Synthesis of new 5-substituted pyrimidine acyclonucleosides

Article abstract of DOI:10.1080/00397910500498994

Acyclonucleosides of pyrimidine were prepared by condensing appropriately silylated 5-substituted pyrimidines with an acyclic side chain in the form of an acetylated haloalkoxyalcohol and subsequent removal of the protecting acetyl group in base. Also, ac

Full text of DOI:10.1080/00397910500498994

This article was downloaded by: [University of Bristol]
On: 25 February 2015, At: 15:27
Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office:
Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Synthetic Communications: An International
Journal for Rapid Communication of
Synthetic Organic Chemistry
Publication details, including instructions for authors and subscription
information:
http://www.tandfonline.com/loi/lsyc20
Synthesis of New 5‐Substituted Pyrimidine
Acyclonucleosides
Ahmed F. Khattab a
a Chemistry Department, Faculty of Science , Monoufiya University , Shebien
El‐Koam, Egypt
Published online: 16 Aug 2006.
To cite this article: Ahmed F. Khattab (2006) Synthesis of New 5‐Substituted Pyrimidine Acyclonucleosides,
Synthetic Communications: An International Journal for Rapid Communication of Synthetic Organic Chemistry,
36:8, 1097-1107, DOI: 10.1080/00397910500498994
To link to this article: http://dx.doi.org/10.1080/00397910500498994
PLEASE SCROLL DOWN FOR ARTICLE
Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”)
contained in the publications on our platform. However, Taylor & Francis, our agents, and our
licensors make no representations or warranties whatsoever as to the accuracy, completeness, or
suitability for any purpose of the Content. Any opinions and views expressed in this publication
are the opinions and views of the authors, and are not the views of or endorsed by Taylor &
Francis. The accuracy of the Content should not be relied upon and should be independently
verified with primary sources of information. Taylor and Francis shall not be liable for any
losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities
whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or
arising out of the use of the Content.
This article may be used for research, teaching, and private study purposes. Any substantial
or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or
distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use
can be found at http://www.tandfonline.com/page/terms-and-conditions

Synthetic Communicationsw, 36: 1097–1107, 2006
Copyright # Taylor & Francis Group, LLC
ISSN 0039-7911 print/1532-2432 online
DOI: 10.1080/00397910500498994
Synthesis of New 5-Substituted Pyrimidine
Acyclonucleosides
Ahmed F. Khattab
Chemistry Department, Faculty of Science, Monoufiya University,
Shebien El-Koam, Egypt
Abstract: Acyclonucleosides of pyrimidine were prepared by condensing appropri-
ately silylated 5-substituted pyrimidines with an acyclic side chain in the form of an
acetylated haloalkoxyalcohol and subsequent removal of the protecting acetyl group
in base. Also, acyclonucleosides with a 1-ethoxymethyl side chain have been investi-
gated. The activity against hepatitis B virus (HBV) has been tested.
Keywords: Pyrimidine acyclonucleosides, substituted pyrimidines
The synthesis and biological evaluation of modified acyclonucleosides have
been very active research areas for a number of years. Several pyrimidine acy-
clonucleosides are presently known as potent antiviral agents.[1–5] Among
them, acyclic nucleoside of the 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)
thymine (HEPT) type has shown high selectivity toward HIV-1,[6,7] and it
was found that replacement of the sulfur atom with a methylene group
resulted in a new series of potent HEPT analogues, of which MKC-442
(6-benzyl-1-ethoxymethyl-5-isopropyluracil) was found to be extremely
potent.[8,9] Therefore, a series of new pyrimidine acyclonucleosides are still
of great interest as potential new active compounds with less prominent
side effects.
We have previously reported the condensation between methyl 2-deoxy-
3,5-di-O-toluoyl-D-pentofuranoside and silylated pyrimidines gave anomeric
mixtures of 20-deoxynucleosides, which can be envisaged as formal analogues
of nucleic acids components.[10] As a continuation of our interest in this area,
Received in the U.K. June 27, 2005
Address correspondence to Ahmed F. Khattab, Chemistry Department, Faculty of
Science, Monoufiya University, Shebien El-Koam, Egypt. E-mail: khattab2000@
yahoo.com
1097

1098
A. F. Khattab
we now report the synthesis and anti-HBV activity of a new series of
pyrimidine acyclonucleosides in which the carbohydrate moiety has been
replaced by an acyclic side chain[11]
RESULTS AND DISCUSSION
The starting 4-hydroxy-6(1H)-pyrimidinones 2a–d have been prepared on
condensation of malondiamide derivatives 1a–d with formamide in the
presence of sodium ethoxide by the method of Hull.[12] Silylation of 2a–d
with 1,1,1,3,3,3-hexamethyldisilazane (HMDS) in the presence of a
catalytic amount of ammonium sulfate was performed according to
Wittenburg[13] to give the derivatives 3a–d. The latter were condensed
with 2-acetoxyethoxy methyl bromide[14] using the trimethylsilyl trifluoro-
methanesulfonate (TMS triflate) using method of Vorbru¨ggen et al.[15] in
anhydrous acetonitrile to give acyclonucleosides (4a–d) in 65–76% yield.
After their chromatographic purification, treatment of these nucleosides
with methanolic ammonia at room temperature for 24 h, followed by chroma-
tographic purification, resulted in complete deprotection of the hydroxyl
group, and the corresponding 1-(2-hydroxyethoxymethyl)pyrimidine deriva-
tives (5a–d) were obtained in 82–90% yield (Scheme 1). The structures of
the new compounds were determined on the basis of their elemental micro-
analyses and spectral data, which are in agreement with their proposed
structures
Scheme 1.

Synthesis of New 5-Substituted Pyrimidine Acyclonucleosides
1099
Similarly, condensation of bromomethyl ethyl ether with the silylated
pyrimidines 3a–b, using TMS triflate as the Lewis acid catalyst, gives the
alkylated products 6–8. As reported in Scheme 2, N-alkylated products
6a,c,d were obtained, on condensation of bromomethyl ethyl ether with
3a,c,d, as the sole products in fairly good yields. However, in the case of
alkylation of 5-ethylpyrimidine derivative 3b, column chromatographic puri-
fication of the reaction mixture gave two products. The less polar product
appeared to be the required N-alkylated product (30% yield). The 1H
NMR spectrum of the more polar product (25% yield) showed the
presence of ethoxymethyl moiety, which shifted downfield compared with
that of N-alkylated product 7. The methylene singlet signal appeared at d
5.49 ppm for the product 8, compared to d 5.24 ppm for N-alkylated
product 7. In addition, the 13C NMR spectrum showed the chemical shift
at C-1 of acyclic part of 7 at d 74.38 ppm and that of compound 8at d
90.28 ppm. This indicated that the alkylation of 3b occurred on the
nitrogen atom to give N-alkylated product 7 and on the oxygen atom to
give O-alkylated product 8, respectively. The FAB-mass spectra of 7 and
8 showed the same protonated positive molecular ion peak (M þ H)þ at
m/z 199. An attempt to synthesize the acyclonucleosides 4–7 by simple
alkylation of the sodium salt of the pyrimidines 2a–d with the appropriate
halomethyl ethers according to the method of Sasaki et al.[16] was
unsuccesful.
Preliminary viral screening against HBV indicated that compounds 4a
and 4c showed moderate viral replication inhibition and low cytotoxicity.
Compounds 5a, 5d, and 6a showed high inhibition with moderate cytotixicity,
Scheme 2.

1100
A. F. Khattab
Table 1. Inhibition of HBV replication by selected compounds
Inhibition (%)
2 weeks
Compound
(10 mM)
Cytotoxicity
(%)
1 week
3 weeks
4a
4c
5a
5d
6a
6c
6d
7
24.6
26.7
80.5
78.7
80.6
79.5
80.4
85.8
75.2
18.3
14.6
78.7
75.2
77.5
75.4
78.5
83.4
80.5
11.1
9.3
4.8
4.6
72.3
70.4
70.6
73.5
71.1
80.5
70.2
15.2
13.0
14.1
4.2
4.8
2.5
8
3.4
and compounds 6c, 6d, 7, and 8 showed high inhibition with low cytotoxicity
(Table 1).
EXPERIMENTAL
Melting points were determined on a Boetius melting-point apparatus and are
uncorrected. Elemental analysis were carried out in the Microanalytical Lab-
oratories of the Faculty of Science, Cairo University. 1H and 13C NMR spectra
were recorded on a Bruker AC 250 FT-NMR spectrometer at 250 MHz for 1H
NMR and 62.9 MHz for 13C NMR. Mass spectra were recorded using fast
atom bombardment (FAB) on a Kratos Ms 50-spectrometer. Analytical TLC
plates 60 F254 and silica gel (0.040–0.063 mm) were purchased from
Merck. Anhydrous CH3CN was distilled from P2O5, followed by distillation
from CaH. All other solvents were used after distillation and drying. Viral
screening against HBV has been done at National Liver Institute,
Monoufiya University, Shebien El-Koam, Egypt.
General Procedure for the Preparation of Compounds (2a–c)
A mixture of methyl malondiamide 1a or ethyl malondiamide 1b and/or
n-butyl malondiamide 1c (10 mmol), formamide (15 mmol), and sodium
ethoxide [prepared by dissolving 0.92 g (40 mmol) of sodium metal in 30 ml
of ethanol] was refluxed for 12 h. The mixture was evaporated to dryness
under reduced pressure, and the obtained residue was dissolved in water
and acidified with 4M HCl. The solid product was filtered off, dried, and
recrystallized from the proper solvent to afford 2a, 2b, and 2c, respectively,
as white prisms in 71–83% yields.

Synthesis of New 5-Substituted Pyrimidine Acyclonucleosides
Data
1101
4-Hydroxy-5-methylpyrimidin-6(1H)-one (2a). White prisms from
methanol, (yield 83%): mp .3208C (reported[17] yield 52%, mp .3308C).
1H NMR (DMSO-d6), (d ppm): 1.77 (s, 3H, CH3), 7.93 (s, 1H, C2-H),
11.63 (sb, 1H, OH), 12.01 (sb, 1H, NH). 13C NMR (DMSO-d6), (d ppm):
7.68 (CH3), 97.98 (C5), 146.30 (C2), 163.07, 164.38 (C4 and C6). Anal.
cacld. for C5H6N2O2: C, 47.62; H, 4.80; N, 22.21. Found: C, 47.85; H,
5.12; N, 21.90.
5-Ethyl-4-hydroxypyrimidin-6(1H)-one (2b). White prisms from methanol,
(yield 71%): mp .3208C. 1H NMR (DMSO-d6), (d ppm): 0.97 (t, 3H,
J ¼ Hz, CH3CH2), 2.31 (q, 2H, J ¼ 7.3 Hz, CH2CH3), 7.92 (s, 1H, C2-H),
11.61 (sb, 1H, OH), 11.90 (sb, 1H, NH). 13C NMR (DMSO-d6), (d ppm)
12.45 (CH3), 15.49 (CH2), 104.26 (C5), 146.58 (C2), 163.01, 164.06 (C4
and C6). Anal. calcd. for C6H8N2O2: C, 51.42; H, 5.75; N, 19.99. Found: C,
51.12; H, 5.80; N, 20.25.
5-Butyl-4-hydroxypyrimidin-6(1H)-one (2c). White prisms from ethanol,
1
(yield 77%): mp 288–2908C (reported[18] yield 39%, mp 2828C). H NMR
(DMSO-d6), (d ppm): 0.87 (t, 3H, J ¼ 7.0 Hz, CH3), 1.23–1.44 (m, 4H,
CH3CH2CH2CH2), 2.25–2.31 (t, 2H, J ¼ 7.2 Hz, CH3CH2CH2CH2), 7.89
(s, 1H, C2-H), 11.60 (sb, 1H, OH), 12.20 (sb, 1H, NH). 13C NMR (DMSO-
d6), (d ppm): 13.83 (CH3), 21.81, 22.11, 29.70 (3 ꢀ CH2), 102.88 (C5),
146.51 (C2), 162.34, 164.28 (C4 and C6). Anal. calcd. for C8H12N2O2: C,
57.13; H, 7.19; N, 16.66. Found: C, 57.43; H, 7.54; N, 16.47.
4-Hydroxy-5-phenylpyrimidin-6(1H)-one (2d)
This compound was prepared according to ref. 12.
General Procedure for the Preparation of Compounds (4a–d)
A mixture of pyrimidine derivatives 2a–d (10 mmol), 1,1,1,3,3,3-hexam-
ethyldisilazane (HMDS) (30 ml), and ammonium sulfate (30 mg) was heated
under reflux for 6 h. The mixture was concentrated at room temperature
under reduced pressure to obtain the silylated derivatives 3a–d as pale
yellow oil. Anhydrous MeCN (20 ml) was added, and the solution was
stirred at 2258C. TMS triflate (2.35 g, 10.5 mmol) was added to the mixture
followed by the dropwise addition of the 2-acetoxyethoxy methyl bromide
(20 mmol) in anhydrous MeCN (5 ml). The reaction mixture was stirred at
2258C for 2 h and then at room temperature for 1 h. The reaction mixture
was diluted with 200 ml of CH2Cl2 and washed with ice-cold saturated
aqueous NaHCO3 (4 ꢀ 100 ml). The organic phase was separated, washed
with cold water (4 ꢀ 100 ml), dried over Na2SO4, and evaporated to obtain

1102
A. F. Khattab
the crude products, which were chromatographed on a silica-gel column using
methanol/chloroform (5–10%) as eluent.
Data
1-[(2-Acetoxyethoxy)methyl]-4-hydroxy-5-methylpyrimidin-6(1H)-one (4a).
White solid (yield 68%), mp 104–1068C. 1H NMR (DMSO-d6), (d ppm): 1.79
(s, 3H, CH3), 1.98 (s, 3H, CH3CO), 3.63–3.75 (m, 2H, CH2), 4.07–4.11
(m, 2H, CH2), 5.28 (s, 2H, NCH2O), 8.27 (s, 1H, C2-H), 11.35 (sb, 1H,
OH). 13C NMR (DMSO-d6), (d ppm): 8.05 (CH3), 20.46 (CH3CO), 62.83
(CH2), 67.02 (CH2), 74.71 (NCH2O), 97.25 (C5), 149.88 (C2), 162.32 (C4),
164.85 (C6), 170.16 (COCH3). FAB MS: m/z (%) 243 (M þ 1, 100), 154
(36). Anal. cacld. for C10H14N2O5: C, 49.58; H, 5.82; N, 11.56. Found: C,
49.32; H, 6.10; N, 11.78.
1-[(2-Acetoxyethoxy)methyl]-4-hydroxy-5-ethylpyrimidin-6(1H)-one (4b).
1
White solid (yield 65%), mp 106–1088C,. H NMR (CDCl3), (d ppm): 1.12
(t, 3H, J ¼ 7.3 Hz, CH3CH2), 2.08 (s, 3H, CH3CO), 2.51 (q, 2H,
J ¼ 7.3 Hz, CH2CH3), 3.85–3.89 (m, 2H, CH2), 4.20–4.24 (m, 2H, CH2),
5.26 (s, 2H, NCH2O), 8.07 (s, 1H, C2-H), 11.32 (sb, 1H, OH). 13C NMR
(CDCl3), (d ppm): 11.92 (CH3), 16.15 (CH2), 20.56 (CH3CO), 62.63 (CH2),
68.22 (CH2), 75.46 (NCH2O), 106.31 (C5), 147.42 (C2), 162.29 (C4),
164.08 (C6), 170.60 (CH3CO). FAB MS: m/z (%) 257 (M þ 1, 100), 154
(47). Anal. calcd. for C11H16N2O5: C, 51.56; H, 6.29; N, 10.93. Found: C,
51.85; H, 6.50; N, 11.22.
1-[(2-Acetoxyethoxy)methyl]-4-hydroxy-5-n-butylpyrimidin-6(1H)-one (4c).
White solid (yield 65%), mp 78–808C,. 1H NMR (CDCl3), (d ppm): 0.86–0.91
(t, 3H, J ¼ 7.0 Hz, CH3CH2CH2), 1.21–1.41 (m, 4H, CH3CH2CH2CH2), 1.96
(s, 3H, CH3CO), 2.23–2.30 (t, 2H, J ¼ 6.8 Hz, CH3CH2CH2CH2), 3.64–3.73
(m, 2H, CH2), 4.12–4.23 (m, 2H, CH2), 5.24 (s, 2H, NCH2O), 8.26(s, 1H, C2-
H), 11.25 (sb, 1H, OH). 13C NMR (CDCl3), (d ppm): 13.66 (CH3), 20.43
(CH3CO), 22.01, 22.15, 28.46 (3 ꢀ CH2), 62.81 (CH2), 68.11 (CH2), 74.37
(NCH2O), 103.88 (C5), 146.43 (C2), 161.73, 163.64 (C6), 170.35 (COCH3).
FAB MS: m/z (%) 285 (M þ 1, 100), 154 (32). Anal. calcd. for C13H20N2O5:
C, 54.92; H, 7.09; N, 9.85. Found. C, 55.13; H, 7.21, N, 10,12.
1-[(2-Acetoxyethoxy)methyl]-4-hydroxy-5-phenylpyrimidin-6(1H)-one (4d).
1
White solid (yield 76%), mp 136–1388C,. H NMR (CDCl3), (d ppm): 2.02
(s, 3H, CH3), 3.81–3.85 (m, 2H, CH2), 4.15–4.18 (m, 2H, CH2), 5.33
(s, 2H, NCH2O), 7.30–7.63 (m, 5H, Ar-H), 8.04 (s, 1H, C2-H), 11.46 (sb,
1H, OH). 13C NMR (CDCl3), (d ppm): 20.56 (CH3), 62.78 (CH2), 68.45
(CH2), 75.81 (NCH2O), 104.63 (C5), 127.52, 127.80, 130.09, 130.49 (Ar-C),
148.68 (C2), 161.31 (C4), 163.84 (C6), 170.73 (COCH3). FAB MS: m/z

Synthesis of New 5-Substituted Pyrimidine Acyclonucleosides
1103
(%) 305 (M þ 1, 100), 189 (32), 154 (58). Anal. calcd. for C15H16N2O5: C,
59.21; H, 5.30; N, 9.21. Found: C, 59.52; H, 5.11; N, 9.50.
General Procedure for the Preparation of (5a–d)
A mixture of 4a, 4b, 4c, and/or 4d (5 mmol), methanol (25 ml), and concen-
trated aqueous ammonia (25%, 25 ml) was stirred at room temperature for
24 h. The solvent was evaporated under reduced pressure, and the residue
was purified on a silica-gel column using 5–10% methanol in diethyl ether
to give 5a–d in 82–90% yields.
Data
4-Hydroxy-1-[(2-hydroxyethoxy)methyl]-5-methylpyrimidin-6(1H)-one (5a).
Colorless oil (yield 87%). 1H NMR (DMSO-d6), (d ppm): 1.77 (s, 3H, CH3),
3.54–3.61 (m, 2H, CH2), 3.75–3.84 (m, 2H, CH2), 4.53 (sb, 1H, OH),
5.16 (s, 2H, NCH2O), 8.07 (s, 1H, C2-H), 11.26 (sb, 1H, OH). 13C NMR
(DMSO-d6), (d ppm): 8.04 (CH3), 61.78 (CH2), 68.04 (CH2), 72.62
(NCH2O), 98.01 (C5), 147.86 (C2), 161.23 (C4), 163.58 (C6). Anal.
calcd. for C8H12N2O4: C, 48.00; H, 6.04; N, 13.99. Found: 48.32; H, 5.95;
N, 14.12.
5-Ethyl-4-hydroxy-1-[(2-hydroxyethoxy)methyl]pyrimidin-6(1H)-one (5b).
Colorless oil (yield 85%). 1H NMR (DMSO-d6), (d ppm): 1.11 (t, 3H, J ¼ 7.1,
CH3CH2), 2.44 (q, 2H, J ¼ 7.3 Hz, CH2CH3), 3.75–3.79 (m, 2H, CH2),
4.11–4.17 (m, 2H, CH2), 4.61 (sb, 1H, OH), 5.24 (s, 2H, NCH2O), 7.96
(s, 1H, C2-H), 11.27 (sb, 1H, OH). 13C NMR (DMSO-d6) (d ppm): 11.75
(CH3), 15.45 (CH2), 61.62 (CH2), 66.34 (CH2), 73.34 (NCH2O), 105.41
(C5), 146.44 (C2), 162.48 (C4), 164.03 (C6). Anal. calcd. for C9H14N2O4:
C, 50.46; H, 6.59; N, 13.08. Found: C, 50.13; H, 6.50; N, 13.34.
5-Butyl-4-hydroxy-1-[(2-hydroxyethoxy)methyl]pyrimidin-6(1H)-one (5c).
1
Colorless oil (yield 82%). H NMR (DMSO-d6), (d ppm) 0.85–0.89 (t, 3H,
J ¼ 7.2 Hz, CH3), 1.11–1.13 (m, 4H, 2 ꢀ CH2), 2.11–2.19 (t, 2H,
J ¼ 7.3 Hz, CH2), 3.44–3.51 (m, 2H, CH2), 4.07–4.11 (m, 2H, CH2), 4.62
(sb, 1H, OH), 5.21 (s, 2H, NCH2O), 7.97 (s, 1H, C2-H), 11.23 (sb,1H, OH).
13C NMR (DMSO-d6), (d ppm): 13.54 (CH3), 22.21, 22.43, 29.21
(3 ꢀ CH2), 62.75 (CH2), 68.46 (CH2), 72.44 (NCH2O), 102.65 (C5), 144.56
(C2), 161.76 (C4), 164.03 (C6). Anal. calcd. for C11H18N2O4: C, 54.43; H,
7.49; N, 11.56. Found: C, 54.57; H, 7.22; N, 11.12.
4-Hydroxy-1-[(2-hydroxyethoxy)methyl]-5-phenylpyrimidin-6(1H)-one (5d).
Colorless oil (yield 90%). 1H NMR (DMSO-d6), (d ppm): 3.41–3.47 (m, 2H,

1104
A. F. Khattab
CH2), 3.58–3.62 (m, 2H, CH2), 4.63 (sb, 1H, OH), 5.11 (s, 2H, NCH2O),
7.21–7.32 (m, 5H, Ar-H), 7.91 (s, 1H, C2-H), 11.23 (sb, 1H, OH). 13C
NMR (DMSO-d6) (d ppm) 60.06 (CH2), 69.19 (CH2), 71.58 (NCH2O),
104.22 (C5), 126.52, 127.60, 130.20, 130.41 (Ar-C), 147.62 (C2), 161.41
(C4), 163.72 (C6). Anal. calcd. for C13H14N2O4: C, 59.54; H, 5.38; N,
10.68. Found: C, 59.33; H, 5.51, N, 10.44.
General Procedure for the Preparation of Compounds (6–8)
A solution of chloromethyl ethyl ether (1.86 g, 20 mmol) in anhydrous MeCN
(10 ml) was added to a stirred solution of the silylated pyrimidines 3a–d in
anhydrous MeCN at 2258C. The stirring was continued for 2 h at 2258C
and for 1 h at room temperature, then the reaction mixture worked up as pre-
viously described. The compounds were purified by silica-gel column chrom-
atography with methanol in chloroform (0–5%). N-Alkylated products 6a–c
were obtained as the sole products in 70–75% yield. N-Alkylated product 7
and its O-alkylated counterpart 8 mixture were obtained and separated.
Fractions with N-alkylated product 7 were eluated faster than their
O-alkylated counterpart 8.
Data
1-(Ethoxymethyl)-4-hydroxy-5-methylpyrimidin-6(1H)-one (6a). White
1
solid (yield 73%), mp 156–1588C. H NMR (DMSO-d6), (d ppm): 1.11
(t, 3H, J ¼ 7.0 Hz, CH3), 1.79 (s, 3H, CH3), 3.53 (q, 2H, J ¼ 7.0 Hz,
CH2), 5.24 (s, 2H, NCH2O), 8.26 (s, 1H, C2-H), 11.42 (sb, 1H, OH).
13C NMR (DMSO-d6), (d ppm): 8.07 (CH3), 14.76 (CH3), 64.11 (CH2),
74.40 (NCH2O), 97.24 (C5), 148.83 (C2), 162.28 (C4), 164.79 (C6).
FAB MS: m/z (%). 185 (M þ 1, 100). 154 (16). Anal. calcd. for
C8H12N2O3: C, 52.17; H, 6.57; N, 15.21. Found: C, 52.43; H, 6.25; N,
15.11.
5-Butyl-1-(ethoxymethyl)-4-hydroxypyrimidin-6(1H)-one (6c). White
1
solid (yield 70%), mp 98–1008C H NMR (DMSO-d6) (d pmm): 0.85–0.90
(t, 3H, J ¼ 7.0 Hz, CH3CH2CH2CH2), 1.08–1.13 (t, 3H, J ¼ 7.0 Hz,
CH3CH2O), 1.25–1.38 (m, 4 H, 2 ꢀ CH2), 2.28–2.34 (t, 2H, J ¼ 7.1 Hz,
CH2), 3.49–3.58 (q, 2H, J ¼ 6.8 Hz, OCH2CH3), 5.24 (s, 2H, NCH2O),
8.25 (s,1H, C2-H), 11.27 (sb, 1H, OH). 13C NMR (DMSO-d6) (d ppm):
13.76 (CH3), 14.78 (CH3), 22.04, 22.16, 29.58 (3 ꢀ CH2), 64.16
(OCH2CH3), 74.36 (NCH2O), 102.03 (C5), 149.05 (C2), 162.03 (C4),
164.78 (C6). FAB MS: m/z (%) 227 (M þ 1, 100). Anal. calcd.
for C11H18N2O3: C, 58.39; H, 8.02; N, 12.38. Found: C, 58.15; H, 8.35; N,
12.11.

Synthesis of New 5-Substituted Pyrimidine Acyclonucleosides
1105
1-(Ethoxymethyl)-4-hydroxy-5-phenylpyrimidin-6(1H)-one (6d). White
1
solid (yield 75%), mp 218–2208C. H NMR (DMSO-d6), (d ppm): 1.12
(t, 3H, J ¼ 3.6 Hz, CH3), 3.58 (q, J ¼ 7.0 Hz, CH2), 5.28 (s, 2H, NCH2O),
7.21–7.49 (m, 5H, Ar-H), 8.44 (s, 1H, C2-H), 11.33 (s, 1H, OH). 13C NMR
(DMSO-d6) d 14.80 (CH3), 64.35 (CH2), 74.73 (NCH2O), 101.91 (C5),
126.22, 127.16, 130.33, 132.59 (Ar-C), 150.33 (C2), 160.66 (C4), 164.21
(C6). FAB MS: m/z (%) 247 (M þ 1, 100), 189 (10), 176 (20). Anal. calcd.
for C13H14N2O3: C, 63.40; H, 5.73; N, 11.38. Found: C, 63.70; H, 5.54; N,
11.53.
1-(Ethoxymethyl)-5-ethyl-4-hydroxypyrimidin-6(1H)-one (7). White solid
1
(yield 30%), mp 160–1628C. H NMR (DMSO-d6), (d ppm): 0.97 (t, 3H,
J ¼ 7.3 Hz, CH3), 1.11 (t, 3H, J ¼ 7.0 Hz, CH3), 2.32 (q, 2H, J ¼ 7.4 Hz,
CH2), 3.54 (q, 2H, J ¼ 7.0 Hz, CH2), 5.24 (s, 1H, NCH2O), 8.25 (s, 1H,
C2-H), 11.33 (sb, 1H, OH). 13C NMR (DMSO-d6), (d ppm): 12.31 (CH3),
14.78 (CH3), 15.87 (CH2), 64.17 (CH2), 74.38 (NCH2O), 103.36 (C5),
149.09 (C2), 161.86 (C4), 164.56 (C6). FAB MS: m/z (%) 199 (M þ 1,
100), 169 (16), 154 (20). Anal. calcd. for C9H14N2O3: C, 54.53; H, 7.12; N,
14.13. Found: C, 54.60; H, 7.42; N, 14.45.
4-(Ethoxymethoxy)-5-ethylpyrimidin-6(1H)-one (8). White solid (yield
30%), mp 118–1208C. 1H NMR (DMSO-d6), (d ppm): 0.99 (t, 3H,
J ¼ 7.3 Hz, CH3), 1.13 (t, 3H, J ¼ 7.0 Hz, CH3), 2.35 (q, 2H, J ¼ 7.2 Hz,
CH2), 3.67 (q, 2H, J ¼ 7.0 Hz, CH2), 5.49 (s, 1H, OCH2O), 8.01 (s, 1H, C2-
H). 13C NMR (DMSO-d6), (d ppm): 12.38 (CH3), 14.90 (CH3), 15.51
(CH2), 64.41 (CH2), 90.28 (OCH2O), 108.05 (C5), 146.84 (C2), 162.82
(C4), 163.63 (C6). FAB MS: m/z (%) 199 (M þ 1, 100). Anal. calcd. for
C9H14N2O3: C, 54.53; H, 7.12; N, 14.13. Found: C, 54.85; H, 7.25; N, 14.50.
BIOLOGICAL ACTIVITY STUDIES
The required cell line was made by transfection of Hep G2-cells with a
plasmid containing multiple tandem copies of HBV genome (subtype
ayw).[19] The 2.2.15 cell line was maintained in RPMI-1640 (Glutamax)
culture media containing 100 IU/ml nystatin þ380 mg/ml G418
(geneticin). The transfected Hep G2-2.2.15 cell line was kept in tissue
culture flask at 378C þ 5% CO2. Maintenance media were added to the cell
culture together with the tested compounds (final concentration ¼ 10 mM).
The supernatant liquid was collected after 1, 2, and/or 3 weeks by asbiration
of the media from culture flask and washing the cells twice by PBS. Ten
percent versene/trypsin was added, and the cells were incubated for 1 min
at 378C.[20] The DNA replication was estimated by the PCR (polymerase
chain reaction) technique. The PCR reaction mixture contained 14 mL of
extracted supernatant, 4 mmol/L of MgCl2, 10 mmol/L of DIG-11-dUTP,

1106
A. F. Khattab
190 mmol/L of dTTP, 200 mmol/L of dATP, dGTP, 1,5 U Taq polymerase,
20 mmol/L of HCl (pH 8.4), 50 mmol/L of KCl, 1 mmol/L of HCID-1
primer (50GGAAAGAAGTCAGAAGGCA30), and 1 mmol/L of HCID-2
(50TTGGGGGAGGAGATTAGGTT30), in a total volume of 50 mL. PCR
reaction conditions were 32 cycles of 1 min at 948C, 30 s at 588C, and 30 s
at 728C þ 3 s for each cycle in a thermal circler as described in literature.[21]
The percentage inhibition could be calculated by the relation between the
plank experiment (containing maintenance media without the tested
compounds) and the results obtained after the periods. The percentage cyto-
toxicity could be estimated by the relation between the number of the living
and dead cells after 3 weeks as counted by the Haemocytometer.
ACKNOWLEDGEMENTS
DANIDA and Danish Ministry of Foreign Affairs are gratefully acknowledged
for financial support through the project “Development of New Drugs against
Hepatitis” at Monoufiya University, and E. B. Pedersen is thanked for making
spectral measurements at Chemistry Institute, Syddansk University, Odense
M, Denmark.
REFERENCE
1. Schaeffer, J. H.; Beauchamp, L.; De Miranda, P.; Elion, G.; Bauer, G. D.;
Collins, P. Nature. 1978, 272, 583.
2. Pan, B.-C.; Chen, Z.-H.; Piras, G.; Dutschman, G. E.; Rowe, E. C.; Cheng, Y.-C.;
Chu, S.-H. J. Heterocycl. Chem. 1994, 31, 177.
3. Zeid, I. F.; Abdel-Rahman, A.-H. A.; Abdel-Megied, E.-S. A.; El-Etrawy, S. H.A.
Nucleosides Nucleotides 1999, 18 (1), 95.
4. Krivonogov, V. P.; Myshkin, V. A.; Sivkova, G. A.; Grebenkova, N. A.;
Srubillin, D. V.; Kozlova, G. G.; Abdrakhmanov, I. B.; Mannapova, R. T.;
Spirikhin, L. V.; Tolstikov, G. A. Pharm. Chem. J. 2001, 35 (8), 411.
5. El-Essawy, A. F.; El-Brollosy, R. N.; Pedersen, B. E.; Nielsen, C. J. Heterocycl.
Chem. 2003, 40, 213.
6. Miyasaka, T.; Tanaka, H.; Baba, M.; Hayakawa, H.; Walker, R. T.; Balzarini, J.;
De Clercq, E. J. Med. Chem. 1989, 32, 2507.
7. Tanaka, H.; Baba, M.; Hayakawa, H.; Sakamaki, T.; Miyasaka, T.; Ubasawa, M.;
Takashima, H.; Sekiya, K.; Nitta, I.; Shigeta, S.; Walker, R. T.; Balzarini, J.; De
Clercq, E. J. Med. Chem. 1991, 34, 349.
8. Baba, M.; Shigeta, S.; Yuasa, S.; Takashima, H.; Sekiya, K.; Ubasawa, M.;
Tanaka, H.; Miyasaka, T.; Walker, R. T.; De Clercq, E. Antimicrob. Agents
Chemother. 1994, 38, 688.
9. Baba, M.; Tanaka, H.; Miyasaka, T.; Yuasa, S.; Ubasawa, M.; Walker, R. T.; De
Clereq, E. Nucleosides Nucleotides 1995, 14, 575.
10. Khattab, A. F.; Abdel Megied, A. E.-S.; Pedersen, E. B. Nucleosides Nucleotides
Nucleic Acids. 2003, 22 (1), 99.

Synthesis of New 5-Substituted Pyrimidine Acyclonucleosides
1107
11. El-Essawy, F. A.; Khattab, A. F. J. Heterocycl. Chem. 2004, 41, 311.
12. Hull, R. J. Chem. Soc. 1951, 487, 2214.
13. Wittenburg, E. Z. Chem. 1964, 4 (3), 303.
14. Robins, J. M.; Peter, W. P. Can. J. Chem. 1982, 60, 547.
15. Vorbru¨ggen, H.; Krolikiewicz, K.; Bennua, B. Chem. Ber. 1981, 114, 1234.
16. Sasaki, T.; Minamoto, K.; Suzuki, T.; Yamashita, S. Tetrahedron 1980, 36, 865.
ˇ
17. Prystas, M. Coll. Czech. Chem. Commun. 1967, 32, 4241.
˘ˇ´
´
´
18. Budesınsky, Z.; Roubınek, F.; Svatek, E. Coll. Czech. Chem. Commun. 1965, 30,
´
3730.
19. Sells, M. A.; Chen, M. L.; Acs, G. Proc. Natl. Acad. Sci. USA 1987, 84, 1005.
20. Doong, S. L.; Tasi, C. H.; Schinazai, R. F.; Liotta, D. C.; Cheng, Y. C. Proc. Natl.
Acad. Sci. USA 1991, 88, 8495.
21. Kobra, B. E.; Gerin, J. L. Antiviral Res. 1992, 19, 55.