Synthesis of native-like crosslinked duplex RNA and study of its properties

Article abstract of DOI:10.1016/j.bmc.2017.02.034

A variety of enzymes have been found to interact with double-stranded RNA (dsRNA) in order to carry out its functions. We have endeavored to prepare the covalently crosslinked native-like duplex RNA, which could be useful for biochemical studies and RNA nanotechnology. In this study, the interstrand covalently linked duplex RNA was formed by a crosslinking reaction between vinylpurine (VP) and the target cytosine or uracil in RNA. We measured melting temperatures and CD spectra to identify the properties of the VP crosslinked duplex RNA. The crosslinking formation increased the thermodynamic stability without disturbing the natural conformation of dsRNA. In addition, a competitive binding experiment with the duplex RNA binding enzyme, ADAR2, showed the crosslinked dsRNA bound the protein with nearly the same binding affinity as the natural dsRNA, confirming that it has finely preserved the natural traits of duplex RNA.

Full text of DOI:10.1016/j.bmc.2017.02.034

Accepted Manuscript
Synthesis of native-like crosslinked duplex RNA and study of its properties
Kazumitsu Onizuka, Madoka E. Hazemi, Justin M. Thomas, Leanna R.
Monteleone, Ken Yamada, Shuhei Imoto, Peter A. Beal, Fumi Nagatsugi
PII:
S0968-0896(17)30019-6
DOI:
http://dx.doi.org/10.1016/j.bmc.2017.02.034
BMC 13564
Reference:
Bioorganic & Medicinal Chemistry
To appear in:
Received Date:
Revised Date:
Accepted Date:
6 January 2017
13 February 2017
15 February 2017
Please cite this article as: Onizuka, K., Hazemi, M.E., Thomas, J.M., Monteleone, L.R., Yamada, K., Imoto, S.,
Beal, P.A., Nagatsugi, F., Synthesis of native-like crosslinked duplex RNA and study of its properties, Bioorganic
& Medicinal Chemistry (2017), doi: http://dx.doi.org/10.1016/j.bmc.2017.02.034
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com
Synthesis of native-like crosslinked duplex RNA and study of its properties
Kazumitsu Onizuka a, Madoka E. Hazemi a, Justin M. Thomas b, Leanna R. Monteleone b, Ken Yamada a,
Shuhei Imoto c, Peter A. Beal b and Fumi Nagatsugi a*
a Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577, Japan
b Department of Chemistry, University of California, Davis, One Shields Ave, Davis, California 95616, USA
c Faculty of Pharmaceutical Sciences, Sojo University, 4-22-1 Ikeda, Kumamoto 860-0082, Japan
ARTICLE INFO
ABSTRACT
Article history:
Received
A variety of enzymes have been found to interact with double-stranded RNA (dsRNA) in
order to carry out its functions. We have endeavored to prepare the covalently crosslinked
native-like duplex RNA, which could be useful for biochemical studies and RNA
nanotechnology. In this study, the interstrand covalently linked duplex RNA was formed
by a crosslinking reaction between vinylpurine (VP) and the target cytosine or uracil in
RNA. We measured melting temperatures and CD spectra to identify the properties of the
VP crosslinked duplex RNA. The crosslinking formation increased the thermodynamic
stability without disturbing the natural conformation of dsRNA. In addition, a competitive
binding experiment with the duplex RNA binding enzyme, ADAR2, showed the
crosslinked dsRNA bound the protein with nearly the same binding affinity as the natural
dsRNA, confirming that it has finely preserved the natural traits of duplex RNA.
Received in revised form
Accepted
Available online
Keywords:
RNA
Crosslinking reaction
6-Vinylpurine
ADAR
Native-like
Elsevier Ltd. All rights reserved.
1. Introduction
in the cell. RNA helicases also recognize dsRNA. Brr2 is an
RNA helicase that plays an essential role in pre-mRNA
1Double-stranded RNA (dsRNA) plays an important role in
many biological processes.1,2 Various enzymes recognize dsRNA
and function at specific positions. For example, adenosine
deaminases that act on RNA (ADARs) are RNA editing enzymes
that recognize dsRNA substrates and convert adenosine (A) to
inosine (I) at specific locations in the duplex. Inosine (I) is
decoded as guanosine (G) which can lead to alteration of the
codon meaning in RNAs.3,4 RNA editing leads to various
functional consequences including regulation of the
neurotransmitter receptor activity to modulating the functionality
of small dsRNA molecules.5 It has also been reported that
misregulation of the ADAR activity is related to numerous
known diseases including cancer,6 Aicardi-Goutieres syndrome,7
and HIV.8 As another example, dsRNA is also known for its
critical role in gene expression through RNA interference (RNAi)
and as a biosynthetic precursor to miRNAs.9 Dicer and Drosha
are the enzymes responsible for initiating these processes through
their nuclease activity. RNAi is started by cleavage of long
dsRNA by Dicer to create short dsRNA fragments known as
siRNAs.10 Through different pathways, siRNA and miRNA
perform gene silencing by intercepting the translation of mRNA
splicing.11 It catalyzes the ATP-dependent unwinding of the
U4/U6 dsRNA structure. This is an essential step in the assembly
of a catalytically-active spliceosome.
For the study of the interaction of dsRNA-modifying enzymes
and for the development of new tools for biochemical studies and
RNA nanotechnology,12-14 chemical tools to create crosslinked
dsRNA are of great importance. However, the study of the
RNA-RNA crosslink formation15-18 is still limited due to the
complicated synthesis and the instability of RNA, while the
DNA-DNA and DNA-RNA crosslink formation has been well
studied and developed.19-27 An effective RNA-RNA crosslink
formation is mostly achieved using photo-affinity reagents that
require activation by UV light. Thionucleosides such as
6-thioguanosine16 and 4-thiouridine17 were reported to be photo
crosslinking agents for RNA-RNA crosslinking. Crosslinking
using thionucleotides has been mainly applied in the study of
complex RNA such as tRNA or ribosomal RNA. Since the
thionucleotides can crosslink only with the close contact-base by
[2+2] photocycloaddition onto the 5,
6 double bond of
pyrimidines, they have been used to identify the close
contact-sites in folded RNA. However, due to this reaction site,
this crosslinking method is unsuitable to form less distorted
natural-like dsRNA. In recent developments, covalent bond
formation at the terminus of siRNA was reported using
* Corresponding author. Tel.: +81-22-217-5633
E-mail address: nagatugi@tagen.tohoku.ac.jp

Figure. 1 RNA containing crosslinking base 6-vinylpurine (VP). Expected crosslinking reaction of RNA containing VP with
cytosine (C) (top), and with uracil (U) (bottom) on the complementary RNA strand.
Scheme 1. Synthesis of CPG (4 and 5) and phosphoramidite (7): (a) DMTrCl, pyridine, 88%; (b) tributylvinyltin, PdCl2(PPh3)2,
DMF, 77%; (c) NaSMe, H2O, DMF, 84%; (d) Succinylated CPG support, EDC, DMAP, DIPEA, pyridine, 56%; (e) TBSCl, AgNO3,
THF, 56%; (f) iPr2NP(Cl)OCH2CH2CN, DIPEA, CH2Cl2, 92%.
p-cyanostilbenes or p-stilbazoles as the photo crosslinking
moiety.18 Exposure of the oligonucleotides containing this group
to UV light will induce [2+2] photocycloaddition, resulting in a
crosslinked siRNA that is resistant toward nuclease activity.
of a less distorted native-like crosslinked duplex RNA using
VP-containing RNA and further discuss the properties of the
crosslinked dsRNA.
In our previous study, we developed interstrand crosslinking
bases, i.e., 2-amino-6-vinylpurine (AVP) and 6-vinylpurine (VP).
Oligonucleotides conjugated with AVP or VP can undergo a
selective crosslinking reaction with cytosine (C) or uracil (U) on
the complementary strand.28-32 We expected that RNA containing
VP will undergo an efficient crosslinking reaction with uracil (U)
or cytosine (C) base of the complementary strand when at the
proximal position (Fig. 1). Importantly, our designed VP can
react with a chemically unmodified natural base and form a
simple, two-carbon crosslink with no attachment of other bulky
groups, thus reducing the potential of significant distortion of the
native dsRNA structure. In this paper, we report on the synthesis
2. Results and discussion
2.1. Synthesis of 6-vinylpurine (VP)-containing RNA.
The synthesis of SMe-protected VP controlled pore glass
(CPG) precursor and a phosphoramidite precursor is shown in
Scheme 1. The 5’-hydroxyl group of the commercially-available
6-chloropurine riboside was protected with a DMTr group.
Vinylation by Stille coupling followed by S-methylation was
performed to produce compound 3. For incorporating VP at the
3’ end position of the RNA, a CPG precursor was synthesized by
coupling compound 3 with CPG that had previously been

and purification. (a) RNA synthesizer, (b) NH4OH/EtOH (3:1), 30 oC, 12h; (c) TEA-3HF, 65 oC, 2.5 h.
succinylated to give 4 and 5 (Scheme 1A).33 As for incorporating
(Scheme 3), then confirmed by HPLC and MALDI-TOF mass
spectroscopy. The HPLC profile and MALDI-TOF mass
spectroscopy have also confirmed the byproduct sulfonyl
compound resulting from over oxidation of the S-Me by MMPP
(Fig. S1). VP conversion was performed using 50% acetic acid
VP in the middle and at the 5’ end position, from compound 3
TBS protection at the 2’ position continued with phosphitylation
to give the phosphoramidite precursor 7 (Scheme 1B).
o
at 37 C for 3 h. The product was confirmed by MALDI-TOF
mass spectroscopy (Fig. S2). The ORN-D was used for the
crosslinking reaction without further purification.
Table 1. ORN sequences used in this study
entry
ORN1
Sequences (5’-3’)
ACAGCAGGCGCX
ORN2
ORN3
ORN4
ORN5
ORN6
ACAGCXGGCGCG
XCAGCAGGCGCG
ACUGAACCACCAAUGUGGGGAX
ACUXAACCACCAAUGUGGGGAA
XCUGAACCACCAAUGUGGGGAA
ACAGCAGGCGCG
ORN7
ORN8
ORN9
ACUGAACCACCAAUGUGGGGAU
FAM-CGCGCCUGCUGU
ORN10 FAM-UGCGCCUGCUGU
ORN11 FAM-CGCGCCCGCUGU
ORN12 FAM-CGCGCCUGCUGC
ORN13 FAM-UUCCCCACAUUAGACGUUCAGU
ORN14 UUCCCCACAUUAGACGUUCAGU
Scheme 3. Synthesis of VP-containing ORN-D. (a) MMPP, H2O,
RT, 30 min, (b) 50% AcOH, 37oC, 3h.Scheme 2. RNA synthesis
2.2. Crosslinking reaction in RNA duplex
First, the crosslinking reaction condition screening was
performed using four different conditions by altering the pH and
temperature of the reaction; (i) pH 7, 37 oC; (ii) pH 7, 50 oC; (iii)
pH 5, 37 oC; (iv) pH 5, 50 oC (Fig. 3, 4). The synthesized
VP-containing oligonucleotides (2 µM) and complementary RNA
strand (1 µM) were dissolved in 50 mM of MES (pH 7.0) or
MES (pH 5.0) containing 100 mM NaCl, then incubated at 37 or
Using CPG 4 and 5 and the phosphoramidite precursor 7, 6
different oligoribonucleotides (ORNs) were synthesized on a
DNA/RNA synthesizer. The ORN sequences used in this study
are shown in Table 1. After incorporation of the VP precursor
into the oligonucleotides, deprotection and CPG cleavage were
carried out under ultramild conditions using ammonium
o
hydroxide/ethanol (3:1) at 30 C for 12 h to avoid undesirable
o
50 C for 24 h. The crosslink formation in the duplex RNA was
amination of the S-methyl group (Scheme 2). The 2’-O-TBS
group was then removed with TEA-3HF. Oligonucleotide
purification was performed using 20% polyacrylamide gel
electrophoresis.
analyzed by polyacrylamide gel electrophoresis (PAGE). The
condition giving the best crosslinking yield was used for a time
course experiment (Fig. 3, 4).
After gel purification, HPLC analysis was performed on each
of the synthesized ORNs. The HPLC profiles in Figure 2 show
three types of compounds confirmed by MALDI-TOF mass
spectroscopy (Table S1). ORN-B having a sulfoxide group was
obtained by the auto oxidation of the S-Me group in ORN-A.
ORN-C is a byproduct resulting from amination of the S-Me
group that occurs due to ammonium hydroxide used in the
deprotection step. ORN-C was not clearly observed when VP
was incorporated at the middle position.
(A) HPLC profile of ORN1
A
B
C
(min)
(B) HPLC profile of ORN2
ORN-A having an S-Me group was converted into ORN-B by
oxidation using magnesium monoperoxyphtalate (MMPP)
A
B
(min)
Figure. 2. HPLC profiles of (A) ORN1 and (B) ORN2.

ORN9, 11
ORN2
ORN9, 12
ORN3
ORN9, 10
ORN1
C: Condition screening with ORN3.
B: Condition screening with ORN2.
A: Condition screening with ORN1.
(oC)
(oC)
(oC)
pH 5
pH 7
pH 5
pH 7
pH 5
pH 7
F: Crosslinking formation of
ORN2-ORN9(U).
D: Time course of ORN1.
E: Time course of ORN2.
ORN9
24
48
72
96 (h)
Time (h)
Time (h)
Figure 3. Crosslinking reaction with the model sequence ORN1-3. Condition screening with (A) ORN1, (B) ORN2 and (C) ORN3.
The reaction was performed in MES buffer (50 mM. pH 7.0 or 5.0) containing NaCl (100 mM) at 37 or 50 oC for 24 h. Time course
of crosslinking reaction of (D, blue square) ORN1-ORN10(U), pH 7, 50 oC, (D, red circle) ORN1-ORN9(C), pH 5, 37 oC, (E, blue
o
square) ORN1-ORN9(U), pH 5, 50 C, (E, red circle) ORN1-ORN11(C), pH 5, 50 oC. (F) Gel image of crosslinking formation of
ORN2-ORN9(U).
ORN13
ORN13
ORN13
ORN6
ORN4
ORN5
C: Condition screening with ORN6.
B: Condition screening with ORN5.
A: Condition screening with ORN4.
(oC)
(oC)
(oC)
pH 5
pH 5
pH 7
pH 5
pH 7
pH 7
F: Time course of ORN6.
E: Time course of ORN5.
D: Time course of ORN4.
Time (h)
Time (h)
Time (h)
Figure 4. Crosslinking reaction with the ADAR substrate sequence ORN4-6. Condition screening with (A) ORN4, (B) ORN5 and (C) ORN6.
The reaction was performed in MES buffer (50 mM. pH 7.0 or 5.0) containing NaCl (100 mM) at 37 or 50 oC for 24 h. Time course of
crosslinking reaction of (D) ORN4-ORN13, pH 7, 50 oC, (E) ORN5-ORN13, pH 5, 37 or 50 oC, (F) ORN6-ORN13, pH 5 or 7, 50oC.
o
The results of the crosslinking reaction condition screening
and time course experiments for the model sequence ORN1-3 are
shown in Figure 3. For ORN1-ORN10 having U as the target,
milder conditions (pH 7, 50 C) for the crosslinking. The time
course showed that the crosslinking yield after 96 h for
ORN1-ORN10(U) was at 52% and ORN1-ORN9(C) was at 46%
(Fig. 3D). For ORN2, a 12 mer sequence of ORN having VP at
the middle position, both U and C as the target gave a high yield
at pH 5 and 50 oC (Fig. 3B). The time course showed that
ORN2 rapidly undergoes a crosslinking reaction for both the
o
the conditions that gave a relatively high yield were pH 7, 50 C
and pH 5, 50 oC; whereas for ORN1-ORN9 having C as the
o
target, the best yield was observed at pH 5, 37 C (Fig. 3A). In
the time course experiment for ORN1 with the U target, we used

target U and C. The crosslinking yield after 96 h was at 77%
for ORN2-ORN9(U), while ORN2-ORN11(C) was at 80% (Fig.
3E). The gel image for the crosslinking reaction of
ORN2-ORN9(U) is shown in Figure 3F and one clear new band
was observed. As for ORN3 having VP at the 5’ position, the
crosslinking yield was not more than 10% for any tested
condition (Fig. 3C). Since the yield was insufficiently high, a
time course experiment was not performed for this sequence.
1
2
3
4
For providing further information in the application of this
crosslinking method, we next performed the same crosslinking
formation toward the longer 22 mer sequences of ORN having
VP at 3’, the middle, and 5’ end positions (Fig. 4). The sequence
of ORN is reported as the substrate with the highest turnover rate
by ADAR2.34,35 The crosslinking reaction result for ORN4 and
ORN5 showed a similar tendency with the model sequences
ORN1 and ORN2. However, the maximum yields were
considerably low, even after 96 h of reaction, the yields were
only 27% for ORN4 and 25% for ORN5 (Fig. 4D, E). On the
other hand, the crosslinking formation at ORN6 gave the best
yield among all the sequences. Condition screening has shown
that ORN6 effectively crosslinked at pH 5, 50 oC followed by pH
7 nt
6 nt
Figure 5. Alkali mediated foot printing of crosslinked
ORN2-ORN9(U). 1: ORN9, 2: crosslinked duplex ORN2-ORN9(U),
3: after reaction with ORN9, 4: after reaction with crosslinked
duplex ORN2-ORN9(U).
o
7, 50 C (Fig. 4C). An incredibly satisfying yield of 87% was
o
obtained at pH 7, 50 C and 75% yield at pH 5 after 96 h of
reaction (Fig. 4F).
thiouracil instead of uracil.30
From the obtained data, we concluded that, in general, an
effective crosslinking reaction with a cytosine base requires
o
acidic conditions (pH 5) whereas for U, heat is required (50 C).
2.3. Alkali mediated foot-printing of crosslinked dsRNA
The position of the crosslink formation inside the dsRNA was
determined by performing alkali mediated foot-printing. In
order to obtain the crosslinking products of ORN2-ORN9(U),
ORN2-ORN11(C) and ORN6-ORN13 on a large scale, we
purified the crosslinking products by HPLC. The HPLC profile
showed that the crosslinked dsRNA had a longer retention time
compared to the complementary ORN, and the VP-containing
ORN was almost completely consumed (Fig. S4). The
crosslinking products were confirmed by MALDI-TOF mass
spectroscopy.
However, the crosslinking yields strongly depend on the
sequence. In our previous study with the 2’-OMe type ORN, we
observed a similar sequence dependency.32 We hypothesized
that one of the reasons for the sequence dependency was due to
the different lifetime of VP in each sequence. Since the
decomposition of VP was not observed from the MALDI-TOF
mass measurements (Table S1), we considered that VP would
become inactive by an intramolecular reaction. In order to
investigate the ratio of inactive VP, the reaction of VP with
glutathione was pursued by MALDI-TOF mass spectroscopy.
ORN1, 3, and 6 were investigated because they showed
considerably different yields regardless of the similarity of VP
position. The inactive products cannot react with glutathione, that
is, the reaction yield with glutathione should be low. The yield
for ORN3 was quite low compared to the other two sequences,
suggesting that ORN3 has less active VP than the others, which
is probably due to an unexpected intramolecular reaction within
ORN3 (Fig. S3). More effort is required in the development of
this crosslinking approach to overcome these sequence effects.
This may be accomplished with effective additives36 or
modification of the complimentary base, for example, using
To the crosslinked dsRNA was added a solution of K2CO3 in
MeOH with 5% H2O (45 mM). The reaction was carried out at 30
oC for 4 h. Random cleavage of the ORN will reveal the
crosslinking site in the dsRNA.
The alkali mediated
foot-printing result with the crosslinked ORN2-ORN9(U) is
shown in Figure 5. Based on the PAGE analysis, short
fragments of 1 nt to 6 nt and long fragments of more than 12 nt
were observed, but not 7 nt-11 nt fragments. These results
indicate that VP is crosslinked to the 7th base in the
complementary stand. The crosslinked ORN2-ORN11(C) alkali
mediated foot-printing analysis showed a similar result as with
ORN2-ORN9(U) (Fig. S5). Therefore, the crosslinking site of
A: ORN2-ORN9(U) duplex.
B: ORN2-ORN11(C) duplex.
C: ORN6-ORN13 duplex.
Temperature (oC)
Temperature (oC)
Temperature (oC)
Figure 6. Melting temperature measurement of dsRNA. A: ORN2-ORN9(U) duplex, B: ORN2-ORN11(C) duplex, C:
ORN6-ORN13 duplex. Natural duplex and crosslinked duplex are shown as dotted line and solid line, respectively.

B: ORN2-ORN11(C) duplex.
C: ORN6-ORN13 duplex.
A: ORN2-ORN9(U) duplex.
Wavelength (nm)
Wavelength (nm)
Wavelength (nm)
Figure 7. CD measurement of dsRNA. A: ORN2-ORN9(U) duplex, B: ORN2-ORN11(C) duplex, C: ORN6-ORN13
duplex. Natural duplex and crosslinked duplex are shown as dotted line and solid line, respectively.
ORN2-ORN11(C) was also at the 7th base, which is the expected
C base target.
duplex, ORN6(X=A)-ORN13, had a melting temperature value
of 55.6 oC. After the crosslink was formed, the melting
temperature value of the dsRNA significantly increased to 82.6
As for the crosslinked ORN6-ORN13, the alkali mediated
foot-printing experiment showed that the crosslinking occurred at
the expected position (Fig. S6). PAGE analysis revealed all the
possible fragments except for the 22nd fragment. This result
indicated that crosslinking of ORN6 occurred at the 22nd base,
which is the expected U base target.
o
oC. A melting temperature increase by a value of 27 C shows
that the crosslink formation, regardless of the position, can
significantly increase the thermodynamic stability of the dsRNA.
Circular dichroism (CD) spectra were obtained to provide
information regarding the conformational properties of the
crosslinked dsRNA. Prior to the measurement, both the natural
and crosslinked dsRNA samples were reannealed by heating at
2.4. Melting temperature and CD spectra of crosslinked
dsRNA
o
90 C for 5 min, then gradually cooling to room temperature.
The CD spectra of the typical dsRNA with its A conformation is
characterized by a dominant positive band at 260 nm and a
negative band at 210 nm.37 For the crosslinked duplexes,
ORN2-ORN9(U), ORN2-ORN11(C), and ORN6-ORN13, the
CD spectra showed almost no difference from those of the
natural dsRNA, indicating that the crosslinking formation does
not disturb the dsRNA natural conformational properties (Figs.
7A, B, C).
Melting temperature measurements were performed to provide
insight into the crosslinked dsRNA thermodynamic stability
compared to the natural dsRNA. The melting temperature
measurements of ORN2-ORN9(U) and ORN2-ORN11(C) are
shown in Figures 6A and 6B. Curves shown with a dotted line on
the graph are the melting temperature curve of the natural duplex
o
with their melting temperature values obtained as 70.5 C and
59.6 oC, respectively, for ORN2(X=A)-ORN9(U) and
ORN2(X=A)-ORN11(C). It should be noted that the natural
duplex with ORN11(C) has a lower Tm than that with ORN9(U)
because it contains one base mismatch at the C target position.
Interestingly, no absorbance changes characteristic of the duplex
melting were observed for the crosslinked duplex
ORN2-ORN9(U) and ORN2-ORN11(C) (solid lines, Figures 6A
and 6B). One possible explanation is that denaturation of the
crosslinked dsRNA to single stranded RNA does not occur at
2.5. Competitive binding assay with ADAR2
In order to validate our hypothesis that the crosslink formation
does not disrupt the nature of the dsRNA, a competitive binding
assay was performed with the dsRNA-binding enzyme, ADAR2.
The complex of the human ADAR2 bound to a 32P-labeled
natural duplex ORN6(X=A)-ORN14 was resolved from the free
duplex RNA using a non-denaturing PAGE gel. Either the
unlabeled natural or crosslinked duplex, ORN6-ORN14, was
then used as a competitor for formation of the labeled complex,
and the IC50 for inhibition of the complex formation was
measured for each duplex (Fig. S7).
o
temperatures below 95 C. These results imply that crosslinking
the dsRNA has significantly increased its thermodynamic
stability.
Melting temperature measurements for ORN6-ORN13 are
shown in Figure 6C. This duplex is an ADAR2 substrate RNA
with an internal loop near the reactive adenosine and with a
crosslink formed from VP at the 5’ end position. The natural
The results are plotted in Figure 8 and the IC50s for the two
duplexes were calculated from these data. The result shows that
the natural duplex RNA had an IC50 = 330 55 nM whereas the
crosslinked IC50 = 270 73 nM. Thus, the crosslinked dsRNA
has nearly the same binding affinity for ADAR as the natural one,
showing that the crosslinked dsRNA is well tolerated by the
enzyme. This experiment confirms that our crosslinked duplex
preserved the natural traits of the dsRNA.
3. Conclusion
We have successfully developed a native-like crosslinked
dsRNA with our designed reactive base vinylpurine (VP). Two
types of VP precursors, a phosphoramidite and a CPG precursor,
were successfully synthesized and both VP precursors were
incorporated into the RNA sequences at several different
positions. We observed effective crosslinking with cytosine
under acidic conditions, whereas for U, heating was required. We
Figure 8. Competitive binding assay result with ADAR2 enzyme.
red: native dsRNA; blue: crosslinked dsRNA.

confirmed that the crosslinking occurred at the expected target by
performing alkali facilitated foot printing.
127.1, 113.3, 90.9, 86.9, 85.9, 75.9, 72.4, 63. 5, 55.4. ESI-HRMS
(m/z) calcd for C13H29ClN4O6 (M+H)+ 589.1848, found 589.1864.
The crosslinked duplex melting temperature (Tm) and CD
spectra were obtained and compared to that of the natural
oligonucleotides. The melting temperature of the crosslinked
dsRNA showed a substantial increase compared to that of the
natural duplex suggesting that by inducing crosslinking via VP, a
much more stable dsRNA can be obtained. Moreover, a great
similarity was found in the CD spectra of the crosslinked dsRNA
and natural dsRNA implying that even after the crosslink
formation, the native conformation of dsRNA is maintained. To
further strengthen this point, a competitive binding experiment
with the dsRNA-binding enzyme, ADAR2, was performed.
Our result showed that the crosslinked dsRNA has nearly the
same binding affinity as the natural dsRNA, confirming that our
crosslinked dsRNA is well recognized by ADAR2. One of the
advantages of this dsRNA crosslinking method is that, in
principle, crosslink formation can be easily performed with the
chemically unmodified natural RNA. The potential to form a less
distorted native-like stable dsRNA will find application in
biochemical studies for dsRNA-binding enzymes and RNA
nanotechnology. For example, the crosslinking would be useful
to develop a new inhibitor for dsRNA-binding enzymes since the
crosslinking leads to increase the resistance toward nuclease
activity. In addition, duplex stabilization could allow for short
duplex inhibitors to be used. The less distorted RNA-RNA
crosslinking will be also useful to form thermally stable RNA
nanostructures as well as previously reported DNA-DNA
crosslinked nanostructures.38,39
4.2.2. Synthesis
9-(5-O-dimethoxytrityl-D-ribofuranosyl)-6-vinylpurine (2)
of
To a solution of 1 (0.77 g, 1.3 mmol) in DMF were added
PdCl2(PPh3)2 (92 mg, 0.13 mmol) and tributyl(vinyl)tin (0.57 mL,
2.0 mmol). The reaction mixture was stirred at 85° C for 40 min
and then allowed to cool at room temperature. The reaction
mixture was diluted with CH2Cl2 (70 mL) and washed with
saturated aqueous NaHCO3 (70 mL) and brine (100 mL). The
organic layer was dried over Na2SO4, concentrated under reduced
pressure and purified by column chromatography (CH2Cl2:MeOH
= CH2Cl2 only→ 49:1→ 29:1→ 9:1 containing 1% pyridine) to
give 2 as a brown foam (0.53 g). The product was immediately
used for next reaction.
4.2.3.
9-(5-O-dimethoxytrityl-D-ribofuranosyl)-6-(2-methylthioethyl
Synthesis
of
)purine (3)
To a solution of 2 (0.53 g, 0.91 mmol) in acetonitrile (4 mL)
was added CH3SNa (0.32 g, 0.22 mmol) which was dissolved
in water (0.4 mL), and the mixture was stirred at RT for 3 h. The
reaction mixture was diluted with CH2Cl2 (15 mL) and washed
with water (70 mL) and brine (100 mL). The organic layer was
dried over Na2SO4, concentrated under reduced pressure and
purified by column chromatography (CHCl3:MeOH = CHCl3
only→ 49:1→ 29:1→ 9:1 containing 1% pyridine) to give 3 as
an orange foam (0.48 g, 60% in two steps). 1H-NMR (600
MHz, CDCl3) δ (ppm) 8.85 (1H, s), 8.32 (1H, s), 7.27-26 (2H,
m), 7.20-16 (7H, m), 6.74 (4H, dd, J = 9.0, 2.4 Hz), 6.04 (1H, d,
J = 5.4), 5.71 (1H, d, J = 2.4), 4.85 (1H, td, J = 6.0, 3.6 Hz), 4.45
(1H, m), 4.43 (1H, dd, J = 6.0, 3.0 Hz), 3.77 (6H, s), 3.52 (2H, td,
J = 7.2 4.8 Hz), 3.46 (1H, dd, J = 10.8, 3.6 Hz), 3.29 (1H, dd, J =
10.8, 3.6 Hz), 3.27 (1H, d, J = 2.4), 3.10 (2H, t, J = 7.2 Hz), 2.18
(3H, s). 13C-NMR (150 MHz, CDCl3) δ (ppm) 161.4, 158.7,
151.8, 150.1, 149.7, 144.4, 142.6, 135.5, 135.4, 133.8, 130.1,
128.0, 127.1, 113.3, 90.8, 86.7, 86.1, 76.0, 72.7, 63.5, 55.3, 32.9,
32.1, 15.6. ESI-HRMS (m/z) calcd for C34H36N4O6S (M+H)+
629.2428, found 629.2428.
4. Materials and methods
4.1. General
1
The H-NMR spectra (400 MHz) and 32P-NMR (162 MHz)
were recorded by a Bruker 400 spectrometer. The 1H-NMR
spectra (600 MHz) and 13C-NMR spectra (150 MHz) were
recorded by a Bruker AVANCE III 600 spectrometer. High
resolution electrospray mass analysis was performed by a Bruker
MicrOTOFQ II. The MALDI-TOF mass analysis was performed
by a Bruker autoflex speed mass spectrometer.
4.2.4.
9-(5-O-dimethoxytrityl-2/3-O-succinylated-LCAA-CPG-D-rib
Synthesis
of
4.2. Synthesis of SMe-protected VP CPG and
phosphoramidite precursor
ofuranosyl)-6-(2-methylthioethyl)purine (4 and 5)
Preparation of succinylated LCAA-CPG
4.2.1. Synthesis
9-(5-O-dimethoxytrityl-D-ribofuranosyl)-6-chloropurine (1)
of
LCAA-CPG (0.5 g, 76 µmol) in a vial was slowly stirred in a
solution of 3% trichloroacetic acid in CH2Cl2 (4.5 mL) at room
temperature for 4 h. The LCAA-CPG filtered off and washed
first with 9:1 triethylamine:diisopropylethylamine (50 mL), then
with CH2Cl2 and ether. The activated support was dried under
vacuum for 2 h. Into the vial containing the acid-activated
LCAA-CPG was added succinic anhydride (0.1 g, 1.0 mmol) and
4-dimethyl aminopyridine (4-DMAP, 20mg, 0.16 mmol).
Anhydrous pyridine (3 mL) was added via a syringe, and the vial
was shaken at room temperature for 20 h. The CPG was filtered
off, washed successively with pyridine, CH2Cl2 and ether. The
succinylated CPG was dried under vacuum for 3 h.
6-Chloropurine riboside (1.0 g, 3.5 mmol) was co-evaporated
with acetonitrile and pyridine, then dissolved in pyridine (10
mL). To the solution was added DMTrCl (2.4 g, 7.0 mmol), and
the mixture was stirred at RT for 1 h. The reaction mixture was
then diluted with ethyl acetate (50 mL), washed with water (50
mL) and brine (100 mL). The organic layer was dried over
Na2SO4, then concentrated under reduced pressure. The crude
was purified by column chromatography (Hexane:Ethyl acetate =
1:1→1:3→1:6→Ethyl acetate only containing 1% pyridine) to
give 1 as a yellow foam (1.74 g, 85%). 1H-NMR (400 MHz,
CDCl3) δ (ppm) 8.69 (1H, s), 8.37 (1H, s), 7.27-26 (3H, m),
7.19-17 (6H, m), 6.74 (4H, dd, J = 1.6, 8.8 Hz), 6.05 (1H, d, J =
5.6), 5.04 (1H, brs), 4.86 (1H, t, J = 5.2 Hz), 4.47 (1H, dd, J =
5.2, 6.0 Hz), 4.39 (1H, dd, J = 3.2, 6.0 Hz), 3.76 (6H, s), 3.45
(1H, dd, J = 10.8, 3.6 Hz) 3.35 (1H, dd, J = 10.8, 3.2 Hz), 3.25
(1H, brs). 13C-NMR (150 MHz, CDCl3) δ (ppm) 158.7, 151.7,
151.6, 151.0, 144.3, 144.0, 135.4, 132.5, 130.1, 130.0, 128.0,
Nucleoside succinylated LCAA-CPG coupling
The succinylated CPG (0.1 g, ~16 µmol) in a vial was
co-evaporated with acetonitrile three times, then dried overnight
under vacuum. To the vial were added EDC (0.62 g, 400 µmol),
4-DMAP (2.4 mg, 20 µmol), and pyridine (0.6 mL). To this
solution, precursor 3 that was coevaporated with ACN,
vacuumed overnight and diluted in pyridine (0.6 mL) and

N,N-diisopropylethylamine (DIPEA, 20.9 µL) were added and
the solution was shaken at room temperature for 48 h.
Pentachlorophenol (26.6 mg, 0.1 mmol) was added and the
mixture was shaken for an additional period of 19 h. The CPG
was washed using pyridine, CH2Cl2, and ACN in a small amount
and dried under vacuum for 1 h. Piperidine (2.5 mL) was added
and the mixture was shaken for 1 h, then washed with a small
amount of pyridine, CH2Cl2, and ACN dried under vacuum for
3h. Cap A (0.5 mL) and cap B (0.5 mL) were added and the
mixture was shaken for 3 h at room temperature, washed with a
small amount of pyridine three times, CH2Cl2 three times, THF
and ether, then it was dried under vacuum overnight to give 4 and
5 as a dark orange powder (86 µmol/g loading, 56%).
NH4OH:EtOH for 12 h at 30°C, followed by TBS deprotection
by incubation with trimethylamine trihydrofluoride (TEA-3HF)
(125 µL) in DMSO (100 µL) for 2.5 h at 65oC. The reaction
mixture was desalted by an NAP-10 column (GE Healthcare).
The ORNs were then purified by gel electrophoresis (20%
polyacrylamide) in 1x TBE buffer. The extract was filtered and
desalted by a Sep-pak C-18 Cartridge (Waters Co.). Further
purification was carried out by HPLC. The purified ORNs were
treated with Zip-tip (Merck-Millipore), and then MALDI-TOF
mass spectroscopy was measured. The concentration of the
ORNs was determined by UV absorption at 260 nm.
4.4. General procedure for crosslinking reaction
30 µM of ORN-B (5 µL, 150 pmol) and acetic acid (5 µL)
were mixed, and the mixture was incubated at 37°C for 3h. The
mixture was evaporated to dryness, and then water (10 µL) was
added. 15 µM of RNA-D having a vinyl group (1 µL, 15 pmol,
final 2 µM) was combined with 10 µM of the RNA target (0.75
µL, 7.5 pmol, final 1 µM) and MES buffer (pH 7.0 or 5.0, final
50 mM) containing NaCl (final 100 mM). After incubation, a part
of the reaction mixture was collected in a small tube and
quenched with loading buffer (80% formamide, 10 mM EDTA).
The collected reaction mixture was analyzed by denaturing 16%
polyacrylamide gel electrophoresis containing 20% formamide,
run at 300V x 45 mins to 1 hour in 1x TBE buffer. The
FAM-labelled RNAs were visualized and quantified with
FLA-5100 (Fujifilm Co., Tokyo, Japan).
4.2.5.
9-(5-O-dimethoxytrityl-2-O-tert-butyldimethylsilyl)-6-(2-meth
Synthesis
of
ylthioethyl)purine (6)
Compound 3 (0.58 g, 0.92 mmol) was co-evaporated with
acetonitrile, and then the dried residue was dissolved in THF (4
mL). To the solution were added pyridine (371 µL, 4.6 mmol),
AgNO3 (240 mg, 1.4 mmol) and TBDMSCl (249 mg, 1.65
mmol), and the mixture was stirred for 3 h at room temperature.
The reaction mixture was diluted with CH2Cl2 (50 mL), filtered
through celite, and washed with NaHCO3 (50mL) and brine (50
mL). The organic layer was dried over Na2SO4, concentrated
under reduced pressure and purified by column chromatography
(Hexane/Ethyl acetate = 9:1→ 6:1→ 4:1→ 3:1→ 1:1→ Ethyl
acetate only, containing 1% pyridine) to give 6 as an orange foam
(412 mg, 61%). 1H-NMR (600MHz, CDCl3) δ (ppm) 8.81 (1H,
s), 8.27 (1H, s), 7.45 (2H, d, J = 9.0 Hz), 7.34 (4H, dd, J = 9.0,
0.6 Hz), 7.27-26 (3H, m), 6.81 (4H, dd, J = 11.4, 2.4 Hz), 6.11
(1H, d, J = 5.4), 5.01 (1H, t, J = 5.4 Hz), 4.36 (1H, dd, J = 4.2,
9.0 Hz), 4.29 (1H, dd, J = 9.0, 7.2 Hz), 3.79 (6H, s), 3.55-51 (3H,
m), 3.39 (1H, dd, J = 13.6, 4.2 Hz), 3.10 (2H, t, J = 5.4 Hz), 2.71
(d, J = 4.2 Hz), 2.18 (3H, s), 0.83 (9H, s), -0.02 (3H, s), -0.17
(3H, s). 13C-NMR (150 MHz, CDCl3) δ (ppm) 160.8, 158.7,
152.6, 150.8, 144.7, 142.8, 135.7, 133.5, 130.2, 128.2, 128.1,
127.1, 113.3, 88.3, 86.8, 84.3, 75.8, 71.6, 63.4, 55.4, 32.9, 32.2,
25.7, 18.0, 15.6, -4.9, -5.1. ESI-HRMS (m/z) calcd for
C40H50N4O6SSi (M+H)+ 743.3293, found 743.3293.
4.5. Alkali mediated foot-printing
To the duplex RNA (0.13 µM) was added K2CO3 diluted in
MeOH with 5% H2O (45 mM). The reaction was carried out at
30ºC for 4 h. The reaction solution was neutralized by the
addition of 0.5M of TEAA (20 µL) and 1M of HCl (0.5 µL) and
then analyzed by denaturing 16% polyacrylamide gel
electrophoresis containing 20% formamide, run at 300V x 45
mins to 1 hour in 1x TBE buffer. The FAM-labelled RNAs were
visualized with FLA-5100 (Fujifilm Co., Tokyo, Japan).
4.6. Melting temperature (Tm) measurement
The duplex RNA (0.2 µM, natural or crosslinked) in 50 mM
of MES buffer (pH 7.0) containing 100 mM NaCl was
transferred to a microquartz cell with a 1-cm path length. The
melting temperature was then measured under UV absorption at
260 nm from 25°C to 95°C at the rate of 1°C/min. The
measurements were carried out 3 times per each sample, and
averaged for obtaining the final value. The melting temperature
4.2.6.
Synthesis
of
9-(5-O-dimethoxytrityl-3-O-(N,N-diisopropyl-2-cyanoethylph
osphoramidyl)-2-O-tert-butyldimethylsilyl-D-ribofuranosyl)-6
-(2-methylthioethyl)purine (7)
measurement
was
performed
by
a
DU-800
temperature
Compound 6 (120.0 mg, 0.162 mmol) was co-evaporated with
acetonitrile and dissolved in CH2Cl2 (1 mL). To the dry residue
were added DIPEA (170 µL, 0.98 mmol) and phosphoramidite
(90 µL, 0.40 mmol), and the mixture was stirred at RT for 1 h.
The reaction mixture was then quenched with NaHCO3 (20 mL),
and extracted three times with EtOAc (20 mL). The combined
organic layers were washed with brine (20 mL), dried over
Na2SO4, and concentrated under reduced pressure. The residue
was purified by silica gel column chromatography (Hexane/Ethyl
acetate = 4:1 →3:1 →2:1 →1:1, containing 1% pyridine) to give
7 as a pale orange foam (141 mg, 92%). 31P NMR (162 MHz,
CDCl3): δ (ppm) 151.0, 149.0. ESI-HRMS (m/z) calcd for
C49H68N6O7PSSi (M+H)+ 943.4372, found 943.4372.
(BECKMAN-COULTER) equipped with
controller.
a
4.7. Circular Dichroism (CD) measurement
The CD spectra were measured using 1 µM duplex RNA
(natural or crosslinked) in 20 mM phosphate buffer (pH 7.0)
containing 100 mM NaCl at 25°C by a J-720WI (JASCO Co.,
Hachioji, Japan) equipped with a Peltier temperature controller.
4.8. Competitive binding assay with ADAR2
ORN14 (30 pmol) was 5’-end-labeled by incubating the
oligonucleotide with T4 polynucleotide kinase and [γ-32P] ATP
(6000 Ci mmol-1) for 37 ºC for 1 h. Sample was filtered through a
4.3. Synthesis and purification of SMe-protected
VP-containing oligonucleotides
G25 column and purified on
a 19% (w/v) denaturing
polyacrylamide gel. The labeled RNA was visualized by storage
phosphor autoradioradiography, excised, crushed, and soaked
overnight at 4ºC using a solution containing 500 nM NH4OAC
and 0.1 mM EDTA. The sample was ethanol precipitated,
washed with 70% (v/v) ethanol, lyophilized to dryness, and
The ORNs were synthesized following standard protocols on a
DNA/RNA synthesizer. Cleavage from the solid support and
deprotection were accomplished under a mild condition with

11. Mozaffari-Jovin, S.; Wandersleben, T.; Santos, K. F.; Will, C. L.;
Luhrmann, R.; Wahl, M. C. RNA Biol. 2014, 11, 298.
12. Guo, P. Nat Nanotechnol 2010, 5, 833.
dissolved in nuclease-free water. ORN6(X=A) and ORN14
duplex was hybridized in a 1:1 ratio in 1X TE buffer and 0.1 M
NaCl by heating to 95 ºC for 5 minutes and slow cooling to 30
ºC.
13. Grabow, W. W.; Jaeger, L. Acc. Chem. Res. 2014, 47, 1871.
14. Patel, M. R.; Kozuch, S. D.; Cultrara, C. N.; Yadav, R.; Huang, S.;
Samuni, U.; Koren III, J.; Chiosis, G.; Sabatino, D. Nano Lett.
2016, 16, 6099.
15. Sloane, J. L.; Greenberg, M. M. J. Org. Chem. 2014, 79, 9792.
16. Christian, E. L.; McPheeters, D. S.; Harris, M. E. Biochemistry
1998, 37, 17618.
17. Hiley, S. L.; Sood, V. D.; Fan, J.; Collins, R. A. EMBO J. 2002,
21, 4691.
18. Kamiya, Y.; Iishiba, K.; Doi, T.; Tsuda, K.; Kashida, H.;
Asanuma, H. Biomater. Sci. 2015, 3, 1534.
19. Nagatsugi, F.; Imoto, S. Org. Biomol. Chem. 2011, 9, 2579.
20. Kocalka, P.; El-Sagheer, A. H.; Brown, T. ChemBioChem 2008, 9,
1280.
21. Xiong, H.; Seela, F. Bioconjugate Chem. 2012, 23, 1230.
22. Sakamoto, T.; Ooe, M.; Fujimoto, K. Bioconjugate Chem. 2015,
26, 1475.
23. Ichikawa, K.; Kojima, N.; Hirano, Y.; Takebayashi, T.; Kowata,
K.; Komatsu, Y. Chem. Commun. 2012, 48, 2143.
24. Ghosh, S.; Greenberg, M. M. J. Org. Chem. 2014, 79, 5948.
25. Fakhari, F.; Rokita, S. E. Nat. Commun. 2014, 5, 5591.
26. Sugihara, Y.; Nakata, Y.; Yamayoshi, A.; Murakami, A.; Kobori,
A. J. Org. Chem. 2016, 81, 981.
Samples containing 63 nM hADAR2, 2.8 nM 32P-labeled,
ORN6(X=A) and ORN14 duplex and different concentrations of
unlabeled natural or crosslinked ORN6-ORN14 duplex (1000,
500, 250, 125, 62.5, 31.25, 15.6, 7.81, and 0 nM) were
equilibrated in 20-mM Tris-HCl, pH 7.0, 6% glycerol, 0.5 mM
DTT, 60 mM KCl, 20 mM NaCl, 0.1 mM 2- mercaptoethanol,
1.5 mM EDTA, 0.003% NP-40, 160-units/ml RNasin, 100-µg/ml
BSA and 1.0-µg/ml yeast tRNA for 30 min at 30 ºC. Samples
were run on a 6% 80:1 native polyacrylamide gel at 16V/cm for
45 min, dried at 80 ºC for 1 hr and imaged on a Typhoon Trio
Variable Mode Image from GE Healthcare. Bands were
quantified by volume integration using ImageQuant software
such that all radioactive signal not found in the free RNA band
was quantified as bound RNA. The data were fitted to the
following equation: m4+((m1-m4)/(1+(m0/m3)^m2)) where
m0 = concentration of competing RNA, m1 = curve maximum,
m2 = slope, m3 = IC50 and m4 = curve minimum. IC50 assays
were carried out in triplicate. Reported IC50 values are average
of individual assays and error reported is standard deviation of
the individual IC50 values.
27. Op de Beeck, M.; Madder, A. J. Am. Chem. Soc. 2011, 133, 796.
28. Nagatsugi, F.; Kawasaki, T.; Usui, D.; Maeda, M.; Sasaki, S. J.
Am. Chem. Soc. 1999, 121, 6753.
29. Kawasaki, T.; Nagatsugi, F.; Ali, M. M.; Maeda, M.; Sugiyama,
K.; Hori, K.; Sasaki, S. J. Org. Chem. 2005, 70, 14.
30. Imoto, S.; Hori, T.; Hagihara, S.; Taniguchi, Y.; Sasaki, S.;
Nagatsugi, F. Bioorg. Med. Chem. Lett. 2010, 20, 6121.
31. Imoto, S.; Chikuni, T.; Kansui, H.; Kunieda, T.; Nagatsugi, F.
Nucleos. Nucleot. Nucl. 2012, 31, 752.
32. Hagihara, S.; Kusano, S.; Lin, W. C.; Chao, X. G.; Hori, T.;
Imoto, S.; Nagatsugi, F. Bioorg. Med. Chem. Lett. 2012, 22, 3870.
33. Damha, M. J.; Giannaris, P. A.; Zabarylo, S. V. Nucleic Acids Res.
1990, 18, 3813.
Acknowledgments
This work was supported by a Grant-in-Aid for Scientific
Research on Innovative Areas (‘‘Middle Molecular Strategy.”
JP15H05838) and a Grant-in-Aid for Scientific Research (B)
[25288073] from the Japan Society for the Promotion of Science
(JSPS). This work was also supported in part by the research
program of “Dynamic Alliance for Open Innovation Bridging
Human, Environment and Materials”.
34. Phelps, K. J.; Tran, K.; Eifler, T.; Erickson, A. I.; Fisher, A. J.;
Beal, P. A. Nucleic Acids Res. 2015, 43, 1123.
35. Matthews, M. M.; Thomas, J. M.; Zheng, Y.; Tran, K.; Phelps, K.
J.; Scott, A. I.; Havel, J.; Fisher, A. J.; Beal, P. A. Nat. Struct.
Mol. Biol. 2016, 23, 426.
References and notes
36. Kusano, S.; Ishiyama, S.; Lam, S. L.; Mashima, T.; Katahira, M.;
Miyamoto, K.; Aida, M.; Nagatsugi, F. Nucleic Acids Res. 2015,
43, 7717.
37. Lesnik, E. A.; Freier, S. M. Biochemistry 1995, 34, 10807.
38. Rajendran, A.; Endo, M.; Katsuda, Y.; Hidaka, K.; Sugiyama, H.
J. Am. Chem. Soc. 2011, 133, 14488.
1. Lunde, B. M.; Moore, C.; Varani, G. Nat. Rev. Mol. Cell Biol.
2007, 8, 479.
2. Beal, P. A. ChemBioChem 2005, 6, 257.
3. Bass, B. L. Annu. Rev. Biochem 2002, 71, 817.
4. Nishikura, K. Annu. Rev. Biochem 2010, 79, 321.
5. Tomaselli, S.; Galeano, F.; Alon, S.; Raho, S.; Galardi, S.; Polito,
V. A.; Presutti, C.; Vincenti, S.; Eisenberg, E.; Locatelli, F.; Gallo,
A. Genome Biol. 2015, 16, 5.
39. Tagawa, M.; Shohda, K., Fujimoto, K.; Suyama, A. Soft Matter
2011, 7, 10931.
6. Paz, N.; Levanon, E. Y.; Amariglio, N.; Heimberger, A. B.; Ram,
Z.; Constantini, S.; Barbash, Z. S.; Adamsky, K.; Safran, M.;
Hirschberg, A.; Krupsky, M.; Ben-Dov, I.; Cazacu, S.; Mikkelsen,
T.; Brodie, C.; Eisenberg, E.; Rechavi, G. Genome Res. 2007, 17,
1586.
Supplementary data
Supplementary data associated with this article can be found,
in the online version.
7. Rice, G. I.; Kasher, P. R.; Forte, G. M.; Mannion, N. M.;
Greenwood, S. M.; Szynkiewicz, M.; Dickerson, J. E.; Bhaskar, S.
S.; Zampini, M.; Briggs, T. A.; Jenkinson, E. M.; Bacino, C. A.;
Battini, R.; Bertini, E.; Brogan, P. A.; Brueton, L. A.; Carpanelli,
M.; De Laet, C.; de Lonlay, P.; del Toro, M.; Desguerre, I.; Fazzi,
E.; Garcia-Cazorla, A.; Heiberg, A.; Kawaguchi, M.; Kumar, R.;
Lin, J. P.; Lourenco, C. M.; Male, A. M.; Marques, W., Jr.;
Mignot, C.; Olivieri, I.; Orcesi, S.; Prabhakar, P.; Rasmussen, M.;
Robinson, R. A.; Rozenberg, F.; Schmidt, J. L.; Steindl, K.; Tan,
T. Y.; van der Merwe, W. G.; Vanderver, A.; Vassallo, G.;
Wakeling, E. L.; Wassmer, E.; Whittaker, E.; Livingston, J. H.;
Lebon, P.; Suzuki, T.; McLaughlin, P. J.; Keegan, L. P.;
O'Connell, M. A.; Lovell, S. C.; Crow, Y. J. Nat. Genet. 2012, 44,
1243.
8. Weiden, M. D.; Hoshino, S.; Levy, D. N.; Li, Y.; Kumar, R.;
Burke, S. A.; Dawson, R.; Hioe, C. E.; Borkowsky, W.; Rom, W.
N.; Hoshino, Y. PLoS One 2014, 9, e108476.
9. Meister, G.; Tuschl, T. Nature 2004, 431, 343.
10. Bernstein, E.; Caudy, A. A.; Hammond, S. M.; Hannon, G. J.
Nature 2001, 409, 363.

Graphical Abstract
To create your abstract, type over the instructions in the
template box below.
Synthesis of native-like cross-linked duplex
Leave this area blank for abstract info.
R
RNA and study of its properties
K
L
azumitsu Onizuka a, Madoka E. Hazemi a, Justin M. Thomas b,
Leanna R. Monteleoneb, Ken Yamada a, Shuhei Imoto c, Peter A. Beal b, Fumi Nagatsugi a,*
a Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, 2-1-1 Katahira, Aoba-ku,
Seendai, Miyagi 980-8577, Japan
b Department of Chemistry, University of California, Davis, One Shields Ave, Davis, California 95616, USA
c Faculty of Pharmaceutical Sciences, Sojo University, 4-22-1 Ikeda, Kumamoto 860-0082, Japan
Fonts or abstract dimensions should not be changed or altered.