Structure-guided design and development of novel benzimidazole class of compounds targeting DNA gyraseB enzyme of Staphylococcus aureus

Article abstract of DOI:10.1016/j.bmc.2014.09.008

The gyraseB subunit of Staphylococcus aureus DNA gyrase is a well-established and validated target though less explored for the development of novel antimicrobial agents. Starting from the available structural information in PDB (3TTZ), we identified a novel series of benzimidazole used as inhibitors of DNA gyraseB with low micromolar inhibitory activity by employing structure-based drug design strategy. Subsequently, this chemical class of DNA gyrase inhibitors was extensively investigated biologically through in vitro assays, biofilm inhibition assays, cytotoxicity, and in vivo studies. The binding affinity of the most potent inhibitor 10 was further ascertained biophysically through differential scanning fluorimetry. Further, the most potent analogues did not show any signs of cardiotoxicity in Zebra fish ether-a-go-go-related gene (zERG), a major breakthrough among the previously reported cardiotoxic gyraseB inhibitors.

Full text of DOI:10.1016/j.bmc.2014.09.008

Bioorganic & Medicinal Chemistry xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Structure-guided design and development of novel benzimidazole
class of compounds targeting DNA gyraseB enzyme of Staphylococcus
aureus
Renuka Janupally a, Variam Ullas Jeankumar a, Karyakulam Andrews Bobesh a, Vijay Soni a,
Parthiban Brindha Devi a, Venkat Koushik Pulla a, Priyanka Suryadevara a,
Keerthana Sharma Chennubhotla b, Pushkar Kulkarni b,c, Perumal Yogeeswari a, Dharmarajan Sriram a,
⇑
a Department of Pharmacy, Birla Institute of Technology & Science-Pilani, Hyderabad Campus, Shameerpet, Jawahar Nagar, Ranga Reddy District, Hyderabad 500078,
Andhra Pradesh, India
b Dr. Reddy’s Institute of Life Sciences, University of Hyderabad Campus, Gachibowli, Hyderabad 500046, India
c Zephase Therapeutics (An Incubated Company at the Dr. Reddy’s Institute of Life Sciences), University of Hyderabad Campus, Gachibowli, Hyderabad 500046, India
a r t i c l e i n f o
a b s t r a c t
Article history:
The gyraseB subunit of Staphylococcus aureus DNA gyrase is a well-established and validated target
though less explored for the development of novel antimicrobial agents. Starting from the available struc-
tural information in PDB (3TTZ), we identified a novel series of benzimidazole used as inhibitors of DNA
gyraseB with low micromolar inhibitory activity by employing structure-based drug design strategy. Sub-
sequently, this chemical class of DNA gyrase inhibitors was extensively investigated biologically through
in vitro assays, biofilm inhibition assays, cytotoxicity, and in vivo studies. The binding affinity of the most
potent inhibitor 10 was further ascertained biophysically through differential scanning fluorimetry. Fur-
ther, the most potent analogues did not show any signs of cardiotoxicity in Zebra fish ether-a-go-go-
related gene (zERG), a major breakthrough among the previously reported cardiotoxic gyraseB inhibitors.
Ó 2014 Elsevier Ltd. All rights reserved.
Received 7 July 2014
Revised 3 September 2014
Accepted 5 September 2014
Available online xxxx
Keywords:
DNA gyraseB
Antibacterial activity
hERG inhibition
Biofilm
Cytotoxicity
1. Introduction
mechanisms like broad spectra of efficacy, reduced toxicity and
improved ADME properties, could help in evading the existing bac-
The Gram-positive bacterium Staphylococcus aureus was a nor-
mal flora, inhabiting 30% of human population, had emerged to
the status of causative agent of many infections globally and was
found to be a major cause of morbidity and mortality in commu-
nity-associated environments and hospital settings.1,2 According
to the statistics, a gradual evolution of methicillin resistant strain
of S. aureus (MRSA) seem to be a global threat accounting for about
50% death worldwide.3 The available therapies no longer found
effective in treating the infections due to increased antibiotic resis-
tance, while the other failure for developing therapeutics to treat
this gram-positive bacterial infections is due to the formation of
biofilm compounded by the existence of multiple biofilm mecha-
nisms in S. aureus and high resistant MRSA.4,5 By implementing
certain unique strategies like identifying novel therapeutic agents,
that can inhibit the known drug targets through a unique binding
site and also by following different strategy in drug inhibition
terial resistance without side effects.6,7
DNA gyrase could be one such attractive target which possess
the above features and could aid in developing antibacterial agents
against the infectious organism.8 Gyrase belongs to type II topoiso-
merase class from the GHKL (gyrase, HSP 90, histidine kinase,
MutL) enzyme family that plays an important role in maintaining
the DNA topology.7 The main role of the enzyme is to introduce
negative supercoils through ATP hydrolysis in the process of repli-
cation, unlike other topoisomerases, makes it a unique target in
drug discovery.9 It is a heterodimeric enzyme with A2B2 complex,
the A subunit aid in breakage and reunion of the double stranded
DNA, while the B subunit act through ATPase function, providing
sufficient amount of energy for the DNA supercoiling.10 Not many
drugs acting through DNA gyrase are reported till date except
6-fluoroquinolone chemical class of molecules. These are the only
DNA gyrase inhibitors approved and available for clinical practice.7
The strategy of inhibition by the quinolones involves binding to the
ternary complex formed between the DNA molecule and the DNA
gyraseA subunit, subsequently stabilizing the complex. As a whole
⇑
Corresponding author. Tel.: +91 40663030506; fax: +91 4066303998.
E-mail address: dsriram@hyderabad.bits-pilani.ac.in (D. Sriram).
http://dx.doi.org/10.1016/j.bmc.2014.09.008
0968-0896/Ó 2014 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

2
R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
this ternary complex helps in preventing the reunion of both the
DNA strands and ultimately stopping the bacterial replication
cycle. Fluoroquinolones have significant utility in the treatment
of respiratory and urinary infections; however, the occurrence of
some serious side effects calls for novel research in this field.11
The other drawback of this chemical class is, they are more potent
against the gram-negative bacteria when compared with gram-
positive ones due to the presence of another homologous target
topoisomerase IV.12 In order to overcome these hindrances, we
took efforts to explore on a less targeted side of DNA gyrase. That
is the DNA gyraseB which is an ATP binding subunit, clinically very
important as it holds the catalytic domain unlike the gyraseA sub-
unit.13 There are several natural and synthetic classes designed to
inhibit gyraseB and were evaluated biologically, but none have
come up to the final stages of clinical trials; though novobiocin
being the only one released into the market in 1960s, was later
withdrawn due to its toxicity and permeability issues.14,15 Other
reported gyraseB inhibitors include coumarins,16 cyclothiali-
dines,17 pyrazolthiazoles18 and pyrrolamides6 classes which were
rather unsuccessful due to their permeability parameters and their
in vivo antibacterial activity. In the present study, we attempted
development of a novel class of S. aureus DNA gyraseB inhibitors
employing energy-optimized structure based pharmacophore (e-
pharmacophore) as a query in database searching. The identified
hits were procured and subjected to in vitro activity analysis, of
which the top active lead was considered for synthesizing its deriv-
atives. The working outline from design phase to the in vivo
activity has been depicted in Figure 1.
2. Results and discussion
2.1. Design and chemistry
Our effort to identify novel small molecule inhibitors that bind
to the active site of S. aureus gyraseB ATPase domain started with
e-pharmacophore approach, which combined both the aspects of
structure-based and ligand-based techniques using the crystal
structure of DNA gyraseB protein–ligand complex (PDB code:
3TTZ)19 as template. The pharmacophore hypothesis was estab-
lished by mapping the energetic terms from the extra precision
Glide scoring function (Glide XP) onto the atom centres (Glide, ver-
sion 5.7, Schrödinger, LLC, New York, NY, 81 2011).20,21 The struc-
tural and energetic information between the protein and ligand
were evaluated by using Phase module (Phase, v3.3, Schrödinger,
LLC, New York, NY). A three-point e-pharmacophore model was
generated with ATPase gyraseB domain. The pharmacophoric sites
established included one donor (D), one acceptor (A) and one neg-
ative ionisable group (N), which was further utilised for virtual
screening of commercial database (Asinex) containing five lakh
molecules using the protocol as described in Section 4.1. Initially,
the compounds were retrieved by the three-point e-pharmaco-
phore filter using phase module and those with fit value above 2
were regarded as potential hits and were further subjected to high
throughput virtual screening. The top compounds having a good
fitness, docking pose with two or more hydrogen bonds, with a
Glide score P5.8 kcal molꢀ1 were subjected to another round of
docking by Glide XP. The Glide XP module has been reported to
Figure 1. Outline of the computational and biological work presented in this study.
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
3
be a precise tool as it combines accurate, well defined physics-
with IC50 less than 50
lM and the compounds BAS01340688,
based scoring terms and thorough sampling of the terms. The final
output file resulted in scores ranging from ꢀ11.81 to
ꢀ6.93 kcal molꢀ1. The final shortlisting of the molecules was based
on the protein ligand interaction in the active site cleft through
BAS01355130, BAS04380545 and BAS3776474 were found to be
promising as revealed in the gyraseB inhibition assay. Among the
active compounds, the hits BAS01340688 and BAS01355130
belong to benzimidazole nucleus and the most active compound
was found to be 4-[4-(1H-benzimidazol-2-yl)-phenylcarbamoyl]
butanoic acid (BAS01355130), which showed significant activity
hydrogen bonding with Asp81, Arg144 and via
p stacking with-
Arg84. GyraseB consisted of a hydrophobic pocket, surrounded
by the amino acid residues like Ser55, Thr173, Val79, Gly85,
Pro87, Glu58, Asn54, and Ile86 in the vicinity. Finally, top twelve
hits were selected from the Asinex database and were evaluated
biologically. Among the twelve hits shown in Figure 2 four com-
pounds (BAS01340688, BAS01355130, BAS04380545, and
in the gyraseB assay (IC50 of 12.6 0.32
lM) and supercoiling assay
(IC50 of 2.9 M).The docking orientation of this compound
l
BAS01355130 hereafter represented as lead 1, when compared
with the crystal ligand, revealed important polar contacts with
Asp81, Arg84 and Arg144 similar to that of the crystal ligand of
S. aureus gyraseB. The docking score of lead 1 was found to be
ꢀ6.58 and a strong non-polar interaction by the benzimidazole
moiety at the adenine binding position of ATP with Ile51, Ile102
and Ile175was observed as shown in Figure 3.
BAS3776474) showed IC
of less than 20
l
M against gyraseB
and others except one (BAS01340688) showed an IC50 less than
100 M. All these compounds were also tested for the DNA
supercoiling assay and only six compounds showed bioactivity
50
l
Figure 2. Top twelve hit molecules retrieved from Asinex database after virtual screening of 5 lakh molecules.
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

4
R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
The lead molecule 1 (BAS01355130) has an benzimidazole
result, gyraseB assay was performed with recombinant proteins
of E. coli gyraseA and S. aureus gyraseB.19,23 A library of forty one
compounds synthesized, were screened for the gyraseB activity,
throughout the assay novobiocin was set as standard positive con-
trol with an IC50 of 15 nM.9 Among the forty one compounds
tested, thirty two compounds showed a good inhibitory potency
nucleus on the left hand core that run through a 4-aminophenyl
linker, to a right handed acyl side chain as per Figure 2. The prom-
ising results of the virtual screening hits encouraged us to design a
library of benzimidazole scaffold with a goal of obtaining a series of
analogues with tractable SAR and potencies better than the identi-
fied virtual screening lead. Considering the input from protein–
ligand interactions observed with the crystal structure of gyraseB
and the lead molecule 1, the following modifications (and combi-
nations thereof) were attempted as a first ligand expansion step
which included (i) exploring the effect of various substituent’s on
benzimidazole nucleus (ii) extending the length of acyl side chain
and converting the carboxylic acid group into their corresponding
ester as shown in Table 1, to identify the ideal sites for introducing
chemical diversity and to have a clearer understanding of the role
of these substituent as determinants of inhibitory potency. The
synthetic pathway used to achieve lead modifications is delineated
in Scheme 1. The synthesis of target molecules began with the con-
densation of commercially available substituted 1,2 phenylenedi-
amine (compounds 2a–e) with 4-aminobenzoic acid in the
presence of Eaton’s reagent to yield the corresponding 4-(sub:-
1H-benzo[d]imidazol-2-yl) aniline (compounds 3a–e) in good
yields. This method utilizing Eaton’s reagent was highly beneficial
in improving the yields of the so obtained 1H-benzo[d]imidazol-2-
yl) aniline analogues, when compared to other reagents/protocols
available in literatures. A similar strategy was adopted to develop
4-(3H-imidazo [4,5-b]pyridin-2-yl)aniline nucleus (3f) as well,
starting from 1,2-diaminopyridine (2f). Functionalization of 4-ami-
nophenyl linker was then brought about by treatment with various
acid anhydrides to yield compounds 4–32. Further the carboxylic
acid side chains of few selected analogues (5, 10, 15, 20, 25 and
30) were converted into their corresponding esters (6, 11, 16, 21,
26 and 31) as an effort to improve the bacterial cell wall perme-
ability of these compounds. The oxygen and thio-substituted acyl
derivatives (33–44) were prepared by coupling 4-(sub:-1H-
benzo[d]imidazol-2-yl)aniline/4-(3H-imidazo[4,5-b]pyridin-2-
yl)aniline nucleus (3a–f) with diglycolic acid and 2,20-thiodiacetic
acid respectively. A library of forty one derivatives were synthe-
sized (4–44, as shown in Table 1), characterized and evaluated
for their ability to inhibit the gyraseB activity as an effort towards
the derivatization of structure–activity relationships and lead
optimization.
profile of >80% at 50
these thirty two compounds were rescreened at lower concentra-
tions of 10 M and 5 M, in which four compounds showing
>65% inhibition. A final compound concentration of 1 M for the
lM and 20 lM concentrations. Subsequently,
l
l
l
four potent compounds was performed and IC50 was calculated
by GraphPad Prism software, evaluating the compounds in the
above five concentrations for the final time in duplicates. The assay
was performed in the presence of detergent to rule out the artifacts
like auto absorbance and aggregation of molecules. The IC50 are
shown in Table 1.
In order to evaluate the binding profile and interaction pattern
of the designed library of molecules, in silico molecular docking
studies were carried out with the crystal structure of S. aureus gyr-
aseB. With respect to the structure–activity relationship study; out
of the various substitutions attempted on the benzimidazole
nucleus, the 5-fluoro substituted analogues turned out to be more
promising leads with compound 10 emerging as the most potent
analogue with an IC50 of 1.32 0.17 lM as shown in Figure 4,
which showed a 10 fold increment in activity when compared to
the lead compound 1 (BAS01355130). The corresponding docking
score of compound 10 was ꢀ7.06, better than that of lead com-
pound 1 which showed ꢀ6.58; revealing a good binding affinity
against the protein. Compound 10 was found to retain all the cru-
cial polar contacts as that of crystal ligand (Asp81, Arg84 and
Arg144) as illustrated in Figure 5. The remarkable potency of the
compound 10 may be attributed to the presence of highly lipo-
philic fluorine attached to the benzimidazole group which was
involved in strong in nonpolar interactions with residues Ile51,
Ile102, Leu103 and Ile175 as conferred from docking study. The
terminal carboxylic acid side chain as well as the chain length
was detrimental to bioactivity as these modifications of the termi-
nal carboxyl group into the corresponding methyl ester and alter-
ation in linker chain length resulted in decreased activity as found
in case of compounds 8, 9, 11 and 12. Replacement of fluoro group
in 5th position of the benzimidazole nucleus with chlorine atom
resulted in compounds with reduced activity having an IC50 in
the range of 11.23 to 35.63
l
M and docking score of ꢀ6.43 to
2.2. DNA gyraseB enzyme inhibition of synthesized compounds
ꢀ4.89. This reduced activity range can be attributed to the high
electron affinity nature of chlorine. Though these compounds were
found to possess polar contacts with Arg144, the presence of
chlorine containing lone pair of electrons was believed to perturb
As reported earlier, the purified S. aureus gyraseB do not have a
highly active ATPase activity like Escherichia coli gyraseB.22 As a
Figure 3. Interaction pattern of crystal ligand and lead molecule 1 (BAS01355130).
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
5
Table 1
Biological evaluation of the synthesized compounds
O
OH
O
O
R2
O
R1
R
R
N
N
n
NH
NH
N
H
N
H
X
X
Cm 4- 32
Cm 33 - 44
d
p
d
p
Compd
R
n
X
R1
R2
GyraseB assay
Supercoiling assay
MIC (
l
M)c
MRSA MIC (
l
M)d
Biofilm Inhibi.
Cytotoxicity
(% inhibi.)f
a
b
e
(IC50
)
(IC50
)
(IC50
)
4
5
6
7
8
H
H
H
H
F
F
F
F
F
Cl
Cl
Cl
Cl
Cl
NO2
NO2
NO2
NO2
NO2
OCH3
OCH3
OCH3
OCH3
OCH3
H
H
H
H
H
H
H
F
F
1
2
3
4
1
2
3
3
4
1
2
3
3
4
1
2
3
3
4
1
2
3
3
4
1
2
3
3
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
N
N
N
N
N
H
H
H
H
H
H
H
H
H
H
N
N
OH
OH
OCH3
OH
OH
OH
OH
OCH3
OH
OH
OH
OH
OCH3
OH
OH
OH
OH
OCH3
OH
OH
OH
OH
OCH3
OH
OH
OH
OH
OCH3
OH
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
O
S
6.91 0.43
7.32 0.83
36.31 0.48
5.7 0.16
6.125 0.21
6.125 0.32
25 0.37
6.125 0.44
16.31 0.21
12.0 0.26
1.13 0.34
10.7 0.11
7.1 0.11
42.33
21.16
40.41
148.2
37.05
79.8
38.19
9.15
32.175
59.3
47.8
7.2
2.9
9.7
32.06
18.06
28.72
7.59
20.205
148.2
37.05
79.8
38.19
4.57
70.35
35.17
75.8
36.36
34.9
67.23
33.61
9.18
16.96
33.9
88.31
>100
81.5
>100
82.7
13.43 1.12
17.6 0.87
1.32 0.17
18.6 0.56
15.34 0.32
26.35 0.23
11.23 0.85
9.85 0.31
35.63 0.76
13.06 1.73
4.932 0.34
17.53 1.41
6.832 0.49
9.83 1.1
9.823 0.61
11.06 0.23
13.43 0.85
8.93 0.44
21.34 0.34
22.93 1.33
21.8 0.94
9.23 0.88
18.53 1.44
5.23 0.81
2.9 0.4
6.01 0.41
22.8 0.14
6.125 0.23
6.93 0.83
15.34 0.88
13.83 0.62
8.51 0.54
3.132 0.24
4.34 0.77
9.31 0.63
6.935 0.25
2.31 0.48
0.125 0.24
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
9.63
59.33
>100
>100
53.2
>100
>100
39.2
18.35
27.92
62.31
59.31
44.2
>100
>100
52.2
63.9
71.1
71.9
29.43
88.09
79.32
15.73
68.8
33.81
29.04
25.62
31.66
45.52
27.93
39.67
26.91
24.57
27.23
35.89
31.74
27.35
26.74
22.37
50.48
29.36
27.24
31.14
33.81
57.54
22.72
40.02
13.07
14.47
20.63
29.67
23.04
31.29
25.21
23.26
22.63
38.71
31.86
ND
18.21 0.71
9.8 0.34
75.8
36.36
69.8
9.13 0.11
22.19 1.56
8.91 0.35
2.23 0.51
8.32 0.77
6.12 0.18
5.3 0.25
6.09 0.42
18.36 0.33
11.3 0.48
5.32 0.17
12.5 0.67
12.5 0.71
8.9 0.38
134.47
33.61
18.33
16.96
44.12
32.69
32.6
76.84
73.67
35.37
34.02
34.08
42.18
10.07
38.54
36.94
9.23
46.88
37.6
9.102
17.32
69.49
4.15
46.98
16.98
17.58
67.31
38.3
32.69
32.6
38.42
73.67
35.37
68.04
68.04
42.18
20.14
38.54
36.94
4.61
38.42
73.3
9.102
34.78
34.74
4.15
3.125 0.61
6.98 0.67
6.8 0.1
4
2.1 0.23
—
—
—
—
—
—
—
—
—
—
—
—
4.81 0.41
12.5 0.82
2.9 0.31
—
—
—
—
—
—
—
—
82.1
O
S
O
S
O
S
O
S
19.64
59.12
71.23
9.72
83.22
10.32
31.72
>100
82.45
11.31
ND
4.8 0.54
Cl
Cl
12.5 0.92
12.1 0.95
5.8 0.31
NO2
NO2
OCH3
OCH3
H
33.75
8.087
17.58
67.31
19.15
4.55
2.1 0.31
3.062 1.53
15.98 0.28
4.7 0.52
1.7 0.3
0.030 0.015
—
—
—
O
S
H
9.12
ND
Novobiocin
0.25
ND, indicates not determined.
a
S. aureus gyraseB ATPase activity.
b
c
d
e
f
S. aureus DNA gyrase supercoiling activity.
In vitro (MTCC 3160) activity.
In vitro (MTCC 96) MRSA MIC activity.
Biofilm inhibition of MTCC 96.
At 100 lM against RAW 264.7 cells.
the electron cloud spanning over the aromatic ring, thereof result-
ing in the loss of key non-polar interactions in the binding pocket.
Another important factor playing a key role in the reduced activity
profile of these compounds can be the steric hindrance imparted
by chlorine. The bigger size of chlorine in comparison to fluorine
can be attributed for the decreased activity of the compounds as
chlorine blocks the efficient binding of compounds at the active
site. However nitro substitution at 5th position of benzimidazole
nucleus (18–22, 39, 40) resulted in compounds showing good
hydrophobic pocket and an additional polar contact with Asn54
which explains their activity. Introduction of sulfur in the linker
chain (40) made the compound more active probably due to an
extra polar contact that it maintained with Arg144. Decrease in
the linker length to one carbon chain as in compound 18 (docking
score of ꢀ6.2) oriented the molecule in the vicinity of Arg144
allowing the two carbonyl oxygen to healthier interactions. Substi-
tution of methoxy group at 5th position of benzimidazole nucleus
(23–27, 41 and 42) was found to reduce the activity profile against
activity profile with IC50 in the range of 3.13–17.53
lM. Docking
GyrB with IC50 in the range of 4.34–22.93 lM. Presence of
studies in this case conferred that the presence of nitro group on
benzimidazole increased the non-polar interactions at the
methoxy group resulted in less active compounds owing to its
nature of stearic bulkiness, and was not involved in any non-polar
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

6
R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
Scheme 1. Synthetic protocol adopted for the lead derivatization.
interactions. However, compound 41 was found to be active with
IC50 of 4.34
M and docking score of ꢀ7.09, probably due to the
l
introduction of oxygen in linker which made the compound to ori-
ent in such a way that the two carbonyl oxygen made polar contact
with Arg144. Also methoxy group was found to be involved in
polar contact with Ser129 attributing to its better activity profile.
Compounds 25 and 42 were found to retain the polar contacts with
Asp81 and Arg144 with scores of ꢀ7.1 and ꢀ6.72, respectively.
From the combined inference from assays and docking studies, it
implied that as observed in earlier cases, the linker length played
an important role in the methoxy substituted series as well as a
decrease in linker length also was detrimental to activity. Replace-
ment of benzimidazole nucleus with imidazopyridine (28–32, 43
and 44) was found to be beneficial resulting in compounds with
marked activity in the range of 2.9–21.8 lM. Further, introduction
of sulfur in the side chain linker (as modifications over compound
44), resulted in compounds with encouraging potency which was
confirmed by docking where the compound orientated (thio
substituted linker) into the hydrophobic pocket and
imidazopyridine was towards the solvent exposure area. This
Figure 4. Hill slope of compound 10 with different log concentration of the
inhibitor on X-axis against percentage inhibition on Y-axis.
Figure 5. Surface interaction picture of Compound 10 with conserved amino acids accordance with ligand interaction diagram.
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
7
reorientation was acquired with an extra polar contact with Gly85
along with Asp81 and Arg144. Compound 32 (docking score of
ꢀ6.89), the only potent compound with increased linker length
(four carbon chain) was found with its imidazopyridine in the
hydrophobic pocket and the terminal carboxyl group interacting
with Arg84 and Arg144. Presence of terminal methyl-ester moiety
as in compound 31 (docking score of ꢀ6.72) was also found to have
a similar interaction profile.
In a nutshell, it can be concluded that substitutions like fluoro
and nitro groups on benzimidazole were favorable in terms of
activity against S. aureus gyraseB. The linker length played an
important role in the activity as it was found to be involved in
the orientation of the terminal hydrophobic and hydrophilic moie-
ties in the active site. Linker length of three carbon atoms was
found to be favorable in many of the cases and four carbon chains
was tolerated in few cases as illustrated above. Decrease in linker
length was not recommended, as these compounds showed a
marked reduction in activity. Presence of oxygen and sulfur were
advantageous with few compounds as they were involved in the
orientation of the compound at the active site for interactions.
enzyme inhibition also displayed significant in vitro antibacterial
activity against both the MTCC and MRSA strains indicating its
potential as bactericidal in vitro, whose MICs were 4.57
9.15 M comparable to the reference compound ofloxacin which
showed 4.15 M and 17.29 M in MTCC 3160 strain and MRSA
96 strain respectively. Ciprofloxacin displayed an MIC of
9.431 M against MTCC 3160 and 18.8 M against MRSA strain.
lM and
l
l
l
l
l
This confirmed the activity profile of the compound 10 with
respect to the reference standards ofloxacin and ciprofloxacin as
bactericidal. Compounds 38 and 44 also exhibited good antimicro-
bial properties in both the strains highlighting the efficacy of this
chemical class of molecules in inhibiting the microbes. In contrast,
few compounds 5–9, 13–17, 25–28 and 43 displayed a weak anti-
bacterial activity against the above bacterial strains, which could
be attributed to the permeability issue or efflux pump
transportation.
2.5. Inhibition of biofilm formation by S. aureus
Biofilm is an extracellular polysaccharide, produced by staphy-
lococcal species that facilitate attachment and matrix formation
that results in alteration in the phenotype of the organism, with
respect to gene transcription and growth rate.25 It was estimated
that 65% of all the human bacterial infections were due to biofilm
formation which may result in prolonged and chronic infections
leading to death.25,26 While recalcitrance of these biofilm-medi-
ated infections has been associated with adverse effect on patient
health, the increase in the resistance of S. aureus to methicillin
resulted in more hysterical condition.27 The extensive resistance
of S. aureus biofilms against the antibacterials can be attributed
to failure of antibiotics to penetrate the biofilm, the different met-
abolic states of the cells in the biofilm aggregates, and the differen-
tial expression of genes by the bacteria concerned in the same
biofilm aggregates.28 One of the novel approach of inhibiting path-
ogen virulence could be by inhibiting the biofilm formation thus
minimizing the selection pressure for resistance as it hold a great
promise as an alternative to traditional antibiotic treatment.29
We focused our study on inhibition of S. aureus biofilm formation
by the forty one synthesised small molecule inhibitors. The estima-
tion of inhibition of biofilm formation was monitored quantita-
tively and qualitatively. Initially, Congo red method was adopted
to know the strain’s efficiency in biofilm formation.27 The MRSA
2.3. DNA supercoiling assay
Supercoiling of the DNA occurs in the presence of gyraseA and
gyraseB subunits. Targeting either of the domains may result in
loss of supercoiling activity. The DNA supercoiling assay was per-
formed using a commercially available Inspiralis kit (Inspiralis
Limited, Norwich, UK) with a positive control, moxifloxacin having
an IC50 of 11.2 1.8 l
M.24 The kit included the assay buffer,
relaxed pBR 322 DNA as substrate, S. aureus DNA with A2B2 sub-
units. A library of the above forty one synthesized compounds
when screened initially at 50 lM and 25 lM concentrations, we
found thirty nine compounds with percentage inhibition >60%.
These compounds were repeated at lower concentrations of
12.5
pounds that exhibited >50% relative inhibition profile. These
potent inhibitory compounds were finally screened at 1.56
and 0.75 M and IC50 values are reported in Table 1. As observed
in the gyraseB assay results, compound 10 was found to be the
most potent exhibiting an IC50 value of 1.13 0.34 M as depicted
lM and 6.25 lM subsequently, resulting in eleven com-
lM
l
l
in Figure 6. Thus the gyraseB assay results well correlated with the
supercoiling activity profile.
96 was
a strong biofilm producer with >2 OD at 570 nm
2.4. In vitro MIC evaluation
wavelength. Assays were performed in a 96-well microtiter plate,
All the synthesized compounds (4–44) were further tested for
their in vitro antibacterial activity against two bacterial strains, S.
aureus MTCC 3160 and MRSA 96 using the protocol as described
in Section 4.3.4. Ofloxacin and ciprofloxacin were included as ref-
erence compounds. The results of the antibacterial screening are
presented in Table 1. Compound 10 which displayed a very good
Figure 6. Inhibitory profile of S. aureus DNA gyrase supercoiling activity by
compound 10. A representative gel obtained from the analysis of the inhibition of
DNA gyrase supercoiling activity is shown above. (R) represents relaxed closed
circular DNA; (Con) represents the supercoiled relaxed DNA in the presence of
gyrase enzyme. Gel data for assays with compound 10 in different concentrations
Figure 7. Dose–response curve of compound 10 inhibition on S. aureus MRSA 96
biofilm formation. The data is presented as% inhibition mean standard error of
means for 6 samples. Percent inhibition is relative to DMSO control.
with novobiocin as positive standard are shown (in lM).
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

8
R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
with different concentrations of the compounds on biofilm produc-
ing clinical MRSA strain 96. The procedure followed was as illus-
trated in Section 4.3.5.1. All the forty one compounds were
subjected for biofilm assay and it was gratifying to observe that
the most potent compound 10 had good biofilm formation inhibi-
2.8. hERG channel inhibition studies
Till date the only drugs clinically approved for DNA gyrase inhi-
bition were fluoroquinolones, among which the potent one being
moxifloxacin, that suffer from hERG toxicity.31,32 Also the previ-
ously reported antibacterial C- and N-linked aminopiperidine
DNA gyrase inhibitors suffered from serious hERG toxicity, we felt
it was very important to ensure that the newly designed molecules
did not suffer from such drawbacks. Compound 10 was subjected
for hERG channel inhibition studies by assessing the arrhythmo-
genic potential on zebra fish ether-a-go-go-related gene (zERG)
which was orthologous to the human ether-a-go-go-related gene
(hERG), due to their homology. This method of study, possessed
significant advantage over the current conventional animal models
which include ethical issues, low compound requirement, manu-
ally less tedious and low cost. Presently, zebrafish (Daniorerio)
has become an emerging model to study the pro-arrhythmic
potential of candidate drugs.33 Furthermore, Milan et al.34 and Mit-
telstadt et al.35 had reported that bradycardia and atrio-ventricular
dissociation in zebrafish larvae can be used as a surrogate marker
for hERG channel inhibition thereby affecting the rapid component
of the repolarizing potassium current and inducing arrhythmia. In
our study, compound 10 was subjected to hERG channel inhibition
tory profile with an IC50 of 9.63
acin was used as the standard reference possessing an IC50 of
16.89 M. In comparison with ciprofloxacin, compound 10 showed
lM as shown in Figure 7. Ciproflox-
l
two-fold increased efficacy in inhibiting the biofilm formation.
Compounds 39, 19, 33, 36, 41 and 45 also displayed appreciable
IC50’s below 20 lM as depicted in Table 1, giving enough proof that
this class of compounds possess dual effect, as DNA gyrase inhibi-
tors with effective inhibition of biofilm formation too.
2.6. Cytotoxicity screening
Further to know the safety profile of this chemical class, forty
one compounds were evaluated by testing for their in vitro
cytotoxicity against mammalian HEK-293 cell line at 100 lM con-
centration in triplicates by utilizing (4,5-dimethylthiazol-2-yl)-2,5-
diphenyltetrazolium bromide (MTT) assay.30 The entire series of
compounds tested demonstrated a good safety profile range with
very low inhibitory potential. These results were gratifying for us
as the most potent compound 10 showed only 7% cytotoxicity at
the highest concentration tested on par with ciprofloxacin drug
which was considered as control and thus these results confirmed
the safety profile of compounds. Percentage inhibition of HEK cells
by all the forty one compounds is reported in Table 1.
in concentrations ranging from 1 lM to 30 lM with 0.1% DMSO as
vehicle, the heart rate variations and AV ratio were analysed by
using a protocol described in more detail in Section 4.3.8. Com-
pound 10 was found to be safe when compared to the positive con-
trol (20
cardiotoxicity until 30
l
M
terfenadine), by not showing any significant
M concentration. There was no significant
l
2.7. In vivo evaluation in mouse septicaemia model
change in the heart rate or AV ratio, in comparison to control group
making them relatively safe, a significant breakthrough when com-
pared to otherwise cardiotoxic terfenadine and amiodaroneas
illustrated in Figure 9a and b.
Based on the promising profile of compound 10, in vivo efficacy
was carried out in mouse septicaemia model. Briefly CD-1 female
mice (10 per group) were administered S. aureus inoculum of
3 ꢁ 107 cfu/mouse via intraperitoneal route. Mice were then trea-
ted with compound 10 in varying doses of 5, 10, and 25 mg/kg
(iv) at time of and 4 h of post infection. Vancomycin was used as
a control and dosed at 5 mg/kg. Survival was assessed 24 h post
infection. Compound 10 was found to protect 60% of animals at
5 mg/kg, 80% and 100% protection at 10 and 25 mg/kg respectively
as illustrated in Figure 8.
2.9. QikProp results
Further, to analyse various pharmacokinetic properties of these
forty one compounds QikProp 3.5 module of Schrodinger software
was utilized. A preliminary examination of the ADMET results
showed that all the desired hits obey Lipinski’s rule of five showing
their drug-like nature. Compounds with favourable activity against
S. aureus DNA gyraseB (10, 44, 41 and32) showed parameters
Figure 9a. Mean ( SEM) of the heart rates of atria and ventricles of Compound-10.
(⁄p <0.05, ⁄⁄p <0.01 and ⁄⁄⁄p <0.001). Statistical significance was analyzed comparing
control group versus treated groups.
Figure 8. Number of survivals of mice, 24 h post infections with S. aureus treated
with varying doses of compound 10; standard drug was vancomycin.
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
9
2.10. Biophysical characterization
The active compounds from this series of chemical class of mol-
ecules were further investigated using a biophysical technique, dif-
ferential scanning fluorimetry (DSF). The ability of the compounds
to stabilize the catalytic domain of the gyrase protein was assessed
utilizing the DSF technique by which the thermal stability of the
catalytic domain of gyraseB native protein and of the protein
bound with the ligand was measured.7,36 Complexes with three
different ligands 10, 32 and 44 were heated stepwise from 25 °C
to 95 °C in steps of 0.6 °C in the presence of a fluorescent dye,
whose fluorescence increased as it interacted with hydrophobic
residues of the gyraseB protein. As the protein was denatured,
the amino acid residues became exposed to the dye.9 A right side
positive shift of Tm in comparison to native protein meant higher
stabilization of the protein–ligand complexes, which was a conse-
quence of the inhibitor binding.36 In our study, compound 10
showed significant positive shift confirming the stability of the
protein–ligand complex, as it was already reported in literature
that the carboxylic group at para position played an important role
in the complex stabilization by interacting with amino acid resi-
dues like Arg144, Arg84 as shown in our in silico model. In addi-
tion, the hydrophobic pocket formed around the lipophilic group
by Ile102, Ile86, Leu103, Gly85, Ile102, Thr173, Ile175, Ile51 and
Pro87 also contributed to the stabilization of this complex. Among
the three tested compounds, best improvement in the pro-
teinꢀinhibitor complex stability, as indicated by the positive shift
was observed in the case of compound 10 with the Tm shift of
3.2 °C, followed by compound 32 and 44. These results were in
accordance with the most potent DNA gyraseB inhibition by com-
Figure 9b. Mean ( SEM) score of atrio ventricular ratio. (⁄p <0.05, ⁄⁄p <0.01 and ⁄⁄⁄
<0.001). Statistical significance was analyzed comparing control group versus all
groups.
p
within desirable range as shown in the Supplementary information
Table 1. Interestingly the inactive compound 6 showed poor range
values for QPPCaco and QPPMDCK properties. As these two proper-
ties were important pharmacokinetic determining parameters for
absorption and distribution fate of any drug-like compound. Addi-
tionally, percentage human oral absorption range was upto the
mark for all active compounds considered, whereas compound 6
values were unacceptable for oral absorption. Thus according to
the ADMET analysis, we can conclude that all the active com-
pounds showed characteristics of a promising drug candidature
which can be worked for rational drug design against S. aureus
DNA gyraseB enzyme from pharmaceutical point of view.
pound 10, with an IC50 of 1.32 0.17 lM. Figure 10 depicts the
curves obtained in the DSF experiment for the native gyraseB pro-
tein (red) and protein–compound 10 complex (blue).
3. Conclusion
Efforts since 1950s to discover a drug against DNA gyraseB
enzyme have not been fruitful as there is no single drug approved
clinically till date.7 So in an effort to discover lead molecules
against this enzyme, we generated a structure-based e-pharmaco-
phore model to identify structurally diverse, small molecule
Figure 10. DSF experiment for compound 10 showing an increase in thermal stability between the native G24 protein (blue) and DNA gyraseB protein–compound 10
complex (red).
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

10
R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
inhibitors of S. aureus DNA gyraseB enzyme based on the crystal
structure of the enzyme with a co-crystallized inhibitor. Subse-
quently, twelve active compounds of varied structural classes were
identified. Out of which, three molecules had an in vitro gyraseB
out on an automatic Flash EA 1112 Series, CHN Analyzer (Thermo).
The purity of the final compounds was examined by HPLC (Shima-
dzu, Japan, (on Phenomenex C8 (150 * 4.6 mm, 5 lm, 100 Å) dou-
ble end-capped RP-HPLC column)) and was greater than 95%.
activity in 5 lM range, and the best compound was selected as lead
1 for which further synthesis of a library of forty one molecules
was carried out. All these compounds were subjected to DNA gyr-
aseB assay, DNA supercoiling assay, further their binding mode
was biophysically confirmed by differential scanning fluorimetry
(DSF). It was gratifying to see the best inhibitory compound 10
in the in vitro assays also showed a greater positive shift in DSF,
indicating the highest increase of thermal stability of the complex
inhibitor-protein that matched the best in vitro antimicrobial
activity against the MRSA strain as well. Furthermore, compound
10 showed better biofilm inhibition profile along with low cell
cytotoxicity in mammalian HEK-293 cell line with zero hERG inhi-
bition posing no cardiotoxicity at all and a very high in vivo effi-
cacy in the mouse model too, thereby making this compound a
potent molecule in this chemical class of DNA gyraseB inhibitors.
Furthermore, this class of benzimidazole besets a collection of
promising lead compounds for further optimization and develop-
ment to yield best novel drugs aimed to combat ever-present
and ever-increasing bacterial infections. Undoubtedly, this study
provides the basis for further chemical optimization of these
potent inhibitors against DNA gyraseB enzyme.
4.2.1. General procedure for the synthesis of 4-(sub:-1H-Benzo-
[d]imidazol-2-yl)aniline (3a–e)/4-(3H-imidazo[4,5-b]pyridin-2-
yl)aniline (3f). procedure A
Eaton’s reagent (10 vol; wt/vol)) was added drop wise to a well
pulverised mixture of the corresponding 1,2-phenylenediamine
(2a–e)/1,2-diaminopyridine (2f) (1 equiv) and 4-amino benzoic
acid (1 equiv) at 0 °C. The reaction mixture was then heated at
130 °C for 5–6 h (monitored by TLC and LCMS for completion).
The reaction mixture was cooled and neutralised with 10% sodium
hydroxide solution to pH of 6–7, the precipitate formed was fil-
tered and washed repeatedly with water and dried. The solid
obtained was recrystallized from ethanol to afford the desired
product in good yield as described below.
4.2.2. General procedure for the synthesis of 4-(1H-benzo[d]
imidazol-2-yl)aniline (3a)
The compound was prepared according to the general proce-
dure A using 1,2-phenylenediamine 2a (1 g, 9.25 mmol), 4-amino
benzoic acid (1.27 g, 9.25 mmol) and eatons reagent (10 mL) to
afford 3a (1.42 g, 74% yield) as pale brown solid. Mp—259–
261 °C. 1H NMR (DMSO-d6): dH 6.42 (s, 2H), 6.82–7.98 (m, 8H).
13C NMR (DMSO-d6): dc 153.1, 145.4, 141.5, 128.7, 123.5, 116.7,
115.5. EI-MS m/z: 210.45 (M+H)+. Anal. Calcd for C13H11N3: C,
74.62; H, 5.30; N, 20.08. Found: C, 74.64; H, 5.33; N, 20.12.
4. Experiments
4.1. Computer aided structure-based pharmacophore model
generation and virtual screening procedure
4.2.3. General procedure for the synthesis of 4-(5-fluoro-1H-
benzo[d]imidazol-2-yl)aniline (3b)
The crystal structure of S. aureus had co-crystallised inhibitor–
DNA gyraseB protein complex was retrieved from Protein Data
Bank (PDB code: 3TTZ), the interactions of the protein ligand were
examined using the Schrodinger software. The module PHASE 3.3
implemented in the Maestro 9.2 software package (Schrodinger,
LLC) was used to derive the e-pharmacophore. Glide energy grids
were generated for each of the prepared complexes of protein–
ligand. The binding site was defined by a rectangular box of 20 Å
surrounding the ligand in the X-ray structure while the others
were kept at default setting. Ligands were refined using the ‘Refine’
option in Glide, and the Glide XP (extra precision) descriptor was
chosen (Glide v5.7, Schrodinger, LLC, New York, NY). Default set-
tings were used for the refinement and scoring of the protein–
ligand complex. The final model generated for the first phase of
high throughput virtual screening consisted of a hydrogen bond
donor, a ring group and a negative ionisable group.
The compound was prepared according to the general proce-
dure A using 4-fluoro-1,2-phenylenediamine 2b (1 g, 7.93 mmol),
4-amino benzoic acid (1.09 g, 7.93 mmol) and eatons reagent
(10 mL) to afford 3b (1.02 g, 56% yield) as brown solid. Mp: 242–
244 °C. 1H NMR (DMSO-d6): dH 6.33 (s, 2H), 7.00–8.09 (m, 7H).
13C NMR (DMSO-d6): dc 156.6, 153.3, 145.6, 139.1, 137.8, 128.2,
116.8, 115.6, 110.3, 101.9. EI-MS m/z: 228.26 (M+H)+. Anal. Calcd
for C13H10FN3: C, 68.71; H, 4.44; N, 18.49. Found: C, 68.73; H,
4.42; N, 18.47.
4.2.4. General procedure for the synthesis of 4-(5-chloro-1H-
Benzo[d]imidazol-2-yl)aniline (3c)
The compound was prepared according to the general proce-
dure A using 4-chloro-1,2-phenylenediamine 2c (1 g, 7.02 mmol),
4-amino benzoic acid (0.96 g, 7.02 mmol) and eatons reagent
(10 mL) to afford 3c (1.1 g, 64% yield) as buff coloured solid. Mp:
291–293 °C. 1H NMR (DMSO-d6): dH 6.45 (s, 2H), 7.08–8.39 (m,
7H). 13C NMR (DMSO-d6): dc 153.1, 145.7, 133.2, 131.2, 129.6,
128.4, 124.3, 116.7, 116.3, 115.9, 115.2. EI-MS m/z:
244.42(M+H)+. Anal. Calcd for C13H10ClN3: C, 64.07; H, 4.14; N,
17.24. Found C, 64.11; H, 4.16; N, 17.19.
4.2. Chemistry
All commercially available chemicals and solvents were used
without further purification. TLC experiments were performed on
alumina-backed silica gel 40 F254 plates (Merck, Darmstadt, Ger-
many). The homogeneity of the compounds was monitored by thin
layer chromatography (TLC) on silica gel 40 F254 coated on alumi-
num plates, visualized by UV light and KMnO4 treatment. Flash
chromatography was performed on a Biotage Isolera with pre-
packaged disposable normal phase silica columns. All 1H and 13C
NMR spectra were recorded on a Bruker AM-300 (300.12 MHz,
75.12 MHz) NMR spectrometer, Bruker BioSpin Corp, Germany.
Chemical shifts are reported in ppm (d) with reference to the inter-
nal standard TMS. The signals are designated as follows: s, singlet;
d, doublet; dd, doublet of doublets; t, triplet; m, multiplet. Molec-
ular weights of the synthesized compounds were checked by LCMS
6100B series Agilent Technology. Elemental analyses were carried
4.2.5. General procedure for the synthesis of 4-(5-nitro-1H-
benzo[d]imidazol-2-yl)aniline (3d)
The compound was prepared according to the general proce-
dure A using 4-nitro-1,2-phenylenediamine 2d (1 g, 6.53 mmol),
4-amino benzoic acid (0.9 g, 6.53 mmol) and eatons reagent
(10 mL) to afford 3d (1.2 g, 72% yield) as yellowish brown solid.
MP: 277–278 °C. 1H NMR (DMSO-d6): dH 6.53 (s, 2H), 7.21–8.49
(m, 7H). 13C NMR (DMSO-d6): dc 153.3, 148.6, 145.7, 144.6, 140.2,
128.3, 118.9, 116.3, 116.1, 115.3, 113.2. EI-MS m/z: 255.44
(M+H)+. Anal. Calcd for C13H10N4O2: C, 61.41; H, 3.96 N, 22.04.
Found C, 61.44; H, 3.94 N, 22.06.
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
11
4.2.6. General procedure for the synthesis of 4-(5-methoxy-1H-
benzo[d]imidazol-2-yl)aniline (3e)
4.2.9.3. 6-((4-(1H-Benzo[d]imidazol-2-yl)phenyl)amino)-6-oxo-
hexanoic acid (7). The compound was prepared according to
The compound was prepared according to the general proce-
the general procedure B using 4-(1H-benzo[d]imidazol-2-yl)ani-
line 3a (0.2 g, 0.96 mmol), adipic anhydride (0.122 g, 0.96 mmol)
to afford 7 (0.211 g, 65% yield) as yellow solid. MP: 276–278 °C.
1H NMR (DMSO-d6): dH 1.34–2.42 (m, 8H), 7.48–8.32 (m, 8H),
10.11 (s, 1H), 12.53 (b, 1H). 13C NMR (DMSO-d6): dc 180.2, 178.7,
152.7, 142.2, 139.1, 128, 123.3, 122.2, 120.1, 115.8, 37.5, 32.8,
27.9, 24.4. EI-MS m/z: 338.2 (M+H)+. Anal. Calcd for C19H19N3O3:
C, 67.64; H, 5.68; N, 12.46. Found: C, 67.61; H, 5.71; N, 12.43.
dure
A
using 4-methoxy-1,2-phenylenediamine 2e (1 g,
7.24 mmol), 4-amino benzoic acid (0.99 g, 7.24 mmol) and eatons
reagent (10 mL) to afford 3e (0.91 g, 53%) as reddish brown solid.
MP: 162–165 °C. 1H NMR (DMSO-d6): dH 3.85 (s, 3H), 6.51 (s,
2H), 7.04–8.13 (m, 7H). 13C NMR (DMSO-d6): dc 156.7, 153.4,
145.7, 139.5, 134.5, 128.4, 116.8, 115.3, 112.1, 100.6, 56.1. EI-MS
m/z: 240.3 (M+H)+. Anal. Calcd for C14H13N3O: C, 70.28; H, 5.48;
N, 17.56. Found: C, 70.31; H, 5.47; N, 17.58.
4.2.9.4.
3-((4-(5-Fluoro-1H-benzo[d]imidazol-2-yl)phenyl)-
The compound was
4.2.7. General procedure for the synthesis of 4-(3H-imidazo[4,5-
b]pyridin-2-yl)aniline (3f)
amino)-3-oxopropanoic acid (8).
prepared according to the general procedure B using4-(5-fluoro-
1H-benzo[d]imidazol-2-yl)aniline 3b (0.2 g, 0.88 mmol), malonic
anhydride (0.076 g, 0.88 mmol) to afford 8 0.188 g, 68% yield) as
off white solid. Mp: 210–212 °C. 1H NMR (DMSO-d6): dH 1.71–
2.39 (m, 2H), 7.03–8.25 (m, 7H) 10.16 (s, 1H), 12.68 (b, 1H). 13C
NMR (DMSO-d6): dc 172.3, 163.1, 157.2, 153.2, 141.2, 138.7,
137.8, 128.2, 122.3, 120.3, 117.4, 110.3, 102.8, 39.6. EI-MS m/z:
314.3 (M+H)+. Anal. Calcd for C16H12FN3O3: C, 61.34; H, 3.86; N,
13.41. Found: C, 61.38; H, 3.89; N, 13.45.
The compound was prepared according to the general proce-
dure A using pyridine-2,3-diamine 2f (1 g, 9.16 mmol), 4-amino
benzoic acid (1.26 g, 9.16 mmol) and eatons reagent (10 mL) to
afford 3f (1.1 g, 58% yield) as pale brown solid. Mp: 265–267 °C.
1H NMR (DMSO-d6): dH 6.43 (s, 2H), 7.03–8.22 (m, 7H). 13C NMR
(DMSO-d6): dc 162.3, 150.7, 145.6, 145.2, 130.5, 128.3, 124.8,
123.6, 122.8, 115.6. EI-MS m/z: 211.33 (M+H)+. Anal. Calcd for
C12H10N4: C, 68.56; H, 4.79; N, 26.65. Found: C, 68.59; H, 4.77; N,
26.62.
4.2.9.5.
4-((4-(5-Fluoro-1H-benzo[d]imidazol-2-yl)phenyl)-
The compound was
4.2.8. General procedure for the synthesis of acylated
derivatives (4–6, 8–11, 13–16, 18–21, 23–26, 28–31, 33)
procedure B
amino)-4-oxobutanoic acid (9).
prepared according to the general procedure B using4-(5-fluoro-
1H-benzo[d]imidazol-2-yl)aniline 3b (0.2 g, 0.88 mmol), succinic
anhydride (0.088 g, 0.88 mmol) to afford 9 (0.193 g, 67% yield) as
off white solid. Mp—297–299 °C. 1H NMR (DMSO-d6): dH 2.35–
2.68 (m, 4H), 7.03–8.29 (m, 7H) 10.14 (s, 1H), 12.65 (b, 1H).). 13C
NMR (DMSO-d6): dc 177.8, 174.2, 156.8, 153.2, 140.8, 138.6,
137.8, 128.3, 122.4, 120.3, 117.4, 110.4, 102.6, 30.5, 28.3. EI-MS
m/z: 328.42(M+H). Anal. Calcd for C17H14FN3O3: C, 62.38; H,
4.31; N, 12.84. Found: C, 62.35; H, 4.36; N, 12.86.
The synthesis followed the literature procedure. To a well stir-
red solution of the corresponding 4-(sub:-1H-benzo[d]imidazol-
2-yl)aniline/4-(3H-imidazo[4,5-b]pyridin-2-yl)aniline (3a–f)
(1 equiv) in anhydrous tetrahydrofuran (0.15 M) with 4 Å molecu-
lar sieves in an appropriate sized microwave vial; was added the
corresponding anhydride (1 equiv) at room temperature. The reac-
tion mixture was then irradiated in Biotage microwave initiator
with stirring at 160–170 °C for about 20–30 min (monitored by
TLC and LCMS for completion). The solvent was removed under
vacuum, diluted with water and basified with solid sodium bicar-
bonate to a pH of 9. The aqueous layer was further washed with
dichloromethane, acidified with 2 N HCl to a pH of 2, and extracted
repeatedly with ethyl acetate. The combined organic layer was
then dried over anhydrous sodium sulfate and concentrated under
reduced pressure. The residue obtained was further recrystallized
from ethanol to afford the desired product in good yield and purity
as described below.
4.2.9.6.
5-((4-(5-Fluoro-1H-benzo[d]imidazol-2-yl)phenyl)-
The compound was
amino)-5-oxopentanoic acid (10).
prepared according to the general procedure B using4-(5-fluoro-
1H-benzo[d]imidazol-2-yl)aniline 3b (0.2 g, 0.88 mmol), glutaric
anhydride (0.1 g, 0.88 mmol) to afford 10 as off white solid. Mp-
282–284 °C. 1H NMR (DMSO-d6): dH 1.77–2.37 (m, 6H), 7.00–8.08
(m, 7H), 10.16 (s, 1H), 12.91 (b, 1H). 13C NMR (DMSO-d6): dc
174.3, 171.2, 160.2, 157, 152.6, 140.9, 124.4, 119.1, 109.76, 35.5,
33.1, 20.4. EI-MS m/z: 342.56 (M+H)+. Anal. Calcd for C18H16FN3O3:
C, 63.34; H, 4.72; N, 12.31. Found: C, 63.36; H, 4.71; N, 12.32.
4.2.9.1. 3-((4-(1H-Benzo[d]imidazol-2-yl)phenyl)amino)-3-oxo-
propanoic acid (4).
The compound was prepared according
4.2.9.7.
6-((4-(5-Fluoro-1H-benzo[d]imidazol-2-yl)phenyl)-
The compound was
to the general procedure B using 4-(1H-benzo[d]imidazol-2-yl)ani-
line 3a (0.2 g, 0.96 mmol), malonic anhydride (0.082 g, 0.96 mmol)
to afford 4 (0.174 g, 61% yield)as pale yellow solid. Mp: 279–
281 °C. 1H NMR (DMSO-d6): dH 3.25 (s, 2H), 7.44–8.24 (m, 8H),
10.12 (s, 1H), 12.73 (b, 1H). 13C NMR (DMSO-d6): dc 172, 163.3,
153.5, 141.5, 139, 128.3, 123.5, 122.2, 120.6, 115.7, 37.3. EI-MS
m/z: 296.4 (M+H)+. Anal. Calcd for C19H13N3O3: C, 65.08; H, 4.44;
N, 14.23 Found: C, 65.11; H, 4.47; N, 14.28.
amino)-6-oxohexanoic acid (12).
prepared according to the general procedure B using4-(5-fluoro-
1H-benzo[d]imidazol-2-yl)aniline 3b (0.2 g, 0.88 mmol), adipic
anhydride (0.113 g, 0.88 mmol) to afford 12 (0.232g, 74% yield) as
off white solid. Mp—282–284 °C. 1H NMR (DMSO-d6): dH 1.35–
2.48 (m, 8H), 7.05–8.31 (m, 7H) 10.16 (s, 1H), 12.62 (b, 1H). 13C
NMR (DMSO-d6): dc 180.2, 178.9, 156.7, 153.4, 140.6, 138.9, 137.5,
128.4, 122.3, 120.2, 117.2, 110.3, 102.5, 38.2, 33.6, 27.5, 24.2. EI-
MS m/z: 356.4 (M+H)+. Anal. Calcd for C19H18FN3O3: C, 64.22; H,
5.11; F, 5.35; N, 11.82. Found: C, 64.25; H, 5.16; F, 5.39; N, 11.87.
4.2.9.2. 4-((4-(1H-Benzo[d]imidazol-2-yl)phenyl)amino)-4-oxo-
butanoic acid (5).
The compound was prepared according to
the general procedure B using 4-(1H-benzo[d]imidazol-2-yl)ani-
line 3a (0.2 g, 0.96 mmol), succinic anhydride (0.096 g, 0.96 mmol)
to afford 5 (0.21 g, 71%)as off white solid. Mp: 259–261 °C. 1H NMR
(DMSO-d6): dH 2.34–2.91 (m, 4H), 7.42 -8.24 (m, 8H), 10.14 (s, 1H),
12.63 (b, 1H). 13C NMR (DMSO-d6): dc 177.5, 174.2, 153.4, 141.4,
139, 127.5, 123.5, 122.1, 120.2, 115.8, 30.9, 29.5. EI-MS m/z:
310.3 (M+H)+. Anal. Calcd for C17H15N3O3: C, 66.01; H, 4.89; N,
13.58. Found: C, 66.05; H, 4.84; N, 13.54.
4.2.9.8. 3-((4-(5-Chloro-1H-benzo[d]imidazol-2-yl)phenyl)-
amino)-3-oxopropanoic acid (13).
The compound was
prepared according to the general procedure B using4-(5-chloro-
1H-benzo[d]imidazol-2-yl)aniline 3c (0.2 g, 0.82 mmol), malonic
anhydride (0.071 g, 0.82 mmol) to afford 13 (0.178 g, 66% yield)as
pale brown solid.. Mp—276–278 °C. 1H NMR (DMSO-d6): dH 3.25 (s,
2H), 7.25–8.42 (m, 7H) 10.16 (s, 1H), 12.73 (b, 1H). 13C NMR
(DMSO-d6): dc 171.8, 163.2, 153.2, 138.7, 133.2, 131.3, 129.4,
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

12
R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
128.2, 124.5, 122.3, 120.3, 116.8, 115.9, 39.6. EI-MS m/z: 330.5
(M+H)+. Anal. Calcd for C16H12ClN3O3: C, 58.28; H, 3.67 N, 12.74.
Found: C, 58.29; H, 3.65 N, 12.77.
prepared according to the general procedure B using4-(5-nitro-
1H-benzo[d]imidazol-2-yl)aniline 3d (0.2 g, 0.79 mmol), glutaric
anhydride (0.09 g, 0.79 mmol) to afford 20 (0.221 g, 76% yield)as
yellow solid. 1H NMR (DMSO-d6): dH 1.71 -2.36 (m, 6H), 7.73–
8.57 (m, 7H), 10.16 (s, 1H), 12.56 (b, 1H). 13C NMR (DMSO-d6): dc
180.2, 178.8, 153.4, 148.2, 144.6, 140.2, 138.8, 128.3, 122.2,
120.2, 118.8, 116.3, 133.2, 37.1, 32.5, 20.5. EI-MS m/z: 369.5
(M+H)+. Anal. Calcd for C18H16N4O5: C, 58.69; H, 4.38 N, 15.21.
Found: C, 58.72; H, 4.37 N, 15.21.
4.2.9.9. 4-((4-(5-Chloro-1H-benzo[d]imidazol-2-yl)phenyl)-
amino)-4-oxobutanoic acid (14).
The compound was
prepared according to the general procedure B using4-(5-chloro-
1H-benzo[d]imidazol-2-yl)aniline 3c (0.2 g, 0.82 mmol), succinic
anhydride (0.082 g, 0.82 mmol) to afford 14 (0.19 g, 68% yield)as
pale brown solid. Mp—288–290 °C. 1H NMR (DMSO-d6): dH 2.37 -
2.68 (s, 4H), 7.23–8.36 (m, 7H) 10.15 (s, 1H), 12.69 (b, 1H). 13C
NMR (DMSO-d6): dc 177.8, 174.2, 153.3, 138.8, 133.2, 131.3,
129.4, 128.2, 124.5, 122.2, 120.2, 116.7, 155.9, 30.5, 28.8. EI-MS
m/z: 344.6 (M+H)+. Anal. Calcd for C17H14ClN3O3: C, 59.40; H,
4.10 N, 12.22. Found: C, 59.43; H, 4.12 N, 12.18.
4.2.9.15.
6-((4-(5-Nitro-1H-benzo[d]imidazol-2-yl)phenyl)-
The compound was
amino)-6-oxohexanoic acid (22).
prepared according to the general procedure B using4-(5-nitro-
1H-benzo[d]imidazol-2-yl)aniline 3d (0.2 g, 0.79 mmol), adipic
anhydride (0.1 g, 0.79 mmol) to afford 22 (0.21 g, 66% yield) as yel-
low solid. Mp—298–300 °C. 1H NMR (DMSO-d6): dH 1.42 -2.34 (m,
8H), 7.67–8.58 (m, 7H), 10.16 (s, 1H), 12.65 (b, 1H). 13C NMR
(DMSO-d6): dc 180.1, 178.6, 153.1, 148.2, 144.5, 140.1, 138.8,
128.3, 122.2, 120.2, 118.8, 116.2, 113.2, 38.2, 33.6, 27.2, 23.9. EI-
MS m/z: 383.3 (M+H)+. Anal. Calcd for C19H18N4O5: C, 59.68; H,
4.74; N, 14.65. Found: C, 59.66; H, 4.77; N, 14.68.
4.2.9.10. 5-((4-(5-Chloro-1H-benzo[d]imidazol-2-yl)phenyl)-
amino)-5-oxopentanoic acid (15).
The compound was
prepared according to the general procedure B using4-(5-chloro-
1H-benzo[d]imidazol-2-yl)aniline 3c (0.2 g, 0.82 mmol), glutaric
anhydride (0.094 g, 0.82 mmol) to afford 15 (0.175 g, 59% yield)
as off white solid. Mp—274–276 °C. 1H NMR (DMSO-d6): dH 1.65–
2.28 (m, 6H), 7.23–8.46 (m, 7H) 10.21 (s, 1H), 12.85 (b, 1H). 13C
NMR (DMSO-d6): dc 180.2, 178.6, 153.2, 138.9, 133.2, 131.2,
129.4, 128.3, 124.5, 122.3, 120.2, 116.8, 115.9, 37.5, 32.8, 20.5.
EI-MS m/z: 358.9 (M+H)+. Anal. Calcd for C18H16ClN3O3: C, 60.42;
H, 4.51; N, 11.74. Found C, 60.44; H, 4.49; N, 11.71.
4.2.9.16. 3-((4-(5-Methoxy-1H-benzo[d]imidazol-2-yl)phenyl)-
amino)-3-oxopropanoic acid (23).
The compound was
prepared according to the general procedure B using4-(5-meth-
oxy-1H-benzo[d]imidazol-2-yl)aniline 3e (0.2 g, 0.84 mmol),
malonic anhydride (0.072 g, 0.84 mmol) to afford 23 (0.183 g,
67% yield) as yellow solid. Mp—277–279 °C. 1H NMR (DMSO-d6):
dH 3.36 (s, 2H), 3.89 (s, 3H), 7.06–8.31(m, 7H) 10.12 (s, 1H),
12.55 (b, 1H). 13C NMR (DMSO-d6): dc 172.5, 162.5, 156.4, 153.2,
140.1, 138.2, 133.8, 127.3, 122.3, 120.1, 115.8, 112.5, 101.2, 56.5,
40.2. EI-MS m/z: 326.4 (M+H)+. Anal. Calcd for C17H15N3O4: C,
62.76; H, 4.65; N, 12.92. Found: C, 62.74; H, 4.68; N, 12.89.
4.2.9.11. 6-((4-(5-Chloro-1H-benzo[d]imidazol-2-yl)phenyl)-
amino)-6-oxohexanoic acid (17).
The compound was
prepared according to the general procedure B using4-(5-chloro-
1H-benzo[d]imidazol-2-yl)aniline 3c (0.2 g, 0.82 mmol), adipic
anhydride (0.105 g, 0.82 mmol) to afford 17 (0.198g, 65% yield)
as pale brown solid. Mp—255–257 °C. 1H NMR (DMSO-d6): dH
1.46–2.32 (m, 8H), 7.26–8.37 (m, 7H) 10.17 (s, 1H), 12.59 (b, 1H).
13C NMR (DMSO-d6): dc 180.2, 178.8, 153.4, 138.7, 134.2, 131.2,
129.5, 128.3, 124.3, 122.3, 120.2, 116.7, 115.9, 38.2, 33.5, 27.3,
24.1. EI-MS m/z: 372.6 (M+H)+. Anal. Calcd for C19H18ClN3O3: C,
61.38; H, 4.88 N, 11.30. Found: C, 61.36; H, 4.90 N, 11.31.
4.2.9.17. 4-((4-(5-Methoxy-1H-benzo[d]imidazol-2-yl)phenyl)-
amino)-4-oxobutanoic acid (24).
The compound was
prepared according to the general procedure B using 4-(5-meth-
oxy-1H-benzo[d]imidazol-2-yl)aniline 3e (0.2 g, 0.84 mmol), succi-
nic anhydride (0.084 g, 0.84 mmol) to afford 24 (0.169 g, 60%
yield)as pale brown solid. Mp—180–182 °C. 1H NMR (DMSO-d6):
dH 2.36–2–62 (m, 4H), 3.87 (s, 3H), 7.02–8.33 (m, 7H) 10.13 (s,
1H), 12.61 (b, 1H)). 13C NMR (DMSO-d6): dc 177.8, 174.3, 156.5,
153.2, 140.3, 138.7, 134.2, 128.3, 122.3, 120.2, 116.7, 112.2,
100.9, 56.5, 30.7, 28.8. EI-MS m/z: 340.45(M+H)+. Anal. Calcd for
4.2.9.12.
3-((4-(5-Nitro-1H-benzo[d]imidazol-2-yl)phenyl)-
The compound was
amino)-3-oxopropanoic acid (18).
prepared according to the general procedure B using4-(5-nitro-
1H-benzo[d]imidazol-2-yl)aniline 3d (0.2 g, 0.79 mmol), malonic
anhydride (0.068 g, 0.79 mmol) to afford 18 (0.185 g, 69% yield)as
pale yellow solid. Mp—244–246 °C. 1H NMR (DMSO-d6): dH 3.21 (s,
2H), 7.71–8.57 (m, 7H), 10.16 (s, 1H), 12.61 (b, 1H). 13C NMR
(DMSO-d6): dc 171.7, 163.5, 153.2, 148.9, 144.6, 140.2, 138.7,
128.3, 122.2, 120.1, 118.8, 116.3, 113.2, 39.8. EI-MS m/z: 341.7
(M+H)+. Anal. Calcd for C16H12N4O5: C, 56.47; H, 3.55; N, 16.46.
Found: C, 56.49; H, 3.54; N, 16.48.
C18H17N3O4: C, 63.71; H, 5.05; N, 12.38. Found: C, 63.75; H, 5.01;
N, 12.40.
4.2.9.18. 5-((4-(5-Methoxy-1H-benzo[d]imidazol-2-yl)phenyl)-
amino)-5-oxopentanoic acid (25).
The compound was
prepared according to the general procedure B using4-(5-nitro-
1H-benzo[d]imidazol-2-yl)aniline 3e (0.2 g, 0.84 mmol), glutaric
anhydride (0.095 g, 0.84 mmol) to afford 25 (0.186 g, 63% yield)
as brown solid. Mp—212–214 °C. 1H NMR (DMSO-d6): dH 1.66–
2.33 (m, 6H), 3.94 (s, 3H), 7.05–8.26 (m, 7H) 10.11 (s, 1H),
12.73(b, 1H). 13C NMR (DMSO-d6): dc 180.3, 177.6, 156.5, 153.6,
139.2, 138.5, 134.4, 128.7, 122.3, 120.5, 116.8, 112.3, 100.9, 56.5,
37.2, 33.2, 20.9. EI-MS m/z: 354.4 (M+H)+. Anal. Calcd for
4.2.9.13.
4-((4-(5-Nitro-1H-benzo[d]imidazol-2-yl)phenyl)-
The compound was
amino)-4-oxobutanoic acid (19).
prepared according to the general procedure B using 4-(5-nitro-
1H-benzo[d]imidazol-2-yl)aniline 3d (0.2 g, 0.79 mmol), succinic
anhydride (0.079 g, 0.79 mmol) to afford 19 (0.195 g, 70% yield)
as yellow solid. Mp—298–300 °C. 1H NMR (DMSO-d6): dH 2.35–
2.66 (s, 4H), 7.61–8.49 (m, 7H) 10.15 (s, 1H), 12.69 (b, 1H). 13C
NMR (DMSO-d6): dc 177.8, 174.2, 153.2, 147.9, 144.5, 140.1,
138.8, 127.8, 122.3, 119.9, 118.7, 116.5, 113.2, 30.5, 28.8.. EI-MS
m/z: 355.5 (M+H)+. Anal. Calcd for C17H14N4O5: C, 57.63; H, 3.98
N, 15.81. Found: C, 57.66; H, 3.97; N, 15.85.
C19H19N3O4: C, 64.58; H, 5.42; N, 11.89. Found: C, 64.54; H, 5.45;
N, 11.91.
4.2.9.19. 6-((4-(5-Methoxy-1H-benzo[d]imidazol-2-yl)phenyl)-
amino)-6-oxohexanoic acid (27).
The compound was
prepared according to the general procedure B using4-(5-meth-
oxy-1H-benzo[d]imidazol-2-yl)aniline 3e (0.2 g, 0.84 mmol), adi-
pic anhydride (0.107 g, 0.84 mmol) to afford 27 (0.218 g, 71%
yield) as reddish brown solid. Mp—171–173 °C. 1H NMR
4.2.9.14.
5-((4-(5-Nitro-1H-benzo[d]imidazol-2-yl)phenyl)-
The compound was
amino)-5-oxopentanoic acid (20).
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
13
(DMSO-d6): dH 1.39—2–35 (m, 8H), 3.86 (s, 3H), 7.04–8.26 (m, 7 H)
10.16 (s, 1H), 12.66 (b, 1H). 13C NMR (DMSO-d6): dc 180.2, 178.5,
156.7, 153.2, 140.2, 138.7, 133.8, 128.3, 121.7, 120.3, 116.7,
112.2, 100.6, 56.2, 38.2, 33.5, 27.6, 24.5. EI-MS m/z: 368.5
(M+H)+. Anal. Calcd for C20H21N3O4: C, 65.38; H, 5.76; N, 11.44.
Found: C, 65.35; H, 5.78; N, 11.46.
sulfate and concentrated under reduced pressure to afford the
desired product in good yield and purity as described below.
4.2.10.1. Methyl 5-((4-(1H-benzo[d]imidazol-2-yl)phenyl)a-
mino)-5-oxopentanoate (6).
according to the general procedure C using 5-((4-(1H-benzo[d]imi-
dazol-2-yl)phenyl)amino)-5-oxopentanoic acid (0.1 g, 0.31
The compound was prepared
1
4.2.9.20. 3-((4-(1H-Imidazo[4,5-b]pyridin-2-yl)phenyl)amino)-
mmol), to afford 7 (0.23 g, 69% yield) as pale brown solid.
Mp—218–220 °C. 1H NMR (DMSO-d6): dH 3.82 (s, 3H), 1.77–2.37
(m, 6H), 7.25–8.21 (m, 8H), 10.14 (s, 1H). 13C NMR (DMSO-d6): dc
173.8, 153.1, 141.6, 139.5, 128.5, 123.8, 121.6, 120.2, 115.8, 52.3,
33.2, 20.5. EI-MS m/z: 338.45 (M+H)+. Anal. Calcd for
3-oxopropanoic acid (28).
The compound was prepared
according to the general procedure B using4-(3H-imidazo[4,5-
b]pyridin-2-yl)aniline 3e (0.2 g, 0.95 mmol), malonic anhydride
(0.082 g, 0.95 mmol) to aff 28 (0.193 g, 68% yield) as buff coloured
solid. Mp—288–290 °C. 1H NMR (DMSO-d6): dH 3.36 (s, 2H), 7.01–
8.25 (m, 7H) 10.19 (s, 1H), 12.71 (b, 1H). 13C NMR (DMSO-d6): dc
172.3, 163.1, 161.9, 150.8, 145.6, 138.6, 130.3, 128.2, 123.7,
122.8, 120.3, 39.8.. EI-MS m/z: 297.5 (M+H)+. Anal. Calcd for
C15H12N4O3: C, 60.81; H, 4.08; N, 18.91. Found C, 60.85; H, 4.04;
N, 18.90.
C19H19N3O3: C, 67.64; H, 5.68; N, 12.46. Found: C, 67.62; H, 5.72;
N, 12.45.
4.2.10.2. Methyl 5-((4-(5-fluoro-1H-benzo[d]imidazol-2-yl)phe-
nyl)amino)-5-oxopentanoate (11).
The compound was
prepared according to the general procedure C using 5-((4-(5-flu-
oro-1H-benzo[d]imidazol-2-yl)phenyl)amino)-5-oxopentanoic
acid 10 (0.1 g, 0.29 mmol), to afford 11 (0.2 g, 63% yield)as off
white solid. Mp—244–246 °C. 1H NMR (DMSO-d6): dH 1.61–2.31
(m, 6H), 3.75 (s, 3H), 7.06–8.28 (m, 7H) 10.18 (s, 1H). 13C NMR
(DMSO-d6): dc 180.2, 173.5, 156.8, 153.2, 140.9, 138.8, 137.6,
128.3, 122.2, 119.6, 117.1, 110.3, 102.2, 52.3, 36.5, 33.1, 20.8. EI-
MS m/z: 356.5 (M+H)+. Anal. Calcd for C19H18FN3O3: C, 64.22; H,
5.11; N, 11.82. Found: C, 64.28; H, 5.07; N, 11.80.
4.2.9.21. 4-((4-(1H-Imidazo[4,5-b]pyridin-2-yl)phenyl)amino)-
4-oxobutanoic acid (29).
The compound was prepared
according to the general procedure B using4-(3H-imidazo[4,5-
b]pyridin-2-yl)aniline 3e (0.2 g, 0.95 mmol), succinic anhydride
(0.095 g, 0.95 mmol) to afford 29 (0.211 g, 71% yield) as off white
solid. Mp—233–235 °C. 1H NMR (DMSO-d6): dH 2.36–2.68 (s, 4H),
7.05–8.32 (m, 7H) 10.15 (s, 1H), 12.68 (b, 1H). 13C NMR (DMSO-
d6): dc 177.8, 174.2, 161.7, 150.6, 145.3, 138.6, 130.6, 128.1,
123.8, 122.6, 120.1, 30.2, 28.6. EI-MS m/z: 311.3 (M+H)+. Anal.
Calcd for C16H14N4O3: C, 61.93; H, 4.55; N, 18.06. Found: C,
61.95; H, 4.58; N, 18.01.
4.2.10.3. Methyl 5-((4-(5-chloro-1H-benzo[d]imidazol-2-yl)phe-
nyl)amino)-5-oxopentanoate (16).
The compound was
prepared according to the general procedure C using 5-((4-(5-
chloro-1H-benzo[d]imidazol-2-yl)phenyl)amino)-5-oxopentanoic
acid 15 (0.1 g, 0.28 mmol), to afford 16 (0.21 g, 68% yield)as off
white solid. Mp—263–265 °C. 1H NMR (DMSO-d6): dH 1.82–2.32
(m, 6H), 3.85 (s, 3H), 7.21–8.43 (m, 7H) 10.19 (s, 1H). 13C NMR
(DMSO-d6): dc 180.3, 173.3, 153.4, 138.7, 133.2, 131.2, 129.6,
128.4, 124.3, 122.4, 120.3, 116.7, 115.9, 52.3, 37.3, 32.7, 20.8. EI-
MS m/z: 372.4 (M+H)+. Anal. Calcd for C19H18ClN3O3: C, 61.38; H,
4.88; N, 11.30. Found C, 61.42; H, 4.85; N, 11.29.
4.2.9.22. 5-((4-(1H-Imidazo[4,5-b]pyridin-2-yl)phenyl)amino)-
5-oxopentanoic acid (30).
The compound was prepared
according to the general procedure B using4-(3H-imidazo[4,5-
b]pyridin-2-yl)aniline 3e (0.2 g, 0.95 mmol), glutaric anhydride
(0.108 g, 0.95 mmol) to afford 30 (0.191 g, 62% yield) as pale brown
solid.. Mp—271–273 °C. 1H NMR (DMSO-d6): dH 1.71–2.39 (m, 6H),
7.03 -8.25 (m, 7H) 10.16 (s, 1H), 12.6 (b, 1H). 13C NMR (DMSO-d6):
dc 180.1, 178.5, 161.8, 150.6, 145.8, 138.7, 130.5, 128.2, 123.8,
122.7, 120.3, 37.5, 32.5, 20.4. 1 EI-MS m/z: 325.5 (M+H)+. Anal.
Calcd for C17H16N4O3: C, 62.95; H, 4.97; N, 17.27. Found: C,
62.98; H, 4.96; N, 17.26.
4.2.10.4. Methyl 5-((4-(5-nitro-1H-benzo[d]imidazol-2-yl)phe-
nyl)amino)-5-oxopentanoate (21).
The compound was
prepared according to the general procedure C using 5-((4-(5-
nitro-1H-benzo[d]imidazol-2-yl)phenyl)amino)-5-oxopentanoic
acid 20 (0.1 g, 0.27 mmol), to afford 21 (0.218 g, 73% yield)as yellow
solid. The compound was prepared according to the general proce-
4.2.9.23. 6-((4-(1H-Imidazo[4,5-b]pyridin-2-yl)phenyl)amino)-
6-oxohexanoic acid (32).
The compound was prepared
according to the general procedure B using4-(3H-imidazo[4,5-
b]pyridin-2-yl)aniline 3e (0.2 g, 0.95 mmol), adipic anhydride
(0.122 g, 0.95 mmol) to afford 32 (0.22 g, 69% yield) as buff col-
oured solid. Mp—259–261 °C. 1H NMR (DMSO-d6): dH 1.42–2.32
(m, 8H), 7.03–8.30 (m, 7H) 10.16 (s, 1H), 12.65 (b, 1H). 13C NMR
(DMSO-d6): dc 180.2, 178.7, 161.8, 150.6, 145.3, 138.9, 130.6,
128.2, 123.6, 122.8, 120.2, 38.2, 33.8, 27.5, 23.9. EI-MS m/z: 339.5
(M+H)+. Anal. Calcd for C18H18N4O3: C, 63.89; H, 5.36; N, 16.56.
Found: C, 63.92; H, 5.34; N, 16.57.
dure
C using 5-((4-(5-nitro-1H-benzo[d]imidazol-2-yl)phenyl)-
amino)-5-oxopentanoic acid 20 (0.1g, mmol), to afford 21
(0.218 g, 73% yield)as yellow solid. Mp—275–277 °C. 1H NMR
(DMSO-d6): dH 1.63–2.35 (m, 6H), 3.8 3(s, 3H), 7.69–8.57 (m, 7H)
10.19 (s, 1H). 13C NMR (DMSO-d6): dc 180.2, 173.3, 153.3, 148.6,
144.6, 140.2, 138.7, 128.3, 122.3, 120.2, 118.9, 116.3, 113.2, 52.3,
37.5, 32.8, 20.8. EI-MS m/z: 383.4 (M+H)+. Anal. Calcd for
C19H18N4O5: C, 59.68; H, 4.74 N, 14.65. Found: C, 59.69; H, 4.77 N,
14.62.
4.2.10.5. Methyl 5-((4-(5-methoxy-1H-benzo[d]imidazol-2-
4.2.10. General procedure for the synthesis of ester derivatives
(6, 11, 16, 21, 26, and 31), procedure C
yl)phenyl)amino)-5-oxopentanoate (26).
The compound
was prepared according to the general procedure C using 5-((4-
(5-methoxy-1H-benzo[d]imidazol-2-yl)phenyl)amino)-5-oxopen-
tanoic acid 25 (0.1 g, 0.28 mmol), to afford 26 (0.188 g, 61% yield)as
brown solid. Mp—251–253 °C. 1H NMR (DMSO-d6): dH 1.74–2.35
(m, 6H), 3.72 (s, 3H), 3.95 (s, 3H), 7.02–8.21 (m, 7H) 10.16 (s,
1H). 13C NMR (DMSO-d6): dc 180.1, 156.7, 153.4, 139.5, 138.6,
134.5, 128.4, 122.3, 120.2, 116.8, 112.1, 100.6, 56.3, 51.5, 37.1,
33.3, 21.2. EI-MS m/z: 368.3 (M+H)+. Anal. Calcd for C20H21N3O4:
C, 65.38; H, 5.76; N, 11.44. Found: C, 65.42; H, 5.72; N, 11.46.
To a well stirred solution of the corresponding carboxylic acid
analogues (1, 10, 20, 25 and 30) in methanol at 0 °C was added cat-
alytic amount of H2SO4. The reaction was then heated to reflux for
about 5–6 h (monitored by TLC and LCMS for completion). The sol-
vent was removed under vacuum, diluted with water and neutra-
lised with 10% sodium bicarbonate solution to a pH of 7, and
extracted repeatedly with ethyl acetate, (any trace amount of acid,
if left over was removed by sodium bicarbonate washings) The
combined organic layer was then dried over anhydrous sodium
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

14
R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
4.2.10.6. Methyl 5-((4-(3H-imidazo[4,5-b]pyridin-2-yl)phenyl)a-
mino)-5-oxopentanoate (31). The compound was prepared
according to the general procedure using 5-((4-(3H-imi-
4.2.11.4. 2-((2-((4-(5-Fluoro-1H-benzo[d]imidazol-2-yl)pheny-
l)amino)-2-oxoethyl)thio)acetic acid (36). The compound
C
was prepared according to the general procedure D using 4-(5-flu-
oro-1H-benzo[d]imidazol-2-yl)aniline 3b (0.1 g, 0.44 mmol), tri-
ethylamine (0.111 g, 1.1 mmol), 2,20-thiodiacetic acid (0.066 g,
0.44 mmol) and propylphosponic anhydride solution (0.35 g,
1.1 mmol) to afford 36 (0.203 g, 64% yield) as pale brown solid.
Mp—159–161 °C. 1H NMR (DMSO-d6): dH 3.2 (s, 2H), 3.41 (s, 2H),
7.06 -8.33 (m, 7H) 10.18 (s, 1H), 12.59 (b, 1H). 13C NMR (DMSO-
d6): dc 175.1, 168.8, 156.8, 153.2, 140.7, 139.1, 137.5, 128.4,
122.3, 120.2, 117.3, 110.3, 102.8, 44.1, 41.7. EI-MS m/z: 360.6
(M+H)+. Anal. Calcd for C17H14FN3O3S: C, 56.82; H, 3.93; N, 11.69.
Found: C, 56.85; H, 3.89; N, 11.71.
dazo[4,5-b]pyridin-2-yl)phenyl)amino)-5-oxopentanoic acid 30
(0.1 g, 0.31 mmol), to afford 31 (0.23 g, 72% yield)as pale brown
solid. Mp—230–232 °C. 1H NMR (DMSO-d6): dH 1.69 -2.32 (m,
6H), 3.43 (s, 3H), 7.03–8.26 (m, 7H) 10.14 (s, 1H). 13C NMR
(DMSO-d6): dc 180.3, 173.8, 162.3, 150.7, 145.6, 138.7, 130.5,
128.3, 123.9, 122.8, 120.3, 52.4, 37.3, 32.8, 20.8. EI-MS m/z: 339.3
(M+H)+. Anal. Calcd for C18H18N4O3: C, 63.89; H, 5.36; N, 16.56;
O, 14.19. Found: C, 63.86; H, 5.39; N, 16.54.
4.2.11. General procedure for the synthesis of oxygen and thio-
substituted acyl derivatives (33–44), procedure D
To a well stirred solution of the corresponding 4-(sub:-1H-
benzo[d]imidazol-2-yl)aniline/4-(3H-imidazo[4,5-b]pyridin-2-
yl)aniline (3a–f) (1 equiv) and triethylamine (2.5 equiv) in
dichloromethane was added the appropriate dicarboxylic acid
(1 equiv) followed by propylphosphonic anhydride solution
(2.5 equiv; 50% solution in ethyl acetate) at 0 °C. The reaction
mixture was warmed to room temperature and stirred at room
temperature for 8h (monitored by TLC and LCMS for completion).
The reaction mixture was then washed with water, brine dried
over anhydrous sodium sulfate and concentrated under reduced
pressure. The residue obtained was then purified by flash chroma-
tography to afford the desired product in good yield and purity as
described below.
4.2.11.5. 2-(2-((4-(5-Chloro-1H-benzo[d]imidazol-2-yl)pheny-
l)amino)-2-oxoethoxy)acetic acid (37).
The compound was
prepared according to the general procedure D using 4-(5-chloro-
1H-benzo[d]imidazol-2-yl)aniline 3c (0.1 g, 0.41 mmol), triethyl-
amine (0.104 g, 1.03 mmol), 2,20-oxydiacetic acid (0.055 g,
0.41 mmol) and propylphosponic anhydride solution (0.326 g,
1.03 mmol) to afford 37 (0.207 g, 70% yield)as off white solid.
Mp—278–280 °C. 1H NMR (DMSO-d6): dH 4.26 (s, 4H), 7.26–8.48
(m, 7H) 10.11 (s, 1H), 12.8 0(b, 1H). 13C NMR (DMSO-d6): dc
173.2, 169.5, 153.4, 138.8, 133.1, 131.5, 129.5, 127.9, 124.5,
122.2, 120.2, 116.8, 115.9, 69.3 67.8. EI-MS m/z: 360.7 (M+H)+.
Anal. Calcd for C17H14ClN3O4: C, 56.75; H, 3.92 N, 11.68. Found C,
56.79; H, 3.88 N, 11.69.
4.2.11.1. 2-(2-((4-(1H-Benzo[d]imidazol-2-yl)phenyl)amino)-2-
4.2.11.6. 2-((2-((4-(5-Chloro-1H-benzo[d]imidazol-2-yl)pheny-
oxoethoxy)acetic acid (33).
The compound was prepared
l)amino)-2-oxoethyl)thio)acetic acid (38).
The compound
according to the general procedure D using 4-(1H-benzo[d]imida-
zol-2-yl)aniline 3a (0.1 g, 0.48 mmol), triethylamine (0.121 g,
1.2 mmol), 2,20-oxydiacetic acid (0.064 g, 0.048 mmol) and propyl-
phosponic anhydride solution (0.38 g, 1.2 mmol) to afford 33
(0.188 g, 61% yield) as off white solid. Mp—244–246 °C. 1H NMR
(DMSO-d6): dH 4.25 (m, 4H), 7.32–8.14 (m, 8H), 10.16 (s, 1H),
12.83 (b, 1H). 13C NMR (DMSO-d6): dc 173.2, 170.1, 153.3, 141.5,
139.2, 127.6, 123.3, 122.2, 120.2, 115.5, 69.2, 68.6. EI-MS m/z:
326.4 (M+H)+. Anal. Calcd for C17H15N3O4: C, 62.76; H, 4.65; N,
12.92 Found: C, 62.79; H, 4.64; N, 12.91.
was prepared according to the general procedure D using 4-(5-
chloro-1H-benzo[d]imidazol-2-yl)aniline 3c (0.1 g, 0.41 mmol), tri-
ethylamine (0.104 g, 1.03 mmol), 2,2’-thiodiacetic acid (0.062 g,
0.41 mmol) and propylphosponic anhydride solution (g,
1.03 mmol) to afford 38 (0.227 g, 74% yield) as off white solid.
Mp—278–280 °C. 1H NMR (DMSO-d6): dH 3.21 (s, 2H), 3.40 (s,
2H), 7.24–8.39 (m, 7H) 10.18 (s, 1H), 12.65 (b, 1H). 13C NMR
(DMSO-d6): dc 174.8, 168.6, 153.2, 138.7, 133.2, 131.2, 129.4,
128.2, 124.5, 122.2, 120.3, 116.8, 115.9, 43.8, 41.4. EI-MS m/z:
376.3 (M+H)+. Anal. Calcd for C17H14ClN3O3S: C, 54.33; H, 3.75
N, 11.18. Found: C, 54.35; H, 3.77 N, 11.14.
4.2.11.2. 2-((2-((4-(1H-Benzo[d]imidazol-2-yl)phenyl)amino)-2-
oxoethyl)thio)acetic acid (34).
The compound was prepared
4.2.11.7. 2-(2-((4-(5-Nitro-1H-benzo[d]imidazol-2-yl)phenyl)a-
according to the general procedure D using 4-(1H-benzo[d]imida-
zol-2-yl)aniline 3a (0.1 g, 0.48 mmol), triethylamine (0.121 g,
1.2 mmol), 2,20-thiodiacetic acid (0.072 g, 0.048 mmol) and propyl-
phosponic anhydride solution (0.38 g, 1.2 mmol) to afford 34
(0.231 g, 70% yield)as pale brown solid. Mp—184–186 °C. 1H NMR
(DMSO-d6): dH 3.22 (s, 2H), 3.6 (s, 2H), 7.54–8.34 (m, 8H), 10.15
(s, 1H), 12.93 (b, 1H). 13C NMR (DMSO-d6): dc 175.2, 169.1, 153.2,
141.5, 139, 128.1, 123.2, 121.6, 119.5, 115.7, 44, 42.2. EI-MS m/z:
342.3 (M+H)+. Anal. Calcd for C17H15N3O3S: C, 59.81; H, 4.43; N,
12.31. Found: C, 59.78; H, 4.45.
mino)-2-oxoethoxy)acetic acid (39).
The compound was
prepared according to the general procedure D using 4-(5-chloro-
1H-benzo[d]imidazol-2-yl)aniline 3d (0.1 g, 0.39 mmol), triethyl-
amine, (0.1 g, 0.98 mmol), 2,20-oxydiacetic acid (0.053 g,
0.39 mmol) and propylphosponic anhydride solution (0.313 g,
0.98 mmol) to afford 39 (0.173 g, 59% yield) as yellow solid. Mp—
251–253 °C. 1H NMR (DMSO-d6): dH 4.23 (s, 4H), 7.72–8.55 (m,
7H), 10.15 (s, 1H), 12.58 (b, 1H). 13C NMR (DMSO-d6): dc 173.2,
169.8, 153.2, 147.9, 144.6, 140.2, 138.1, 122.2, 128.3, 119.9,
118.7, 116.5, 113.2, 69.2, 68.2. EI-MS m/z: 371.3 (M+H)+. Anal.
Calcd for C17H14N4O6: C, 55.14; H, 3.81; N, 15.13. Found: C,
55.16; H, 3.79; N, 15.12.
4.2.11.3. 2-(2-((4-(5-Fluoro-1H-benzo[d]imidazol-2-yl)pheny-
l)amino)-2-oxoethoxy)acetic acid (35).
The compound was
prepared according to the general procedure D using 4-(5-fluoro-
1H-benzo[d]imidazol-2-yl)aniline 3b (0.1 g, 0.44 mmol), triethyl-
amine (0.111 g, 1.1 mmol), 2,20-oxydiacetic acid (0.059 g,
0.44 mmol) and propylphosponic anhydride solution (0.35 g,
1.1 mmol) to afford 35 (0.186 g, 62% yield)as pale brown solid.
Mp—247–249 °C. 1H NMR (DMSO-d6): dH 4.23 (s, 4H), 7.00–8.11
(m, 7H) 10.15 (s, 1H), 12.94 (b, 1H). 13C NMR (DMSO-d6): dc 173.3,
170.2, 153.3, 141.1, 139.1, 137.8, 128.2, 122.3, 119.5, 117.2, 110.3,
101.9, 69.2, 68.5. EI-MS m/z: 344.02 (M+H)+. Anal. Calcd for C17H14-
FN3O4: C, 59.47; H, 4.11; N, 12.24. Found: C, 59.50 H, 4.10; N, 12.25.
4.2.11.8. 2-((2-((4-(5-Nitro-1H-benzo[d]imidazol-2-yl)phenyl)a-
mino)-2-oxoethyl)thio)acetic acid (40).
The compound was
prepared according to the general procedure D using 4-(5-chloro-
1H-benzo[d]imidazol-2-yl)aniline 3d (0.1 g, 0.39 mmol), triethyl-
amine (0.1 g, 0.98 mmol), 2,20-thiodiacetic acid (0.059 g,
0.39 mmol) and propylphosponic anhydride solution (0.313 g,
0.98 mmol) to afford 40 (0.173 g, 57% yield) as yellow solid. Mp—
231–233 °C. 1H NMR (DMSO-d6): dH 3.25 (s, 2H), 3.39 (s, 2H),
7.69–8.52 (m, 7H), 10.14 (s, 1H), 12.68 (b, 1H). 13C NMR (DMSO-
d6): dc 174.8, 168.5, 153.2, 148.2, 144.5, 140.1, 138.8, 128.1,
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
15
122.3, 120.2, 118.7, 116.5, 113.3, 43.8, 41.5. EI-MS m/z: 387.6
M+H)+. Anal. Calcd for C17H14N4O5S: C, 52.84; H, 3.65; N, 14.50.
Found C, 52.86; H, 3.63; N, 14.52.
were fromNew England Biolabs. E. coli DNA gyraseA gene was ampli-
fied using a forward primer 50CACCCATATGCTACGTTATGGTTTACCG
GC 30 and a reverse primer 50AGCTGCGGCCGCCCCACTGCCAGCA
TATTGCA 30 from the genomic DNA of E. coli DH5
a strain. Subse-
4.2.11.9. 2-(2-((4-(5-Methoxy-1H-benzo[d]imidazol-2-yl)pheny-
quently, the amplified PCR products were further digested with
NdeI and NotI and cloned into NdeI and NotI sites of pQE2 vector
under T5 promoter with His tag at N-terminal domain in our labo-
ratory. Similarly, the gene encoding S. aureus DNA gyraseB was
amplified from S. aureus RN4220 genomic DNA by using the for-
l)amino)-2-oxoethoxy)acetic acid (41).
The compound was
prepared according to the general procedure D using 4-(5-meth-
oxy-1H-benzo[d]imidazol-2-yl)aniline 3e (0.1 g, 0.42 mmol), tri-
ethylamine (0.11 g, 1.05 mmol), 2,20-oxydiacetic acid (0.056 g,
0.42 mmol) and propylphosponic anhydride solution (0.332 g,
1.05 mmol) to afford 41 (0.208 g, 70% yield)as buff coloured solid.
Mp—234–236 °C. 1H NMR (DMSO-d6): dH 4.26 (s, 4H), 3.91 (s, 3H),
7.03–8.24 (m, 7H) 10.15 (s, 1H), 12.65 (b, 1H). 13C NMR (DMSO-d6):
dc 171.3, 165.8, 155.8, 153.2, 139.8, 138.2, 134.8, 128.3, 122.3,
119.8, 115.8, 112.2, 100.3, 68.5, 56.8.. EI-MS m/z: 356.3 (M+H)+.
Anal. Calcd for C18H17N3O5: C, 60.84; H, 4.82; N, 11.83. Found: C,
60.87; H, 4.79; N, 11.85.
ward primer 50CACCCATATGGTGACTGCATTGTCAGA 30 and
a
reverse primer 50 AGCTAAGCTTTTAGAAGTCTAAGTTTGCAT 30
flanked with NdeI and HindIII sites. These digested products were
ligated at the same site of the pQE2 vector, downstream of the T5
promoter with an N-terminal His tag, the clone were later authen-
ticated by sequencing using a sequencer. Final clones were con-
firmed by sequencing in a sequencer. Further, for expression of
these clones, they were transformed into BL21-codon plus (DE3)
cells of E. coli. Transformants were grown in Luria Bertani (LB)
broth (Himedia) at 37 °C with shaking (rpm 140), in the presence
4.2.11.10. 2-((2-((4-(5-Methoxy-1H-benzo[d]imidazol-2-yl)phe-
nyl)amino)-2-oxoethyl)thio)acetic acid (42).
The compound
of ampicillin (100 lg/mL) (Sigma)until the starting optical density
was prepared according to the general procedure D using 4-(5-
methoxy-1H-benzo[d]imidazol-2-yl)aniline 3e (0.1 g, 0.42 mmol),
triethylamine (0.11 g, 1.05 mmol), 2,20-thiodiacetic acid (0.063 g,
0.42 mmol) and propylphosponic anhydride solution (0.332 g,
1.05 mmol) to afford 42 (0.189 g, 61% yield) as dark brown solid.
Mp—250–252 °C. 1H NMR (DMSO-d6): dH 3.26 (s, 2H), 3.39 (s,
2H), 3.92 (s, 3 H), 7.09–8.29 (m, 7H) 10.11 (s, 1H), 12.81 (b, 1H).
13C NMR (DMSO-d6): dc 174.8. 169.1.156.7, 153.1, 140.2, 138.7,
133.9, 128.2, 122.3, 120.2, 115.9, 111.8, 101.3, 56.3, 44.2, 41.8.
EI-MS m/z: 372.5 (M+H)+. Anal. Calcd for C18H17N3O4S: C, 58.21;
H, 4.61; N, 11.31. Found: C, 58.25; H, 4.65; N, 11.30.
of 0.1 reached the value of 0.4ꢀ0.6. The protein expression was
induced with 0.2 mM IPTG (Himedia) and further grown overnight
for induction of the protein, at 18 °C. Cells were harvested by cen-
trifugation (5500 rpm, 4 °C, 15 min) and suspended in lysis buffer
containing 20 mM Tris–HCl (pH 7.4), 0.1 M NaCl, 2 mM KCl,
10 mM Na2HPO4, 1.3 mM K2HPO4, 5% Glycerol, 1 mM DTT,
1:200 lL protease inhibitor cocktail. The mixture was further son-
icated (amplitude 35%, 1 s on 2 s off for 4 min) and was centrifuged
(12,000 rpm, 4 °C 20 min). To the supernatant, pre-equilibrated Ni-
NTA beads (GE Healthcare) were mixed and swirled for 1 h in cold
room, centrifuged at 500 rpm for 5 min at 4 °C, the pellets were
redissolved in lysis buffer and loaded onto the Bio-Rad column,
each loaded fraction was washed with 50 mL Tris–HCl (pH7.4),
500mM NaCl, 2 mM KCl, 10 mM Na2HPO4, 1.3 mM K2HPO4, 5%
Glycerol, 1 mM DTT. Protein was eluted with 25 mM Tris–HCl
(pH 8), 140 mM NaCl, 5% Glycerol, 1 mM DTT, and 1 mM PMSF. Ini-
tial wash was done with elution buffer without imidazole (Hime-
dia). Subsequently, various imidazole concentration gradients
were included from 5 mM to 500 mM. Samples were collected in
autoclaved 2 mL eppendorf tubes. Dialysis was performed 4 times
overnight against (25 mM Tris–HCl pH 7.4, 140 mM NaCl, 15% glyc-
erol, 2 mM dithiothreitol, 1 mM EDTA), and dialyzed protein was
concentrated at (3000 rpm, 4 °C) to a final concentration of
2.5 mg/mL. Later the purity of the protein was analysed by SDS
4.2.11.11. 2-(2-((4-(3H-Imidazo[4,5-b]pyridin-2-yl)phenyl)-
amino)-2-oxoethoxy)acetic acid (43).
The compound was
prepared according to the general procedure D using 4-(3H-imi-
dazo[4,5-b]pyridin-2-yl)aniline 3f (0.1 g, 0.48 mmol), triethyl-
amine, acid (0.12 g, 1.2 mmol), 2,20-oxydiacetic acid (0.063 g,
0.48 mmol) and propylphosponic anhydride solution (0.38 g,
1.2 mmol) to afford 43 (0.228 g, 73% yield)as pale brown solid.
Mp—273–275 °C. 1H NMR (DMSO-d6): dH 4.21 (s, 4H), 7.03–8.26
(m, 7H) 10.16 (s, 1H), 12.61 (b, 1H). 13C NMR (DMSO-d6): dc
173.4, 169.8, 162.2, 150.7, 145.6, 138.8, 130.8, 128.9, 123.8,
122.6, 120.3, 70.2, 67.8. EI-MS m/z: 327.4 (M+H)+. Anal. Calcd for
C16H14N4O4: C, 58.89; H, 4.32; N, 17.17. Found: C, 58.91; H, 4.30;
N, 17.19.
PAGE method. A 20
lL volume of the dialyzed protein was applied
on the polyacrylamide gel (1 mm, 10%), and 5
l
L of a commercially
4.2.11.12.
2-((2-((4-(3H-Imidazo[4,5-b]pyridin-2-yl)phenyl)a-
The compound was
available protein molecular weight marker (Bio-Rad) was added.
The electrophoresis was run in 1X TBE buffer (Tris–HCl pH 7.5,
1 mM boric acid, 1 mM EDTA) for a period of 90 min at a constant
voltage. Later the gel was transferred to a solution of Coomassie
Brilliant Blue dye mixed with 20% acetic acid. After 20 min of shak-
ing in an orbital shaker, it was destined several times with 10% ace-
tic acid in 30% methanol and 60% of water until the complete
staining is lost and transparency of the gel was achieved. Subse-
quently, the purity of the protein was determined to be >90% as
only single bands corresponding to its molecular weight of S. aur-
eus gyraseB was observed between 70 and 80 kDa, while that of
E. coli gyraseA was observed between 90 and 99 kDa.
mino)-2-oxoethyl)thio)acetic acid (44).
prepared according to the general procedure D using 4-(3H-imi-
dazo[4,5-b]pyridin-2-yl)aniline 3f (0.1 g, 0.48 mmol), triethyl-
amine, acid (0.12 g, 1.2 mmol), 2,20-thiodiacetic acid (0.071 g,
0.48 mmol) and propylphosponic anhydride solution (0.38 g,
1.2 mmol) to afford 44 (0.232 g, 71% yield) as brown solid. Mp—
250–252 °C. 1H NMR (DMSO-d6): dH 3.26 (s, 2H), 3.39 (s, 2H),
7.02–8.27 (m, 7H) 10.14 (s, 1H), 12.73 (b, 1H). 13C NMR (DMSO-
d6): dc 174.8, 168.5, 161.8, 150.6, 145.3, 138.8, 130.8, 128.5,
123.8, 122.6, 120.2, 43.8, 41.5. EI-MS m/z: 343.5 (M+H)+. Anal.
Calcd for C16H14N4O3S: C, 56.13; H, 4.12; N, 16.36. Found: C,
56.16; H, 4.09; N, 16.38.
4.3.2. In vitro screening of the compounds for inhibitory activity
and determination of IC50 values through ATPase assay
4.3. Biological activity
The proteins were expressed as described in Section 4.3.1. As
reported earlier, the purified S. aureus gyraseB does not have a
highly active ATPase activity like E. coli gyraseB.22 Hence gyraseB
assay was performed with recombinant proteins of E. coli gyraseA
and S. aureus gyraseB.19,23 As per the reports, the reaction is
4.3.1. E. coli DNA gyraseA and S. aureus DNA gyraseB cloning,
protein expression and purification
While the vectors were from Qiagen, the primers from
Sigma–Aldrich and all the enzymes unless otherwise mentioned
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

16
R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
activated to about 620 fold with incorporation of small molecular
weight DNA, in the assay as it is reported to stimulate the pro-
4.3.5. Inhibitions of biofilm formation
Biofilm assay was carried out in 96-well tissue culture plate
(TCP) method as described by Christensen et al.42 Detection of
the biofilm formation by the MRSA 96 strain was done as reported
earlier by the Congo red agar media (CRA)43 method. Though cer-
tain disadvantages are associated with this method, yet it was fol-
lowed due to its simple, economic and efficient process.43 The
screening was done using specially prepared solid medium that
is brain heart infusion broth (BHI) (Himedia) supplemented with
5% sucrose. Congo red stain was prepared as concentrated solution
and autoclaved at 121 °C for 15 min, added when the agar had
cooled to 55 °C.43 The strain was inoculated on to the plates pre-
pared, incubated for 36 h at 37 °C aerobically. The observation of
the black colonies has confirmed the biofilm producing nature of
the MRSA strain. Subsequently, the assay was performed in a 96-
well flat bottom tissue culture plate in tryticase soy broth with
1% glucose (TSB) (Himedia).
tein.23 Initially, equimolar quantities of about 0.5
lM each of
E. coli gyraseA and S. aureus gyraseB were incubated for a period
of 45 min with salmon sperm DNA (Sigma) in 50 mM Tris (pH
7.5), 75 mM ammonium acetate buffer for the reconstitution of
the hybrid topoisomerases at 4 °C. Later the assay was performed
in a 96-well microtiter plate as mentioned earlier.37 The assay buf-
fer includes 50 mM Tris (pH 7.5), 75 mM ammonium acetate, 5% w/
v glycerol, 0.5 mM EDTA, 6 mM magnesium chloride, 0.001% Triton
X-100, 1 mM dithiothreitol, DNA of 2
l
g/mL (ꢂ3
lM base pairs),
250 M ATP, 2.2 nM of E. coli gyraseA and S. aureus gyraseB. Reac-
l
tions were performed with various drug concentration ranges for
the calculation of IC50, with a negative moxifloxacin and positive
novobiocin control as standards. The reaction was allowed to pro-
ceed for 60 min and was quenched by addition of 20 lL of mala-
chite green reagent (POMG-25H, Bioassay systems, USA)
subsequently absorbance was read at 650 nm after 20 min incuba-
tion. Triton X-100 acts as a surfactant to prevent aggregation of
molecules during the assay.
4.3.5.1. Quantitative assay of the biofilm formed on 96-well
microtiter plates.
TSB media and incubated for 18 h at 37 °C with 120 rpm. Later the
culture was diluted 1 in 100 with fresh TSB medium and 200 L of
it was aliquoted into each of the wells along with the test com-
pounds at different concentrations of 100–1.56 M, while the con-
Isolates from agar plate were inoculated in
l
4.3.3. Determination of S. aureus DNA gyrase supercoiling
activity38 with (IC50) determination
Supercoiling assay was performed using the commercially
available kit (DNA gyrase supercoiling assay kit: SAS4001) from
Inspiralis Pvt. limited, Norwich, UK. The assay was performed in
1.5 mL eppendorf tubes at room temperature. 1 U of S. aureus
l
trol was incubated with DMSO solvent, though the DMSO usage
was limited to 4% during the assay. The plates were incubated
for 24 h at 37 °C in stationary phase with the lid closed. The con-
tents of each well was gently removed by tapping the plates
inverted, the plates were washed thrice with 0.2 mL of phosphate
buffer saline (PBS) at pH 7.2 to remove the unattached, dead and
free floating planktonic bacteria. The biofilm formed by adherent
sessile S. aureus MRSA 96 was fixed with sodium acetate (2%)
and stained with (0.1%w/v) crystal violet. As the crystal violet
stains the dead and live cells, it is limited to certain use, but in this
assay the wells were washed thrice so the chance of unattached
dead cells staining is almost neglected.43 Excess stain was rinsed
off by thorough washing with water and plates were dried in a
hot air oven. The plates were photographed. For the quantitative
estimation, absorbance was read at 570 nm by Perkin Elmer Victor
X3 plate reader. The optical density (OD) values reflected an index
of the S. aureus bacteria adhering to surface and forming biofilm.
The experiment was performed in triplicates, the background
absorbance was compensated by reading the OD from sterile med-
ium, fixative used, auto absorbance and dye which were averaged
and subtracted from all test values, and this mean OD was also
subtracted from the control well too. The control well OD was
0.28 which indicated that the MRSA 96 strain was a strong biofilm
producer. In general, OD values above 0.2 are considered as strong
biofilm producers.44 The inhibition percentage of the tested com-
pounds was calculated by the formula.
DNA gyrase was incubated with 0.5
lg of relaxed pBR 322 DNA
in 30 L reaction volume at 37 °C for 30 min with 40 mM HEPES.
l
KOH (pH 7.6), 10 mM magnesium acetate, 10 mM DTT, 2 mM
ATP, 500 mM potassium glutamate, 0.05 mg/mL albumin (BSA).
Standard compound novobiocin was the positive control and 4%
DMSO was considered as negative control. Subsequently, each
reaction was stopped by the addition of 30 lL of Stop dye [40%
sucrose, 100 mM Tris–HCl (pH 7.5), 1 mM EDTA and 0.5 mg/mL
bromophenol blue],39 briefly centrifuged for 45 s and was run in
1% agarose gel in 1X TAE buffer (40 mM Tris acetate, 2 mM EDTA).
Furthermore, concentration of the range of compounds that
inhibits 50% of supercoiling activity (IC50) was determined using
densitometry and NIH image through Bio-Rad GelDoc image
viewer.
4.3.4. Antimicrobial activity measurements
The Staphylococcus aureus bacterial culture (MTCC 3160) was
obtained from Microbial Type Culture Collection and Gene Bank,
Chandigarh, India while the MRSA 96 strain was obtained from
Sir Ronald Ross Institute of Tropical and Communicable Diseases
(Nallakunta, India). Minimum inhibitory concentrations for the
test compounds were determined by agar dilution method40
according to Clinical and Laboratory Standards Institute guide-
lines.41 The antibacterial activity study for forty one compounds
was performed at the Department of Pharmacy, Birla Institute of
Technology and Science, Hyderabad on both the strains separately.
Fresh overnight colonies from Mueller–Hinton agar (Hi-Media)
medium were suspended to a turbidity of approximately 106 col-
ony forming units (cfu)/mL. Stock solutions of tested compounds
and standards (ciprofloxacin and ofloxacin) were prepared in
0.9% saline. A control was set for the comparison of the test com-
pounds. A total of 1 mL of the bacterial suspension was added to
plates containing 19 mL of the media, so the test range was about
% Inhibition ¼ control reading ꢀ blank reading=control reading
ꢃ 100:
Further, the dry crystal violet stained plates were treated with
200 lL of 33% glacial acetic acid, given a brief shake in orbital sha-
ker and the plates were read at 570 nm in a Perkin Elmer Victor X3
96-well plate reader. The OD gives us the approximate count of the
cells involved in the biofilm formation.
4.3.6. Mammalian cytotoxicity studies
10 doubling dilutions from 100 lM to 0.1 lM. The plates were
A diploid human embryonic kidney cell line (HEK-293) from
ATCC was used to assess the cytotoxicity of all the forty one test
compounds as described before.45 Briefly, HEK-293 cells were
seeded at 5000 cells per well in a 96-well microtiter plate (NEST).
After 24 h incubation, the cells were washed with PBS and 2-fold
incubated at 35 °C in ambient air for about 16ꢀ20 h. The minimum
inhibitory concentration (MIC) for the compounds was considered
to be the lowest drug concentration that prevented the visible
growth of the bacteria on the agar plates.
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
17
dilutions of the drug was made in 200 lL of standard culture med-
Acknowledgments
ium (RPMI + 5% FBS + 1% penicillin and streptomycin) were added,
while the final DMSO concentration of the culture was limited to
0.5%. Further, the cultures were incubated with a drug concentra-
We are sincerely grateful to Prof. M. Meera and Gujjula Ravi
Kumar (Sir Ronald Ross Institute of Tropical and Communicable
Diseases (Nallakunta, India), Osmania University for help with S.
aureus MRSA 96 strain.
tion of 100 lM at 37 °C in 5% CO2/95% air for 72 h. Untreated cul-
tures with DMSO were included as controls. The viability of the
cells was assessed on the basis of cellular conversion of the dye
MTT (Methylthiazol-tetrazolium) into formazan crystals using Per-
kin Elmer Victor X3 Titre 96 plate reader at 570 nm. Ciprofloxacin
(3% inhibition) and novobiocin (9.8% inhibition) were used as a
positive controls.
Supplementary data
Supplementary data (additional experimental details concern-
ing e-pharmacophore modelling, docking studies, QikProp results)
associated with this article can be found, in the online version, at
http://dx.doi.org/10.1016/j.bmc.2014.09.008.
4.3.7. In vivo efficacy in mouse septicemia model
The in vivo antibacterial activity of the test compounds was
determined in CD-1 female mice (20–25 g bodyweight, ten per
group). The mice were infected intraperitoneally with a suspension
containing an amount of the indicated organism slightly greater
than its lethal dose 100 (3 ꢁ 107 cfu/mouse). The mice were trea-
ted orally intravenous (iv) with a specific amount of the test com-
pound administered after 4 h infection. Survival was assessed 24 h
post infection.
References and notes
1. McAdam, P. R.; Templeton, K. E.; Edwards, G. F.; Holden, M. T.; Feil, E. J.;
Aanensen, D. M.; Bargawi, H. J.; Spratt, B. G.; Bentley, S. D.; Parkhill Proc. Natl.
Acad. Sci. 2012, 109, 9107.
2. Lele, A. C.; Tawari, N. R.; Degani, M. S. Int. J. Pharm. Biosci. Technol. 2013, 1, 34.
3. Ginzburg, E.; Namias, N.; Brown, M.; Ball, S.; Hameed, S. M.; Cohn, S. M. Int. J.
Antimicrob. Agents 2000, 16, 39.
4. Eakin, A. E.; Green, O.; Hales, N.; Walkup, G. K.; Bist, S.; Singh, A.; Mullen, G.;
Bryant, J.; Embrey, K.; Gao, N. Antimicrob. Agents Chemother. 2012, 56, 1240.
5. Waters, E. M.; Rudkin, J. K.; Schaeffer, C. R.; Lohan, A. J.; Tong, P.; Loftus, B. J.;
Fey, P. D.; Massey, R. C.; O’Gara, J. P.; Pozzi, C. PLoS Pathog. 2012, 8, 1002626.
6. Basarab, G. S.; Manchester, J. I.; Bist, S.; Dangel, B.; Illingworth, R.; Sriram, S.;
Boriack-Sjodin, P. A.; Sherer, B. A.; Uria-Nickelsen, M.; Eakin, A. J. Med. Chem.
2013, 56, 8712.
7. Brvar, M.; Perdih, A.; Renko, M.; Anderluh, G.; Turk, D. A.; Solmajer, T. J. Med.
Chem. 2012, 55, 6413.
8. Maxwell, A. Trends Microbiol. 1997, 5, 102.
9. Brvar, M.; Perdih, A.; Hodnik, V.; Renko, M.; Anderluh, G.; Jerala, R.; Solmajer, T.
Bioorg. Med. Chem. 2012, 20, 2572.
10. Champoux, J. J. Annu. Rev. Biochem. 2001, 70, 369.
11. Minovski, N.; Perdih, A.; Solmajer, T. J. Mol. Model. 2012, 18, 1735.
12. Fournier, B.; Zhao, X.; Lu, T.; Drlica, K.; Hooper, D. C. Antimicrob. Agents
Chemother. 2000, 44, 2160.
13. Jackson, A. P.; Maxwell, A. Proc. Natl. Acad. Sci. 1993, 90, 11232.
14. Garry, M. W. The Am. J. Med. Sci. 1958, 236, 330.
15. Oblak, M.; Kotnik, M.; Solmajer, T. Curr. Med. Chem. 2007, 14, 2033.
16. Lafitte, D.; Lamour, V.; Tsvetkov, P. O.; Makarov, A. A.; Klich, M.; Deprez, P.;
Moras, D.; Briand, C.; Gilli, R. Biochemistry 2002, 41, 7217.
17. Angehrn, P.; Goetschi, E.; Gmuender, H.; Hebeisen, P.; Hennig, M.; Kuhn, B.;
Luebbers, T.; Reindl, P.; Ricklin, F.; Schmitt-Hoffmann, A. J. Med. Chem. 2011, 54,
2207.
18. Ronkin, S. M.; Badia, M.; Bellon, S.; Grillot, A.-L.; Gross, C. H.; Grossman, T. H.;
Mani, N.; Parsons, J. D.; Stamos, D.; Trudeau, M. Bioorg. Med. Chem. Lett. 2010,
20, 2828.
19. Sherer, B. A.; Hull, K.; Green, O.; Basarab, G.; Hauck, S.; Hill, P.; Loch, J. T., III;
Mullen, G.; Bist, S.; Bryant, J. Bioorg. Med. Chem. Lett. 2011, 21, 7416.
20. Friesner, R. A.; Murphy, R. B.; Repasky, M. P.; Frye, L. L.; Greenwood, J. R.;
Halgren, T. A.; Sanschagrin, P. C.; Mainz, D. T. J. Med. Chem. 2006, 49, 6177.
21. Poyraz, O. M.; Jeankumar, V. U.; Saxena, S.; Schnell, R.; Haraldsson, M.;
Yogeeswari, P.; Sriram, D.; Schneider, G. J. Med. Chem. 2013, 56, 6457.
22. Blanche, F.; Cameron, B.; Bernard, F.-X.; Maton, L.; Manse, B.; Ferrero, L.; Ratet,
N.; Lecoq, C.; Goniot, A.; Bisch, D. Antimicrob. Agents Chemother. 1996, 40, 2714.
23. Eakin, A.; Ehmann, D.; Gao, N.; Karantzeni, I.; Walkup, G.; Google Patents. 2004.
24. Ince, D.; Zhang, X.; Hooper, D. C. Antimicrob. Agents Chemother. 2003, 47, 1410.
25. Donlan, R. M. J. Clin. Infect. Dis. 2001, 33, 1387.
4.3.8. hERG (orthologous to human ether-a-go-go-related gene)
channel inhibition studies
hERG studies were conducted using zebrafish larval model. Zeb-
rafish were procured commercially from Vikrant Aquaculture,
Mumbai, India. They were maintained in a recirculatory system
containing 0.06% sea salt under 14 h light and 10 h dark cycle
and 28 °C water temperature.46 Males and females were main-
tained in different tanks before they were allowed to breed. Breed-
ing of zebrafish were allowed in the ratio of 2 females: 3 males
under the sudden stimulation of light. Subsequently, embryos
were collected into petridish containing E3 medium (5 mM NaCl,
0.17 mM KCl, 0.33 mM CaCl2 and 0.33 mM MgSO4) and incubated
at 28 °C temperature.47 In this assay 3 dpf embryos were distrib-
uted in a 24-well plate along with 250 lL of 0.1% DMSO solution,
while the stocks were prepared in 100% DMSO, working concentra-
tions of the compound was prepared by serial dilutions. Each well
containing 5 embryos were treated with each required concentra-
tion of the solution and incubated at 28 °C for 4 h. Later, individual
embryo of each well was focused under light microscope (Leica)
and heartbeat was observed (i.e., atrial and ventricular beats).
The time taken for 30 beats was measured with the help of stop-
watch while the mean for the time taken by 5 embryos was calcu-
lated for each well. Subsequently, the number of heart beats per
minute was calculated as follows:
1800=X ¼ beats=minute ðwhere X ¼ time in secondsÞ:
26. (a) Donlan, R. M. Emerg. Infect. Dis. 2001, 7, 277; (b) Barie, P. S. World J. Surg.
1998, 22, 118.
27. Smith, K.; Perez, A.; Ramage, G.; Lappin, D.; Gemmell, C. G.; Lang, S. J. Med.
Microbiol. 2008, 1018, 57.
28. Giacometti, A.; Cirioni, O.; Gov, Y.; Ghiselli, R.; Del Prete, M. S.; Mocchegiani, F.;
Saba, V.; Orlando, F.; Scalise, G.; Balaban, N. Antimicrob. Agents Chemother.
1979, 2003, 47.
29. Ma, Y.; Xu, Y.; Yestrepsky, B. D.; Sorenson, R. J.; Chen, M.; Larsen, S. D.; Sun, H.
PLoS ONE 2012, 7, 47255.
30. Sriram, D.; Yogeeswari, P.; Basha, J. S.; Radha, D. R.; Nagaraja, V. Bioorg. Med.
Chem. 2005, 13, 5774.
31. Alexandrou, A. J.; Duncan, R. S.; Sullivan, A.; Hancox, J. C.; Leishman, D. J.;
Witchel, H. J.; Leaney, J. L. Br. J. Pharmacol. 2006, 147, 905.
32. Chen, X.; Cass, J. D.; Bradley, J. A.; Dahm, C. M.; Sun, Z.; Kadyszewski, E.;
Engwall, M. J.; Zhou, J. Br. J. Pharmacol. 2005, 146, 792.
33. Ahuja, V.; Sharma, S. J. Appl. Toxicol. 2013, 34, 576.
34. Milan, D. J.; Peterson, T. A.; Ruskin, J. N.; Peterson, R. T.; MacRae, C. A.
Circulation 2003, 107, 1355.
4.3.9. Differential scanning fluorimetry (DSF): biophysical and
structural evaluation of benzimidazole chemical class
The active compounds from this series of chemical class of mol-
ecules were further investigated using a biophysical technique, dif-
ferential scanning fluorimetry. The ability of the compounds to
stabilize the catalytic domain of the gyrase protein was assessed
utilizing the DSF technique by which the thermal stability of the
catalytic domain of gyraseB native protein and of the protein with
the ligand is measured.7 Complex with compound 10 were heated
stepwise from 25 °C to 95 °C in steps of 0.6 °C in the presence of the
fluorescent dye, whose fluorescence increases as it interacts with
hydrophobic residues of the gyraseB protein. As the protein gets
denatured the amino acid residues become exposed to the dye.9
A right side positive shift of Tm in comparison to native protein
means higher stabilization of the protein-ligand complexes, which
is a consequence of the inhibitor binding.36
35. Mittelstadt, S.; Hemenway, C.; Craig, M.; Hove, J. J. Pharmacol. Toxicol. Methods
2008, 57, 100.
36. Niesen, F. H.; Berglund, H.; Vedadi, M. Nat. Protoc. 2007, 2, 2212.
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008

18
R. Janupally et al. / Bioorg. Med. Chem. xxx (2014) xxx–xxx
37. Green, O. M.; Hull, K. G.; Ni, H.; Hauck, S. I.; Mullen, G. B.; Breeze, A. L.; Hales, N.
J.; Timms, D.; Google Patents. 2010.
38. Hossion, A. M.; Zamami, Y.; Kandahary, R. K.; Tsuchiya, T.; Ogawa, W.; Iwado,
A.; Sasaki, K. J. Med. Chem. 2011, 54, 3686.
39. Hallett, P.; Grimshaw, A.; Wigley, D.; Maxwell, A. Gene 1990, 93, 139.
40. Pandeya, S.; Sriram, D.; Nath, G.; DeClercq, E. Eur. J. Pharmacol. Sci. 1999, 9, 25.
41. Ferraro, M. J.; NCCLS: 2000.
43. Freeman, D.; Falkiner, F.; Keane, C. J. Clin. Pathol. 1989, 42, 872.
44. Mathur, T.; Singhal, S.; Khan, S.; Upadhyay, D.; Fatma, T.; Rattan, A. Indian J.
Med. Microbiol. 2006, 24, 25.
45. Sriram, D.; Senthilkumar, P.; Dinakaran, M.; Yogeeswari, P.; China, A.; Nagaraja,
V. J. Med. Chem. 2007, 50, 6232.
46. Banote, R. K.; Koutarapu, S.; Chennubhotla, K. S.; Chatti, K.; Kulkarni, P. Epilepsy
Behav. 2013, 27, 212.
42. Christensen, G. D.; Simpson, W.; Younger, J.; Baddour, L.; Barrett, F.; Melton, D.;
Beachey, E. J. Clin. Microbiol. 1985, 22, 996.
47. Jung, T.-P.; Makeig, S.; Westerfield, M.; Townsend, J.; Courchesne, E.;
Sejnowski, T. J. Clin. Neurophysiol. 2000, 111, 1745.
Please cite this article in press as: Janupally, R.; et al. Bioorg. Med. Chem. (2014), http://dx.doi.org/10.1016/j.bmc.2014.09.008