Effects of C-terminal truncation on autocatalytic processing of Bacillus licheniformis γ-glutamyl transpeptidase

Article abstract of DOI:10.1134/S0006297910070151

The role of the C-terminal region of Bacillus licheniformis γ-glutamyl transpeptidase (BlGGT) was investigated by deletion analysis. Seven C-terminally truncated BlGGTs lacking 581-585, 577-585, 576-585, 566-585, 558-585, 523-585, and 479-585 amino acids,

Full text of DOI:10.1134/S0006297910070151

ISSN 0006ꢀ2979, Biochemistry (Moscow), 2010, Vol. 75, No. 7, pp. 919ꢀ929. © Pleiades Publishing, Ltd., 2010.
Effects of CꢀTerminal Truncation on Autocatalytic Processing
γ
of Bacillus licheniformis ꢀGlutamyl Transpeptidase
HuiꢀPing Chang1, WanꢀChi Liang1, RuiꢀCin Lyu1, MengꢀChun Chi1,
TzuꢀFan Wang2, KuoꢀLiang Su3, HuiꢀChih Hung3, and LongꢀLiu Lin1*
1Department of Applied Chemistry, National Chiayi University, 300 Syuefu Road,
Chiayi County 60004, Taiwan; fax: +886ꢀ5ꢀ271ꢀ7901; Eꢀmail: llin@mail.ncyu.edu.tw
2Department of Life Sciences and Institute of Molecular Biology, National Chung Cheng University,
168 University Road, Minhsiung Township, Chiayi County 62102, Taiwan
3Institute of Genomics and Bioinformatics, National Chung Hsing University,
250 Kuokuang Road, Taichung County 400, Taiwan
Received January 18, 2010
Revision received April 30, 2010
Abstract—The role of the Cꢀterminal region of Bacillus licheniformis γꢀglutamyl transpeptidase (BlGGT) was investigated by
deletion analysis. Seven Cꢀterminally truncated BlGGTs lacking 581ꢀ585, 577ꢀ585, 576ꢀ585, 566ꢀ585, 558ꢀ585, 523ꢀ585,
and 479ꢀ585 amino acids, respectively, were generated by siteꢀdirected mutagenesis. Deletion of the last nine amino acids
had no appreciable effect on the autocatalytic processing of the enzyme, and the engineered protein was active towards the
synthetic substrate Lꢀγꢀglutamylꢀpꢀnitroanilide. However, a further deletion to Val576 impaired the autocatalytic processꢀ
ing. In vitro maturation experiments showed that the truncated BlGGT precursors, proꢀ∆(576ꢀ585), proꢀ∆(566ꢀ585), and
proꢀ∆(558ꢀ585), could partially precede a timeꢀdependent autocatalytic process to generate the Lꢀ and Sꢀsubunits, and
these proteins showed a dramatic decrease in catalytic activity with respect to the wildꢀtype enzyme. The parental enzyme
(BlGGTꢀ4aa) and BlGGT were unfolded biphasically by guanidine hydrochloride (GdnCl), but ∆(577ꢀ585), ∆(576ꢀ585),
∆(566ꢀ585), ∆(558ꢀ585), ∆(523ꢀ585), and ∆(479ꢀ585) followed a monophasic unfolding process and showed a sequential
reduction in the GdnCl concentration corresponding to half effect and ∆G0 for the unfolding. BlGGTꢀ4aa and BlGGT sedꢀ
imented at ~4.85 S and had a heterodimeric structure of approximately 65.23 kDa in solution, and this structure was conꢀ
served in all of the truncated proteins. The frictional ratio (f/fo) of BlGGTꢀ4aa, BlGGT, ∆(581ꢀ585), and ∆(577ꢀ585) was
1.58, 1.57, 1.46, and 1.39, respectively, whereas the remaining enzymes existed exclusively as precursor form with a ratio of
less than 1.18. Taken together, these results provide direct evidence for the functional role of the Cꢀterminal region in the
autocatalytic processing of BlGGT.
DOI: 10.1134/S0006297910070151
Key words: Bacillus licheniformis, γꢀglutamyl transpeptidase, Cꢀterminal truncation, autocatalytic processing, analytical
ultracentrifugation
γꢀGlutamyl transpeptidase (GGT; EC 2.3.2.2) is a acceptor that can be an amino acid, a peptide, or water
member of the Nꢀterminal nucleophile (Ntn) hydrolase [2]. The inactive precursor of Ntn hydrolases must underꢀ
superfamily [1] and catalyzes the transfer of the γꢀgluꢀ go intramolecular autocatalytic processing to generate
tamyl group of glutathione and related compounds to an the mature active enzyme. The new Nꢀterminal residue,
typically a serine, threonine, or cysteine, acts as a nucleoꢀ
phile for both autocatalytic processing and catalytic reacꢀ
Abbreviations: AEW, average emission wavelength; BlGGT,
tion. GGTs are generally considered to be involved in the
EcGGT, and HpGGT, Bacillus licheniformis, Escherichia coli,
metabolism of glutathione and in salvaging of cysteine [3,
and Helicobacter pylori γꢀglutamyl transpeptidases; CD, circuꢀ
4]. Helicobacter pylori GGT (HpGGT) has been shown to
lar dichroism; IPTG, isopropylꢀβꢀDꢀthiogalactopyranoside;
degrade extracellular glutathione and glutamine, providꢀ
LꢀγꢀGluꢀpꢀNA, Lꢀγꢀglutamylꢀpꢀnitroanilide; Ntn, Nꢀterminal
nucleophile; pꢀNA, pꢀnitroaniline; SDSꢀPAGE, sodium dodeꢀ
cyl sulfate polyacrylamide gel electrophoresis.
ing an advantage for the bacterium within its growth enviꢀ
ronment [5]. Similarly, upregulation of human GGT in
cancer cells is generally known to help supplement these
* To whom correspondence should be addressed.
919

920
HUIꢀPING CHANG et al.
rapidly dividing cells with essential amino acids for proꢀ GGT activity was determined with Lꢀγꢀglutamylꢀpꢀ
tein biosynthesis [6, 7]. nitroanilide (LꢀγꢀGluꢀpꢀNA), GlyꢀGly, pꢀnitroaniline
Members of Ntn hydrolases, despite lacking any disꢀ (pꢀNA), 5ꢀLꢀglutamylꢀ2ꢀnaphthylamide, and Fast garnet
cernible sequence identity, share the same tertiary fold conꢀ GBC, which were purchased from SigmaꢀAldrich
sisting of a fourꢀlayer αββαꢀstructure with two antiparallel Chemicals (USA). All other chemicals were commercial
βꢀsheets between αꢀhelical layers [8]. Recently, crystal products of analytical or molecular biological grade.
structures of the bacterial GGTs (PDB code for GGT of
Siteꢀdirected mutagenesis. The pQEꢀBlGGT plasꢀ
Bacillus subtilis, Escherichia coli, and H. pylori is 2v36, mid [15], which contains a recombinant B. licheniformis
2dbu, and 2nqo, respectively) have indicated a hetꢀ ggt gene encoding in order the Nꢀterminal hexahistidine
erodimeric arrangement (one large subunit + one small tag, BlGGT, and four additional amino acid residues
subunit) and contributed greatly to our understanding of (TrpꢀGlyꢀThrꢀAsn), was used as the DNA template for
the maturation and catalytic reaction of Ntn hydrolases. siteꢀdirected mutagenesis of codons 586, 581, 577, 576,
Escherichia coli GGT (EcGGT) becomes active only after 566, 558, 523, and 479 to stop codons to generate pQEꢀ
cleavage of the peptide bond between Gln390 and Thr391 BlGGT(1ꢀ585), pQEꢀBlGGT(1ꢀ580), pQEꢀBlGGT(1ꢀ
in its precursor protein [9]. The structure of the acylꢀ 576), pQEꢀBlGGT(1ꢀ575), pQEꢀBlGGT(1ꢀ565), pQEꢀ
enzyme intermediate of EcGGT elucidates the role of BlGGT(1ꢀ557), pQEꢀBlGGT(1ꢀ522), and pQEꢀ
Thr391 and the location of the donor substrateꢀbinding site BlGGT(1ꢀ478), respectively. Two overlapping compleꢀ
[10]. Structural evidence further confirms the autocatalytic mentary primers containing the desired nucleotide
processing of EcGGT [11], and the structure of HpGGT changes were designed for each mutation (Table 1). The
has provided more information on this mechanism [12, 13]. mutagenic PCR reaction mixture consisted of 20 mM
Earlier, the gene encoding Bacillus licheniformis TrisꢀHCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4,
GGT (BlGGT) was cloned and overexpressed in E. coli 2 mM MgSO4, 0.1% Triton Xꢀ100, 0.1 mg/ml nucleaseꢀ
[14]. BlGGT is synthesized as a 61.259ꢀkDa polypeptide free bovine serum albumin, 15 ng of template DNA,
precursor made up a large subunit of 374 residues and a 0.5 mM dNTPs, 1 µM each of the complementary
small subunit of 187 residues (SwissꢀProt Q65KZ6). primers, and 3 units of Pfu DNA polymerase. Mutant
Recently, we constructed six Nꢀterminally truncated DNA was generated with a thermocycling program of
mutants of BlGGT and found that removal of the signal 2 min at 95°C and 16 cycles of 30 sec at 95°C, 60 sec at
peptide significantly affects the functional expression of 55°C, and 12 min at 68°C on an Applied Biosystems therꢀ
the enzyme in recombinant E. coli [15]. Kinetic and mal cycler. The amplified products were digested with 10
mutagenesis studies of HpGGT have demonstrated that a units of DpnI at 37°C for 1 h prior to their use for transꢀ
Thr380ꢀThr398 dyad is critical for efficient cleavage of
the γꢀglutamyl peptide bond of glutathione [13]. The corꢀ
Table 1. Oligonucleotide primers used for siteꢀdirected
responding residues, Thr399 and Thr417, of BlGGT have
been shown to be important for the enzymatic maturation
and reaction [16]. To our knowledge, there has been no
experimental work done to investigate effects of deletion
of the Cꢀterminal region of GGTs on enzyme maturation.
In this study, one fullꢀlength BlGGT and seven truncated
proteins lacking the last 5, 9, 10, 20, 28, 63, and 107
amino acids were constructed to gain insight into the role
of this region. We have narrowed the critical amino acid
residues to Val576, which is involved in autocatalytic proꢀ
cessing and provides the correct conformation of the
active site. These results reveal that deletion of more than
nine amino acids from the Cꢀterminus of the enzyme
would lead to the expression of an inactive precursor, sugꢀ
gesting that the Cꢀterminal region might play a crucial
role in BlGGT maturation.
mutagenesis
Enzyme
Nucleotide sequence (5′→3′)
BlGGT
Sense: ACATCGGCTAAATAGGGTACCCCGGGT
Antisense: ACCCGGGGTACCCTATTTAGCCGATGT
Sense: GTTGGGGTCAACATTTAGACATCGGCT
Antisense: AGCCGATGTCTAAATGTTGACCCCAAC
Sense: GGAACGGCGGTTTAGGTCAACATTAAG
Antisense: CTTAATGTTGACCTAAACCGCCGTTCC
Sense: AACGGAACGGCGTAAGGGGTCAACATT
Antisense: AATGTTGACCCCTTACGCCGTTCCGTT
Sense: ACGTTTATGGGGTAAGCCGATTCAAGC
Antisense: GCTTGAATCGGCTTACCCCATAAACGT
Sense: ATTTTCATTGACTAGGAGAACAAAACG
Antisense: CGTTTTGTTCTCCTAGTCAATGAAAAT
Sense: TCGTACCGCTATTAATCCGGAATGCCG
Antisense: CGGCATTCCGGATTAATAGCGGTACGA
Sense: CTGACTGTCGGTTAACCTGGCGGAACG
Antisense: CGTTCCGCCAGGTTAACCGACAGTCAG
∆(581ꢀ585)
∆(577ꢀ585)
∆(576ꢀ585)
∆(566ꢀ585)
∆(558ꢀ585)
∆(523ꢀ585)
∆(479ꢀ585)
MATERIALS AND METHODS
Materials. A QuikChange II siteꢀdirected mutagenꢀ
esis kit for mutagenic PCR amplification was obtained
from Stratagene (USA). Ni2+ꢀnitrilotriacetate (Ni2+ꢀ
NTA) resin was acquired from Qiagen Inc. (USA). The
BIOCHEMISTRY (Moscow) Vol. 75 No. 7 2010

AUTOCATALYTIC PROCESSING OF B. licheniformis γꢀGLUTAMYL TRANSPEPTIDASE
921
formation of E. coli XLꢀ1 blue cells. Mutations were conꢀ was recorded by monitoring the absorbance changes at
firmed by DNA sequencing, which was carried out with a 410 nm. One unit of GGT activity is defined as amount of
dye terminator sequencing kit and an automatic DNA enzyme that releases 1 µmol of pꢀNA per minute under
sequencer (Applied Biosystems, USA).
the assay conditions.
Expression and purification of parental and truncated
Km and kcat values were estimated by measuring pꢀNA
enzymes. For highꢀlevel expression of parental and production in 1ꢀml reaction mixtures with various conꢀ
mutant enzymes, E. coli M15 harboring pQEꢀBlGGT or centrations of the substrate (0.3ꢀ2.0 Km). Samples were
each of the mutated plasmids was grown on LB medium incubated at 40°C for 10 min. The kinetic parameters
supplemented with ampicillin (100 µg/ml) and were determined using Lineweaver–Burk plots.
kanamycin (25 µg/ml) to an optical density at 600 nm of
Unfolding of recombinant proteins in GdnCl. Parental
approximately 0.8. Protein expression was induced by the BlGGT or each of the Cꢀterminally truncated enzymes
addition of isopropylꢀβꢀDꢀthiogalactopyranoside (IPTG) was unfolded with different concentrations of GdnCl in
to a final concentration of 0.1 mM. The cultivation was 20 mM TrisꢀHCl buffer (pH 8.0) at room temperature. A
continued at 20°C for 12 h. Cells were harvested by cenꢀ 10ꢀmin incubation was employed in unfolding experiꢀ
trifugation (4000g for 10 min at 4°C), and the cell pellets ments. The unfolding of the enzyme was monitored by
were stored at –20°C until required.
fluorescence and circular dichroism (CD).
To purify His6ꢀtagged enzymes, cell pellets were
Spectrofluorimetric and CD analyses. Fluorescence
resuspended in binding buffer (5 mM imidazole, 500 mM spectra of parental and mutant enzymes were monitored at
NaCl, and 20 mM TrisꢀHCl, pH 7.9) and lysed by soniꢀ 30°C in a Hitachi Fꢀ7000 fluorescence spectrophotometer
cation (30ꢀsec bursts and pulses for 5 min). The cell with an excitation wavelength of 280 nm. All spectra were
extract was obtained by centrifugation, and the soluble corrected for buffer absorption. The fluorescence emission
His6ꢀtagged protein was bound to 2 ml of Ni2+ꢀNTA resin spectra of protein samples with a concentration of 42 µM
by gentle mixing at 4°C for 30 min. Subsequently, the were recorded from 300 to 400 nm at a scanning speed of
resin was loaded onto a column and washed with three 240 nm/min. The maximal peak of the fluorescence specꢀ
volumes of 50 mM phosphate buffer (pH 7.9) containing trum and the change in fluorescence intensity were used in
0.3 M NaCl and 20 mM imidazole, and the bound proꢀ monitoring the unfolding processes of the enzyme. Both
tein was eluted with 5 ml of 250 mM imidazole added to the red shift and the change in fluorescence intensity were
the washing buffer.
analyzed together using the average emission wavelength
Gel electrophoresis, activity staining, and determinaꢀ (AEW) (λ) according to Eq. (1) [18]:
tion of protein concentration. Polyacrylamide gel elecꢀ
trophoresis (PAGE) was performed in a vertical miniꢀgel
system (miniꢀProtean III system; BioꢀRad Laboratories,
USA) with a 10% nonꢀdenaturing polyacrylamide gel.
Electrophoresis was done at 4°C and a constant voltage of
100 V for 3 h. To detect the GGT activity, the gel was
,
(1)
immersed into 1 mM 5ꢀLꢀglutamylꢀ2ꢀnaphthylamide in which Fi is the fluorescence intensity at the specific
and 50 mM GlyꢀGly in 100 mM TrisꢀHCl buffer (pH 10) emission wavelength (λi).
and incubated at 40°C for 30 min. The gel was then transꢀ
Far UVꢀCD spectra of parental and mutant enzymes
ferred into a solution containing 0.05% Fast garnet GBC were acquired on a JASCO model Jꢀ815 spectropolarimeꢀ
in 8% acetic acid until the red dark GGT band appeared. ter (JASCO Inc., Japan) from 250 to 190 nm in cuvettes at
Sodium dodecyl sulfate PAGE (SDSꢀPAGE) was carꢀ 25°C using 1.0ꢀnm bandwidth, 0.1ꢀnm resolution, 0.1ꢀcm
ried out using the Laemmli buffer system [17]. The gels pathlength, 1ꢀsec response time, and 100ꢀnm/min scanꢀ
were stained with 0.25% Coomassie brilliant blue Rꢀ250 ning speed. The photomultiplier voltage was always below
dissolved in 50% methanol–10% acetic acid and destained 600 V in the analyzed region. Each scanning was repeated
in a solution of 30% methanol and 10% acetic acid.
ten times, and the average is reported. Data were correctꢀ
Protein concentrations were measured using the ed for the buffer effect, and the results are expressed as
BioꢀRad protein assay reagent and bovine serum albumin molar ellipticity [Θ] in the units of deg⋅cm2⋅dmol–1
as the standard.
Enzyme assays. GGT activity was routinely assayed
according to Eq. (2):
at 40°C using LꢀγꢀGluꢀpꢀNA as substrate. The reaction
mixture contained 1.25 mM LꢀγꢀGluꢀpꢀNA, 30 mM
GlyꢀGly, 1 mM MgCl2, 50 mM TrisꢀHCl buffer (pH 8.0),
,
(2)
20 µl enzyme solution at a suitable dilution, and enough where l represents the light pathlength (cm), C is the
distilled water to bring the final volume to 1 ml. After 10ꢀ molar concentration of protein (mol/liter), and Θ repreꢀ
min incubation, the reaction was quenched by the addiꢀ sents the observed ellipticity (mdeg). Thermal denaturaꢀ
tion of 100 µl 3.5 N acetic acid. The formation of pꢀNA tion experiments were performed by monitoring the ellipꢀ
BIOCHEMISTRY (Moscow) Vol. 75 No. 7 2010

922
HUIꢀPING CHANG et al.
ticity at 222 nm. The temperature was increased with a
heating rate of 2°C/min from 20 to 100°C, and the temꢀ
perature at which half of the protein molecules were
unfolded was recorded (Tm).
,
(6)
Analytical ultracentrifugation. Sedimentation velociꢀ
ty was measured in a BeckmanꢀCoulter XLꢀA analytical
ultracentrifuge with an An50Ti rotor at 20°C and
42,000 rpm in 12ꢀmm doubleꢀsector Epon charcoalꢀ
filled centerpieces. The ultraviolet (UV) absorption of the
cells at 280 nm was scanned in continuous mode with
time interval of 8 min and step size of 0.003 cm. The parꢀ
tial specific volume of the enzyme, solvent density, and
viscosity were calculated by the free software SEDNꢀ
TERP (http://www.jphilo.mailway.com/). All samples
were visually checked for clarity after ultracentrifugation
to make sure that there was no precipitation due to where
unfolding of the protein. Multiple scans at different time
points were analyzed with the SEDFIT program [19, 28].
The sedimentation velocity data were fitted using a twoꢀ
dimensional distribution with respect to frictional ratio
c(s, f/fo) according to the Lamm equation [19] (Eq. (3)):
,
(7)
, (8)
.
The threeꢀstate unfolding model (Scheme 2) was
described by Eq. (9) [21]:
, (3)
KN−I
KI−U
with a(r,t) denoting the observed optical signal at radius r
and time t; χ(s,D,r,t), the solution of the Lamm equation;
and D(s, f/fo), the dependence of diffusion coefficient (D)
on sedimentation coefficient (s) and frictional ratio (f/fo),
where
N
I
U,
Scheme 2
, (9)
,
(4)
where
,
,
,
(5)
with ω denoting angular velocity; k, Boltzmann constant;
T, absolute temperature; ν, enzyme partial specific volꢀ
−
ume; η, buffer viscosity; and ρ, buffer density.
yobs is the observed biophysical signal; yN, yI, and yU are
All twoꢀdimensional distributions were solved and the calculated signals of the native, intermediate, and
normalized to a confidence level of p = 0.95 by maximum unfolded states, respectively. [GdnCl] is the GdnCl conꢀ
entropy and a resolution N of 200 with sedimentation centration, and ∆GN–I and ∆GI–U are the free energy
coefficients between 0.1 and 20 S. The anhydrous friction changes for the N ↔ I and I ↔ U processes, respectively.
ratio is from 1.0 to 2.0 or 3.5 at a resolution of 10.
The values mU, mN–I, and mI–U are the sensitivities of the
Unfolding data analysis. Because unfolding/refolding respective unfolding states or process to denaturant conꢀ
of BlGGT is a reversible process, the unfolding data were centration.
treated with the following thermodynamic models by
global fitting of the data. The twoꢀstate unfolding model
(Scheme 1) was described by Eq. (6) [20]. Equations (7)
and (8) were used to fit postꢀslope and both preꢀ and
postꢀslope unfolding curves, respectively:
RESULTS AND DISCUSSION
Sequence comparison and plasmid constructions.
Figure 1a shows the sequence alignment of the fullꢀlength
BlGGT. The alignment reveals a significant degree of priꢀ
mary sequence identity in the small subunits (Fig. 1). The
small subunit spanning the BlGGT residues 399ꢀ585 had
KN−U
N
U,
Scheme 1
BIOCHEMISTRY (Moscow) Vol. 75 No. 7 2010

AUTOCATALYTIC PROCESSING OF B. licheniformis γꢀGLUTAMYL TRANSPEPTIDASE
923
a
b
Fig. 1. Sequence alignment of BlGGT and schematic presentation of fullꢀlength and truncated enzymes. a) A graphic representation of amino
acid sequence alignment generated with the ExPAsy molecular server (Swiss Institute of Bioinformatics, Basel, Switzerland). The deduced
amino acid sequence for B. licheniformis ATCC 14580 GGT (BlGGT; SwissꢀProt Q62WE3), Bacillus subtilis GGT (BsGGT; SwissꢀProt
P54422), Thiobacillus denitrificans GGT (TdGGT; SwissꢀProt Q3SJ07), E. coli GGT (EcGGT; SwissꢀProt P18956), H. pylori GGT (HpGGT;
SwissꢀProt O25743), Pseudomonas aeruginosa GGT (PaGGT; SwissꢀProt Q9I406), Homo sapiens GGT (HsGGT; SwissꢀProt P19440), Sus
scrofa GGT (SsGGT; SwissꢀProt P20735), and Mus musculus GGT (MmGGT; SwissꢀProt Q60928) were used for the alignment. Gaps in
aligned sequences (dashes) were introduced to maximize similarities. The vertical line shows the putative cleavage site. HpGGT residues
involved in the formation of salt bridges are indicated above the sequence. b) Schematic presentation of the engineered enzymes. Positions of
the tryptophanyl residues in BlGGT are indicated. The putative cleavage for autocatalytic processing of BlGGT is also marked. Every trunꢀ
cated protein has a histidine tag fused to its N terminus.
BIOCHEMISTRY (Moscow) Vol. 75 No. 7 2010

924
HUIꢀPING CHANG et al.
between 33 to 78% identity with B. subtilis, E. coli, H. unit of these proteins shares the same molecular size of
pylori, and Pseudomonas aeruginosa GGTs, while identiꢀ ~44,729 Da. To have a comprehensive presentation, the
ties with nonꢀmicrobial enzymes (bovine, human, and schematic diagram of fullꢀlength BlGGT and partial
mouse GGTs) ranged from 25 to 31%. In HpGGT, the amino acid sequences at the Cꢀtermini of these constructs
mobile Cꢀterminus has been shown to be positioned by are shown in Fig. 1b.
several electrostatic interactions within the Cꢀterminal
Purification and characterization of parental and Cꢀ
region, and mutational studies have confirmed that these terminally truncated enzymes. The expression of parental
salt bridges play an important role in the autocatalytic and truncated enzymes was evaluated by analyzing the
processing and catalysis of the enzyme [22]. As shown in wholeꢀcell lysate preparations. BlGGTꢀ4aa, BlGGT,
Fig. 1a, the alignment also revealed a strict conservation ∆(581ꢀ585), and ∆(577ꢀ585) were expressed as three preꢀ
of residues implicated in the formation of salt bridges.
dominant bands with the molecular masses of approxiꢀ
Recently, the overexpression plasmid pQEꢀBlGGT mately 65, 44.9, and 20ꢀ21.7 kDa, respectively, whereas
was constructed for the functional expression of BlGGTꢀ the remaining mutant enzymes were present as a precurꢀ
4aa [15]. Based on pQEꢀBlGGT, eight recombinant plasꢀ sor form (data not shown). Importantly, all of the mutant
mids were further constructed for IPTGꢀinduced producꢀ proteins were expressed in the soluble fraction, suggesting
tion of the fullꢀlength and Cꢀterminally truncated that gross disruption of protein structure does not occur
BlGGTs. The molecular mass for the small unit of as a result of these deletions. The recombinant enzymes
BlGGT, ∆(581ꢀ585), ∆(577ꢀ585), ∆(576ꢀ585), ∆(566ꢀ constructed in this study have a Hisꢀtag at the Nꢀtermiꢀ
585), ∆(558ꢀ585), ∆(523ꢀ585), and ∆(479ꢀ585) was estiꢀ nus, which does not have detrimental effects on BlGGT
mated to be 20517, 20001, 19618, 19519, 18560, 17596, activity [14, 15]. To characterize these enzymes, the His6ꢀ
13694, and 8701 Da, respectively, whereas the large subꢀ tagged proteins were purified to near homogeneity using a
a
b
3
2
1
4
5
∆ (523ꢀ585)
∆ (479ꢀ585)
7
6
8
9
Time, days
Fig. 2. Autocatalytic processing of proꢀBlGGTs. Approximately 1 mg protein/ml in the elution buffer was incubated for 0, 9, 25, and 60 days.
Aliquots of 100 µl were withdrawn at the indicated intervals for SDSꢀPAGE analysis (a) and enzymatic assays (b). Lanes: M, molecular mass
maker; 1) BlGGTꢀ4aa; 2) BlGGT; 3) ∆(581ꢀ585); 4) ∆(577ꢀ585); 5) ∆(576ꢀ585); 6) ∆(566ꢀ585); 7) ∆(558ꢀ585); 8) ∆(523ꢀ585); 9) ∆(479ꢀ
585).
BIOCHEMISTRY (Moscow) Vol. 75 No. 7 2010

AUTOCATALYTIC PROCESSING OF B. licheniformis γꢀGLUTAMYL TRANSPEPTIDASE
925
neously assayed. As shown in Fig. 2a, BlGGTꢀ4aa,
BlGGT, ∆(581ꢀ585), and ∆(577ꢀ585) were predominantly
as the mature form. A significant amount of the processed
∆(576ꢀ585), ∆(566ꢀ585), and ∆(558ꢀ585) was observed
after 60ꢀday incubation. GGT activity of the incubated
∆(576ꢀ585), ∆(566ꢀ585), and ∆(558ꢀ585) was 2.71 0.01,
1.10 0.03, and 1.11 0.02 U/mg, respectively (Table 2).
However, the remaining two proteins, ∆(523ꢀ585) and
∆(479ꢀ585), were actually detrimental to the autocatalytic
capability. These results clearly indicate that the Cꢀtermiꢀ
nus of BlGGT participates in the autocatalytic processing,
and residue Val576 is located at the boundary.
Table 2. GGT activity and kinetic parameters of parental
and mutant enzymes
Enzyme* GGT activity,
U/mg
Km, mM
kcat,
kcat/Km,
sec–1 mM–1·sec–1
0 day
BlGGTꢀ4aa
BlGGT
94
91
88
70
2
2
1
1
0.070 0.005 97 4 1310 40
0.080 0.007 97 2 1245 91
0.090 0.006 96 3 1014 30
∆(581ꢀ585)
∆(577ꢀ585)
∆(576ꢀ585)
∆(566ꢀ585)
∆(558ꢀ585)
∆(523ꢀ585)
∆(479ꢀ585)
0.050 0.008 72
2
1412 100
n.d.
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
BlGGT must undergo autocatalytic processing
before it has enzymatic activity, but the mechanism of
activation has not been elucidated. A base is generally
proposed to be crucial for the autocatalytic activation of
Ntnꢀhydrolase precursors into Lꢀ and Sꢀsubunits. It has
been suggested that a histidine residue in the vicinity of
the processing site of Flavobacterium meningosepticum
glycosyl asparaginase is essential for its maturation and
acts as a base in this reaction [23]. However, Xꢀray crysꢀ
tallographic results demonstrated that the βꢀcarboxyl
group of the Asp residue just before the catalytic Thr
residue, which is the nucleophile of Flavobacterium
enzyme, acts as the base [24]. In the case of the Sꢀsubunit
of 20 S proteasome, the residue just ahead the catalytic
residue is the invariant Gly, which has no side chain to act
as a base similar to glycosyl asparaginase. These findings
therefore rule out the involvement of Asp in the autocatꢀ
alytic processing. In contrast, Ditzel et al. [25] showed
that a water molecule acts as the base at the active center
for the processing of Sꢀsubunit precursor of yeast 20 S
proteasome. Also, a water molecule was found to be the
general base in cephalosporin acylase [26] and glutaryl 7ꢀ
aminocephalosporanic acid acylase [27]. As shown in
Fig. 2a, the purified ∆(576ꢀ585), ∆(566ꢀ585), and ∆(558ꢀ
585) could slowly undergo autocatalytic processing in the
elution buffer. In this regard, it is likely that a water molꢀ
ecule plays a critical role in the autocatalytic activation of
BlGGT precursors into Lꢀ and Sꢀsubunits. These results
also reflect the fact that the Cꢀterminus of BlGGT plays a
role in enzyme maturation, and Cꢀterminal deletion of
more than nine amino acids would lead to the expression
of inactive precursors.
n.d.
n.d.
n.d.
n.d.
60 days
BlGGTꢀ4aa
BlGGT
94
86
2
4
0.080 0.004 112
0.090 0.014 102
3
1342 40
5
5
1179 30
∆(581ꢀ585) 97.2 0.3 0.110 0.009 112
∆(577ꢀ585) 75.2 0.5 0.080 0.007 94
1060 50
2
1216 90
∆(576ꢀ585) 2.71 0.01
∆(566ꢀ585) 1.10 0.03
∆(558ꢀ585) 1.11 0.02
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
∆(523ꢀ585)
∆(479ꢀ585)
n.d.
n.d.
Note: n.d., not detected; –, not determined.
* Protein concentration of these samples was approximately 1 mg/ml.
Ni2+ꢀNTA column (Fig. 2a). The oneꢀstep purification
procedure resulted in a protein yield of 13ꢀ27% for the
recombinant enzymes. The assay for GGT activity with
the synthetic substrate, LꢀγꢀGluꢀpꢀNA, and the kinetic
parameters of these proteins are summarized in Table 2.
The Km and kcat values for BlGGT were 0.08 mM and
97 sec–1 (91 U/mg), respectively, which is comparable to
those of BlGGTꢀ4aa. A slight decrease in the enzyme
activity was observed in ∆(577ꢀ585). Moreover, ∆(581ꢀ
585) and ∆(577ꢀ585) showed comparable catalytic conꢀ
stant (kcat) and specificity constant (kcat/Km) values
respective to the parental enzyme, but the GGT activity
was not detected in ∆(576ꢀ585), ∆(566ꢀ585), ∆(558ꢀ585),
∆(523ꢀ585), and ∆(479ꢀ585). These results indicate that
the local structural motifs in the Cꢀterminus of BlGGT
are critical for the proper function of the enzyme.
The Cꢀterminus of HpGGT has been reported to play
critical roles in autocatalytic processing and catalysis [22].
Although the indicated region shows low sequence conꢀ
servation among GGT members, the disruption of conꢀ
served salt bridges in the Cꢀterminal region of the 20ꢀkDa
subunit has been demonstrated to cause a significant
reduction in autoprocessing and hydrolase activities of
HpGGT. In the HpGGT structure, the carboxylate of
Asp562 interacts with Arg564 as well as another conserved
arginine residue, Arg502. Similarly, Arg564 forms a salt
bridge with a conserved glutamate residue, Glu515.
Given the involvement of these residues in the extensive
In vitro processing of enzyme precursors. To investiꢀ
gate in vitro processing of the truncated enzymes, the puriꢀ
fied proteins were incubated at 4°C for a period of time. At
each sampling time, the amount of precursors was anaꢀ
lyzed by SDSꢀPAGE, and the GGT activity was simultaꢀ
BIOCHEMISTRY (Moscow) Vol. 75 No. 7 2010

926
HUIꢀPING CHANG et al.
hydrogen bond network and the remote location relative As noted by Williams et al. [22], disruption of the correꢀ
to the catalytic nucleophile, it was proposed that these sponding salt bridges in the small subunit of BlGGT
four highly conserved residues are important for enzyme might be responsible for the suppression of autocatalytic
maturation [22]. For BlGGT, the corresponding pairs of processing and enzymatic activity. However, the reasons
salt bridges are Arg571/Asp568 and Glu523/Arg571. In for the loss of autocatalytic processing in ∆(576ꢀ585)
the present constructions, four of the truncated enzymes, remain to be explored.
including ∆(566ꢀ585), ∆(558ꢀ585), ∆(523ꢀ585), and
Unfolding of parental and Cꢀterminally truncated
∆(479ꢀ585), definitely abolish the proposed salt bridges. enzymes at various concentrations of GdnCl. BlGGT has a
total of four tryptophanyl residues (Trp157, Trp273, and
Trp376 in L subunit and Trp408 in S subunit) (Fig. 1).
a
When excited at 280 nm, the protein intrinsic emission
fluorescence comes mostly from the tryptophanyl
residues. Deletion at the Cꢀterminus of BlGGT even for
∆(479ꢀ585) did not exclude these four tryptophanyl
residues. Moreover, no precipitation was observed, and
also the unfolding was completely reversible for BlGGTs
at any GdnCl concentration (data not shown). Thus, the
GdnClꢀinduced unfolding is very suitable for conformaꢀ
tional stability studies of the enzyme. Unfolding of the
enzyme at different concentrations of GdnCl is shown in
Fig. 3. The average emission wavelength (AEW) that
reports on the changes in both fluorescence wavelength
and fluorescence intensity was used to calculate the therꢀ
modynamic parameters of the unfolding/refolding
process (Table 3). By fitting the data with Eq. (9),
BlGGTꢀ4aa was seen to start to unfold at very low conꢀ
centration of GdnCl and reach an unfolding intermediate
with [GdnCl]0.5,N–I of 1.10⋅10–12 M. The second unfoldꢀ
ing phase started at 1.23
M denaturant with
b
[GdnCl]0.5,I–U of 2.874 M. The calculated free energy
change (∆G) for the N ↔ I and I ↔ U processes was
1.19·10–12 and 7 1 kcal/mol, respectively. The stability
parameters of BlGGT are comparable to those of
BlGGTꢀ4aa. However, the fluorescence signals of
GdnClꢀinduced Cꢀterminally truncated enzymes folꢀ
lowed a monophasic process (Fig. 3a). Similar results
were obtained with CD spectra (Fig. 3b). ∆(581ꢀ585),
∆(577ꢀ585), ∆(576ꢀ585), ∆(566ꢀ585), ∆(558ꢀ585),
∆(523ꢀ585), and ∆(479ꢀ585) showed [GdnCl]0.5,N–U of
2.92, 1.37, 0.44, 0.56, 0.63, 1.2⋅10–6 and 1.9⋅10–9 M, corꢀ
responding to free energy change of 8 3, 16 10, 0.8
0.3, 2.2 0.2, 1.5 0.2, 1.5⋅10–6, and 4.8⋅10–9 kcal/mol,
respectively, for the N ↔ U process. It is very likely that
as more amino acid residues at the Cꢀterminus of the
enzyme were deleted, a lower concentration of GdnCl
was required to start unfolding. This allows one to distinꢀ
guish the conformation stabilities of the parental and
truncated BlGGTs and assign the functional role of the
Cꢀterminus. Clearly, the significant changes in protein
structure occur as a consequence of the deletions.
Fig. 3. Unfolding curves of parental and truncated BlGGTs in difꢀ
ferent concentrations of GdnCl. The enzyme in 30 mM TrisꢀHCl
buffer (pH 7.7) was incubated with various concentrations of
GdnCl for 10 min. The enzyme solution was excited at 280 nm,
and the emission was recorded at 25°C. a) Average emission waveꢀ
length (AEW) of the enzyme was used to analyze the unfolding
data. b) CD changes at 222 nm versus GdnCl concentration. Solid
symbols are experimental data and the smooth curves are comꢀ
puterꢀgenerated bestꢀfit lines according to a twoꢀstate unfolding
model (Eq. (6) or (7)).
To probe the structural integrity of parental and
mutant enzymes, their thermal unfolding patterns were
determined by following the changes in ellipticity at
222 nm (Table 3). The unfolding curves of the tested proꢀ
teins showed single sigmoidal transitions. Midpoints of
thermal transition, Tm, were calculated as 64.8 0.3 and
BIOCHEMISTRY (Moscow) Vol. 75 No. 7 2010

AUTOCATALYTIC PROCESSING OF B. licheniformis γꢀGLUTAMYL TRANSPEPTIDASE
927
These data clearly indicate that deletions of more than
nine amino acids from the Cꢀterminus have a profound
effect on the thermal stability of the enzyme. Also, the
results shown in Table 3 indicate the close correlation of
inability to autoprocess with the unstable structure.
Table 3. Stability parameters of Cꢀterminally truncated
enzymes
Tmd, oC
Enzyme
∆GN–U
, mN–U, kcal· [GdnCl]0.5,N–U,
kcal/mol mol–1·M–1
M
Correlation of quaternary structural changes of
BlGGT with autocatalytic processing. To determine the
oligomeric structure of the parental and mutant BlGGTs,
the purified enzymes were subjected to native PAGE and
the gel was stained with Coomassie brilliant blue Rꢀ250.
As shown in Fig. 4a, one major band with a similar migraꢀ
tion pattern to the recombinant BlGGT heterodimer was
detected, ruling out a possible role of the Hisꢀtag in the
polymerization process. Most importantly, higher polyꢀ
mers were not as prominent for these enzymes. Activity
staining showed that the heterodimer and the higher
order oligomers of BlGGTꢀ4aa, BlGGT, ∆(581ꢀ585), and
∆(577ꢀ585) had GGT activity (Fig. 4b). Although ∆(576ꢀ
585), ∆(566ꢀ585), ∆(558ꢀ585), ∆(523ꢀ585), and ∆(479ꢀ
585) migrated at the positions corresponding to their hetꢀ
erodimers on the gel, these precursor enzymes displayed
abnormal mobility. Actually, the truncations lead to a
modification in the net charge and a decrease in the pI
∆(581ꢀ585)a
8
3
2.8 1.0
12
2.92
1.37
64.7 0.4
51.0 0.03
45.1 0.2
44.9 0.1
43.9 0.1
32.6 0.9
31.7 1.0
∆(577ꢀ585)a 16 10
7
∆(576ꢀ585)b 0.8 0.3 1.8 0.3
∆(566ꢀ585)b 2.2 0.2 4.0 0.2
∆(558ꢀ585)b 1.5 0.2 2.3 0.2
∆(523ꢀ585)b 1.5⋅10−6 1.3 0.2
∆(479ꢀ585)c 4.8⋅10−9 2.6 0.3
0.44
0.56
0.63
1.2⋅10−6
1.9⋅10−9
a Unfolding data were fitted to a twoꢀstate unfolding model according to
Eq. (8).
b Unfolding data were fitted to a twoꢀstate unfolding model according to
Eq. (7).
c Unfolding data were fitted to a twoꢀstate unfolding model according to
Eq. (6).
d Melting temperature determined by CD spectropolarimetry.
64.7
0.4°C for BlGGT and ∆(581ꢀ585), respectively. values (5.07ꢀ5.11 compared with 5.19 for BlGGT), which
The Tm values for ∆(577ꢀ585), ∆(576ꢀ585), ∆(566ꢀ585), might cause an abnormal mobility of the mutant enzymes
∆(558ꢀ585), ∆(523ꢀ585), and ∆(479ꢀ585) were 12.9ꢀ during native PAGE. After 60 days incubation, however, a
32.2°C lower than that of BlGGTꢀ4aa Tm (63.8 0.2°C). significant amount of ∆(576ꢀ585), ∆(566ꢀ585) was
a
b
c
d
Fig. 4. Staining of native polyacrylamide gel for GGT activity. Purified parental and mutant BlGGTs (100 µg of protein) were subjected to
native PAGE followed by staining for GGT activity. The purified proteins are visualized by nonꢀdenaturing PAGE at 0 (a) and 60 days (c);
activity staining at 0 (b) and 60 days (d). Lanes: M, molecular mass markers; 1) BlGGTꢀ4aa; 2) BlGGT; 3) ∆(581ꢀ585); 4) ∆(577ꢀ585); 5)
∆(576ꢀ585); 6) ∆(566ꢀ585); 7) ∆(558ꢀ585); 8) ∆(523ꢀ585); 9) ∆(479ꢀ585). The positions of heterodimeric and oligomeric GGTs are indicatꢀ
ed by M and O, respectively.
BIOCHEMISTRY (Moscow) Vol. 75 No. 7 2010

928
HUIꢀPING CHANG et al.
BlGGT, ∆(581ꢀ585), and ∆(577ꢀ585), respectively. The
processed form was not detected in ∆(576ꢀ585), ∆(566ꢀ
585), ∆(558ꢀ585), ∆(523ꢀ585), and ∆(479ꢀ585), in which
the enzyme existed exclusively as precursor with f/fo of
1.18, 1.05, 1.23, 1.31, and 1.32. After autocatalytic proꢀ
cessing, the conformational changes of BlGGTs were
clearly demonstrated by the increase in frictional ratio of
the enzyme upon maturation (data not shown). The trunꢀ
cated BlGGTs with deletions of more than nine amino
acids from the Cꢀterminus could not induce the autocatꢀ
alytic process. Thus, the Cꢀterminal region close to Val576
is essential for the autocatalytic processing of BlGGT.
In summary, we have studied the role of the Cꢀtermiꢀ
nal region of BlGGT by deletion analysis. The mutagenꢀ
esis results revealed that deletion of up to nine amino acid
residues from the Cꢀterminal end of BlGGT definitely
affects the autocatalytic activity of the enzyme. Although
the sequence in the Cꢀterminal region is not strictly conꢀ
served among GGTs, these enzymes show a high level of
similarity in structure organization. Thus, the role of the
Cꢀterminal region proposed herein might also be true for
other GGTs, and this research also provides a starting
point for further studies of the quaternary structure of this
family.
Fig. 5. Quaternary structure analysis of the fullꢀlength and Cꢀterꢀ
minally truncated BlGGTs. Continuous sedimentation of the proꢀ
tein in 20 mM TrisꢀHCl (pH 8.0) was monitored with the analytꢀ
ical ultracentrifuge. The sedimentation velocity data were anaꢀ
lyzed with SEDFIT [28]. All enzyme preparations were at
0.4 mg/ml concentration.
The authors acknowledge financial support (NSC
95ꢀ2313ꢀBꢀ415ꢀ012ꢀMY3 and NSC 97ꢀ2628ꢀBꢀ415ꢀ
001ꢀMY3) from the National Science Council of Taiwan.
processed and the mature enzymes also retained GGT
activity (Figs. 4c and 4d).
EcGGT and HpGGT were reported to have hetꢀ
erodimeric structures [10, 12]. The quaternary structures
of parental and mutant BlGGTs were examined using
analytical ultracentrifugation, and the sedimentation
velocity data were analyzed using the continuous size disꢀ
tribution model using the SEDFIT program (Fig. 5). In
these experiments no aggregation was observed at sediꢀ
mentation coefficients of up to 20 S. Analytical ultracenꢀ
trifugation provides very detailed conformational inforꢀ
mation about enzyme structural changes. The parental
enzyme and BlGGT sedimented at ~4.85 S, and there
was a peak between 4.82 and 5.60 S corresponding to the
truncated enzymes (data not shown). An equivalent conꢀ
tinuous distribution C(s,M) plot (Fig. 5) indicated that
both BlGGTꢀ4aa and BlGGT have a calculated molecuꢀ
lar mass of approximately 65.23 kDa in buffer. Analytical
ultracentrifugation analysis verified the expected decreasꢀ
es in molar masses of ∆(581ꢀ585) (76.0 kDa), ∆(577ꢀ585)
(66.5 kDa), ∆(576ꢀ585) (60.1 kDa), ∆(566ꢀ585)
(59.0 kDa), ∆(558ꢀ585) (62.0 kDa), ∆(523ꢀ585)
(55.0 kDa), and ∆(479ꢀ585) (50.5 kDa). All these experiꢀ
mentally determined molar mass values are in agreement
with the theoretical values calculated from the amino acid
sequences. The parental BlGGT existed as a heterodimer,
and almost all the truncated enzymes were heterodimeric
in solution too (Fig. 5). This confirms that the active form
of BlGGT is the heterodimeric one.
REFERENCES
1. Brannigan, J. A., Dodson, G., Duggleby, H. J., Moody, P.
C., Smith, J. L., Tomchick, D. R., and Murzin, A. G.
(2006) Nature, 90, 4651ꢀ4661.
2. Tate, S. S., and Meister, A. (1981) Mol. Cell Biochem., 39,
357ꢀ368.
3. Hanigan, M. H., and Ricketts, W. A. (1993) Biochemistry,
32, 6302ꢀ6306.
4. Suzuki, H., Hashimoto, W., and Kumagai, H. (1999) J.
Mol. Catal. B: Enzym., 6, 175ꢀ184.
5. Shibayama, K., Wachino, J., Arakawa, Y., Saidijam, M.,
Rutherford, N. G., and Henderson, P. J. (2007) Mol.
Microbiol., 64, 396ꢀ406.
6. Godwin, A. K., Meister, A., O’Dwyer, P. J., Huang, C. S.,
Hamilton, T. C., and Anderson, M. E. (1992) Proc. Natl.
Acad. Sci. USA, 89, 3070ꢀ3074.
7. Hanigan, M. H., Gallagher, B. C., Townsend, D. M., and
Gabarra, V. (1999) Carcinogenesis, 20, 553ꢀ559.
8. Oinonen, C., and Rouvinen, J. (2000) Protein Sci., 9, 2329ꢀ
2337.
9. Suzuki, H., and Kumagai, H. (2002) J. Biol. Chem., 277,
43536ꢀ43543.
10. Okada, T., Suzuki, H., Wada, K., Kumagai, H., and Fukuyama,
K. (2006) Proc. Natl. Acad. Sci. USA, 103, 6471ꢀ6476.
11. Okada, T., Suzuki, H., Wada, K., Kumagai, H., and
Fukuyama, K. (2007) J. Biol. Chem., 282, 2433ꢀ2439.
12. Boanca, G., Sand, A., and Barycki, J. J. (2006) J. Biol.
Chem., 281, 19029ꢀ19037.
Significant mature form with a frictional ratio (f/fo) of
1.58, 1.57, 1.46, and 1.39 was detected with BlGGTꢀ4aa,
BIOCHEMISTRY (Moscow) Vol. 75 No. 7 2010

AUTOCATALYTIC PROCESSING OF B. licheniformis γꢀGLUTAMYL TRANSPEPTIDASE
929
13. Boanca, G., Sand, A., Okada, T., Suzuki, H., Kumagai, H.,
Fukuyama, K., and Barycki, J. J. (2007) J. Biol. Chem.,
282, 534ꢀ541.
14. Lin, L. L., Chou, P. R., Hua, Y. W., and Hsu, W. H. (2006)
Appl. Microbiol. Biotechnol., 73, 103ꢀ112.
22. Williams, K., Cullati, S., Sand, A., Biterova, E. I., and
Barycki, J. J. (2009) Biochemistry, 48, 2459ꢀ2467.
23. Guan, C., Cui, T., Rao, V., Liao, W., Benner, J., Lin, C. L.,
and Comb, D. (1996) J. Biol. Chem., 271, 1732ꢀ1737.
24. Xu, Q., Buckley, D., Guan, C., and Guo, H. C. (1999) Cell,
98, 651ꢀ661.
25. Ditzel, L., Huber, R., Mann, K., Heinemeyer, W., Wolf,
D. H., and Groll, M. (1998) J. Mol. Biol., 279, 1187ꢀ
1191.
26. Kim, Y., Kim, S., Earnest, T. N., and Hol, W. G. (2002) J.
Biol. Chem., 277, 2823ꢀ2829.
27. Kim, J. K., Yang, I. S., Rhee, S., Dauter, Z., Lee, Y. S.,
Park, S. S., and Kim, K. H. (2003) Biochemistry, 42, 4084ꢀ
4093.
15. Lin, L. L., Yang, L. Y., Hu, H. Y., and Lo, H. F. (2008)
Curr. Microbiol., 57, 603ꢀ608.
16. Lyu, R. C., Hu, H. Y., Kuo, L. Y., Lo, H. F., Ong, P. L., Chang,
H. P., and Lin, L. L. (2009) Curr. Microbiol., 59, 101ꢀ106.
17. Laemmli, U. K. (1970) Nature, 227, 680ꢀ685.
18. Royer, C. A., Mann, C. J., and Matthews, C. R. (1995)
Protein Sci., 2, 1844ꢀ1852.
19. Schuck, P. (2000) Biophys. J., 78, 1600ꢀ1619.
20. Pace, C. N. (1990) Trends Biotechnol., 8, 93ꢀ98.
21. Morjana, N. A., McKeone, B. J., and Gilbert, H. F. (1993)
Proc. Natl. Acad. Sci. USA, 90, 2107ꢀ2111.
28. Brown, P. H., and Schuck, P. (2006) Biophys. J., 90, 4651ꢀ
4661.
BIOCHEMISTRY (Moscow) Vol. 75 No. 7 2010