Differential carbohydrate recognition of two GlcNAc-6-sulfotransferases with possible roles in L-selectin ligand biosynthesis

Article abstract of DOI:10.1021/ja001224k

Two human GlcNAc-6-sulfotransferases, CHST2 and HEC-GlcNAc6ST, have been recently identified as possible contributors to the inflammatory response by virtue of their participation in L-selectin ligand biosynthesis. Selective inhibitors would facilitate their functional elucidation and might provide leads for antiinflammatory therapy. Here we investigate the critical elements of a disaccharide substrate that are required for recognition by CHST2 and HEC-GlcNAc6ST. A panel of disaccharide analogues, bearing modifications to the pyranose rings and aglycon substituents, were synthesized and screened for substrate activity with each enzyme. Both GlcNAc-6-sulfotransferases required the 2-N-acetamido and 4-hydroxyl groups of a terminal GlcNAc residue for conversion to product. Both enzymes tolerated modifications to the reducing terminal pyranose. Key differences in recognition of an amide group in the aglycon substituent were observed, providing the basis for future glycomimetic inhibitor design.

Full text of DOI:10.1021/ja001224k

8612
J. Am. Chem. Soc. 2000, 122, 8612-8622
Differential Carbohydrate Recognition of Two
GlcNAc-6-sulfotransferases with Possible Roles in L-Selectin Ligand
Biosynthesis
Brian N. Cook,‡ Sunil Bhakta,† Teresa Biegel,† Kendra G. Bowman,‡ Joshua I. Armstrong,‡
Stefan Hemmerich,† and Carolyn R. Bertozzi*,‡,§
Contribution from the Departments of Chemistry and Molecular and Cell Biology,
UniVersity of California, Berkeley, California 94720, and Department of Molecular Biology,
Roche Bioscience, 3401 HillView AVenue, Palo Alto, California 94304-1397
ReceiVed April 7, 2000
Abstract: Two human GlcNAc-6-sulfotransferases, CHST2 and HEC-GlcNAc6ST, have been recently identified
as possible contributors to the inflammatory response by virtue of their participation in L-selectin ligand
biosynthesis. Selective inhibitors would facilitate their functional elucidation and might provide leads for
antiinflammatory therapy. Here we investigate the critical elements of a disaccharide substrate that are required
for recognition by CHST2 and HEC-GlcNAc6ST. A panel of disaccharide analogues, bearing modifications
to the pyranose rings and aglycon substituents, were synthesized and screened for substrate activity with each
enzyme. Both GlcNAc-6-sulfotransferases required the 2-N-acetamido and 4-hydroxyl groups of a terminal
GlcNAc residue for conversion to product. Both enzymes tolerated modifications to the reducing terminal
pyranose. Key differences in recognition of an amide group in the aglycon substituent were observed, providing
the basis for future glycomimetic inhibitor design.
Introduction
Sulfation of carbohydrates in the Golgi compartment is a
mechanism for modulating their activity on the cell surface. The
enzymes that effect this, carbohydrate sulfotransferases, have
only recently been identified as modulators of biological
recognition events and therefore possible therapeutic targets.1
The importance of sulfate as a regulatory element is highlighted
by the discovery of sulfated oligosaccharides as key determi-
nants for recognition by the leukocyte homing receptor
L-selectin.2-4 This receptor-ligand interaction mediates the
transient rolling of lymphocytes on high endothelial venules in
peripheral lymph nodes, and a similar interaction of leukocytes
with vascular endothelium at sites of chronic inflammation.5-10
Presented on mucin-like glycoproteins (O-linked to Ser or Thr)
on the endothelial cell surface, the oligosaccharides share a
sulfated sialyl Lewis x motif (6-sulfo sialyl Lewis x, highlighted
in the dashed box in Figure 1) built from a sialylated core 2
GlcNAc residue (1, Figure 1).2-4 The sulfate ester on the
Figure 1. A sulfated oligosaccharide ligand for L-selectin characterized
on mucin-like glycoproteins from peripheral lymph node high endo-
thelial venules. Dashed box: 6-sulfo sialyl Lewis x, a critical motif
for L-selectin recognition. Solid box: Disaccharide motif on which
synthetic sulfotransferase substrates were based.
6-hydroxyl group of GlcNAc has been demonstrated to increase
the binding affinity of the oligosaccharide with L-selectin.11-13
Moreover, immunohistological studies using an antibody specific
for this unusual epitope indicate that its expression is restricted
to sites of lymphocyte recruitment, including chronically
inflamed tissues.14,15 Due to the importance of the sulfate ester
* To whom correspondence should be addresssed. Telephone: (510) 643-
1682. Fax: (510) 643-2628. E-mail: bertozzi@cchem.berkeley.edu.
‡ Department of Chemistry, University of California.
§ Department of Molecular and Cell Biology, University of California.
† Roche Bioscience.
(1) Bowman, K. G.; Bertozzi, C. R. Chem. Biol. 1999, 6, R9-R22.
(2) Hemmerich, S.; Leffler, H.; Rosen, S. D. J. Biol. Chem. 1995, 270,
12035-12047.
(3) Hemmerich, S.; Bertozzi, C. R.; Leffler, H.; Rosen, S. D. Biochemistry
1994, 33, 4820-4829.
(4) Hemmerich, S.; Rosen, S. D. Biochemistry 1994, 33, 4830-4835.
(5) Rosen, S. D. Am. J. Pathol. 1999, 155, 1013-1020.
(6) Girard, J.-P.; Springer, T. A. Immunol. Today 1995, 16, 449-457.
(7) Lasky, L. A. Annu. ReV. Biochem. 1995, 64, 113-139.
(8) Varki, A. J. Clin. InVest. 1997, 99, 158-162.
(9) Bertozzi, C. R. Chem. Biol. 1995, 2, 703-708.
(10) McEver, R. P.; Moore, K. L.; Cummings, R. D. J. Biol. Chem. 1995,
270, 11025-11028.
(11) Scudder, P. R.; Shailubhai, K.; Duffin, K. L.; Streeter, P. R.; Jacob,
G. S. Glycobiology 1994, 4, 929-933.
(12) Sanders, W. J.; Katsumoto, T. R.; Bertozzi, C. R.; Rosen, S. D.;
Kiessling, L. L. Biochemistry 1996, 35, 14862-14867.
(13) Galustian, C.; Lawson, A. M.; Komba, S.; Ishida, H.; Kiso, M.;
Feizi, T. Biochem. Biophys. Res. Commun. 1997, 240, 748-751.
(14) Michie, S. A.; Streeter, P. R.; Bolt, P. A.; Butcher, E. C.; Picker,
L. J. Am. J. Pathol. 1993, 143, 1688-1698.
(15) Mitsuoka, C.; Sawada-Kasugai, M.; Ando-Furui, K.; Izawa, M.;
Nakanishi, H.; Nakamura, S.; Ishida, H.; Kiso, M.; Kannagi, R. J. Biol.
Chem. 1998, 273, 11225-11233.
10.1021/ja001224k CCC: $19.00 © 2000 American Chemical Society
Published on Web 08/23/2000

Carbohydrate Recognition of Two Sulfotransferases
J. Am. Chem. Soc., Vol. 122, No. 36, 2000 8613
carbohydrate substrate. Kinetic studies16 and crystallographic
data from a distant relative, estrogen sulfotransferase, suggest
that the sulfotransferase mechanism proceeds by direct transfer
of the sulfuryl group from PAPS to the substrate.24-26 Inhibitors
based on either or both substrates should therefore compete for
the active site. Indeed, we have recently identified inhibitors of
a bacterial GlcNAc-6-sulfotransferase by screening a kinase-
directed library of compounds that resemble the purine ring of
both PAPS and ATP.27 Since all sulfotransferases utilize PAPS
as a substrate, one concern with this approach is a potential
lack of selectivity for one enzyme from a family of close
relatives.
Alternatively, elements of the carbohydrate substrate might
be integrated into inhibitor design. Although all three GlcNAc-
6-sulfotransferases modify the 6-hydroxyl group of a GlcNAc
residue, the preferred structures surrounding this residue within
a larger glycoprotein substrate may differ for each enzyme. The
details of oligosaccharide recognition have not been investigated
for these enzymes and may provide a basis for selectivity. Ulti-
mately, compounds that are effective in cell-based assays will
be required for functional deconvolution of the sulfotransferases.
Carbohydrate molecules are generally unsuitable for such studies
due to their polar nature and consequent poor membrane
permeability. This limitation could be overcome with the design
of glycomimetics, compounds that retain the critical recognition
elements but eliminate unnecessary polar functionality.28-30
Knowledge of the critical functional groups on an oligosaccha-
ride substrate would therefore serve two purposes: first, to attain
inhibitor selectivity among the highly homologous enzymes, and
second to design more useful pharmacological tools.
Figure 2.
for L-selectin binding and its possible correlation with inflam-
matory disease, the associated sulfotransferase represents a novel
target for inhibition and study.
The notion of a specific GlcNAc-6-sulfotransferase respon-
sible for sulfation of 1 in endothelial cells was supported by
our previous observation, using an in vitro biochemical assay,
of a GlcNAc-6-sulfotransferase activity restricted to lymphoid
tissue.16 Several groups have since reported the molecular
cloning of human GlcNAc-6-sulfotransferases that are candi-
dates for this activity. Three such enzymes have been recently
described that constitute a new enzyme family and share
approximately 30-50% sequence identity. The first, termed
CHST2 by Uchimura et al., is broadly distributed in many
tissues and when assayed in vitro prefers terminal GlcNAc
oligosaccharides as substrates.17,18 The second, termed HEC-
GlcNAc6ST by Bistrup et al.19 and LSST by Hiraoka et al.,20
is highly restricted in expression to lymph node high endothelial
venules. It requires a terminal GlcNAc residue for modification
as well.21 Both HEC-GlcNAc6ST and CHST2 have been shown
to generate 6-sulfo sialyl Lewis x when transfected into COS
cells,19,20 as well as functional L-selectin ligands that support
lymphocyte rolling.20,22 A third GlcNAc-6-sulfotransferase,
termed I-GlcNAc6ST by Lee et al.,23 is restricted in expression
to small intestine and colon; its specific oligosaccharide substrate
preference has not yet been reported.
These three enzymes, and possibly others that have yet to be
identified, have some overlap in tissue expression pattern and
substrate specificity. Thus, it is not clear what distinct physi-
ological roles the enzymes play and the extent to which each
contributes to L-selectin ligand biosynthesis. Selective inhibitors
would be powerful tools for deconvolution of the sulfotrans-
ferases’ biological functions. Furthermore, they might serve as
leads for antiinflammatory therapy. Several avenues for inhibitor
design/discovery can be envisioned based on the details of the
sulfotransferase reaction, depicted in Figure 2. 3′-Phosphoad-
enosine-5′-phosphosulfate (PAPS) is utilized as the sulfate
donor, from which a sulfuryl group is transferred to the
In this report, we identify key substituents on a disaccharide
substrate that are required for recognition by HEC-GlcNAc6ST
and CHST2. Our approach utilized a panel of compounds
distinguished by either the nature or orientation of the substit-
uents on the pyranose rings. We identified a region of the
substrate at the reducing terminus that is critical for activity
with HEC-GlcNAc6ST but not for CHST2, establishing a basis
for the design of specific glycomimetic inhibitors.
Results and Discussion
Enzyme Assays. The two GlcNAc-6-sulfotransferases in this
study, HEC-GlcNAc6ST and CHST2, are normally Golgi-
resident molecules that are predicted to have a single pass
transmembrane domain, a short N-terminal cytosolic tail and a
C-terminal catalytic domain in the lumen of the Golgi
compartment.17-20 To facilitate our studies, we desired secreted,
soluble enzymes with an expedient means of purification and
detection. Toward this end, we subcloned the catalytic domains
of the two sulfotransferases, without the transmembrane domain
and cytosolic tail, into a vector possessing an N-terminal
secretion signal and an additional N-terminal His6 sequence.
(16) Bowman, K. G.; Hemmerich, S.; Bhakta, S.; Singer, M. S.; Bistrup,
A.; Rosen, S. D.; Bertozzi, C. R. Chem. Biol. 1998, 5, 447-460.
(17) Uchimura, K.; Muramatsu, H.; Kadomatsu, K.; Fan, Q.-W.; Kuro-
sawa, N.; Mitsuoka, C.; Kannagi, R.; Habuchi, O.; Muramatsu, T. J. Biol.
Chem. 1998, 273, 22577-22583.
(24) Kakuta, Y.; Pedersen, L. G.; Carter, C. W.; Negishi, M.; Pedersen,
L. C. Nat. Struct. Biol. 1997, 4, 904-908.
(18) Uchimura, K.; Muramatsu, H.; Kaname, T.; Ogawa, H.; Yamakawa,
T.; Fan, Q.-W.; Mitsuoka, C.; Kannagi, R.; Habuchi, O.; Yokoyama, I.;
Yamamura, K.; Ozaki, T.; Nakagawara, A.; Kadomatsu, K.; Muramatsu,
T. J. Biochem. (Tokyo) 1998, 124, 670-678.
(25) Kakuta, Y.; Pedersen, L. G.; Pedersen, L. C.; Negishi, M. Trends
Biochem. Sci. 1998, 23, 129-130.
(26) Kakuta, Y.; Petrotchenko, E. V.; Pedersen, L. C.; Negishi, M. J.
Biol. Chem. 1998, 273, 27325-27330.
(19) Bistrup, A.; Bhakta, S.; Lee, J. K.; Belov, Y. Y.; Gunn, M. D.;
Zuo, F.-R.; Huang, C.-C.; Kannagi, R.; Rosen, S. D.; Hemmerich, S. J.
Cell. Biol. 1999, 145, 899-910.
(27) Armstrong, J. I.; Portley, A. R.; Chang, Y.-T.; Nierengarten, D. M.;
Cook, B. N.; Bowman, K. G.; Bishop, A.; Gray, N. S.; Shokat, K. M.;
Schulzt, P. G.; Bertozzi, C. R. Angew. Chem., Int. Ed. 2000, 39, 1303-
1306.
(20) Hiraoka, N.; Petryniak, B.; Nakayama, J.; Tsuboi, S.; Suzuki, M.;
Yeh, J.-C.; Izawa, D.; Tanaka, T.; Miyasaka, M.; Lowe, J. B.; Fukuda, M.
Immunity 1999, 11, 79-89.
(28) Sears, P.; Wong, C.-H. Proc. Natl. Acad. Sci. U.S.A. 1996, 93,
12086-12093.
(29) Sears, P.; Wong, C. H. Angew. Chem., Int. Ed. 1999, 38, 2300-
2324.
(30) Simanek, E. E.; McGarvey, G. J.; Jablonowski, J. A.; Wong, C.-H.
Chem. ReV. 1998, 98, 833-862.
(21) Bowman, K. G. Unpublished data.
(22) Tangemann, K.; Bistrup, A.; Hemmerich, S.; Rosen, S. D. J. Exp.
Med. 1999, 190, 935-942.
(23) Lee, J. K.; Bhakta, S.; Rosen, S. D.; Hemmerich, S. Biochem.
Biophys. Res. Commun. 1999, 263, 543-549.

8614 J. Am. Chem. Soc., Vol. 122, No. 36, 2000
Cook et al.
Figure 3. Panel of disaccharide sulfotransferase substrates.
The soluble His6-tagged constructs were expressed in baculovi-
rus-infected insect cells and purified from the conditioned media
on Ni-NTA agarose.
Scheme 1
The activities of the enzymes with various oligosaccharide
analogues were determined using an in vitro assay similar to
that which we have used previously in the study of tissue
extracts.16 The assay utilized the C-glycosyl disaccharide
GlcNAcâ1,6GalR-C-R (2, Figure 3), based on the disaccharide
within structure 1 outlined in the solid box in Figure 1, as a
sulfate acceptor. This substrate was incubated with the enzyme
and a 35S-labeled version of the sulfate donor PAPS; the amount
of sulfate transfer was determined by separation of the products
on a silica gel TLC plate followed by quantitation by phospho-
rimaging. Initial studies demonstrated that compound 2 is a
substrate for the soluble His-tagged versions of both HEC-
GlcNAc6ST (Km ) 0.51 ( 0.17 mM) and CHST2 (Km ) 1.17
( 0.21 mM) with kinetic parameters similar to those of the
GlcNAc-6-sulfotransferase activity from lymph node extracts.16
As observed with enzyme activity from lymph nodes,16 elabora-
tion of the distal GlcNAc residue of 2 with an additional Gal
residue severely diminished substrate activity; its terminal
position was required for recognition. In this study, we used
compound 2 as the basis for evaluating the effects of structural
modifications on substrate activity.
Synthesis of Carbohydrate Analogues. We designed a panel
of analogues (3-8, Figure 3) that would test the importance of
various functional groups on the pyranose rings as well as the
orientation and nature of the reducing terminal (aglycon) moiety.
In all cases, a hydrophobic tail at the reducing end provided a
convenient means for purification of the final products using
reversed-phase HPLC. Compounds 3-6 retain the reducing
terminal R-C-glycoside of the parent compound 2. Compounds
3 and 4 bear modifications to the terminal residue, replacing
GlcNAc with a GalNAc (3) or glucose (4) residue. Compounds
5 and 6 substitute the reducing terminal Gal residue of 2 with
a glucose or mannose residue, respectively. Finally, compounds
7 and 8 replace the C-glycosyl substituent at the reducing end
with R- and â-O-glycosides, respectively.
octylamine produced 15-17. The 6-O-benzyl ether was removed
by selective C-6 acetoxylation32 followed by deacetylation to
provide glycosyl acceptors 18-20.
The glycosyl donors for compounds 2-6 were prepared as
outlined in Scheme 2. Glucosamine hydrochloride (21) and
galactosamine hydrochloride (22) were protected as their
peracetylated N-p-nitrobenzylcarbamate (PNZ) derivatives 23
and 24. These compounds and peracetylated glucose (25) were
treated with benzylamine to effect selective removal of the
anomeric acetate.33 The products, 26-28, were converted to
the corresponding trichloroacetimidates 29-31 using standard
procedures.34 These glycosyl donors were coupled with accep-
tors 18-20 in various combinations to afford disaccharides 32-
36 (Scheme 3). Finally, a series of protecting group manipu-
lations provided 2-6.
The O-glycosyl acceptors 38 and 39 were synthesized as
shown in Scheme 4. Treatment of galactose with boron
trifluoride etherate and octyl alcohol35 produced a 2.4:1 mixture
Disaccharides 2-8 were prepared via glycosidic coupling of
a trichloroacetimidate donor with the corresponding selectively
protected glycosyl acceptor. The glycosyl acceptors for com-
pounds 2-6 were synthesized as shown in Scheme 1. Benzyl-
protected C-allyl glycosides 9-11 were prepared according to
Hosomi et al.31 Hydroboration/oxidation produced alcohols 12-
14. Jones’ oxidation followed by EDC-mediated coupling with
(31) Hosomi, A.; Sakata, Y.; Sakurai, H. Tetrahedron Lett. 1984, 25,
2383-2386.
(32) Angibeaud, P.; Utille, J.-P. Synthesis 1991, 737-738.
(33) Qian, X.; Hindsgaul, O. Chem. Commun. 1997, 1059-1060.
(34) Schmidt, R. R. Angew. Chem., Int. Ed. Engl. 1986, 25, 212-235.
(35) Aguilera, B.; Romero-Ramirez, L.; Abad-Rodriguez, J.; Corrales,
G.; Nieto-Sampedro, M.; Fernandez-Mayoralas, A. J. Med. Chem. 1998,
41, 4599-4606.

Carbohydrate Recognition of Two Sulfotransferases
J. Am. Chem. Soc., Vol. 122, No. 36, 2000 8615
Scheme 2
on the pyranose ring. Still, the enzymes do not appear to be
sensitive to the structural perturbation. Interestingly, the reducing
terminal residue is not wholly dispensable. The simple â-methyl
glycoside of GlcNAc showed no measurable substrate activity
with either enzyme under similar conditions (data not shown).
A dramatic distinction between the two enzymes was revealed
by modifications to the C-glycosyl substituent at the reducing
end of substrate 2. Replacement of the C-glycoside with a more
native O-octyl glycoside, in either the R (7) or â (8) configu-
ration, had no significant effect on the efficiency of CHST2.
The R-glycoside, however, appeared to be a slightly better
substrate than the â-anomer, perhaps reflecting its closer
relationship to the native structure 1 (Figure 1).
Surprisingly, the O-glycosides showed 10-fold reduced activ-
ity with HEC-GlcNAc6ST compared to C-glycoside 2. Again,
the R-anomer 7 was slightly superior to the â-anomer 8. To
address whether the O-glycosides were binding unproductively,
we performed competition studies with substrate 2. Both the
R-anomer 7 and the â-anomer 8 reduced the observed activity
of HEC-GlcNAc6ST with 2 when added at equal concentrations
(0.5 mM, data not shown). Thus, the O-glycosides appear to
disrupt enzyme activity with 2, although the mechanism of this
is still under investigation.
of the R and â-octyl glycosides. The anomers were selectively
protected on the 6-position with a TBDMS group and then
peracetylated. The silyl-protecting group was removed under
mild acidic conditions to furnish glycosyl acceptors 38 and 39
as separable compounds. Reaction of these with glycosyl donor
29 (Scheme 2) followed by protecting group removal steps
finally yielded compounds 7 and 8. All compounds were purified
by reversed-phase HPLC before assaying for substrate activity.
Substrate Activities of Carbohydrate Analogues. Com-
pounds 2-8 were assayed at a fixed concentration of 1 mM
using recombinant His-tagged CHST2 and HEC-GlcNAc6ST.
The radioactivity incorporated into the substrates was measured
at 2-hour intervals for a total of 8 h. No more than 15% of any
substrate was reacted under these conditions. Using these data,
relative rates were determined for each substrate. These are
expressed as percent activity relative to the basis substrate,
compound 2, in Figure 4 (CHST2) and Figure 5 (HEC-
GlcNAc6ST).
The integrity of the GlcNAc residue is essential for both
GlcNAc-6-sulfotransferases. Replacement of GlcNAc with a
GalNAc residue (3) or a glucose residue (4) resulted in no
significant activity with HEC-GlcNAc6ST and diminished
activity with CHST2. Thus, both the orientation of the 4-hy-
droxyl group and the presence of the 2-N-acetamido group are
essential for enzymatic sulfation. Since the sulfate transfer
reaction takes place at a relatively distant site (C-6), this result
may reflect decreased binding of the substrates in the enzyme
active sites. In the case of glucose substrate 4, this hypothesis
was borne out by competition studies. Addition of 0.5 mM
compound 4 to a CHST2 enzyme reaction that included 0.5
mM compound 2 resulted in sulfated products equal to the sum
of the products produced in each reaction separately (data not
shown). Thus, compound 4 is not inhibiting the sulfotransferase;
it is simply not an efficient substrate.
By contrast, when GalNAc substrate 3 (0.5 mM) was added
to a CHST2 reaction along with substrate 2 (0.5 mM), a
reduction in sulfated products was observed (12% compared to
a control reaction lacking compound 3). Thus, compound 3
might bind unproductively in the enzyme’s active site, although
further experiments are needed to confirm its mode of inhibition.
Both GlcNAc-6-sulfotransferases are tolerant of conservative
modifications to the reducing terminal sugar residue. Replace-
ment of galactose with glucose (5) or mannose (6) had no
significant effect on the efficiency of the reaction for both
CHST2 and HEC-GlcNAc6ST. In the case of compound 5, only
a single stereocenter is altered compared to basis substrate 2.
But in case of compound 6, two stereocenters are altered; one
would expect this to effect a significant conformational change
Discussion
A summary of the critical and dispensable functional groups
for CHST2 and HEC-GlcNAc6ST is depicted in Figure 6. The
results indicate that C-glycoside 2 possesses a critical recognition
determinant for HEC-GlcNAc6ST activity that is not required
by CHST2. The molecular basis of this is an interesting matter
for speculation. Several reports have shown C- and O-glycosidic
isosteres to behave similarly in assays of biological recogni-
tion.36-40 Therefore, we think it unlikely that the differential
turnover of the C-and O-linked substrates by the two GlcNAc-
6-sulfotransferases is solely the result of the glycosidic linkage.
Indeed, one might expect the more native O-glycoside to be
the superior substrate; this is clearly not the case with HEC-
GlcNAc6ST. Both the C- and O-glycoside substrates possess a
C-8 tail, rendering their overall hydrophobic character similar.
The only significant difference between the two classes of
substrates is the presence of an amide linkage in the C-
glycosides that is lacking in the O-glycosides. The amide can
interact with protein components through hydrogen bonding,
and a critical fortuitous interaction of this type with HEC-
GlcNAc6ST might be required for productive binding that leads
to sulfation. It is interesting to note that the amide NH in
compound 2 can be superimposed with the amide NH of Ser
(or Thr) in structure 1. An intriguing possibility is that HEC-
GlcNAc6ST interacts with that component of the peptide in its
native glycoprotein substrate whereas CHST2 is ignorant of the
underlying peptide. Also, the peptide-proximal GalNAc residue
in 1 was replaced with galactose in 2 for reasons of synthetic
accessibility. Interactions of HEC-GlcNAc6ST with the 2-N-
acetamido group of this residue might be important for
productive binding of the native substrate, and the C-glycosyl
(36) Weatherman, R. V.; Mortell, K. H.; Chervenak, M.; Kiessling, L.
L.; Toone, E. J. Biochemistry 1996, 35, 3619-3624.
(37) Bertozzi, C. R.; Bednarski, M. D. Carbohydr. Res. 1992, 223, 243-
253.
(38) Bertozzi, C. R.; Cook, D. G.; Kobertz, W. R.; Gonzalez-Scarano,
F.; Bednarski, M. D. J. Am. Chem. Soc. 1992, 114, 10639-10641.
(39) Bertozzi, C. R.; Bednarski, M. D. In Synthesis of C-Glycosides:
Stable Mimics of O-Glycosidic Linkages; Khan, S. H., O’Neill, R. A., Eds.;
Harwood Academic Publishers: 1996; pp 316-351.
(40) Nagy, J. O.; Wang, P.; Gilbert, J. H.; Schaefer, M. E.; Hill, T. G.;
Callstrom, M. R.; Bednarski, M. D. J. Med. Chem. 1992, 35, 4501-4502.

8616 J. Am. Chem. Soc., Vol. 122, No. 36, 2000
Cook et al.
Scheme 3
Scheme 4
Figure 4. Relative substrate activity of compounds 2-8 with CHST2.
Values are expressed as percent activity relative to compound 2. Error
bars represent the standard deviation of three replicate experiments.
Likewise, one could design a library of compounds that exploits
the amide required for productive binding to HEC-GlcNAc6ST.
The identification of a discriminating feature using synthetic
substrates bodes well for future prospects of selective inhibitor
discovery.
Experimental Section
side chain amide of 2 might fulfill this function in its absence.
We are presently addressing these possibilities with an expanded
panel of substrates.
General Methods. All chemical reagents were used as purchased
from Sigma and Aldrich. Thin-layer chromatography (TLC) was
performed using Analtech Uniplate silica gel plates. Flash chromatog-
raphy was performed using Merck 60 Å 230-400 mesh silica gel. All
reaction solvents were distilled under a nitrogen atmosphere. THF was
dried and deoxygenated over benzophenone and Na0; CH2Cl2, pyridine,
and CH3CN were dried over CaH2; CH3OH was dried over Mg0; and
toluene was dried over CaH2.
The information presented in Figures 4 and 5 provides a basis
for the design of glycomimetic inhibitors that can distinguish
CHST2 from HEC-GlcNAc6ST. Such compounds should retain
the critical recognition elements of GlcNAc, such as the 2-N-
acetamido and 4-OH groups, while the reducing terminal sugar
could be replaced with a variety of carbohydrate or non-
carbohydrate moieties, perhaps in library format. Aglycons that
lead to unproductive binding might also provide a starting point
for inhibitor design. Furthermore, hydrophobic groups could be
incorporated into or in place of the reducing terminal sugar to
enhance cell permeability without compromising binding activ-
ity. Without the proper structural elements for HEC-GlcNAc6ST
binding, such compounds should be selective for CHST2.
Biological procedures used doubly distilled and deionized water from
a Millipore Milli-Q system. ATP sulfurylase and pyrophosphatase were
purchased from Sigma, and APS kinase was purchased from Calbio-
2-
chem. The 35SO4 was purchased from American Radiolabeled
Chemicals. PEI-cellulose TLC plates were purchased from VWR, and
reversed-phase extraction plates (96-well, Oasis) were from Waters.
1
All H and 13C NMR spectra were recorded using a Bruker AMX-
300, AMX-400, or DRX 500 MHz spectrometers as noted. Chemical

Carbohydrate Recognition of Two Sulfotransferases
J. Am. Chem. Soc., Vol. 122, No. 36, 2000 8617
4.05 (m, 1 H), 4.47 (app t, 2 H, J ) 12.4) 4.60 (d, 1 H, J ) 12.4), 4.61
(d, 1 H, J ) 12.0), 4.70 (d, 1 H, J ) 11.6), 4.80 (app t, 2 H, J ) 10.8),
4.92 (d, 1 H, J ) 11.2), 7.10-7.15 (m, 2 H), 7.20-7.31 (m, 18 H);13C
NMR (125 MHz, CDCl3) δ 21.0, 29.1, 62.3, 69.1, 71.1, 73.1, 73.5,
74.3, 75.0, 75.4, 78.2, 80.1, 82.4, 127.6, 127.6, 127.7, 127.7, 127.8,
127.9, 127.9, 128.0, 128.3, 128.3, 128.4, 128.4, 137.9, 138.1, 138.2,
138.7; MS (FAB+) m/z 589 (M + Li).
3-(2,3,4,6-Tetra-O-benzyl-r-D-mannopyranosyl) propanol (14):
1
81% yield; H NMR (500 MHz, CDCl3) δ 1.60-1.80 (m, 4 H), 2.40
(br s, 1 H), 3.62-3.70 (m, 3 H), 3.73 (dd, 1 H, J ) 5.0, 10.0), 3.75-
3.85 (m, 3 H), 3.90-3.95 (m, 1 H), 4.00-4.10 (m, 1 H), 4.54 (d, 1 H,
J ) 11.5), 4.56-4.61 (m, 6 H), 4.71 (d, 1 H, J ) 11.0), 7.2-7.4 (m,
20 H); 13C NMR (125 MHz, CDCl3) δ 26.2, 29.4, 62.2, 69.1, 71.6,
72.2, 72.8, 73.3, 73.6, 74.4, 74.9, 75.2, 76.3, 127.7, 127.8, 127.9, 128.0,
128.0, 128.1, 128.2, 128.3, 128.3, 128.4, 128.4, 128.5, 138.2, 138.2,
138.2, 138.2; MS (FAB+) m/z 589 (M + Li).
3-(2,3,4,6-Tetra-O-benzyl-r-D-galactopyranosyl) Propanoic Acid
(12a). General procedure: A solution of 2.83 g (4.85 mmol) of 12 in
20 mL of acetone was cooled to 0 °C. Over a period of 15 min, 6.0
mL (12 mmol) of 2 M Jones’ reagent (prepared using 27 g CrO3, 100
mL H2O, 23 mL concentrated H2SO4) was added dropwise, after which
the reaction flask was warmed to rt and stirred for 1.5 h. Excess Jones’
reagent was quenched with 15 mL of i-PrOH, and the solution was
diluted with 50 mL of ether, washed successively with NaHCO3 (1 ×
25 mL), H2O (2 × 25 mL) and brine (1 × 15 mL), and then dried over
Na2SO4. Purification of the concentrated product was achieved by silica
gel chromatography eluting with 200:1 CHCl3/MeOH to afford 2.69 g
(92%) of a clear, colorless syrup; 1H NMR (400 MHz, CDCl3) δ 1.95-
2.20 (m, 2 H), 2.37-2.44 (m, 1 H), 2.49-2.57 (m, 1 H), 3.65-3.69
(m, 1 H), 3.76-3.83 (m, 2 H), 3.91 (m, 1 H), 4.02-4.06 (m, 3 H),
4.48-4.63 (m, 4 H), 4.67-4.86 (m, 4 H), 7.32-7.36 (m, 20 H); Lit.16
1H NMR (500 MHz, CDCl3) δ 1.95 (m, 1 H), 2.03 (m, 1 H), 2.41 (m,
1 H), 2.53 (m, 1 H), 3.68 (dd, 1 H, J ) 4.8, 10.5), 3.78 (m, 2 H), 3.91
(app s, 1 H), 4.03 (m, 3 H), 4.50 (d, 1 H, J ) 11.9), 4.56 (d, 1 H, J )
11.9), 4.59 (d, 1 H, J ) 11.2), 4.62 (d, 1 H, J ) 11.4), 4.69 (d, 1 H,
J ) 11.8), 4.70 (d, 1 H, J ) 11.6), 4.75 (d, 1 H, J ) 11.9), 4.80 (d, 1
H, J ) 11.6), 7.34-7.37 (m, 20 H).
3-(2,3,4,6-Tetra-O-benzyl-r-D-glucopyranosyl) propanoic acid
(13a): 80% yield;1H NMR (300 MHz, CDCl3) δ 2.06 (m, 2 H), 2.52
(m, 2 H), 3.65 (m, 2 H), 3.75 (m, 2 H), 3.88 (m, 2 H), 4.05 (m, 1 H),
4.49 (d, 1 H, J ) 10.8), 4.52 (d, 1 H, J ) 12.3), 4.64 (d, 1 H, J )
12.3), 4.66 (d, 1 H, J ) 11.4), 4.72 (d, 1 H, J ) 11.7), 4.83 (d, 1 H,
J ) 10.8), 4.84 (d, 1 H, J ) 10.8), 4.96 (d, 1 H, J ) 10.8), 7.13 (m,
2 H), 7.20-7.35 (m, 18 H);13C NMR (125 MHz, CDCl3) δ 20.0, 68.9,
71.2, 73.1, 73.2, 73.5, 75.0, 75.5, 77.9, 79.8, 82.3, 127.6, 127.6, 127.7,
127.9, 128.1, 128.3, 128.4, 128.4, 128.4, 128.5, 137.9, 138.1, 138.6,
178.8; MS (FAB+) m/z 603 (M + Li).
3-(2,3,4,6-Tetra-O-benzyl-r-D-mannopyranosyl) propanoic acid
(14a): 83% yield;1H NMR (500 MHz, CDCl3) δ 1.80-1.90 (m, 2 H),
2.30-2.50 (m, 2 H), 3.55-3.60 (m, 1 H), 3.68 (dd, 1 H, J ) 3.8,
11.3), 3.70-3.80 (m, 2 H), 3.81-3.89 (m, 2 H), 3.95-4.05 (m, 1 H),
4.51-4.60 (m, 7 H), 4.66 (d, 1 H, J ) 11.4), 7.10-7.40 (m, 20 H),
10.35 (br s, 1 H);13C NMR (125 MHz, CDCl3) δ 24.9, 30.2, 54.2, 68.7,
71.3, 71.5, 72.2, 73.3, 73.4, 73.5, 74.6, 75.9, 127.5, 127.7, 127.7, 127.8,
127.9, 128.0, 128.1, 128.3, 128.4, 128.4, 129.0, 129.7, 138.0, 138.0,
138.1, 138.2, 178.4; MS (FAB+) m/z 603 (M + Li).
1-N-Octyl-3-(2,3,4,6-tetra-O-benzyl-r-D-galactopyranosyl) Pro-
pionamide (15). General procedure: A solution of 1.4 g (2.4 mmol)
of 12a, 0.80 mL (4.8 mmol) of n-octylamine, 0.50 g (3.7 mmol) of
HOBt, and 0.70 g (3.7 mmol) of 1-(3-dimethylaminopropyl)-3-
ethylcarbodiimide (EDCI) in 20 mL of CH2Cl2 was stirred under N2
at rt. After 12 h, the solution was diluted with 50 mL of CHCl3 and
50 mL of saturated aqueous NH4Cl. The organic layer was collected
and washed with H2O (2 × 20 mL) and brine (30 mL) and then
dried over Na2SO4. Purification was achieved by silica gel chroma-
tography eluting with a gradient of 10:1 to 1:1 hexanes/EtOAc to
yield 0.99 g (61%) of a clear, pale yellow syrup; 1H NMR (400
MHz, CDCl3) δ 0.88 (app t, 3 H, J ) 2.8), 1.20-1.36 (m, 12 H),
1.80-2.05 (m, 2 H), 2.23 (m, 2 H), 3.09 (m, 2 H), 3.56 (dd, 1 H, J )
3.2, 10.4), 3.74 (m, 2 H), 3.90-4.10 (m, 4 H), 4.48-4.55 (m, 5 H),
4.60-4.72 (m, 3 H), 6.12 (m, 1 H), 7.28-7.34 (m, 20 H); Lit.16 1H
Figure 5. Relative substrate activity of compounds 2-8 with HEC-
GlcNAc6ST. Values are expressed as percent activity relative to
compound 2. Error bars represent the standard deviation of three
replicate experiments.
Figure 6. Disaccharide substrate with important functional groups
illustrated.
shifts are reported in δ relative to tetramethylsilane. Coupling constants
(J) are reported in Hz. Fast atom bombardment (FAB+) spectra and
elemental analyses were obtained at the U. C. Berkeley Mass Spectral
and Microanalytical Laboratories, respectively. Infrared spectra were
recorded on a Perkin-Elmer series 1600 Fourier transform infrared
spectrometer.
Synthesis. 3-(2,3,4,6-Tetra-O-benzyl-r-D-galactopyranosyl) Pro-
panol (12). General procedure: To a solution of 0.74 g (1.3 mmol) of
10 in 1.3 mL of THF under an atmosphere of N2, 3.27 mL (1.64 mmol)
of 9-BBN was added via syringe. The solution was then heated at reflux
for 2.5 h. The reaction mixture was cooled to 0 °C, and 2.5 mL of
EtOH, 0.5 mL of 4 M NaOH, and 0.5 mL of H2O2 were added. The
reaction mixture was stirred under an N2 atmosphere at 0 °C for 12 h.
The solution was then diluted with 20 mL of Et2O, and the organic
layer was washed successively with saturated NH4Cl (1 × 20 mL),
H2O (2 × 25 mL), and brine (1 × 25 mL) and dried over Na2SO4. The
crude product was concentrated and purified by silica gel chromatog-
raphy eluting with 3:2 hexanes/EtOAc to yield 0.69 g (90%) of a pale
yellow syrup. 1H NMR (500 MHz, CDCl3) δ 1.61-1.64 (m, 3 H), 1.72
(m, 1 H), 2.27 (br s, 1 H), 3.57-3.64 (m, 2 H), 3.65-3.70 (m, 1 H),
3.74 (dd, 1 H, J ) 3.0, 7.5), 3.83 (m, 2 H), 3.98 (t, 1 H, J ) 3.0),
4.00-4.03 (m, 2 H), 4.48 (d, 1 H, J ) 12.0), 4.54 (app d, 2 H, J )
12.0), 4.58 (d, 1 H, J ) 11.5), 4.65 (app d, 2 H, J ) 12.5), 4.74-4.77
(m, 2 H), 7.28-7.35 (m, 20 H); Lit.:16 1H NMR (400 MHz, CDCl3) δ
1.63-1.95 (m, 4 H), 3.18 (br s, 1 H), 3.55-3.67 (m, 3 H), 3.71 (dd,
1 H, J ) 2.8, 7.3), 3.75-3.84 (m, 2 H), 3.94-4.01 (m, 3 H), 4.46 (d,
1 H, J ) 12.0), 4.52 (d, 1 H, J ) 10.3), 4.54 (d, 1 H, J ) 11.9), 4.56
(d, 1 H, J ) 11.8), 4.64 (app d, 2 H, J ) 11.3), 4.67 (d, 1 H, J )
12.2), 4.74 (d, 1 H, J ) 13.1), 7.27-7.35 (m, 20 H).
3-(2,3,4,6-Tetra-O-benzyl-r-D-glucopyranosyl) propanol (13): 89%
yield; 1H NMR (400 MHz, CDCl3) δ 1.65 (app sex, 2 H, J ) 6.8) 1.79
(m, 2 H), 1.94 (br s, 1 H), 3.55 (m, 2 H), 3.66 (m, 4 H), 3.77 (m, 2 H),

8618 J. Am. Chem. Soc., Vol. 122, No. 36, 2000
Cook et al.
NMR (400 MHz, CDCl3) δ 0.87 (t, 3 H, J ) 6.7), 1.22-1.34 (m, 12
H), 1.84 (m, 1 H), 1.94 (m, 1 H), 2.20-2.23 (m, 2 H), 3.05 (m, 1 H),
3.12 (m, 1 H), 3.53 (dd, 1 H, J ) 3.3, 10.7), 3.68-3.74 (m, 2 H),
3.95-4.04 (m, 4 H), 4.48-4.67 (m, 8 H), 5.94 (br s, 1 H), 7.25-7.35
(m, 20 H).
1-N-Octyl-3-(2,3,4,6-tetra-O-benzyl-r-D-glucopyranosyl) propi-
onamide (16): 65% yield; 1H NMR (400 MHz, CDCl3) δ 0.87 (t, 3 H,
J ) 7.2), 1.14 (m, 10 H), 1.35 (m, 2 H), 2.21 (m, 2 H), 3.15 (m, 2 H),
3.44 (m, 1 H) 3.65 (m, 3 H), 3.73 (m, 1 H), 3.79 (dd, 1 H, J ) 8.8,
9.2), 4.04 (m, 1 H), 4.45 (d, 1 H, J ) 11.2), 4.50 (d, 1 H, J ) 13.2),
4.56 (d, 1 H, J ) 12.0), 4.65 (m, 2 H), 4.76 (d, 1 H, J ) 11.6), 4.81
(d, 1 H, J ) 10.8), 4.91 (d, 1 H, J ) 11.2), 5.65 (m, 1 H), 7.15 (m, 2
H), 7.20-7.35 (m, 18 H);13C NMR (125 MHz, CDCl3) δ 14.1, 21.1,
22.6, 26.9, 29.2, 29.3, 29.6, 31.8, 32.1, 39.5, 69.4, 71.1, 72.7, 72.8,
73.4, 74.9, 75.5, 78.2, 79.8, 83.7, 127.6, 127.7, 127.8, 127.9, 127.9,
127.9, 128.1, 128.4, 128.4, 128.4, 137.9, 138.1, 138.1, 138.6, 172.2;
MS (FAB+) m/z 714.5 (M + Li).
1-N-Octyl-3-(2,3,4,6-tetra-O-benzyl-r-D-mannopyranosyl) pro-
pionamide (17): 80% yield;1H NMR (500 MHz, CDCl3) δ 0.88 (t, 3
H, J ) 7.0), 1.20-1.40 (m, 14 H), 1.80-1.97 (m, 2 H), 2.20-2.35
(m, 2 H) 3.11-3.19 (m, 2 H), 3.55 (m, 1 H), 3.65-3.70 (m, 1 H),
3.75-3.85 (m, 3 H), 3.97-4.02 (m, 3 H), 4.45-4.60 (m, 7 H), 5.86
(m, 1 H), 7.20-7.43 (m, 20 H);13C NMR (125 MHz, CDCl3) δ 14.1,
22.6, 25.6, 26.9, 29.2, 29.2, 29.5, 31.8, 39.6, 66.0, 69.1, 71.6, 71.7,
72.2, 73.2, 73.2, 73.8, 75.1, 76.0, 127.7, 127.7, 127.7, 127.8, 127.9,
128.0, 128.2, 128.3, 128.3, 128.4, 128.4, 128.5, 138.1, 138.1, 138.1,
138.1, 172.6; MS (FAB+) m/z 714.5 (M + Li).
H);13C NMR (125 MHz, CDCl3) δ 14.1, 22.6, 26.9, 29.2, 29.2, 29.4,
29.5, 31.8, 32.7, 39.7, 61.4, 67.6, 72.8, 72.4, 73.7, 73.7, 74.8, 75.0,
76.5, 127.8, 127.8, 127.9, 128.0, 128.2, 128.2, 128.4, 128.4, 128.4,
138.0, 138.1, 142.6, 172.5; MS (FAB+) m/z 624.5 (M + Li).
2-N-p-Nitrobenzyloxycarbonyl-1,3,4,6-tetra-O-acetyl-D-glu-
cosamine (Mixture of Anomers) (23). General procedure: 5.0 g (23
mmol) of glucosamine‚HCl was dissolved in 130 mL of 0.19 M NaOMe
in MeOH and was stirred for 20 min. The reaction mixture was cooled
to 0 °C, 3.23 mL (23.2 mmol) of TEA and 5.0 g (23 mmol) of
p-nitrobenzyl chloroformate were added, and the mixture was stirred
for 5 h. The thick suspension was concentrated and dissolved in 25
mL of Ac2O and 50 mL of pyridine. A catalytic amount of N,N-
(dimethylamino)pyridine (DMAP) was added, and the solution was
stirred overnight. It was concentrated and coevaporated with toluene
(6 × 25 mL). The resulting syrup was dissolved in 40 mL of CHCl3
and washed with saturated CuSO4 (2 × 20 mL), saturated NaHCO3 (2
× 25 mL), and brine (1 × 25 mL). The combined aqueous layers were
extracted with 40 mL of CHCl3, and the combined organic layers were
dried over Na2SO4. The crude product was concentrated and purified
by silica gel chromatography eluting with a gradient of 200:1 to 20:1
CHCl3/MeOH to yield 6.3 g (52%) of a yellow syrup comprising a
mixture of anomers (1:1 R/â). 1H NMR (500 MHz, CDCl3) 1.88 (s, 3
H), 1.91 (s, 3 H), 1.92 (s, 3 H), 1.95 (s, 3 H), 4.10 (m, 1 H), 4.2 (m,
1 H), 5.0-5.2 (m, 4 H), 5.37 (d, 1 H, J ) 9.5) (R anomer H-1), 6.10
(d, 1 H, J ) 3.5) (â anomer H-1), 7.35 (d, 2 H, J ) 8.5), 8.05 (d, 2 H,
J ) 9.0); 13C NMR (125 MHz, CDCl3) δ 20.2, 20.2, 20.3, 20.5, 52.7,
61.3, 65.2, 69.4, 72.3, 72.3, 90.27, 123.36, 127.6, 127.7, 143.3, 168.5,
168.9, 170.3, 170.7; lit.41 characteristic peaks: 13C NMR (75 MHz,
CDCl3) 55.9, 62.5, 65.5, 69.2, 73.2, 73.2, 92.9.
1-N-Octyl-3-(2,3,4-tri-O-benzyl-r-D-galactopyranosyl) Propion-
amide (18). General procedure: A solution of 0.32 g (0.46 mmol) of
15 in 2 mL of CH2Cl2 and 2 mL of Ac2O was cooled to -42 °C
(CH3CN/CO2) under an atmosphere of N2. Over the course of 1 h, a
solution of 0.09 mL (0.05 mmol) of trimethylsilyl trifluoromethane-
sulfonate (TMSOTf) in 0.3 mL CH2Cl2 was added dropwise via syringe,
and the solution was stirred for an additional 3 h. The solution was
then diluted with 10 mL of CHCl3 and quenched with aqueous NaHCO3.
The organic layer was washed successively with H2O (2 × 25 mL)
and brine (1 × 25 mL), and then dried over Na2SO4. Concentration
afforded a clear, colorless syrup which was carried on to the next
reaction without further purification. The crude product was dissolved
in 10 mL of a 10 mM solution of NaOMe in MeOH and stirred
overnight. The reaction was neutralized using Dowex AG 50w-X2
cation-exchange resin (H+ form), and the product was concentrated
and purified by silica gel chromatography eluting with 1:4 EtOAc/
2-N-p-Nitrobenzyloxycarbonyl-1,3,4,6-tetra-O-acetyl-D-galac-
tosamine (Mixture of Anomers) (24). A mixture of anomers (2.6:1
R/â) (68% yield) was obtained using the previous procedure. 1H NMR
(400 MHz, CDCl3) δ 1.97 (s, 3 H), 2.01 (s, 3 H), 2.16 (s, 3 H), 2.17
(s, 3 H), 4.10 (m, 2 H), 4.25 (m, 1 H), 4.46 (m, 1 H), 4.90 (d, 1 H, J
) 9.6), 5.21 (m, 3 H), 5.39 (m, 1 H), 5.72 (d, 1 H, J ) 8.4) (R anomer
H-1), 6.25 (d, 1 H, J ) 3.6) (â anomer H-1), 7.48 (d, 2 H, J ) 7.2),
8.19 (d, 2 H, J ) 8.8); 13C NMR (100 MHz, CDCl3) δ 20.6, 20.8,
21.0, 21.1, 49.0, 61.2, 65.7, 66.7, 67.7, 68.6, 91.7, 123.8, 128.2, 143.3,
155.4, 169.5, 170.1, 170.4, 170.8; MS (FAB+) m/z 533 (M + Li).
2-N-p-Nitrobenzyloxycarbonyl-3,4,6-tri-O-acetyl-D-glu-
cosamine (Mixture of Anomers) (26). General procedure: Under an
atmosphere of N2, 0.16 mL (1.5 mmol) of distilled benzylamine
(BnNH2)was added to a solution of 0.70 g (1.3 mmol) of 24 in 3 mL
of THF. The reaction mixture was stirred for 12 h, and an additional
0.02 mL (0.18 mmol) of BnNH2 was added. The solution was stirred
another 2 h and then concentrated. The crude product was then purified
by silica gel chromatography eluting with 1:1 EtOAc/hexanes to yield
1
hexanes to give 0.21 g (76%) of a clear, colorless syrup; H NMR
(300 MHz, CDCl3) δ 0.85 (m, 3 H), 1.20-1.40 (m, 12 H), 1.42-1.44
(m, 2 H), 2.10-2.20 (m, 2 H), 3.10-3.20 (m, 2 H), 3.60-3.67 (m, 2
H), 3.74 (m, 1 H), 3.99 (m, 2 H), 4.00-4.10 (m, 2 H), 4.45-4.90 (m,
6 H), 6.28 (app t, 1 H, J ) 5.6), 7.27-7.44 (m, 15 H); Lit.16 1H NMR
(500 MHz, CDCl3) δ 0.92 (t, 3 H, J ) 6.8), 1.28 (m, 10 H), 1.48 (m,
2 H), 1.81 (m, 1 H), 2.04 (m, 1 H), 2.25 (d app t, 1 H, J ) 6.1, 13.9),
2.37 (m, 1 H), 3.18 (br s, 1 H), 3.19 (m, 2 H), 3.62 (m, 1 H), 3.68 (m,
1 H), 3.76 (m, 1 H), 3.97 (m, 2 H), 4.04 (d app t, 1 H, J ) 2.8, 10.9),
4.14 (m, 1 H), 4.48 (d, 1 H, J ) 12.1), 4.65, 1 H, J ) 11.9), 4.68 (d,
1 H, J ) 12.0), 5.89 (br m, 1 H), 7.19-7.35 (m, 15 H).
1-N-Octyl-3-(2,3,4-tri-O-benzyl-r-D-glucopyranosyl) propion-
amide (19): 82% yield; 1H NMR (500 MHz, CDCl3) δ 0.84 (t, 3 H, J
) 4.5), 1.25 (m, 10 H), 1.45 (m, 2 H), 1.62 (m, 2 H), 2.08 (m, 2 H),
2.43 (br s, 1 H), 3.18 (m, 2 H), 3.33 (m, 1 H), 3.54 (m, 1 H), 3.62 (m,
2 H), 3.82 (m, 2 H), 3.97 (m, 1 H), 4.58 (d, 1 H, J ) 11.0), 4.63 (m,
1 H), 4.75 (d, 1 H, J ) 11.0), 4.82 (d, 1 H, J ) 11.5), 4.88 (d, 1 H, J
) 11.0), 5.95 (m, 1 H), 7.20-7.35 (m, 15 H);13C NMR (125 MHz,
CDCl3) δ 14.0, 22.6, 26.9, 29.2, 29.5, 31.5, 32.1, 34.6, 39.7, 62.3, 72.0,
72.8, 73.1, 74.8, 75.2, 77.2, 78.0, 79.7, 81.8, 127.5, 127.5, 127.7, 127.7,
127.8, 127.9, 128.3, 128.3, 128.4, 138.0, 138.1, 138.5, 172.8; MS
(FAB+) m/z 624.5 (M + Li).
1
0.61 g (95%) of a gel. H NMR (400 MHz, CDCl3) δ 1.91 (s, 3 H),
2.05 (s, 3 H), 2.14 (s, 3 H), 3.85 (m, 1 H), 3.97 (m, 1 H), 4.10 (m, 2
H), 4.20 (m, 1 H), 5.05-5.30 (m, 4 H), 7.45 (d, 2 H, J ) 8.3), 8.20 (d,
2 H, J ) 8.4).
2-N-p-Nitrobenzyloxycarbonyl-3,4,6-tri-O-acetyl-D-galac-
tosamine (mixture of anomers) (27): 74% yield; 1H NMR (300 MHz,
CDCl3) δ 1.87 (br s, 1 H), 1.93 (s, 3 H), 2.03 (s, 3 H), 2.15 (s, 3 H),
4.11 (m, 2 H), 4.22 (m, 1 H), 4.41 (m, 1 H), 5.10-5.28 (m, 4 H), 5.35
(m, 1 H), 7.48 (d, 2 H, J ) 8.7), 8.19 (d, 2 H, J ) 8.7); 13C NMR (125
MHz, CDCl3) δ 20.7, 20.7, 22.5, 50.0, 63.4, 65.3, 66.3, 67.6, 68.5,
92.2, 123.8, 128.0, 128.9, 143.8, 149.4, 170.1, 170.4, 170.6.
2,3,4,6-Tetra-O-acetyl-D-glucose (28). Distilled BnNH2 (0.85 mL,
7.8 mmol) was added to a solution of 2.65 g (6.79 mmol) of glucose
pentaacetate in 5 mL of THF under N2. The solution was stirred for 12
h, and an additional 0.02 mL (0.18 mmol) of BnNH2 was added. The
solution was stirred another 2 h and then concentrated. The crude
product was purified by silica gel chromatography eluting with 1:1
1
EtOAc/hexanes to yield 1.5 g (63%) of a gel. H NMR (400 MHz,
1-N-Octyl-3-(2,3,4-tri-O-benzyl-r-D-mannopyranosyl) propion-
CDCl3) δ 1.97 (s, 3 H), 1.99 (s, 3 H), 2.04 (s, 3 H), 2.05 (s, 3 H),
4.1-4.15 (m, 2 H) 4.15-4.30 (m, 1 H), 4.83 (dd, 1 H, J ) 3.6, 10.2),
5.04 (t, 1 H, J ) 9.7), 5.2 (d, 1 H, J ) 9.5) (â Η-1) 5.41 (m, 1 H) (R
1
amide (20): 60% yield; H NMR (500 MHz, CDCl3) δ 0.85 (t, 3 H,
J ) 7.0), 1.20-1.30 (m, 10 H), 1.47 (m, 2 H), 1.85 (m, 2 H), 2.24 (m,
1 H), 2.35 (m, 1 H), 2.97 (br s, 1 H), 3.23 (m, 2 H), 3.55 (m, 2 H),
3.68 (m, 2 H), 3.82 (m, 1 H), 3.95 (m, 1 H), 4.08 (m, 1 H), 4.50-4.59
(m, 5 H), 4.70 (d, 1 H, J ) 11.5), 5.80 (m, 1 H), 7.20-7.45 (m, 15
(41) Boullanger, P.; Jouineau, M.; Bouammali, B.; Lafont, D.; Descotes,
G. Carbohydr. Res. 1990, 202, 151-164.

Carbohydrate Recognition of Two Sulfotransferases
J. Am. Chem. Soc., Vol. 122, No. 36, 2000 8619
H-1), 5.50 (t, 1 H, J ) 9.8); 13C NMR (100 MHz, CDCl3) δ 20.7,
62.0, 67.1, 68.5, 69.9, 71.1, 90.0, 169.7, 170.3, 170.3, 171.0; the product
was taken on to the next reaction without further purification.
3 H), 2.04 (s, 3 H), 2.14 (s, 3 H), 2.18 (m, 2 H), 3.18 (m, 2 H), 3.71
(m, 1 H), 3.89 (m, 2 H), 3.99 (m, 3 H), 4.11 (m, 2 H), 4.26 (m, 1 H),
4.41 (m, 1 H), 4.48 (m, 1 H), 4.50-4.67 (m, 4 H), 5.10-5.25 (m, 5
H), 5.36 (m, 1 H), 5.40 (m, 1 H), 5.83 (m, 1 H), 6.22 (m, 1 H), 7.10-
7.30 (m, 15 H), 7.78 (d, 2 H, J ) 9.0), 8.20 (d, 2 H, J ) 8.5); 13C
NMR (125 MHz, CDCl3) δ 14.0, 20.6, 20.6, 20.7, 22.6, 24.4, 26.9,
29.2, 29.3, 29.6, 31.8, 32.5, 39.6, 49.9, 61.2, 61.9, 65.1, 65.3, 65.9,
66.5, 66.6, 67.5, 68.3, 70.4, 70.7, 73.1, 73.2, 102.2, 123.6, 123.7, 127.6,
127.7, 127.8, 127.8, 128.0, 128.4, 128.4, 138.0, 138.3, 143.7, 147.5,
152.4, 155.5, 167.5, 170.2, 170.4, 170.5, 173.0; MS (FAB+) m/z 1090.7
(M + Li).
Compound 29. General procedure: A solution of 3.3 g (6.9 mmol)
of 26 and 1.04 g (7.56 mmol) of anhydrous K2CO3 in 34 mL of
CH2Cl2 was stirred under an atmosphere of N2. To this solution was
added 6.9 mL (69 mmol) of trichloroacetonitrile by syringe, and the
reaction mixture was stirred overnight. The solution was then warmed
in a water bath at 30 °C for 1 h. The reaction mixture was then concen-
trated and purified by silica gel chromatography eluting with a gradient
of 1:2 to 1:1 EtOAc/hexanes to yield 2.6 g (61%) of a yellow glass.
1H NMR (400 MHz, CDCl3) δ 1.94 (s, 3 H), 2.00 (s, 3 H), 2.01 (s, 3
H), 4.06 (m, 2 H), 4.21 (m, 2 H), 5.1-5.2 (m, 3 H), 5.3 (m, 1 H), 6.35
(d, 1 H, J ) 3.2), 7.40 (d, 2 H, J ) 8.4), 8.13 (d, 1 H, J ) 8.8), 8.77
Compound 34. General procedure: Glycosyl acceptor 18 (0.058 g,
0.094 mmol) was concentrated in the reaction flask and dried under
vacuum over P2O5. Glycosyl donor 31 (0.16 g, 0.33 mmol) was
concentrated and dried under vacuum over P2O5, and dissolved in 1.5
mL of CH2Cl2. This solution was transferred via syringe to the reaction
flask, which was cooled to -42 °C under N2, and 0.006 mL (0.047
mmol) of BF3OEt2 was added via syringe. The reaction mixture was
stirred at -42 °C for 6 h, and then diluted with CHCl3. The solution
was then washed with saturated NaHCO3 (1 × 5 mL) and brine (1 ×
5 mL), and the aqueous layers were extracted with 5 mL of CHCl3.
The combined organic layers were dried over Na2SO4 and concentrated.
The crude product was purified by silica gel chromatography eluting
with 9:1 hexanes/EtOAc yielding 0.035 g (39%) as a clear syrup. IR
33
(s, 1 H); MS (FAB+) m/z 636 (M + Li); lit. characteristic peaks:
1H NMR (400 MHz, CDCl3) δ 6.39 (d, 1 H, J ) 3.6), 8.75 (s, 1 H).
Compound 30: 55% yield; 1H NMR (400 MHz, CDCl3) δ 1.98 (s,
3 H), 2.01 (s, 3 H), 2.17 (s, 3 H), 4.05 (m, 1 H), 4.15 (m, 1 H), 4.36
(m, 1 H), 4.50 (ddd, 1 H, J ) 3.6, 11.6, 13.2), 4.97 (d, 1 H, J ) 9.6),
5.18 (m, 2 H), 5.23 (dd, 1 H, J ) 3.2, 11.2), 5.49 (d, 1 H, J ) 2.4),
6.43 (d, 1 H, J ) 3.6), 7.46 (d, 2 H, J ) 8.4), 8.20 (d, 2 H, J ) 8.4),
8.78 (s, 1 H).
Compound 31. A solution of 1.5 g (4.3 mmol) of 28 and 0.594 g
(4.31 mmol) of anhydrous K2CO3 in 21 mL of CH2Cl2 was stirred under
N2. To this solution was added 4.31 mL (43.3 mmol) of trichloroac-
etonitrile by syringe, and the reaction mixture was stirred overnight.
The solution was warmed 30 °C for 1 h, and the reaction mixture was
then concentrated and purified by silica gel chromatography eluting
with 1:1 EtOAc/hexanes to yield 1.48 g (70%) total mass, obtained as
0.756 g of an orange glass (R anomer) and 0.724 g of an orange syrup
1
(thin film) 3390, 2915, 1559 cm-1; H NMR (500 MHz, CDCl3) δ
0.87 (t, 3 H, J ) 6.5), 1.21-1.30 (m, 12 H), 1.24-1.29 (m, 2 H), 2.01
(s, 3 H), 2.02 (s, 3 H), 2.03 (s, 3 H), 2.05 (s, 3 H), 2.10-2.20 (m, 2
H), 3.20-3.30 (m, 2 H), 3.60-3.75 (m, 3 H), 3.83 (m, 2 H), 3.90 (m,
1 H), 4.02 (m, 1 H), 4.10-4.20 (m, 1 H), 4.30 (dd, 1 H, J ) 4.2, 8.3),
4.45 (d, 1 H, J ) 8.0), 4.54 (d, 1 H, J ) 11.5), 4.58 (d, 1 H, J ) 11.7),
4.60-4.70 (m, 2 H), 4.72 (d, 1 H, J ) 12.0), 4.79 (d, 1 H, J ) 11.8),
5.00 (app t, 1 H, J ) 8.0), 5.10 (app t, 1 H, J ) 9.5), 5.19 (app t, 1 H,
J ) 9.5), 6.20-6.30 (m, 1 H), 7.28-7.33 (m, 15 H); 13C NMR (125
MHz, CDCl3) δ 14.0, 14.1, 20.6, 20.7, 22.6, 22.6, 22.7, 26.9, 29.2,
29.2, 29.2, 29.6, 31.6, 31.7, 39.5, 39.5, 63.4, 68.2, 71.3, 71.7, 72.5,
73.0, 74.3, 74.3, 101.1, 127.6, 127.9, 128.1, 128.3, 128.3, 128.4, 138.2,
138.4, 169.4, 170.0, 170.2, 170.6, 172.5; HRMS (FAB+) m/z 948.4748
(MH+ C52H70N1O15 requires 948.4745).
Compound 35: 95% yield; 1H NMR (400 MHz, CDCl3) δ 0.85 (t,
3 H, J ) 6.8), 1.23 (m, 10 H), 1.45 (m, 2 H), 1.90 (s, 3 H), 1.96 (s, 3
H), 2.06 (s, 3 H), 3.20 (m, 2 H), 3.28 (m, 1 H), 3.52 (m, 1 H), 3.60-
3.70 (m, 2 H), 3.76 (app t, 1 H, J ) 8.8) 3.91 (m, 1 H), 3.99 (m, 1 H),
4.10 (m, 2 H), 4.15-4.25 (m, 2 H), 4.48 (d, 1 H, J ) 11.2), 4.61 (m,
2 H), 4.73 (d, 1 H, J ) 10.8), 4.85 (m, 1 H), 4.89 (d, 1 H, J ) 10.8),
5.00-5.10 (m, 2 H), 5.23 (m, 2 H), 5.32 (m, 2 H), 5.50 (d, 1 H, J )
8.4), 6.04 (m, 1 H), 7.27 (m, 15 H), 7.44 (d, 2 H, J ) 8.8), 8.16 (d, 2
H, J ) 8.8); 13C NMR (100 MHz, CDCl3) δ 14.0, 14.1, 20.6, 20.7,
21.0, 22.6, 26.9, 29.2, 29.2, 29.6, 31.7, 39.6, 54.1, 60.4, 62.0, 65.2,
67.4, 68.2, 68.5, 68.7, 71.1, 71.7, 72.1, 72.8, 73.0, 74.7, 77.3, 78.1,
91.7, 123.6, 123.7, 127.7, 127.8, 127.8, 128.0, 128.4, 128.4, 138.0,
138.0, 138.4, 143.5, 143.7, 147.5, 151.2, 155.3, 169.4, 170.5, 170.7,
170.8, 172.5; MS (FAB+) m/z 1084.7 (M + H).
1
(â anomer). H NMR (500 MHz, CDCl3) (R anomer) δ 2.01 (s, 3 H),
2.03 (s, 3 H), 2.03 (s, 3 H), 2.04 (s, 3 H), 4.12 (dd, 1 H, J ) 2.0, 12.5),
4.2-4.22 (m, 1 H), 4.27 (dd, 1 H, J ) 4.0, 12.0), 5.12 (dd, 1 H, J )
3.5, 10.0) 5.18 (t, 1 H, J ) 10.0) 5.56 (t, 1 H, J ) 4.0), 6.56 (d, 1H,
1
J ) 4.0), 8.69 (s, 1 H); H NMR (500 MHz, CDCl3) (â anomer) δ
2.02 (s, 3 H), 2.03 (s, 3 H), 2.05 (s, 3 H), 2.08 (s, 3 H), 3.89-3.92 (m,
1 H), 4.15 (dd, 1 H, J ) 2.0, 12.5), 4.31 (dd, 1 H, J ) 4.0, 12.5),
5.20-5.23 (m, 1 H), 5.26-5.31 (m, 2 H), 5.87 (d, 1 H, J ) 7.0), 8.71
1
(s, 1 H); Lit.42 (R anomer) H NMR (300 MHz, CDCl3) δ 2.00-2.15
(4 x s, 12 H), 4.15 (dd, 1 H, J ) 2.5, 12.5), 4.25 (m, 2 H), 5.15 (dd,
1 H, J ) 4.0, 9.5), 5.20 (t, 1 H, J ) 9.5), 5.55 (t, 1 H, J ) 9.5), 6.55
(d, 1 H, J ) 4.0), 8.70 (br s, 1 H).
Compound 32. General procedure: Glycosyl acceptor 18 (0.156 g,
0.253 mmol) was concentrated in the reaction flask, dried under vacuum
over P2O5, and placed under an Ar atmosphere. Glycosyl donor 29
(0.47 g, 0.75 mmol) was concentrated and dried over P2O5, placed under
an argon atmosphere, then dissolved in 4 mL of CH2Cl2. This solution
was then transferred via syringe to the reaction flask, which was cooled
to -42 °C. BF3OEt2 (0.016 mL, 0.125 mmol) was added via syringe.
The solution was stirred at -42 °C for 6 h and then diluted with CHCl3.
The solution was washed with saturated NaHCO3 (1 × 5 mL), and
brine (1 × 5 mL), and the aqueous layers were extracted with 5 mL of
CHCl3. The combined organic layers were dried over Na2SO4 and
concentrated. The crude product was purified by silica gel chromatog-
raphy eluting with 200:1 CHCl3/MeOH to obtain 0.269 g (98%) of a
Compound 36: 91% yield; 1H NMR (500 MHz, CDCl3) δ 0.86 (t,
3 H, J ) 7.0), 1.27 (m, 10 H), 1.45 (m, 2 H), 1.77 (m, 2 H), 1.97 (s,
3 H), 2.02 (m, 6 H), 2.14 (m, 2 H), 3.18 (m, 2 H), 3.57 (m, 2 H), 3.63
(m, 1 H), 3.69 (m, 1 H), 3.85 (m, 2 H), 3.97 (m, 1 H), 4.10 (dd, 1 H,
J ) 2.0, 12.5), 4.24 (m, 1 H), 4.28 (m, 1 H), 4.50-4.70 (m, 6 H), 5.03
(m, 3 H), 5.13 (m, 1 H), 5.24 (m, 2 H), 5.31 (m, 1 H), 7.20-7.35 (m,
15 H), 7.46 (d, 2 H, J ) 8.5), 8.15 (d, 2 H, J ) 8.5); 13C NMR (125
MHz, CDCl3) δ 14.1, 17.1, 18.3, 20.6, 20.7, 22.6, 26.9, 29.2, 29.2,
29.5, 31.8, 39.8, 50.7, 54.1, 56.0, 58.4, 62.0, 64.9, 65.3, 67.4, 68.2,
68.3, 68.6, 71.1, 71.6, 72.5, 73.8, 123.7, 127.7, 127.7, 127.8, 127.8,
127.8, 128.0, 128.0, 128.2, 128.3, 128.4, 128.4, 128.58, 137.8, 137.9,
155.9, 162.3, 169.5, 170.6, 170.7, 171.2; MS (FAB+) m/z 1090.7 (M
+ Li).
Compound 32a. General procedure: To a solution of 0.27 g (0.25
mmol) of 32 in 2 mL of EtOH was added 0.016 mL (0.275 mmol) of
glacial AcOH and 0.16 g (60 wt %) of 10% Pd/C. H2 was bubbled
through the stirring mixture for 20 min, and the suspension was stirred
under H2 for another 10 h. The mixture was then filtered through Celite
and resubmitted to the above reaction conditions using fresh catalyst.
1
clear syrup. IR (thin film) 3362, 2923, 1746, 1540 cm-1; H NMR
(500 MHz, CDCl3) δ 0.80-0.90 (m, 3 H), 1.20 (m, 12 H), 1.45 (m, 2
H), 1.70-1.94 (m, 2 H), 1.96 (s, 3 H), 2.01 (s, 3 H), 2.03 (s, 3 H),
3.10-3.30 (m, 2 H), 3.60-3.80 (m, 4 H), 3.90-4.05 (m, 4 H), 4.07
(d, 1 H, J ) 12.1), 4.31 (m, 1 H), 4.50-4.82 (m, 5 H), 5.05-5.30 (m,
4 H), 5.94 (m, 1 H), 6.08 (m, 1 H), 7.28-7.31 (m, 15 H), 7.45 (m, 2
H), 8.16 (d, 2 H, J ) 7.6); 13C NMR (125 MHz, CDCl3) δ 14.0, 14.0,
20.6, 20.6, 22.6, 29.2, 29.3, 31.8, 31.8, 32.2, 38.2, 39.7, 39.7, 42.5,
35.0, 46.3, 49.2, 56.2, 62.1, 62.2, 65.0, 65.0, 68.7, 72.5, 73.4, 73.5,
73.6, 123.6, 127.5, 127.8, 127.8, 127.8, 128.0, 128.3, 128.4, 138.4,
138.4, 138.5, 146.7, 155.6, 169.4, 170.4, 170.4, 172.4; HRMS (FAB+)
m/z 1084.5021 (MH+ C58H74N3O17 requires 1084.5018).
Compound 33: 39% yield; 1H NMR (500 MHz, CDCl3) δ 0.87 (t,
3 H, J ) 7.0), 1.26 (m, 10 H), 1.44 (m, 2 H), 1.69 (m, 2 H), 1.99 (s,
(42) Cook, S. J.; Khan, R.; Brown, J. M. J. Carbohydr. Chem. 1984, 3,
343-348.

8620 J. Am. Chem. Soc., Vol. 122, No. 36, 2000
Cook et al.
This was repeated again before the crude reaction mixture filtered,
concentrated, and redissolved in 2 mL (20 mmol) of Ac2O and 4.0 mL
(49 mmol) of pyridine. A catalytic amount of DMAP was added, and
the reaction mixture was stirred for 12 h. The mixture was concentrated
and coevaporated with toluene (7 × 10 mL). The crude product was
purified by silica gel chromatography eluting with 5:1 EtOAc/hexanes,
and then lyophilized from benzene to yield 0.09 g (45%) of compound
32a. 1H NMR (500 MHz, CDCl3) δ 0.82 (app t, 3 H, J ) 6.5), 1.20-
1.25 (m, 12 H), 1.89 (s, 3 H), 1.92 (s, 3 H), 1.97 (s, 3 H), 1.98 (s, 3
H), 2.02 (s, 3 H), 2.03 (s, 3 H), 2.07 (s, 3 H), 2.20-2.27 (m, 2 H),
3.10-3.20 (m, 2 H), 3.30-3.40 (m, 2 H), 3.65 (m, 1 H), 3.80 (d, 1 H,
J ) 9.5), 3.89 (d, 1 H, J ) 8.0), 4.00-4.10 (m, 4 H), 4.22-4.25 (dd,
1 H, J ) 4.4, 12.3), 4.36 (d, 1 H, J ) 8.0), 5.00-5.08 (m, 2 H), 5.10
(m, 1 H) 5.15 (dd, 1 H, J ) 3.0, 10.5), 5.24-5.28 (m, 1 H), 5.32 (m,
1 H), 6.09 (d, 1 H, J ) 9.5), 7.35 (m, 1 H); Lit.16 1H NMR (500 MHz,
CDCl3): δ 0.86 (app t, 3 H, J ) 8.8), 1.27 (m, 14 H), 1.51 (m, 2 H),
1.4 (s, 3 H), 1.96 (s, 3 H), 2.02 (s, 3 H), 2.04 (s, 3 H), 2.05 (s, 3 H),
2.08 (s, 3 H), 2.11 (s, 3 H), 3.21 (m, 2 H), 3.39 (app t, 1 H, J ) 9.8),
3.63 (m, 1 H), 3.86 (app d, 1 H, J ) 10.1), 3.92 (d, 1 H, J ) 8.1), 4.11
(m, 3 H), 4.28 (dd, 1 H, J ) 4.5, 12.4), 4.35 (d, 1 H, J ) 8.3), 5.04
(app t, 1 H, J ) 9.3), 5.10 (t, 1 H, J ) 9.4), 5.14 (dd, 1 H, J ) 3.4,
10.6), 5.32 (m, 2 H), 5.60 (d, 1 H, J ) 12.0), 7.47 (app t, 1 H).
62.3, 66.9, 68.3, 68.7, 69.1, 70.4, 71.0, 71.9, 72.7, 101.6, 169.2, 169.8,
169.9, 170.2, 170.4, 170.6, 171.1, 171.5; MS (FAB+) m/z 809 (M +
Li).
Compound 2. General procedure: Compound 32a (0.091 g, 0.113
mmol) was dissolved in 3 mL of 0.01 M NaOMe in MeOH and stirred
under a N2 atmosphere for 24 h. The resulting solution was diluted
with MeOH and passed through a column of Dowex AG 50w-X2
cation-exchange resin (H+ form) and concentrated. The product was
dissolved in H2O and lyophilized to yield 61 mg (98%) of a white
glass. 1H NMR (500 MHz, CD3OD) δ 0.90 (m, 3 H), 1.30 (m, 12 H),
1.50 (m, 2 H), 1.86-1.94 (m, 2 H), 1.96 (s, 3 H), 2.10-2.20 (m, 1 H),
2.20-2.30 (m, 1 H), 3.10-3.25 (m, 2 H), 3.30-3.38 (m, 3 H), 3.40-
3.46 (m, 3 H), 3.60-3.75 (m, 4 H), 3.85-3.90 (m, 3 H), 3.95 (m, 1
H), 4.40 (d, 1 H, J ) 8.5); Lit.16 1H NMR (500 MHz, D2O) δ 0.86
(app t, 3 H), 1.27 (m, 12 H), 1.50 (br s, 2 H), 1.93 (m, 3 H), 2.02 (s,
3 H), 2.08 (m, 1 H), 2.18 (m, 1 H), 2.30 (m, 1 H), 3.16 (m, 2 H), 3.44
(m, 2 H), 3.54 (app t, 1 H), 3.66 (app t, 1 H), 3.72 (m, 4 H), 3.77 (app
t, 1 H), 3.91 (m, 2 H), 3.97 (m, 4 H), 4.51 (d, 1 H, J ) 8.4).
Compound 3: 88% yield; 1H NMR (500 MHz, CD3OD) δ 0.89 (t,
3 H, J ) 7.0), 1.25 (m, 10 H), 1.55 (m, 2 H), 1.99 (s, 3 H), 2.15 (m,
2 H), 2.35 (m, 2 H), 3.15 (m, 2 H), 3.53 (m, 1 H), 3.56 (dd, 1 H, J )
3.5, 11.0), 3.62 (m, 1 H), 3.67 (m, 1 H), 3.75 (m, 3 H), 3.83 (d, 1 H,
J ) 3.0), 3.88 (m, 3 H), 3.97 (m, 2 H), 4.37 (d, 1 H, J ) 8.5); HRMS
(FAB+) m/z 551.3170 (MH+ C25H46N2O11 requires 551.3180).
Compound 4. General procedure: A solution of 0.02 g (0.03 mmol)
of 34a in 1 mL of a 10 mM solution of NaOMe in MeOH was stirred
for 24 h. The reaction was passed through a column of Dowex AG
50w-X2 cation-exchange resin (H+ form), eluting with MeOH. The
product was concentrated and redissolved in H2O and lyophilized to
yield 10 mg (78%) of a white glass. IR (thin film) 3423, 2905, 1713
cm-1; 1H NMR (400 MHz, CD3OD), 0.80-0.90 (m, 3 H), 1.20-1.30
(m, 12 H), 1.40-1.50 (m, 2 H), 2.20-2.30 (m, 2 H), 3.10-3.20 (m, 3
H), 3.20-3.40 (m, 5 H), 3.60-3.70 (m, 2 H), 3.80-4.00 (m, 5 H),
4.33 (d, 1 H, J ) 7.6), 7.78 (m, 1 H); 13 C NMR (100 MHz, CD3OD)
δ 14.6, 23.0, 23.9, 28.2, 30.6, 30.6, 30.7, 33.1, 33.6, 40.7, 40.8, 62.9,
69.7, 70.2, 70.5, 71.9, 72.0, 73.1, 75.2, 75.4, 78.1, 78.3, 176.2; HRMS
(FAB+) m/z 510.2921 (MH+ C23H44N1O11 requires 510.2914).
Compound 5: 95% yield;1H NMR (500 MHz, CD3OD) δ 0.91 (t,
3 H, J ) 7.0), 1.35 (m, 10 H), 1.55 (m, 2 H), 1.86 (m, 2 H), 1.98 (s,
3 H), 2.14 (m, 2 H), 2.35 (m, 2 H), 3.15 (m, 2 H), 3.28 (m, 1 H), 3.33
(m, 2 H), 3.36 (m, 2 H), 3.43 (dd, 1 H, J ) 8.5, 10.0), 3.55 (m, 3 H),
3.75 (m, 2 H), 3.82 (m, 1 H), 3.87 (dd, 1 H, J ) 2.0, 11.5), 4.15 (d, 1
H, J ) 8.5), 4.40 (d, 1 H, J ) 8.5);13C NMR (125 MHz, CD3OD) δ
14.6, 23.3, 23.9, 28.2, 30.5, 30.6, 30.6, 33.1, 33.2, 40.7, 49.7, 57.4,
62.9, 72.0, 72.3, 72.7, 73.1, 73.6, 75.4, 76.2, 76.9, 78.1, 103.5, 174.0,
176.0; HRMS (FAB+) m/z 551.3169 (MH+ C25H46N2O11 requires
551.3180).
Compound 6: 97% yield;1H NMR (500 MHz, CD3OD) δ 0.89 (m,
3 H), 1.34 (m, 10 H), 1.83 (m, 1 H), 1.97 (m, 1 H), 1.99 (s, 3 H), 2.25
(m, 1 H), 2.38 (m, 1), 3.17 (m, 2 H), 3.27 (m, 1 H), 3.36 (m, 1 H),
3.44 (dd, 1 H, J ) 8.5, 10.0), 3.53 (app t, 1 H, J ) 8.0), 3.57 (ddd, 1
H, J ) 1.5, 7.6, 9.2), 3.61 (m, 1 H), 3.64 (m, 2 H), 3.66 (m, 2 H), 3.69
(m, 1 H), 3.88 (dd, 1 H, J ) 2.5, 12.0), 4.15 (dd, 1 H, J ) 2.0, 10.5),
4.41 (d, 1 H, J ) 8.5);13C NMR (125 MHz, CDCl3) δ 14.6, 21.4, 23.3,
23.9, 26.0, 28.2, 30.5, 30.6, 30.8, 33.2, 40.6, 57.4, 63.0, 69.9, 70.8,
72.3, 72.8, 73.0, 75.0, 76.2, 77.6, 78.1, 103.4, 173.6, 175.7; HRMS
(FAB+) m/z 551.3181 (MH+ C25H46N2O11 requires 551.3180).
Octyl-2,3,4-tri-O-acetyl-6-O-tert-butyldimethylsilyl-D-galactopy-
ranoside (Mixture of Anomers) (37). To a stirring mixture of 3.0 g
(17 mmol) of galactose in 120 mL CH3CN under Ar was added 7.87
mL (50.0 mmol) of 1-octanol and 1.05 mL (8.33 mmol) of BF3OEt2.
This suspension was heated at reflux for 24 h. The mixture was
concentrated and filtered through silica gel eluting with 5:1 CH2Cl2/
MeOH. The crude product was then dissolved and stirred in 5 mL of
DMF and treated with catalytic DMAP and 0.21 g (1.4 mmol) of
tertbutyldimethylsilyl chloride and 0.21 mL (1.5 mmol) of TEA under
Ar. The reaction mixture was stirred at rt for 30 h and then concentrated
and purified by silica gel chromatography eluting with 1:1 EtOAc/
hexanes. The resultant product was then dissolved in 2 mL of pyridine
and stirred. To this solution was added 1 mL (10 mmol) of acetic
anhydride and a catalytic amount of DMAP. The reaction mixture was
1
Compound 33a: 35% yield; H NMR (500 MHz, CDCl3) δ 0.87
(t, 3 H, J ) 5.0), 1.26 (m, 10 H), 1.54 (m, 2 H), 1.95 (m, 1 H), 1.97
(s, 3 H), 1.98 (s, 3 H), 2.03 (s, 3H), 2.05 (s, 3H), 2.06 (s, 3H), 2.13 (s,
3H), 2.16 (s, 3 H), 2.30 (m, 1 H), 3.23 (m, 2 H), 3.41 (dd, 1 H, J )
9.0, 10.0), 3.89 (m, 2 H), 3.95 (app d, 1 H, J ) 8.0), 4.10 (m, 1 H),
4.19 (m, 2 H), 4.28 (m, 1 H), 4.38 (d, 1 H, J ) 8.0), 5.01 (dd, 1 H, J
) 3.0, 11.0), 5.15 (dd, 1 H, J ) 3.0, 10.5), 5.31 (m, 1 H), 5.34 (m, 2
H), 5.58 (d, 1 H, J ) 9.5), 7.47 (m, 1 H); 13C NMR (125 MHz, CDCl3)
δ 14.1, 20.3, 20.6, 20.7, 20.8, 22.6, 23.5, 27.0, 29.2, 29.3, 29.7, 30.9,
31.8, 39.6, 50.6, 61.1, 63.0, 66.4, 67.8, 68.1, 68.6, 69.1, 70.1, 70.7,
72.9, 77.7, 79.1, 101.9, 169.9, 170.1, 170.1, 170.2, 170.4, 170.6, 170.9,
171.0, 172.0; MS (FAB+) m/z 809.4 (M + Li).
Compound 34a: 79% yield; IR (thin film) 3410, 2916, 1743 cm-1
;
1H NMR (500 MHz, CDCl3) δ 0.87 (t, 3 H, J ) 6.0), 1.20-1.30 (m,
12 H), 1.50-1.52 (m, 2 H), 1.96 (s, 3 H), 2.01 (s, 3 H), 2.02 (s, 3 H),
2.05 (s, 3 H), 2.07 (s, 3 H), 2.10 (s, 3 H), 2.14 (s, 3 H), 2.20-2.21 (m,
2 H), 3.23 (m, 2 H), 3.47 (m, 1 H), 3.70 (m, 1 H), 3.79 (dd, 1 H, J )
2.4, 4.5), 3.89 (dd, 1 H, J ) 2.1, 10.0), 4.15-4.20 (m, 1 H), 4.31 (dd,
1 H, J ) 4.5, 12.4), 4.45 (d, 1 H, J ) 12.0), 5.02 (dd, 1 H, J ) 8.0,
9.8), 5.07 (t, 1 H, J ) 9.6), 5.15 (dd, 1 H, J ) 3.4, 10.6), 5.20 (t, 1 H,
J ) 9.7), 5.30 (t, 1 H, J ) 6.1), 5.34 (m, 1 H) 6.51 (m, 1 H); 13C NMR
(125 MHz, CDCl3) δ 5.9, 11.7, 13.4, 14.0, 20.0, 20.5, 20.5, 20.6, 20.7,
20.8, 22.6, 26.9, 29.2, 29.2, 29.5, 30.7, 31.7, 39.5, 61.6, 67.7, 68.1,
68.2, 68.5, 68.9, 69.1, 71.2, 71.8, 72.2, 72.7, 169.4, 169.9, 170.1, 170.2,
170.3, 170.6, 171.7, 175.2; HRMS (FAB+) m/z 804.3645 (MH+
C37H58N1O18 requires 804.3650).
1
Compound 35a: 40% yield; H NMR (400 MHz, CDCl3) δ 0.86
(t, 3 H, J ) 6.4), 1.28 (m, 10 H), 1.55 (m, 2 H), 1.85 (m, 2 H), 1.94
(s, 3 H), 1.96 (s, 3 H), 1.98 (s, 3 H), 2.01 (s, 3 H), 2.02 (s, 3 H), 2.03
(s, 3 H), 2.07 (s, 3 H), 2.25 (m, 2 H), 3.25 (m, 2 H), 3.33 (m, 1 H),
3.64 (m, 1 H), 3.75 (m, 1 H), 3.93 (m, 1 H), 4.02 (m, 1 H), 4.10 (dd,
1 H, J ) 2.4, 12.4), 4.22 (m, 1 H), 4.28 (dd, 1 H, J ) 4.8, 12.4), 4.34
(d, 1 H, J ) 8.4), 4,79 (dd, 1 H, J ) 9.2, 10.0), 5.05 (m, 3 H), 5.32
(dd, 1 H, J ) 9.2, 9.6), 5.91 (d, 1 H, J ) 9.6), 7.09 (m, 1 H);13C NMR
(125 MHz, CDCl3) δ 14.0, 20.6, 20.6, 20.7, 22.6, 23.2, 27.0, 29.2,
29.2, 29.5, 31.5, 31.8, 39.5, 53.8, 61.7, 68.2, 69.1, 69.5, 70.5, 72.0,
72.4, 72.6, 101.5, 169.2, 169.8, 170.2, 170.5, 170.7, 171.8, 172.5, 173.4;
MS (FAB+) m/z 809.5 (M + Li).
1
Compound 36a: 42% yield; H NMR (500 MHz, CDCl3) δ 0.86
(t, 3 H, J ) 6.9), 1.20-1.35 (m, 10 H), 1.55 (m, 2 H), 1.95 (s, 3 H),
1.97 (s, 3 H), 2.02 (s, 3 H), 2.03 (s, 3 H), 2.05 (s, 3 H), 2.07 (s, 3 H),
2.11 (s, 3 H), 2.21 (m, 2 H), 3.18 (m, 2 H), 3.90 (dd, 1 H, J ) 6.9,
10.5), 3.65 (m, 1 H), 3.83 (m, 1 H), 3.88 (m, 1 H), 3.95 (m, 1 H), 4.12
(dd, 1 H, J ) 2.4, 12.3), 4.20 (m, 2 H), 4.34 (d, 1 H, J ) 8.4), 5.05-
5.27 (m, 5 H), 5.94 (d, 1 H, J ) 9.3), 6.74 (t, 1 H, J ) 5.8);13C
NMR (125 MHz, CDCl3) δ 14.0, 20.6, 20.6, 20.9, 22.6, 23.1, 23.4,
27.3, 27.4, 29.2, 29.2, 29.5, 31.3, 31.8, 33.9, 34.3, 39.6, 53.7, 61.9,

Carbohydrate Recognition of Two Sulfotransferases
J. Am. Chem. Soc., Vol. 122, No. 36, 2000 8621
stirred for 24 h before concentration and coevaporation with toluene
(5 × 20 mL). The product was purified by silica gel chromatography
eluting with 1:9 EtOAc/hexanes to provide 0.083 g (3.2% over three
was cooled to -42 °C under N2, and 0.003 mL (0.023 mmol) of
BF3OEt2 was added via syringe. The reaction mixture was stirred at
-42 °C for 5 h and then quenched with saturated NaHCO3 and diluted
with CHCl3. The organic layer was then washed with saturated NaHCO3
(1 × 5 mL) and brine (1 × 5 mL), and the aqueous layers were extracted
with 5 mL of CHCl3. The combined organic layers were dried over
Na2SO4 and concentrated. The crude product was purified by silica
gel chromatography eluting with a gradient of 1:3 to 1:1 hexanes/EtOAc
yielding 0.028 g (79%) as a clear glass: 1H NMR (500 MHz, CHCl3)
δ 0.87 (t, 3 H, J ) 7.0), 1.25 (m, 10 H), 1.56 (m, 2 H), 1.96 (s, 3 H),
1.97 (s, 3 H), 2.01 (s, 3 H), 2.04 (s, 3 H), 2.08 (s, 3 H), 2.12 (s, 3 H),
3.40 (m, 2 H), 3.67 (m, 2 H), 3.77 (dd, 1 H, J ) 5.5, 6.5), 3.86 (m, 2
H), 4.11 (m, 1 H), 4.25 (dd, 1 H, J ) 8.0, 12.5), 4.35 (d, 1 H, J ) 8.0),
4.79 (m, 1 H), 4.93 (dd, 1 H, J ) 3.5, 10.5), 5.02 (app t, 1 H, J ) 9.5),
5.05 (m, 1 H), 5.15 (d, 1 H, J ) 8.0), 5.19 (m, 2 H), 5.37 (m, 2 H),
7.50 (d, 2 H, J ) 8.0), 8.22 (d, 2 H, J ) 8.5); 13C NMR (125 MHz,
CDCl3) δ 14.1, 14.2, 20.6, 20.6, 20.7, 22.6, 22.6, 25.8, 29.2, 29.3, 29.4,
31.8, 31.8, 56.4, 61.9, 65.4, 67.0, 67.3, 68.4, 68.9, 68.9, 70.3, 70.3,
71.0, 71.6, 71.9, 101.3, 123.8, 128.1, 147.6, 155.1, 169.4, 169.5, 170.2,
170.2, 170.5, 170.6; HRMS (FAB+) m/z 907.3338 (MNa+ C40H56N2O20-
Na requires 907.3324).
1
steps) comprising a mixture of anomers (2.4:1 R/â). H NMR (500
MHz, CHCl3) δ -0.01 (s, 3 H), 0.01 (s, 3 H), 0.84 (s, 9 H), 0.87 (m,
3 H), 1.27 (m, 10 H), 1.56 (m, 2 H), 1.95 (s, 3 H), 2.02 (s, 3 H), 2.04
(s, 3 H), 2.10 (s, 3 H), 3.30-3.41 (m, 1 H), 3.55-3.70 (m, 4 H), 3.86
(m, 1 H), 4.02 (dd, 1 H, J ) 9.0, 10.0), 4.41 (d, 1 H, J ) 6.0), 5.07
(m, 2 H), 5.17 (m, 1 H), 5.34 (dd, 1 H, J ) 3.0, 10.0), 5.44 (d, 1 H,
J ) 3.0), 5.48 (d, 1 H, J ) 3.0); 13C NMR (125 MHz, CDCl3) δ -5.8,
-5.8, -5.6, 14.0, 18.1, 20.6, 20.7, 20.7, 25.6, 25.7, 25.7, 26.0, 29.2,
29.2, 29.2, 29.2, 29.3, 31.7, 31.7, 60.6, 61.0, 67.1, 68.0, 68.2, 68.3,
68.6, 68.8, 69.3, 70.1, 71.2, 73.4, 95.9, 101.3, 169.4, 169.9, 170.0, 170.1,
170.4; HRMS (FAB+) m/z 555.2964 (MNa+ C26H48O9SiNa requires
555.2965).
Octyl-2,3,4-tri-O-acetyl-r-D-galactopyranoside (38). To a stirring
solution of 43.0 mg (0.081 mmol) of 37 in 2 mL of THF/H2O (3:1)
was added 0.5 mL of glacial AcOH. This solution was stirred at rt for
20 h. The reaction was quenched by addition of 5 mL of saturated
NaHCO3 and diluted with 10 mL EtOAc. The organic layer was washed
with saturated NaHCO3 (1 × 10 mL) and brine (1 × 10 mL). The
combined aqueous layers were extracted with CH2Cl2, and the combined
organic layers were then dried over Na2SO4. The crude product was
purified by silica gel chromatography eluting with 1:3 EtOAc/hexanes.
This yielded 16.0 mg (47%) of a clear glass (R anomer) and 7.0 mg
Compound 40a. To a flask containing 40 (0.065 g, 0.073 mmol)
was added 1.0 mL of MeOH and Ac2O (0.07 mL, 0.74 mmol). This
solution was stirred, and to it was added a catalytic amount of 10%
Pd/C. H2 was then bubbled through the stirring mixture for 10 min,
and the mixture was allowed to stir under H2 at rt for 3 h. The mixture
was then filtered through Celite and concentrated. The crude product
was purified by silica gel chromatography eluting with 1:1 hexanes/
1
(21% yield) of a second clear glass (â anomer). R-Anomer (38): H
NMR (400 MHz, CHCl3) δ 0.87 (t, 3 H, J ) 8.5), 1.27 (m, 10 H),
1.55 (m, 2 H), 2.00 (s, 3 H), 2.07 (s, 3 H), 2.16 (s, 3 H), 3.38 (m, 1 H),
3.48 (m, 1 H), 4.08 (app t, 1 H, J ) 8.0), 5.10 (m, 1 H), 5.18 (d, 1 H,
1
EtOAc to yield 0.03 g (55%) of a clear glass. H NMR (500 MHz,
J ) 4.5), 5.37 (dd, 1 H, J ) 4.5, 13.0), 5.43 (app d, 1 H, J ) 4.5); 13
C
CHCl3) δ 0.87 (t, 3 H, J ) 6.5), 1.30 (m, 10 H), 1.55 (m, 2 H), 1.93
(s, 3 H), 1.97 (s, 3 H), 2.01 (s, 3 H), 2.01 (s, 3 H), 2.06 (s, 3 H), 2.08
(s, 3 H), 2.12 (s, 3 H), 3.34 (m, 1 H), 3.59 (m, 2 H), 3.78 (dd, 1 H,J
) 6.5, 10.5), 4.10 (dd, 1 H, J ) 2.0, 12.0), 4.16 (app t, 1 H, J ) 6.5),
4.25 (dd, 1 H, J ) 4.5, 12.0), 4.81 (d, 1 H, J ) 8.5), 5.01 (dd, 1 H, J
) 9.5, 10.0), 5.10 (m, 2 H), 5.29 (m, 1 H), 5.40 (dd, 1 H, J ) 9.5,
10.0), 5.43 (m, 1 H), 5.61 (d, 1 H, J ) 8.5); 13C NMR (125 MHz,
CDCl3) δ 14.1, 20.7, 20.7, 20.7, 20.7, 20.8, 22.6, 23.3, 26.0, 29.2, 29.3,
29.3, 30.7, 31.8, 55.3, 62.0, 66.8, 67.0, 67.8, 68.3, 68.4, 68.4, 68.5,
71.7, 71.8, 95.9, 100.0, 169.5, 170.1, 170.3, 170.4, 170.5, 170.6, 170.7;
HRMS (FAB+) m/z 770.3210 (MNa+ C34H53NO17Na requires 770.3211).
NMR (100 MHz, CDCl3) δ 14.1, 20.4, 20.7, 20.8, 21.3, 22.3, 22.6,
26.0, 29.3, 31.8, 62.0, 67.7, 68.5, 68.6, 68.6, 69.0, 95.6, 169.9, 170.5,
171.1; HRMS (FAB+) m/z 441.2116 (MNa+ C20H34O9Na requires
1
441.2101). â-Anomer (39): H NMR (500 MHz, CHCl3) δ 0.87 (t, 3
H, J ) 6.4), 1.26 (m, 10 H), 1.56 (m, 2 H), 2.00 (s, 3 H), 2.05 (s, 3 H),
2.17 (s, 3 H), 3.48 (m, 2 H), 3.73 (m, 2 H), 3.89 (m, 1 H), 4.48 (d, 1
H, J ) 8.0), 5.05 (dd, 1 H, J ) 3.6, 10.4), 5.23 (dd, 1 H, J ) 8.0,
10.4), 5.36 (app d, 1 H, J ) 3.2); 13C NMR (125 MHz, CDCl3) δ 14.1,
20.6, 20.7, 22.6, 25.8, 29.2, 29.3, 29.3, 31.8, 35.0, 60.7, 68.0, 69.3,
70.4, 70.9, 73.4, 101.4, 166.2, 170.3, 171.2.
Compound 40. The glycosyl acceptor 38 (0.03 g, 0.08 mmol) was
concentrated in the reaction flask and dried under vacuum over P2O5.
Glycosyl donor 29 (0.174 g, 0.213 mmol) was concentrated and dried
under vacuum over P2O5 and dissolved in 1.5 mL of CH2Cl2. This
solution was then transferred via syringe to the reaction flask, which
was cooled to -42 °C under N2, and 0.005 mL (0.036 mmol) of
BF3OEt2 was added via syringe. The reaction mixture was stirred at
-42 °C for 5 h and then quenched with saturated NaHCO3 and diluted
with CHCl3. The organic layer was then washed with saturated NaHCO3
(1 × 5 mL) and brine (1 × 5 mL), and the aqueous layers were extracted
with 5 mL of CHCl3. The combined organic layers were dried over
Na2SO4 and concentrated. The crude product was purified by silica
gel chromatography eluting with a gradient of 1:3 to 1:1 hexanes/EtOAc
yielding 65 mg (93%) as a clear glass: 1H NMR (400 MHz, CHCl3)
δ 0.86 (t, 3 H, J ) 6.8), 1.23 (m, 10 H), 1.52 (m, 2 H), 1.96 (s, 3 H),
2.00 (s, 3 H), 2.03 (s, 3 H), 2.06 (s, 3 H), 2.07 (s, 3 H), 2.11 (s, 3 H),
3.35 (m, 2 H), 3.62 (m, 1 H), 3.65 (m, 2 H), 3.78 (dd, 1 H, J ) 6.0,
10.0), 4.10 (m, 2 H), 4.18 (dd, 1 H, J ) 6.4, 6.8), 4.25 (dd, 1 H, J )
4.8, 12.4), 4.77 (m, 1 H), 5.04 (m, 3 H), 5.18 (m, 2 H), 5.30 (dd, 1 H,
J ) 3.6, 10.0), 5.40 (m, 1 H), 5.44 (d, 1 H, J ) 2.4), 7.47 (d, 2 H, J
) 8.0), 8.21 (d, 2 H, J ) 8.4); 13C NMR (100 MHz, CDCl3) δ 14.0,
20.3, 20.6, 20.6, 20.7, 22.4, 22.6, 25.1, 26.0, 29.2, 29.2, 29.3, 31.8,
56.4, 61.9, 65.3, 67.0, 67.4, 67.7, 68.3, 68.4, 68.9, 71.7, 74.3, 77.3,
77.6, 95.9, 123.7, 128.2, 144.0, 156.0, 169.3, 169.4, 170.1, 170.2, 170.4,
170.6; HRMS (FAB+) m/z 907.3321 (MNa+ C40H56N2O20Na requires
907.3324).
Compound 41a. To a flask containing 41 (0.02 g, 0.02 mmol) was
added 0.5 mL of MeOH and Ac2O (0.5 mL, 5 mmol). This solution
was stirred, and to it was added a catalytic amount of 10% Pd/C. H2
was then bubbled through the stirring mixture for 10 min, and the
mixture was allowed to stir under H2 at rt for 12 h. The mixture was
then filtered through Celite and concentrated. The crude product was
purified by silica gel chromatography eluting with 1:1 hexanes/EtOAc
1
to yield 12 mg (80%) of a clear glass. H NMR (400 MHz, CHCl3) δ
0.87 (t, 3 H, J ) 6.0), 1.26 (m, 10 H), 1.55 (m, 2 H), 1.95 (s, 3 H),
1.96 (s, 3 H), 2.01 (s, 3 H), 2.02 (s, 3 H), 2.04 (s, 3 H), 2.08 (s, 3 H),
2.12 (s, 3 H), 3.44 (m, 2 H), 3.56 (m, 1 H), 3.75 (m, 2 H), 3.84 (m, 2
H), 4.12 (dd, 1 H, J ) 2.6, 10.4), 4.23 (dd, 1 H, J ) 4.4, 10.4), 4.43
(d, 1 H, J ) 8.0), 4.86 (d, 1 H, J ) 8.4), 4.93 (dd, 1 H, J ) 3.6, 10.4),
5.02 (dd, 1 H, J ) 9.2, 10.0), 5.17 (dd, 1 H, J ) 8.0, 10.4), 5.38 (m,
2 H), 5.66 (d, 1 H, J ) 8.0); 13C NMR (100 MHz, CDCl3) δ 14.1,
19.6, 20.6, 20.7, 20.7, 22.6, 22.7, 23.3, 25.8, 29.2, 29.3, 29.4, 31.7,
31.8, 55.3, 61.9, 66.3, 67.3, 68.5, 68.9, 70.2, 71.1, 71.4, 71.8, 76.4,
99.8, 101.2, 169.4, 169.5, 170.2, 170.3, 170.5, 170.7; HRMS (FAB+)
m/z 770.3196 (MNa+ C34H53NO17Na requires 770.3211).
Compound 7. A solution of 0.022 g (0.029 mmol) of 40a in 1 mL
of a 10 mM solution of NaOMe in MeOH was stirred for 24 h. The
reaction was passed through a column of Dowex AG 50w-X2 cation-
exchange resin (H+ form), eluting with MeOH. The product was
concentrated, redissolved in H2O, and lyophilized to yield 13.8 mg
1
(96%) of a white glass. H NMR (500 MHz, CD3OD) δ 0.87 (t, 3 H,
J ) 7.0), 1.27 (m, 10 H), 1.56 (m, 2 H), 1.93 (s, 3 H), 3.27 (m, 3 H),
3.36 (m, 2 H), 3.58-3.65 (m, 2 H), 3.69 (m, 2 H), 3.84 (m, 2 H), 3.86
(d, 1 H, J ) 2.0), 3.97 (dd, 1 H, J ) 5.5, 10.0), 4.37 (d, 1 H, J ) 8.5),
4.72 (d, 1 H, J ) 3.0); 13C NMR (125 MHz, CD3OD) δ 14.6, 23.2,
23.9, 27.6, 30.6, 30.8, 30.8, 33.2, 57.4, 62.9, 69.2, 70.0, 70.4, 70.7,
Compound 41. The glycosyl acceptor 39 (0.17 g, 0.04 mmol) was
concentrated in the reaction flask and dried under vacuum over P2O5.
Glycosyl donor 29 (0.083 g, 0.132 mmol) was concentrated and dried
under vacuum over P2O5, and dissolved in 1.5 mL of CH2Cl2. This
solution was then transferred via syringe to the reaction flask, which

8622 J. Am. Chem. Soc., Vol. 122, No. 36, 2000
Cook et al.
71.0, 71.5, 72.3, 76.4, 78.1, 100.4, 103.2, 173.8; HRMS (FAB+) m/z
518.2567 (MNa+ C22H41NO11Na requires 518.2578).
workers.43 Briefly, 1 mCi of carrier-free 35S-Na2SO4 (American
Radiolabeled Chemicals) and 30 mM ATP were incubated with
approximately 45 µg of APS kinase (Calbiochem), 0.12 µg ATP
sulfurylase (Sigma), and 8.3 µg inorganic pyrophosphatase (Sigma) in
60 µL Buffer A (20 mM Tris-HCl (pH 8.0), 30 mM KCl, 40 mM
MgCl2, 1 mM EDTA, 1 mM DTT, 10% glycerol) for 12 h at 30 °C.
Quantification of conversion was accomplished through separation of
reaction components by thin-layer chromatography on polyethylene-
imine (PEI)-cellulose eluting with 0.9 M LiCl, followed by phosphor-
imaging analysis (model 445 SI, Molecular Dynamics). Incorporation
of the 35S label into 35S-PAPS typically exceeded 90%.
Compound 8. A solution of 0.012 g (0.016 mmol) of 41a in 1 mL
of a 10 mM solution of NaOMe in MeOH was stirred for 24 h. The
reaction was passed through a column of Dowex AG 50w-X2 cation-
exchange resin (H+ form), eluting with MeOH. The product was
concentrated, redissolved in H2O, and lyophilized to yield 7.5 mg (95%)
of a white glass. 1H NMR (500 MHz, CD3OD) δ 0.83 (m, 3 H), 1.20-
1.35 (m, 10 H), 1.53 (m, 2 H), 1.89 (s, 3 H), 3.23 (m, 3 H), 3.30-3.45
(m, 4 H), 3.50-3.65 (m, 4 H), 3.72-3.85 (m, 2 H), 3.90-3.93 (m, 1
H), 4.11 (d, 1 H, J ) 7.2), 4.35 (d, 1 H, J ) 8.4); 13C NMR (125
MHz, CD3OD) δ 14.6, 23.9, 27.3, 30.6, 30.8, 31.0, 33.2, 42.0, 50.0,
69.5, 70.2, 71.0, 72.3, 72.7, 74.8, 74.9, 75.7, 76.3, 78.1, 103.0, 105.0,
171.5; HRMS (FAB+) m/z 518.2579 (MNa+ C22H41NO11Na requires
518.2578).
Biological Procedures. Subcloning of CHST2 and HEC-
GlcNAc6ST. The genes for soluble, truncated versions of CHST2 and
HEC-GlcNAc6ST, in which the cytosolic and transmembrane domains
were replaced with a His6 tail, were obtained from the vector
pCDNA3.1/HisA (Invitrogen) generated at Roche Bioscience. The genes
were subcloned by PCR using the following primers: forward CHST2:
GCGGTACCATCCTGGCAATGGCACTCGGGGCACCGG-
GGGC; reverse CHST2: GCGTCGACGAGACGGGGCTTCCGAAG-
CAGGGTCTTGC; forward HEC-GlcNAc6ST: GCCGGTACCAT-
CACAACATCAGCTCCCTGTCTATGAAGGC; reverse HEC-Glc-
NAc6ST: GCGTCGACGTGGATTTGCTCAGGGACAGTCCAGG-
TAGACA. The PCR products were digested with Kpn1 and Xho1 and
ligated into the baculovirus expression vector pMelBac (Invitrogen).
Growth of Recombinant CHST2. One liter of Sf9 insect cells were
grown in Sf-900 II SFM (Gibco, catalog no. 10902) media, infected
with the baculovirus expression vector and harvested 3 days after
infection. The cells were removed by centrifugation (10 min at 2000g),
and the supernatant was collected. The sample was stored at -80 °C.
Growth of Recombinant HEC-GlcNAc6ST. Ten liters of Sf9 insect
cells were grown in Sf-900 II SFM (Gibco, catalog no. 10902) media,
infected with the baculovirus expression vector and harvested 3 days
after infection. The cells were removed by centrifugation (10 min at
2000g), and the supernatant was collected. The supernatant was
concentrated 12-fold, filtered, and washed (20 mM Tris, pH 8.0, 100
mM NaCl, 4 °C). The sample was stored at -80 °C.
Assays for Sulfotransferase Activity. Standard assay reactions of
50 µL were carried out in 1.5 mL eppendorf tubes at pH 6.5 in Buffer
ST (30 mM HEPES, 1% Triton-X-100, 4 mM Mg(OAc)2, 10 mM NaF,
1 mM ATP, 10% glycerol). The reactions were performed with 1 mM
disaccharides, 5 µCi 35S-PAPS, 2 µM PAPS, and 2 µL enzyme.
Reactions were run for 8 h at room temperature, with 10 µL aliquots
taken out every 2 h and diluted with 20 µL of MeOH. These aliquots
were then spotted on Whatman 19-lane silica gel TLC plates and eluted
with 6:3:2 BuOH:EtOH:H2O. The plates were dried and exposed by
phosphorimaging to determine % incorporation of 35S-sulfate over time.
Total radioactivity of product was divided by radioactivity of the whole
TLC lane and then multiplied by concentration of PAPS and divided
by the % purity of PAPS to yield the final concentration of radiolabeled
product. Total substrate turnover did not exceed 15%. Rates were
determined by nonlinear regression, and these rates were compared to
control substrate 2. Km determinations were made by varying concentra-
tion of substrate 2 (serial dilutions from 5 mM to 0.04 mM), determining
the rates, and using nonlinear regression software (SAS).
Sulfotransferase assays executed during protein purification steps
were performed in 96-well microtiter plates using compound 2 (1.25
mM), PAPS (2.5 µM), ATP (1 mM) and 0.05 µCi 35S-PAPS, in 30
mM Hepes pH 6.5, 4 mM Mg(AcO)2, 10 mM NaF, 10% Glycerol, 1%
Triton-X-100. Reaction mixtures (20 µL) were incubated overnight at
25 °C. The reactions were stopped with the addition of 100 µL of
distilled water. Reactions were then transferred from the 96-well plate
to preconditioned Oasis HLB reversed-phase extraction plates (Waters)
and washed with distilled water. The radiolabeled substrate was eluted
with 200 µL/well MeOH, and the plates were air-dried. The amount
of radioactivity incorporated into the substrate was determined by
scintillation counting. Reactions were run in duplicate, with and without
compound 2.
Purification of Recombinant CHST2 and HEC-GlcNAc6ST. The
supernatants from the above procedures were defrosted and centrifuged
(15 min at 23000g) to remove any precipitate. The supernatants were
then filtered through a Nalgene 0.20 µM filter with a prefilter, and
the buffer was exchanged with 20 mM Tris, pH 8.0, 300 mM NaCl,
10 mM imidazole (TNI buffer) at 4 °C. For every 280 mL of
concentrated, washed supernatant, a 30-mL nickel-nitrilotriacetic acid
affinity resin superflow column (Qiagen catalog no. 30430) was
prepared and equilibrated with the TNI start buffer. The crude protein
was loaded onto the column, and the column was washed with 5 vols
of TNI buffer. The protein was eluted with 2 vols of 20 mM Tris, pH
8.0, 300 mM NaCl, 250 mM imidazole. The fractions were checked
for activity using the sulfotransferase assay. The active fractions were
concentrated 5-fold by ultrafiltration (Centricon 30; Amicon). The
concentrated fractions were then dialyzed into 10% glycerol, 20 mM
Tris, pH 8.0, 100 mM NaCl, 0.01% Trition-X-100. The protein
concentration was determined by Bradford Assay. The sample was
aliquoted and frozen at -80 °C.
Acknowledgment. We thank Steven Rosen for helpful
discussions. J.I.A. and K.G.B. were supported by NIH Molecular
Biophysics Training Grant No. T32GM0895. K.G.B. thanks
Boehringer Ingelheim for a graduate fellowship. We acknowl-
edge generous funding from the W.M. Keck Foundation, the
Pew Scholars Program, and the Arnold and Mabel Beckman
Foundation. This research was supported by grants to C.R.B.
from the American Cancer Society (RPG9700501BE) and the
National Institutes of Health (RO1 GM59907-01).
JA001224K
(43) Ehrhardt, D. W.; Atkinson, E. M.; Faull, K. F.; Freedberg, D. I.;
Sutherlin, D. P.; Armstrong, R.; Long, S. R. J. Bacteriol. 1995, 177, 6237-
6245.
Enzymatic Synthesis of 35S-PAPS. Carrier-free 35S-PAPS was
synthesized in vitro using a procedure similar to that of Long and co-