b-Dp (1), and ImDsDsDs-g-DsDsDsDs-b-Dp (2), and the
corresponding EDTA-modi®ed derivatives, 1-E and 2-E. Schematics
of each polyamide bound to the 50-TGTTAT-30 match site are depic-
ted as in Figure 1, with an open circle representing N-methylpyrrole.

R. E. Bremer et al. / Bioorg. Med. Chem. 8 (2000) 1947±1955
1949
equilibrium association constants (Ka) of each polyamide
at its match and mismatch sites.40 42 Finally, not only
will the Ds monomer reveal the role of the N-methyl
substituent in polyamide:DNA recognition, but each
incorporation will decrease the polyamide molecular
weight and add a hydrogen bond donor that can interact
with the solvent, potentially increasing polyamide solubil-
ity in water and altering cell permeability, as well.
mass spectroscopy. Polyamide 2 showed a signi®cantly
reduced retention time in reversed phase HPLC (21.9 min),
relative to the all-Py analogue, 1 (28.8 min).
.
Identi®cation of binding sites by MPE Fe(II)
footprinting
0
.
MPE Fe(II) footprinting was performed on the 3 - and
5a-32P end-labeled 279 bp EcoRI/PvuII restriction frag-
ment of pSES4 (Figs 3 and 4).4 On the basis of the poly-
amide pairing rules, the sites 50-TGTTAT-30 and 50-
TGGTAT-30 are for 1 and 2 `match' and `single-base-pair
mismatch' sites, respectively (mismatch underlined).
The footprint cleavage protection patterns of 1 and 2
revealed the polyamides bound the expected match site,
50-TGTTAT-30 (Fig. 5A and B). The location and size
of the 30-shifted footprints is consistent with the eight-
ring polyamides binding as hairpins in the minor groove
to the expected 6 bp target. A MPE cleavage protection
pattern was also observed at the mismatch site, with
what appeared to be a potentially elongated footprint to
the 30-side of the bottom strand. Subsequent anity clea-
vage experiments revealed the signi®cance of this observa-
tion (vide infra). A number of additional footprints on the
restriction fragment corresponding to match sequences
of the form 50-(A,T)G(A,T)4-30 and a single-base-pair
mismatch have been identi®ed, but their MPE foot-
prints were not quantitated, due to the closeness of the
bands in this region of the gel.
Results
Desmethylpyrrole monomer and polyamide synthesis
Analogues of distamycin have been prepared previously
by solution phase methods with a single desmethylpyrrole
substitution using the Boc-Ds-acid (5).37 It remained to
be determined if a hairpin polyamide fully substituted
with desmethylpyrrole in place of each pyrrole residue
could be synthesized by solid-phase protocols.30
Towards this end, we report here a convenient synthesis
of 5 based on the preparation of the N-methylpyrrole
derivative that provides 5 in 25 g scale without column
chromatography (Scheme 1).30 Polyamide 1 has been
previously reported.33 The solid-phase synthesis of des-
methylpyrrole containing polyamides, 2, was performed
on b-Ala-Pam resin using DCC/HOBt activated 5, Boc-
Py-OBt, and Boc-Im-acid, according to previously repor-
ted procedures.30 Cleavage of the resin bound polyamide
by aminolysis with dimethylaminopropylamine (Dp)
a€orded polyamide 2, following reversed phase HPLC
puri®cation. Although the recovery of polyamide 2 was
lower than that generally observed for Py-containing
polyamides, the solid-phase protocols did provide Ds-con-
taining polyamides of equal purity to the Py-containing
polyamides. For the synthesis of anity cleavage analo-
gues with EDTA, the desired polyamides were synthesized
using (R)-2-Fmoc-4-Boc-diaminobutyric acid in place of
Boc-g-aminobutyric acid.32 After aminolysis and reversed
phase HPLC puri®cation, the deprotected 2-amino
group was treated with an excess of EDTA-dianhydride,
and the remaining anhydride hydrolyzed to provide 1-E
and 2-E, following another reversed phase HPLC pur-
i®cation.32 Polyamides were characterized by analytical
reversed phase HPLC, 1H NMR, and MALDI-TOF
Identi®cation of binding orientation and stoichiometry by
anity cleavage
Anity cleavage polyamides, 1-E and 2-E were used to
determine binding orientation and stoichiometry for the
Ds polyamides.8,39 The EDTA Fe(II) moiety of poly-
.
amides 1-E and 2-E was attached via the g-turn. The
lack of a ¯exible linker results in a narrow cleavage
pattern centered on the position of the g-turn. Anity
cleavage titrations were performed on the 30- and 50-32P
end-labeled EcoRI/PvuII restriction fragment of pSES4
(Fig. 4). A single cleavage locus at the 30-side of the 50-
TGTTAT-30 site indicated each polyamide bound the
match site as a monomer in a single orientation (Fig. 5C
and D). The expected cleavage pattern at the 30-side of
the 50-TGGTAT-30 single base pair mismatch site was
also observed for 1-E and 2-E. An unexpected cleavage
locus between the designed match and mismatch sites was
believed to result from the polyamide bound in a reverse
orientation (30±50, N±C) with the g-turn centered on the
Scheme 1. Synthesis of the Boc-Ds-acid monomer (5) for solid-phase
synthesis: (i) trichloroacetyl chloride, ethyl ether; (ii) HNO3 (fuming),
H2SO4, acetic anhyride; (iii) NaH, ethanol; (iv) (a) H2 (1 atm), 10% Pd/
C, DMF; (b) Boc-anhyride, DIEA; (v) 1 M KOH, MeOH, water, 60 ꢁC.
Figure 3. The 279 bp EcoRI/PvuII restriction fragment of pSES4. The
match and single-base-pair mismatch sequences, 50-TGTTAT-30 and
50-TGGTAT-30 (mismatch underlined), respectively, are boxed.

1950
R. E. Bremer et al. / Bioorg. Med. Chem. 8 (2000) 1947±1955
Figure 4. Storage phosphor autoradiograms of MPEꢀ Fe(II) foot-
printing (left)4 and anity cleavage experiments (right)8,39 on the
50-32P end-labeled 279 bp EcoRI/PvuII restriction fragment of pSES4.
Match and single-base-pair mismatch sites (mismatch underlined) are
indicated in the middle. MPEꢀ Fe(II) footprinting (left): lane 1, intact
DNA; lane 2, A reaction; lane 3, G reaction; lane 4, MPEꢀ Fe(II)
standard; lanes 5±9, 10, 100, 200, 500 nM, 1 mM, 1; lanes 10±11, 10,
100 nM, 2. All reactions were performed in a ®nal volume of 400 mL
containing 20 kcpm 50-radiolabeled DNA, 20 mM HEPES (pH 7.3),
200 mM NaCl, 50 mg/mL glycogen, 0.5 mM MPEꢀ Fe(II), and 5 mM
DTT. Linear storage phosphor range 160±1600. Anity cleavage
(right): lane 1, intact DNA; lane 2, A reaction; lane 3, G reaction;
lanes 4±7, 1, 10, 100 nM, 1 mM 1-E; lanes 8±9, 1, 10 nM 2-E. All reac-
tions were performed in a ®nal volume of 400 mL containing 20 kcpm
50-radiolabeled DNA, 20 mM HEPES (pH 7.3), 200 mM NaCl, 50 mg/
mL glycogen, 0.5 mM Fe(II)(NH4)2SO4, and 5 mM DTT. Linear sto-
rage phosphor range 200±2000.
Figure 5. (A-B) MPEꢀ Fe(II) protection patterns with (A) ImPyPyPy-
g-PyPyPyPy-b-Dp (1) (500 nM), and (B) ImDsDsDs-g-DsDsDsDs-b-
Dp (2) (100 nM). Bar heights are proportional to the realvtive protec-
tion from cleavage for each band. (C) and (D) Anity cleavage pat-
terns of (C) ImPyPyPy-g-PyPyPyPy-b-Dp-EDTAꢀ Fe (1-E) 1 mM, and
(D) ImDsDsDs-g-DsDsDsDs-b-Dp-EDTAꢀ Fe (2) (10 nM). Line
heights are proportional to the cleavage intensity of each band. The 6-
bp polyamide binding site 50-TGTTAT-30 and the designed single-
base-pair mismatch 50-TGGTAT-30are shown in bold.
bold T in 50-ATATGG-30. This binding mode is also a
single base pair mismatch according to the pairing rules,
because it places the b-alanine residue over a Cꢀ G base
pair. Binding to the designed mismatch and the reverse
orientation mismatch was observed for both the Py- and
Ds-containing polyamides.
TGTTAT-30 target site with similar anity: 1, 1.2Æ0.4Â
1
1010 M 1; 2, 1.5Æ0.2Â1010
M
(Table 1). The presence
of overlapping binding sites for the designed mismatch and
the reverse orientation mismatch, precludes assignment of
the resulting footprint to a speci®c binding mode. How-
ever, the relative anity of 1 and 2 at this combined mis-
match footprint is revealing. Polyamide 1 demonstrated
>200-fold preference for the match site versus the mis-
match (5.9Æ0.9Â107 M 1). Ds-containing polyamide 2
demonstrated a 25-fold preference for its match site
versus the mismatch (5.9Æ2.3Â108 M 1); an 8-fold loss
in speci®city relative to 1.
Quantitative DNase I footprint titrations
Quantitative DNase I footprint titrations were per-
formed on the 30-32P end-labeled EcoRI/PvuII restriction
fragment of pSES4 (Fig. 6).40 42 Equilibrium association
constants (Ka) for each polyamide bound to the match
and mismatch sites were determined by calculating a
fractional saturation value at both sites for each poly-
amide concentration and ®tting the data to a modi®ed
form of the Hill equation (Fig. 7). Both the Py- and Ds-
containing eight-ring hairpin polyamides bound the 50-
In addition to the designed six-base-pair match (50-
TGTTAT-30) and mismatch (50-TGGTAT-30) sites, there
are other binding sites seen in the MPE footprinting
experiment (Fig. 4), which are distal to the 32P label: a
match site, 50-TGATTA-30, two contiguous match sites,

R. E. Bremer et al. / Bioorg. Med. Chem. 8 (2000) 1947±1955
1951
Figure 6. Storage phosphor autoradiograms of quantitative DNase I footprint titration experiments40 42 with (A) ImPyPyPy-g-PyPyPyPy-b-Dp (1)
and (B) ImDsDsDs-g-DsDsDsDs-b-Dp (2), on the 30-32P-end-labeled 279 bp EcoRI/PvuII restriction fragment from pSES4. All reactions contained
20 kcpm restriction fragment, 10 mM Tris±HCl (pH 7.0), 10 mM KCl, 10 mM MgCl2 and 5 mM CaCl2 and were performed at 22 ꢁC. Lane 1, intact
DNA; lane 2, A-speci®c reaction; lane 3, G-speci®c reaction; lane 4, DNase I standard; lanes 5±20, 1, 2, 5, 10, 15, 25, 40, 65, 100, 150, 250, 400,
650 pM, 1, 2, 5 nM, respectively of 1 or 2. Footprinting gels of 1 contained the additional lanes 21±24 of 10, 20, 50, 100 nM, respectively. the posi-
tions of the match and mismatch sequences are indicated. The designed match (50-TGTTAT) and single base pair mismatch (50-TGGTAT-30) mis-
match sites are in bold. The overlapping reverse orientation mismatch site observed by anity cleavage (50ATATGG-30) is also labeled. Linear
storage phosphor ranges for A and B were 30±500 and 80±1000, respectively.
50-TGAAATGTTAT-30, and a single-base-pair mismatch
site, 50-TGTTTC-30. We were able to quantitate binding
of 1 and 2 to 50-TGATTA-30 and 50-TGAAATGTTAT-30
by DNase I footprinting at the concentration ranges used
here and for the sake of completeness, their equilibrium
association constants are reported (Table 2).
Discussion
In the reported syntheses of desmethylpyrrole analogues
of distamycin, the N-1 position proved reactive under
the coupling conditions, resulting in side reactions and
lowering the yield of the desired product.37 The solid-
phase synthesis of Ds-containing polyamides also su€ered
Figure 7. Data from the quantitative DNase I footprint titration
from lower recoveries than the Py-containing analogues,
experiments for ImPyPyPy-g-PyPyPyPy-b-Dp (1), and ImDsDsDs-g-
suggesting that future application of Ds may require
DsDsDsDs-b-Dp (2) bound to the match and mismatch sites. The
protection of the N-1 position.
ꢀnorm points were obtained using photostimulable storage phosphor
autoradiography and processed as described in the experimental
section. The data for the binding of 1 to the match and mismatch
is indicated by ®lled and un®lled circles, respectively. The data for
the binding of 2 to the match and mismatch is indicated by ®lled
carboxamide with hydrogen had little e€ect on poly-
and un®lled triangles, respectively. The solid curves are the best-®t
MPEꢀ Fe(II) footprinting and anity cleavage studies
revealed that replacement of the N-methyl of the pyrrole
amide binding site size, orientation or stoichiometry at
the 6-bp target site. The footprint protection patterns
binding titration isotherms obtained from nonlinear least squares
algorithm.27

1952
R. E. Bremer et al. / Bioorg. Med. Chem. 8 (2000) 1947±1955
1 a
Table 1. Equilibrium association constants (M
Polyamide
)
the polyamide's DNA binding anity to the target site.
Polyamide 2 bound the target site with similar anity to
1, revealing the N-methyl group is not necessary for
subnanomolar binding by hairpin polyamides. How-
ever, removal of the N-methyl substituents resulted in
an 8-fold loss in speci®city for 2, relative to 1. The over-
lapping binding modes at the mismatch site precludes the
development of a model based on the structure of the
polyamide:DNA complex to account for the higher
anity at the mismatch site exhibited by Ds-containing
polyamides. However, in the DNase I footprint titrations,
the mismatch footprint clearly appears at approximately
10-fold lower polyamide concentrations for 2 than 1.
The anity cleavage results strongly suggest that this
DNase I footprint arises from a combination of both
mismatch binding modes.
Matchb Mismatchc Speci®cityd
ImPyPyPy-g-PyPyPyPy-b-Dp (1) 1.2Â1010 5.9Â107
ImDsDsDs-g-DsDsDsDs-b-Dp (2) 1.5Â1010 5.9Â108
203
25
aValues reported are the mean values obtained from three DNase I foot-
print titration experiments. The assays were carried out at 22 ꢁC, 10 mM
Tris±HCl (pH 7.0), 10 mM KCl, 10 mM MgCl2, and 5 mM CaCl2.
bThe `match' anity is for the polyamide binding the 50-TGTTAT-30
target site.
cThe `mismatch' anity is derived from the footprint arising from the
binding of the overlapping reverse orientation and single base pair
mismatch sites (see text).
dSpeci®city is de®ned as Ka(match)/Ka(mismatch).
1 a
Table 2. Equilibrium association constants (M
)
Polyamide
50-caTGATT- 50-tgTGAAAT-
Acg-30 GTTATcc-30
It was unexpected that incorporation of Ds would result
in di€erential polyamide±DNA interactions at the
match and mismatch sites. Further studies, including
structural studies of Ds-containing polyamides bound to
match and mismatch sites, will be necessary to elucidate
the basis for the decrease in speci®city upon Ds-intro-
duction. The N-methyl moiety in the ring±ring pairs
may be necessary to keep the pyrrole rings set deeply in
the minor groove. In the absence of the N-methyl, the
energetic penalty may be decreased for the exocyclic
amine of guanine pushing the ring away from the DNA;
allowing for an increased tolerance of Gꢀ C base pairs.
The N-methyl may also play a role in aligning the side-
by-side register of the ring pairings. Furthermore, it may
be possible for some or all of the Ds carboxamides to
rotate about the amide backbone and place the N-1
toward the ¯oor of the minor groove. The implications
on speci®city of such a structural alteration at the poly-
amide:DNA interface may be signi®cant.
ImPyPyPy-g-PyPyPyPy-b-Dp (1)
1.7 (Æ0.2)Â109 2.2 (Æ0.1)Â109
ImDsDsDs-g-DsDsDsDs-b-Dp (2) 3.3 (Æ1.1)Â109 6.7 (Æ1.6)Â109
aValues reported are the mean values obtained from three DNase I foot-
print titration experiments. The assays were carried out at 22 ꢁC, 10 mM
Tris±HCl (pH 7.0), 10 mM KCl, 10 mM MgCl2, and 5 mM CaCl2.
and cleavage loci at the match site were consistent with
1:1 polyamide:DNA complexes bound as hairpins in the
minor groove. The expected anity cleavage pattern
was also observed at the 30-side of the designed single
base pair mismatch site. Anity cleavage revealed the
polyamide exhibited an additional unexpected binding
mode assigned as reverse orientation (30±50, N±C) binding
to 50-ATATGG-30. The MPE footprints of 1 and 2 at
the mismatch site are consistent with polyamide binding
primarily at the designed mismatch site, 50-TGGTAT-30,
with only a slightly expanded footprint on the bottom
strand perhaps resulting from polyamide binding to the
reverse orientation site. Polyamides have demonstrated
>10-fold preference for binding with the polyamide
oriented N±C along the 50±30 direction of the targeted
DNA strand.21 Furthermore, this orientation preference
would be expected to be enhanced by the R-enantiomer
of the anity cleavage analogues (1-E and 2-E), which
would direct the bulky EDTA moiety into the ¯oor of
the minor groove if the polyamide bound in the reverse
orientation.32 Thus, it was surprising that 1-E and 2-E
bound both the designed mismatch and the reverse
orientation mismatch with similar relative anities, as
revealed by anity cleavage. It is important to note that
the incorporation of Ds resulted in enhanced binding rela-
tive to 1 for both of these mismatch modes, as evidenced by
cleavage at both mismatch sites at lower concentration
for 2 (10 nM) than 1 (1 mM) (Fig. 4). In other words, the
removal of the N-methyl substituent does not result in a
loss of speci®city versus one mismatch binding mode,
but rather versus both mismatches observed here.
Conclusions
The introduction of desmethylpyrrole into the hairpin
polyamide motif has provided insight into the role of the
N-methyl substituent in polyamide:DNA recognition.
While the N-methyl is not necessary for subnanomolar
binding by hairpin polyamides, it is clearly important
for attaining optimal target site speci®city. It is now
becoming clear that a complete understanding of poly-
amide:DNA recognition will require not only structural
studies of a variety of polyamides bound to their DNA
targets, but of equal importance will be an analysis of
the structural basis of speci®city achieved by analyzing
structures of polyamides bound to mismatch DNA sites.
Current e€orts to develop larger polyamides that bind
longer sequences may face diculty with issues of solu-
bility and cell permeability. Desmethylpyrrole contain-
ing polyamides exhibit higher solubility than their
N-methylpyrrole analogues and may potentially alter
polyamide cell permeability, making them useful alter-
natives in the design of second-generation polyamides
to recognize larger binding sites for genomic applica-
tions. In the future, the bene®ts of each incorporation of
Ds must be balanced with the potential loss in sequence
speci®city.
As expected, polyamide 1 bound the 50-TGTTAT-30 site
with subnanomolar anity and excellent speci®city.
Remarkably, replacing all of the N-methylpyrroles with
desmethylpyrrole in 2 did not have a signi®cant e€ect on

R. E. Bremer et al. / Bioorg. Med. Chem. 8 (2000) 1947±1955
1953
Experimental
1.42 (s, 9H), 1.24 (t, 3H, J=7.1 Hz); FABMS m/e
(254.1266 calcd for C12H18N2O4).
All synthetic reagents were as previously described.30
Analytical HPLC was performed on a Beckman Gold
Nouveau system with a model 126 pump and model 168
diode array detector. A Rainen C18, Microsorb MV,
5 mm, 300Â4.6 mm reverse phase column was employed
with 0.1% (w/v) TFA:H2O and 1.5% acetonitrile/min.
Preparatory HPLC was performed on a Hamilton PRP-1
reversed phase C18, 250Â21.5 mm, 12±20 mm column
with 0.5% (w/v) acetic acid and 0.56%/min acetonitrile
unless otherwise noted. Resin substitution of synthe-
4-[(tert-Butoxycarbonyl)amino]pyrrole-2 carboxylic acid
(5). Ethyl 4-[(tert-butoxycarbonyl)amino]pyrrole-2car-
boxylate (31.0 g, 122 mmol) was dissolved in ethanol
(124mL); 1 M KOH (620mL) was added and the solution
heated at 65 ꢁC for 4 h. The solution was cooled to room
temperature and the ethanol removed in vacuo. The
solution was diluted with water (800 mL) and extracted
with diethyl ether. The pH of the aqueous layer was
reduced to ca. 3 with 10% (v/v) H2SO4 and the mixture
extracted with diethyl ether. The combined ether extracts
were dried (MgSO4) and concentrated in vacuo to pro-
sized polyamides was calculated as Lnew(mmol/g)=Lold
/
(1+Lold(Wnew Wold)Â10 3) where L is the loading
(mmol of amine per g of resin) and W is the weight (g
mol 1) of the growing peptide attached to the resin.30
DNA restriction fragment labeling, DNase I footprinting,
and determination of equilibrium association constants
were accomplished using previously described proto-
cols.41,42 Chemical sequencing reactions were performed
according to published methods.43,44 Plasmid pSES4
was previously prepared by S. Swalley using reported
procedures with the following inserts: 50-GATCGGC-
TACGCGCTATGTTATGTGCCGCATATGGTATG
TGCCGCATATGGGATGTGCGCCATATGGGGT
GTGCCG-30 and 50-AGCTCGGCACACCCCATATG
GCGCACATCCCATATGCGGCACATACCATATG
CGGCACATAACATAGCGCGTAGCC.31,42
1
vide a white powder (25.6 g, 113 mmol, 93% yield): H
NMR (DMSO-d6) d 12.17 (s, 1H), 11.34 (s, 1H), 9.03 (s,
1H), 6.90 (s, 1H), 6.53 (s, 1H), 1.42 (s, 9H); FABMS m/
e 249.0841 (M+Na 249.0851 calcd for C10H14N2NaO4).
Polyamide synthesis
ImDsDsDs-ꢀ-DsDsDsDs-ꢁ-Dp (2). ImDsDsDs-g-DsDs
DsDs-b-PAM-resin was synthesized in a stepwise fashion
by manual solid-phase methods from Boc-b-PAM-resin
(600 mg, 0.75 mmol/g).30 A sample of polyamide resin
(217 mg, 0.46 mmol/g) was cleaved with dimethylamino-
propylamine (2 mL, 55 ꢁC, 18 h). The crude polyamide
was diluted to 8 mL with 0.1% (w/v) TFA then puri®ed
by reverse phase HPLC using a Waters DeltaPak 25Â
100 mm 100 mM C18 column in 0.1% (w/v) TFA, gra-
dient elution 0.25%/min. CH3CN. ImDsDsDs-g-DsDs-
DsDs-b-Dp was recovered upon lyophilization of the
appropriate fractions as a white powder (1.7 mg,
1.5 mmol, 1.5% recovery); UV (H20) lmax 312 (66,000);
Monomer synthesis
Ethyl 4-nitropyrrole-2-carboxylate (3). 2-(trichloroacetyl)
pyrrole was available in kg quantities by scaling the lit-
erature procedure.45 Nitration of 2-(trichloroacetyl) pyr-
role was accomplished using the previously reported
procedure for 1-methyl-2-(trichloroacetyl)pyrrole with
minor alterations.30 The addition of nitric acid was per-
formed at 20ꢁC and the reaction was quenched with
water. Esteri®cation of the 2-(trichloroacetyl)-4-nitro-
pyrrole was accomplished using the procedure reported
for the N-methyl analogue without re¯ux.30 The solid
isolated after precipitation with water was recrystalized
from ethyl acetate:hexanes:methanol to provide a light tan
powder (551g, 3.0 mol, 22% yield from pyrrole): 1H
NMR (DMSO-d6) d 13.13 (s, 1H), 8.01 (d, 1H, J=
1.5 Hz), 7.20 (d, 1H, J=1.9 Hz), 4.25 (q, 2H, J=7.2Hz),
1.27 (t, 3H, J=7.2 Hz); EIMS m/e 184.0482 (184.0484
calcd for C7H8N2O4).
1
analytical reverse phase HPLC rt=21.9 min; H NMR
(DMSO-d6): d 11.28 (s, 1H), 11.20 (s, 4H), 11.11 (s, 2H),
10.42 (s, 1H), 9.93 (s, 2H), 9.88 (s, 3H), 9.82 (s, 1H), 9.2
(br s, 1H), 8.04 (m, 3H), 7.35 (s, 1H), 7.23 (s, 1H), 7.17
(s, 3H), 7.14 (s, 1H), 7.13 (s, 1H), 7.06 (s, 1H), 7.04 (s,
1H), 7.02 (s, 2H), 7.01 (s, 2H), 6.90 (s, 1H), 6.83 (s, 1H),
6.81 (s, 1H), 3.95 (s, 3H), 3.61 (m, 2H), 3.19 (m, 2H), 3.06
(quartet, 2H, J=5.8 Hz), 2.93 (quintet, 2H, J=4.6 Hz),
2.68 (d, 6H, J=4.6 Hz), 2.2 (br m, 4H), 1.92 (m, 2H), 1.7
(br m, 2H); MALDI-TOF-MS (monoisotopic) [M+H]
1123.6, 1123.5 calcd for C52H59N20O+10.
ImDsDsDs-(R)EDTAꢀ-DsDsDsDs-ꢁ-Dp (2-E). ImDsDs
Ds-(R)NH2g-DsDsDsDs-b-PAM-resin was synthesized in
a stepwise fashion by manual solid-phase methods from
Boc-b-PAM-resin (600mg, 0.75mmol/g).30 A sample of
polyamide resin (215 mg, 0.46 mmol/g) was cleaved with
dimethylaminopropylamine (2 mL, 55 ꢁC, 18 h). The
crude polyamide was diluted to 8 mL with 0.1% (w/v)
TFA then puri®ed by reverse phase HPLC using a
Waters DeltaPak 25Â100 mm 100 mM C18 column in
0.1% (w/v) TFA, gradient elution 0.25%/min. CH3CN.
ImDsDsDs-(R)NH2g-DsDsDsDs-b-Dp was recovered
upon lyophilization of the appropriate fractions as a
white powder (2.1 mg, 1.9 mmol, 1.9% recovery); UV
Ethyl 4-[(tert-butoxycarbonyl)amino]pyrrole-2carboxylate
(4). Ethyl 4-nitropyrrole-2-carboxylate (128 g, 0.75 mol)
was dissolved in DMF (640 mL) and 23 g of 10% Pd/C
added. The mixture was stirred under H2 (50 psi) for 2 h.
The Pd/C was removed by ®ltration through Celite, fol-
lowed by washing with DMF (100 mL). Di-tert-butyl
dicarbonate (164 g, 0.75 mol) and triethylamine (315 mL,
2.26 mol) was added and stirred for 1.25 h. The mixture
was poured into 1 L of water and extracted with diethyl
ether. The ether was passed over solid sodium bicarbo-
nate, decanted, dried (MgSO4) and concentrated to in
vacuo to provide a white solid (125 g, 0.49 mol, 65%
1
(H2O) lmax 312 (66,000); H NMR (DMSO-d6): d 11.42
(s, 1H), 11.20 (m, 5H), 11.11 (s, 1H), 10.60 (s, 1H), 10.41
(s, 1H), 9.95 (s, 1H), 9.92 (s, 3H), 9.87 (s, 1H), 9.2 (br s,
1H), 8.27 (m, 2H), 8.04 (m, 1H), 7.35 (s, 1H), 7.23 (s,
1
yield): H NMR (DMSO-d6) d 11.50 (s, 1H), 9.08 (s,
1H), 6.96 (s, 1H), 6.59 (s, 1H), 4.18 (q, 2H, J=7.2 Hz),

1954
R. E. Bremer et al. / Bioorg. Med. Chem. 8 (2000) 1947±1955
1H), 7.17 (s, 4H), 7.12 (s, 1H), 7.02 (m, 6H), 6.95 (s, 1H),
6.90 (s, 1H), 6.82 (s, 1H), 3.95 (s, 3H), 3.31 (m, 2H), 3.20
(s, 2H), 3.06 (quartet, 2H, J=5.6 Hz), 2.93 (quintet, 2H,
J=4.9 Hz), 2.69 (d, 6H, J=4.5 Hz), 2.2 (br m, 4H), 1.95
(m, 2H), 1.64 (m, 2H); MALDI-TOF-MS (monoiso-
topic) [M+H] 1138.5, 1138.5 calcd for C52H60N21 O+10.
ImDsDsDs-(R)NH2g-DsDsDsDs-b-Dp (700 nmol) was
functionalized with EDTA as described32 (68 nmol, 9.7%
recovery) MALDI-TOF-MS (monoisotopic) [M+ H]
1412.7, 1412.6 calcd for C62H74N23O+17.
Bristol-Myers Squibb and the Ralph M. Parsons Foun-
dation for predoctoral fellowships to R.E.B., the Howard
Hughes Medical Institute for a predoctoral fellowship to
E.E.B., and the National Institutes of Health for a
research service award to J.W.S.
References and Notes
1. Arcamone, F.; Penco, S.; Prezzi, P. G.; Nicolella, V.; Pirelli,
A. Nature 1964, 203, 1064.
2. Zasedatelev, A. S.; Gursky, G. V.; Zimmer, C.; Thrum, H.
Mol. Biol. Rep 1974, 1, 337.
3. Krylov, A. S.; Grokhovsky, S. L.; Zasedatelev, A. S.;
Zhuze, A. L.; Gursky, G. V.; Gottikh, B. P. Nucleic Acids Res.
1979, 6, 289.
4. Van Dyke, M. W.; Hertzberg, R. P.; Dervan, P. B. Proc.
Natl. Acad. Sci. USA 1982, 79, 5470.
5. Van Dyke, M. W.; Dervan, P. B. Nucleic Acids Res. 1983,
11, 5555.
6. Fox, K. R.; Waring, M. J. Nucleic Acids Res. 1984, 12, 9271.
7. Schultz, P. G.; Taylor, J. S.; Dervan, P. B. J. Am. Chem.
Soc. 1982, 104, 6861.
8. Dervan, P. B. Science 1986, 232, 464.
9. Kopka, M. L.; Yoon, C.; Goodsell, D.; Pjura, P.; Dick-
erson, R. E. J. Mol. Biol. 1985, 183, 553.
10. Coll, M.; Frederick, C. A.; Wang, A. H. J.; Rich, A. Proc.
Natl. Acad. Sci. USA 1987, 84, 8385.
11. Klevit, R. E.; Wemmer, D. E.; Reid, B. R. Biochemistry
1986, 25, 3296.
12. Pelton, J. G.; Wemmer, D. E. Biochemistry 1988, 27, 8088.
13. Pelton, J. G.; Wemmer, D. E. Proc. Natl. Acad. Sci. USA
1989, 86, 5723.
14. Chen, X.; Ramakrishnan, B.; Rao, S. T.; Sundaralingam,
M. Nat. Struct. Biol. 1994, 1, 169.
15. Dervan, P. B.; Burli, R. W. Curr. Opin. Chem. Biol. 1999,
3, 688.
16. Wade, W. S.; Mrksich, M.; Dervan, P. B. J. Am. Chem.
Soc. 1992, 114, 8783.
ImPyPyPy-(R)EDTAꢀ-PyPyPyPy-ꢁ-Dp (1-E). ImPyPy
Py-(R)NH2g-PyPyPyPy-b-PAM-resin was synthesized in
a stepwise fashion by manual solid-phase methods from
Boc-b-PAM-resin (600 mg, 0.75 mmol/g).30 A sample of
polyamide resin (350mg, 0.44mmol/g) was cleaved with
dimethylaminopropylamine (2 mL, 55ꢁC, 18h). The crude
polyamide was diluted to 8 mL with 0.1% (w/v) TFA then
puri®ed by reverse phase HPLC. ImPyPyPy-(R)NH2g-
PyPyPyPy-b-Dp was recovered upon lyophilization of
the appropriate fractions as a white powder (25.3 mg,
20.5 mmol, 13.3% recovery); UV (H2O) lmax 312
1
(66,000); H NMR (DMSO-d6): d 10.40 (s, 1H), 9.93 (s,
1H), 9.92 (s, 1H), 9.89 (s, 2H), 9.87 (s, 2H), 9.75 (br s,
1H), 8.05 (m, 1H), 7.97 (m, 1H), 7.84 (t, 1H, J=5.4 Hz),
7.35 (s, 1H), 7.24 (d, 1H, J=0.9 Hz), 7.20 (s, 2H), 7.16
(s, 1H), 7.14 (s, 2H), 7.12 (m, 2H), 7.01 (s, 2H), 6.99 (s,
2H), 6.92 (s, 1H), 6.83 (s, 1H), 6.78 (s, 1H), 3.94 (s, 3H),
3.80 (s, 12H), 3.75 (m, 9H), 3.23 (m, 5H), 3.00 (m, 2H),
2.23 (m, 2H), 2.16 (m, 2H), 2.04 (m, 2H), 2.03 (s, 6H),
1.42 (m, 2H); MALDI-TOF-MS (monoisotopic) [M+H]
1236.7, 1236.6 calc'd for C59H74N21O+10. ImPyPyPy-
(R)NH2g-PyPyPyPy-b-Dp (6.4 mg, 5.2 mmol) was func-
tionalized with EDTA as described32 (3.5 mg, 2.3 mmol,
43% recovery) MALDI-TOF-MS (monoisotopic) [M+
H] 1510.9, 1510.7 calcd for C69H88N23O+17.
17. White, S.; Szewczyk, J. W.; Turner, J. M.; Baird, E. E.;
Dervan, P. B. Nature 1998, 391, 468.
18. White, S.; Baird, E. E.; Dervan, P. B. Chem. Biol. 1997, 4,
569.
19. Mrksich, M.; Wade, W. S.; Dwyer, T. J.; Geierstanger, B.
H.; Wemmer, D. E.; Dervan, P. B. Proc. Natl. Acad. Sci. USA
1992, 89, 7586.
20. Kielkopf, C. L.; Baird, E. E.; Dervan, P. D.; Rees, D. C.
Nat. Struct. Biol. 1998, 5, 104.
21. White, S.; Baird, E. E.; Dervan, P. B. J. Am. Chem. Soc.
1997, 119, 8756.
22. Pilch, D. S.; Poklar, N.; Baird, E. E.; Dervan, P. B.; Bres-
lauer, K. J. Biochemistry 1999, 38, 2143.
23. Pelton, J. G.; Wemmer, D. E. J. Am. Chem. Soc. 1990,
112, 1393.
24. Kielkopf, C. L.; White, S.; Szewczyk, J. W.; Turner, J. M.;
Baird, E. E.; Dervan, P. B.; Rees, D. C. Science 1998, 282, 111.
25. Urbach, A. R.; Szewczyk, J. W.; White, S.; Turner, J. M.;
Baird, E. E.; Dervan, P. B. J. Am. Chem. Soc. 1999, 121, 11621.
26. Mrksich, M.; Parks, M. E.; Dervan, P. B. J. Am. Chem.
Soc. 1994, 116, 7983.
MPE footprinting and anity cleavage
All reactions were carried out in a ®nal volume of 400 mL.
A polyamide stock solution (or water for reference lanes)
was added to an assay bu€er where the ®nal solution
conditions were as follows: 20 mM HEPES (pH 7.3),
200 mM NaCl, 50 mg/mL glycogen and 20 kcpm 30- or
50-end-labeled EcoRI/PvuII fragment of pSES4. The
reactions were equilibrated for 16h at 22 ꢁC. For MPE
footprinting, MPEꢀ Fe(II) was added to a ®nal concentra-
tion of 0.5 mM and equilibrated for 5 min.4 For anity
cleavage experiments, Fe(NH4)2(SO4)2 was added to a
®nal concentration of 0.5 mM and equilibrated for
20min.8,39 Cleavage was initiated by the addition of DTT
to a ®nal concentration of 5 mM and allowed to proceed
for 30min. Reactions were terminated with ethanol (1 mL)
and 10mL of a precipitation bu€er (2.8mg/mL glycogen,
140 mM bp calf thymus DNA). The labeled DNA was
precipitated and analyzed on a 8% denaturing poly-
acrylamide gel as described for DNase I footprinting.41,42
27. Parks, M. E.; Baird, E. E.; Dervan, P. B. J. Am. Chem.
Soc. 1996, 118, 6147.
28. Pilch, D. S.; Poklar, N.; Gelfand, C. A.; Law, S. M.; Bres-
lauer, K. J.; Baird, E. E.; Dervan, P. B. Proc. Natl. Acad. Sci.
U.S.A. 1996, 93, 8306.
Acknowledgements
29. deClairac, R. P. L.; Geierstanger, B. H.; Mrksich, M.; Der-
van, P. B.; Wemmer, D. E. J. Am. Chem. Soc. 1997, 119, 7909.
30. Baird, E. E.; Dervan, P. B. J. Am. Chem. Soc. 1996, 118,
6141.
We are grateful to the National Institutes of Health for
research support, the National Science Foundation,

R. E. Bremer et al. / Bioorg. Med. Chem. 8 (2000) 1947±1955
1955
31. Swalley, S. E.; Baird, E. E.; Dervan, P. B. J. Am. Chem.
Soc. 1999, 121, 1113.
38. Grehn, L.; Ragnarsson, U.; Datema, R. Acta Chem.
Scand. B 1986, 40, 145.
32. Herman, D. M.; Baird, E. E.; Dervan, P. B. J. Am. Chem.
Soc. 1998, 120, 1382.
39. Taylor, J. S.; Schultz, P. G.; Dervan, P. B. Tetrahedron
1984, 40, 457.
33. Trauger, J. W.; Baird, E. E.; Dervan, P. B. Nature 1996,
382, 559.
40. Brenowitz, M.; Senear, D. F.; Shea, M. A.; Ackers, G. K.
Methods Enzymol. 1986, 130, 132.
34. Gottesfeld, J. M.; Neely, L.; Trauger, J. W.; Baird, E. E.;
Dervan, P. B. Nature 1997, 387, 202.
41. Turner, J. M.; Baird, E. E.; Dervan, P. B. J. Am. Chem.
Soc. 1997, 119, 7636.
35. Dickinson, L. A.; Gulizia, R. J.; Trauger, J. W.; Baird, E.
E.; Mosier, D. E.; Gottesfeld, J. M.; Dervan, P. B. Proc. Natl.
Acad. Sci. USA 1998, 95, 12890.
36. deClairac, R. P. L.; Seel, C. J.; Geierstanger, B. H.;
Mrksich, M.; Baird, E. E.; Dervan, P. B.; Wemmer, D. E. J.
Am. Chem. Soc. 1999, 121, 2956.
42. Swalley, S. E.; Baird, E. E.; Dervan, P. B. Chem. Ð Eur.
J. 1997, 3, 1600.
43. Iverson, B. L.; Dervan, P. B. Nucleic Acids Res. 1987, 15,
7823.
44. Maxam, A. M.; Gilbert, W. S. Methods Enzymol. 1980,
65, 499.
37. Grehn, L.; Ragnarsson, U.; Eriksson, B.; Oberg, B. J.
Med. Chem. 1983, 26, 1042.
45. Bailey, D. M.; Johnson, R. E.; Albertson, N. F. Org.
Synth 1988, 50, 618.