Functional characterization of salt-tolerant microbial esterase WDEst17 and its use in the generation of optically pure ethyl (R)-3-hydroxybutyrate

Article abstract of DOI:10.1002/chir.22847

The two enantiomers of ethyl 3-hydroxybutyrate are important intermediates for the synthesis of a great variety of valuable chiral drugs. The preparation of chiral drug intermediates through kinetic resolution reactions catalyzed by esterases/lipases has been demonstrated to be an efficient and environmentally friendly method. We previously functionally characterized microbial esterase PHE21 and used PHE21 as a biocatalyst to generate optically pure ethyl (S)-3-hydroxybutyrate. Herein, we also functionally characterized one novel salt-tolerant microbial esterase WDEst17 from the genome of Dactylosporangium aurantiacum subsp. Hamdenensis NRRL 18085. Esterase WDEst17 was further developed as an efficient biocatalyst to generate (R)-3-hydroxybutyrate, an important chiral drug intermediate, with the enantiomeric excess being 99% and the conversion rate being 65.05%, respectively, after process optimization. Notably, the enantio-selectivity of esterase WDEst17 was opposite than that of esterase PHE21. The identification of esterases WDEst17 and PHE21 through genome mining of microorganisms provides useful biocatalysts for the preparation of valuable chiral drug intermediates.

Full text of DOI:10.1002/chir.22847

Received: 17 January 2018
DOI: 10.1002/chir.22847
Revised: 5 February 2018
Accepted: 8 February 2018
R E G U L A R A R T I C L E
Functional characterization of salt‐tolerant microbial
esterase WDEst17 and its use in the generation of optically
pure ethyl (R)‐3‐hydroxybutyrate
Yilong Wang1,2 | Yongkai Xu3 | Yun Zhang1,2 | Aijun Sun1,2 | Yunfeng Hu1,2,4
1 CAS Key Laboratory of Tropical Marine
Abstract
Bio‐Resources and Ecology, South China
The two enantiomers of ethyl 3‐hydroxybutyrate are important intermediates
Sea Institute of Oceanology, Chinese
Academy of Sciences, Guangzhou,
for the synthesis of a great variety of valuable chiral drugs. The preparation of
Guangdong, China
2 Guangdong Key Laboratory of Marine
chiral drug intermediates through kinetic resolution reactions catalyzed by
esterases/lipases has been demonstrated to be an efficient and environmentally
Materia Medica, South China Sea Institute
of Oceanology, Chinese Academy of
friendly method. We previously functionally characterized microbial esterase
Sciences, Guangzhou, Guangdong, China
3 Affiliated Hospital of Shandong
PHE21 and used PHE21 as a biocatalyst to generate optically pure ethyl (S)‐3‐
hydroxybutyrate. Herein, we also functionally characterized one novel salt‐tol-
University of Traditional Chinese
erant microbial esterase WDEst17 from the genome of Dactylosporangium
aurantiacum subsp. Hamdenensis NRRL 18085. Esterase WDEst17 was further
developed as an efficient biocatalyst to generate (R)‐3‐hydroxybutyrate, an
important chiral drug intermediate, with the enantiomeric excess being 99%
and the conversion rate being 65.05%, respectively, after process optimization.
Notably, the enantio‐selectivity of esterase WDEst17 was opposite than that of
esterase PHE21. The identification of esterases WDEst17 and PHE21 through
genome mining of microorganisms provides useful biocatalysts for the prepara-
tion of valuable chiral drug intermediates.
Medicine, Jinan, Shandong, China
4 South China Sea Bio‐Resource
Exploitation and Utilization Collaborative
Innovation Center, Guangzhou,
Guangdong, China
Correspondence
Yunfeng Hu, CAS Key Laboratory of
Tropical Marine Bio‐Resources and
Ecology, South China Sea Institute of
Oceanology, Chinese Academy of
Sciences, Guangzhou, Guangdong 510301,
China.
KEYWORDS
Email: yunfeng.hu@scsio.ac.cn
ethyl (R)‐3‐hydroxybutyrate, kinetic resolution, novel esterase, opposite enantio‐selectivity, process
Funding information
optimization
Strategic Priority Research Program of the
Chinese Academy of Sciences, Grant/
Award Number: XDA11030404; Scientific
and Technological Project of Ocean and
Fishery from Guangdong Province, Grant/
Award Number: A201701C12; Guangzhou
Science and Technology Plan Projects,
Grant/Award Number: 201510010012
1 | INTRODUCTION
and have become the hotspot of pharmaceutical industry.
Chiral ethyl 3‐hydroxybutyrate are important intermedi-
The enantiomers of drugs with different chirality may
behave different pharmaceutical activities or more impor-
tantly different toxicities.1,2 Thus, the preparation
methods for optically pure drugs are of great importance
ates for the synthesis of a great variety of valuable chiral
drugs. For example, optically pure ethyl (R)‐3‐
hydroxybutyrate (R‐EHB) has been proven to be a versa-
tile chiral intermediate for the synthesis of β‐lactamase
Chirality. 2018;1–8.
wileyonlinelibrary.com/journal/chir
© 2018 Wiley Periodicals, Inc.
1

2
WANG ET AL.
inhibitors,3 β‐lactam antibiotics,4 and (+)‐decarestrictine
L.5 Ethyl (S)‐3‐hydroxybutyrate (S‐EHB) is an important
chiral intermediate of insect pheromones and chiral citro-
Herein, we identified and characterized one novel
salt‐tolerant esterase WDEst17 from the genome of
Dactylosporangium aurantiacum subsp. Hamdenensis
NRRL 18085. Esterase WDEst17 was used as an effi-
cient biocatalyst in the generation of ethyl (R)‐3‐
hydroxybutyrate through asymmetric hydrolysis of
nellol.6,7 Principally,
optically pure ethyl 3‐
hydroxybutyrate may be synthesized through traditional
organic synthesis.8,9 However, organic synthesis generally
requires toxic and expensive metallic catalysts and is per-
formed under harsh working conditions, which have
brought great pollutions to our environments. Because
of the above mentioned disadvantages of traditional
organic synthesis, scientists are turning to biocatalytic
methods for the synthesis of chiral drug intermediates
represented by chiral ethyl 3‐hydroxybutyrate. Biocata-
lytic methods are generally performed under mild work-
ing conditions and do not require toxic metallic
catalysts. For example, chiral ethyl 3‐hydroxybutyrate
can be prepared through the reduction of corresponding
ketone precursors using dehydrogenases as the
biocatalysts.10,11 But the reduction reactions catalyzed by
dehydrogenases require the involvement of expensive
cofactors such as NADH or NADPH.12,13 Thus, another
route for providing cofactors has to be established at the
same time, which makes the enzymatic synthetic method
derived from dehydrogenases more complicated.
Another biocatalytic route for the synthesis of the two
enantiomers of ethyl 3‐hydroxybutyrate is through kinetic
resolution reactions catalyzed by either esterases or
lipases. However, because the structural differences of
the two enantiomers of ethyl 3‐hydroxybutyrate were
quite small, the kinetic resolutions of racemic ethyl 3‐
hydroxybutyrate may be very challenging and the fact
was that the reports about the preparation of chiral ethyl
3‐hydroxybutyrate through enzymatic kinetic resolutions
catalyzed by esterases/lipases were quite rare. Microor-
ganisms are a great source for the identification of novel
biocatalysts, for example, novel esterases/lipases. Many
novel esterases/lipases may be identified from microor-
ganisms and further developed as biocatalysts for the gen-
eration of valuable chiral drug intermediates or
chemicals.14-16 We previously identified and functionally
characterized one novel esterase PHE21 from Pseudomo-
nas oryzihabitans HUP022.17 Esterase PHE21 was further
used as a useful biocatalyst in the generation of optically
pure ethyl (S)‐3‐hydroxybutyrate with high enantiomeric
excess and high conversion after careful process
optimization.
racemic
ethyl
3‐hydroxybutyrate.
Ethyl
(R)‐3‐
hydroxybutyrate was generated with high enantiomeric
excess and high conversion after process optimization.
Notably, the enantio‐selectivity of esterase WDEst17
was opposite than that of esterase PHE21 (Scheme 1).
2 | MATERIALS AND METHODS
2.1 | Plasmid, strains, and reagents
Plasmid pET‐28a (+) (Novagen, USA) was used as the
expression vector of esterase WDEst17. The strains
Escherichia coli DH5α and Escherichia coli BL21 (DE3)
were reserved in our laboratory. TransStart FastPfu DNA
polymerase, ligases, and restriction enzymes were all pur-
chased from TransGen Biotech (Beijing, China). p‐nitro-
phenyl (p‐NP) esters were purchased from Sigma (St
Louis, Missouri). Racemic ethyl 3‐hydroxybutyrate and
corresponding chiral enantiomers were bought from Alad-
din Industrial Corporation (Shanghai, China). Organic
solvents and other reagents were of analytical grade.
2.2 | Sequence analysis, plasmid, and
recombinant strain construction
The coding DNA sequence of an esterase (named
WDEst17) was amplified from the genomic DNA of
D aurantiacum subsp. Hamdenensis NRRL 18085. The
protein sequences of esterase WDEst17 were analyzed
using the BLASTP program. (http://blast.ncbi.nlm.nih.
gov/Blast.cgi). Secretion signal was estimated by the
SignalP 4.1 prediction tool from http://www.cbs.dtu.dk/
services/SignalP/. The theoretical value of protein molec-
ular and pI were predicted by expasy from http://web.
expasy.org/compute_pi/. Multiple sequence alignments
were constructed using the DNAMAN 6.0 program. The
protein three‐dimensional structure model was built and
analyzed by the online SWISS‐MODEL server from
https://swissmodel.expasy.org/. To clone the gene of
esterase WDEst17 (herein we named WDEst17), a set of
SCHEME 1 Comparison of esterase WDEst17 with PHE21 in the kinetic resolution of racemic ethyl 3‐hydroxybutyrate through
asymmetric hydrolysis reactions

WANG ET AL.
3
primers (forward primer with underlined BamH I site 5′‐
25°C to 60°C. The effect of various organic solvents and
surfactants was measured by incubating WDEst17 in the
presence of seven different organic solvents (10%, v/v)
and four different surfactants (0.1%) for 12 hours at 4°C.
CATGGATCCGTGAGCATCCCGCAGACA‐3,
reverse
primer with underlined Hind III site: 5′‐CACAAGCTT
TCAGACGCCACGGAGTGCG‐3) were designed accord-
ing to the DNA sequence of WDEst17. the BamH I/Hind
III digested polymerase chain reaction (PCR) fragments
were ligated into the BamH I/Hind III pretreated plasmid
pET‐28a (+). The recombinant plasmid pET‐28a (+)‐
WDEst17 was transformed into E coli BL21 (DE3) compe-
tent cells for further protein expression.
The effect of metal ions (Li+, Mg2+, Zn2+, Ba2+, Mn2+
,
Ni2+, Co2+, and Cu2+) was investigated by incubating
WDEst17 in the presence of eight different metal ions
(1 mmol/L) for 12 hours at 4°C. The effect of salinity
(NaCl) on the hydrolytic activity of WDEst17 was deter-
mined by measuring the residual activity after incubation
in solutions containing 0 to 4 mol/L NaCl for 12 hours at
4°C. The hydrolytic activity of WDEst17 without any addi-
tion of organic solvents, surfactants, metal ions, or NaCl
in the reaction mixtures was defined as 100%. Kinetic
parameters were measured using a Lineweaver‐Burk plot
under the optimal reaction conditions.
2.3 | Expression and purification of
WDEst17
The E coli BL21 (DE3)/pET‐28a (+)‐WDEst17 were grown
at 37°C and 200 rpm in Luria‐Bertani medium (recombi-
nant strains with 50 μg/mL kanamycin). When OD600 of
cells reached approximately 0.6 to 0.8, isopropyl‐beta‐D‐
thiogalactopyranoside (IPTG) was added at a final con-
centration of 0.3 mmol/L to induce protein expression.
After 20‐hour induction at 20°C, the cells were collected
by centrifugation at 4000 r/min for 10 minutes, 4°C,
washed with phosphate buffer (50 mmol/L, pH 7.5) for
two times, and then resuspended in the same buffer.
The supernatants containing recombinant WDEst17 were
collected by centrifugation at 10,000 r/min for 15 minutes,
4°C after the cells were disrupted by sonication. Ni Sepha-
rose columns and PD‐10 desalting columns were used to
purify and desalt WDEst17 according to manufacturers'
instructions. Purified WDEst17 was analyzed by SDS‐
PAGE using 12% polyacrylamide gels. The enzyme con-
centration was determined using the Bradford method,18
with bovine serum albumin as the standard.
2.6 | Optimization of the kinetic
resolution of racemic ethyl 3‐
hydroxybutyrate by WDEst17
Using the standard enzymatic reactions system, the opti-
mum pH and temperature on the kinetic resolution of
( )‐ethyl 3‐hydroxybutyrate were examined under a pH
range of 6.0 to 9.0 and a temperature range of 25°C to
45°C, respectively. Under the optimum pH value and tem-
perature, the effect of organic solvents and surfactants on
the enzymatic resolution reactions was performed by
adding 10 kinds of organic solvents (10%, v/v) and five dif-
ferent surfactants (0.01%, v/v) as the cosolvents. Reactions
without any additives were marked as control. Experi-
ments with a series of concentrations (from 2.5 to
20 mmol/L) of ( )‐ethyl 3‐hydroxybutyrate were per-
formed to investigate the optimum substrate concentra-
tion of enzymatic resolution reactions. The effect of
enzyme concentration on the resolution of ( )‐ethyl 3‐
hydroxybutyrate was determined by adding WDEst17 into
the reactions at final concentrations of ranging from
0.4 × 103 to 3.2 × 103 U/L. The optimum reaction time
on the enzymatic resolution of ( )‐ethyl 3‐
hydroxybutyrate by WDEst17 was determined at a range
of 1 to 4 hours. All the products of reactions were detected
by chiral GC.
2.4 | Enzyme assay
The hydrolytic activity of WDEst17 was measured at
405 nm according a standard assay method as described
previously.15 One unit (U) of hydrolytic activity was
defined as the amount of enzyme liberating 1 μmol of
p‐NP per minute from the p‐NP esters.
2.5 | Biochemical characterization of
WDEst17
In the standard assay, the substrate specificity of
WDEst17 was determined by hydrolyzing p‐nitrophenol
(p‐NP) esters of different chain lengths (C2‐C8) dissolved
in acetonitrile. Hydrolytic reactions in range of pH 6.0 to
10.0 were performed to determine the optimum pH for
WDEst17 by using p‐PN acetate (C2) as the substrate.
Under the optimal pH, the effect of temperature on the
activity of WDEst17 was examined in the range from
2.7 | Analytical methods of chiral gas
chromatograph
The enantiomeric excess of chiral products from enzy-
matic kinetic resolution reactions was analyzed by using
a gas chromatograph (FULI GC‐9700II) equipped with
H2 flame ionization detector and 112‐6632 CYCLOSIL‐B
chiral capillary column (30 m × 0.25 mm ID, 0.25 μm df).

4
WANG ET AL.
3 | RESULTS
3.3.2 | Effect of pH and temperature on
the hydrolytic activity of WDEst17
3.1 | Sequence analysis of WDEst17
The effects of pH and temperature on the hydrolytic activ-
ity of WDEst17 were measured at pH ranging from 6.0 to
10.0 and temperatures ranging from 25°C to 60°C with p‐
nitrophenyl acetate as the substrate. The results showed
that the optimal pH and temperature for the hydrolytic
activity of WDEst17 were 8.5 and 40°C, respectively
(Figures S4 and S5).
An esterase gene (here named WDEst17) with an open
reading frame (ORF) of 750 BP encoding a protein of 249
amino acids without a signal peptide was identified from
the genomic sequence of
D aurantiacum subsp.
Hamdenensis NRRL 18085 (the sequence of gene
WDEst17 has been deposited in GenBank with the acces-
sion no. KY321752). Multiple sequence alignment indi-
cated that the catalytic triad of WDEst17 is formed by
Ser94, Asp200, and His228, with Ser94 in a consensus G‐
X1‐S‐X2‐G pentapeptide (Figure S1). The protein
sequence of WDEst17 showed 79% similarity with one
putative esterase from D aurantiacum (WP_052386699)
and 62% similarity with one hypothetical protein from
Streptomyces sp. NRRL F‐6491 (WP_KOX23583.1) by
blasting against the NCBI protein sequence database. So
WDEst17 is identified as a novel microbial esterase, which
exhibits low sequence identities with other putative ester-
ases. Additionally, there were no reports about the bio-
chemical characterization and the utilization of
WDEst17 in enzymatic synthesis of chiral chemicals.
3.3.3 | Effect of metal ions, organic sol-
vents, and surfactants on the hydrolytic
activity of WDEst17
The results showed that the addition of metal ions did not
greatly inhibit the hydrolytic activity of WDEst17, except
Zn2+ (46.98 6.59%) and Cu2+ (60.45 6.89%). The addi-
tion of diverse organic solvents and surfactants basically
did not affect the hydrolytic activity of WDEst17. The pres-
ence of n‐decane (5%, v/v) and Tween‐80 (0.01%, v/v) pro-
moted the hydrolytic activity of WDEst17 with the residual
hydrolytic activities being 137.37% and 120.63%, respec-
tively (Table S1).
3.2 | Expression and purification of
WDEst17
3.3.4 | Effect of NaCl concentration on the
hydrolytic activity of WDEst17
The molecular weight and isoelectric point of WDEst17
were calculated to be 27.3 KDa and 5.75 by http://web.
expasy.org/compute_pi/, respectively. The recombinant
WDEst17 was successfully heterologously expressed in
E coli and purified by using Ni‐NTA affinity chromatogra-
phy. Purified WDEst17 was confirmed by SDS‐PAGE,
with a single band consistent with the anticipated molec-
ular weight (Figure S2). Purified WDEst17 was used for
subsequent biochemical characterization and kinetic res-
olution of racemic ethyl 3‐hydroxybutyrate.
The effect of NaCl concentration on the activity of
WDEst17 was performed by incubating WDEst17 in solu-
tions containing NaCl (0.2 to 5M) for 12 hours. The results
showed that the presence of NaCl, even NaCl of high con-
centration, exhibited positive effect on the hydrolytic
activity of WDEst17. Notably, in the presence of 4M NaCl,
the hydrolytic activity of WDEst17 reached more than
160% of its initial activities (Figure S6). Thus, WDEst17
was characterized to be a salt‐tolerant microbial esterase
with potential usage in some industries which require
high‐salt conditions.
3.3 | Characterization of WDEst17
3.4 | Kinetic resolution of racemic ethyl
3‐hydroxybutyrate by WDEst17
3.3.1 | Substrate specificity of WDEst17
To determine the optimal substrates for WDEst17, we
tested its activities toward various p‐nitrophenyl esters
with C2‐C8 aliphatic acyl‐chains. Under the standard
assay conditions, WDEst17 preferentially hydrolyzed
short‐chain p‐NP esters and exhibited its highest hydro-
lytic activity toward p‐nitrophenyl butyrate (C2), with
the Km of being 0.74mM and a specific activity of being
146.23 U/mg, respectively. Meanwhile, WDEst17 was
found to display low activities towards the C6 and C8 sub-
strates (Figure S3).
3.4.1 | Effect of pH and temperature on
the kinetic resolution of ( )‐ethyl
3‐hydroxybutyrate
The effect of pH and temperature on the kinetic resolu-
tion of racemic ethyl 3‐hydroxybutyrate by esterase
WDEst17 was shown in Figures 1 and 2. The reaction
pH and temperature for the highest ees were found to be
pH 8.0 and 35°C, respectively. So the optimum pH and
temperature for the kinetic resolution of ( )‐ethyl 3‐

WANG ET AL.
5
TABLE 1 Effect of organic cosolvents and surfactants on the
kinetic resolution of ( )‐ethyl 3‐hydroxybutyrate by WDEst17
Organic Solvents and Surfactants
ees, %
C, %
Control
51
22
15
15
32
45
50
51
49
44
49
50
47.25
44.66
39.18
39.18
61.03
44.66
63.08
41.97
54.49
52.16
39.18
58.93
DMSO
Methylbenzene
n‐Decanol
Cyclohexane
Octane
n‐Decane
FIGURE 1 Effect of pH on the kinetic resolution of ( )‐ethyl 3‐
hydroxybutyrate by esterase WDEst17
CTAB
Tween‐20
Tween‐80
TritonX‐100
Sodium tripolyphosphate
3.4.3 | Effect of substrate concentration
and enzyme concentration on the kinetic
resolution of ( )‐ethyl 3‐hydroxybutyrate
The effect of substrate concentration and enzyme concen-
tration on the kinetic resolution of ( )‐ethyl 3‐
hydroxybutyrate by WDEst17 were shown in Figures 3
and 4. The results showed that both the substrate concen-
tration and the enzyme concentration had great impact
on the activities and the stereo‐selectivities of WDEst17.
0.05M and 3.5×103 U/L were characterized to be the opti-
mum substrate concentration and the optimum enzyme
concentration for the kinetic resolution of ( )‐ethyl 3‐
hydroxybutyrate by WDEst17, with the ees being 99%
and the conversion rate being 68.83%, respectively.
FIGURE 2 Effect of temperature on the kinetic resolution of ( )‐
ethyl 3‐hydroxybutyrate by esterase WDEst17
hydroxybutyrate by WDEst17 were characterized to be
pH 8.0 and 35°C.
3.4.4 | Effect of reaction time on the
kinetic resolution of ( )‐ethyl 3‐
hydroxybutyrate
3.4.2 | Effect of organic cosolvents and
surfactants on the kinetic resolution of
( )‐ethyl 3‐hydroxybutyrate
Under above optimized reaction conditions, the optimal
reaction time for the kinetic resolution of ( )‐ethyl 3‐
hydroxybutyrate by WDEst17 was characterized to be
3.5 hours, with a final ees being over 99% and a conversion
rate being 65.05%, respectively (Figure 5).
The results showed that the addition of organic solvents
could strongly affect both the activities and the stereo‐
selectivities of esterase WDEst17. Almost all the tested
organic solvents exhibited adverse effect on both the
ees and conversion rate, thus inhibiting the kinetic res-
olution of ( )‐ethyl 3‐hydroxybutyrate catalyzed by
esterase WDEst17 (Table 1). The addition of surfactants
did not exhibit remarkable effect on the kinetic resolu-
tion of ( )‐ethyl 3‐hydroxybutyrate by WDEst17. Thus,
no organic solvents or surfactants were added to enzy-
matic reactions for the further optimization of the
kinetic resolution of ( )‐ethyl 3‐hydroxybutyrate
catalyzed by WDEst17.
4 | DISCUSSION
In this study, we identified and functionally characterized
one novel microbial esterase, WDEst17, from the genome
of D aurantiacum subsp. Hamdenensis NRRL 18085.
WDEs17 was identified as a novel microbial esterase,
which exhibited low sequence identities with other

6
WANG ET AL.
the Km of 0.74mM and a specific activity of 146.23 U/mg
for p‐NP C2, indicating that WDEst17 was a true esterase
instead of a lipase.19
Stabilities in the presence of organic solvents, surfac-
tants, or NaCl are very important characteristics for
enzymes to be used as biocatalysts in industry.20,21 Ester-
ase WDEs17 exhibited very good stability in the presence
of many surfactants, organic solvents, and metal ions,
although a couple of divalent metal ions could inhibit
the hydrolytic activity of WDEs17. Similar results were
also observed in the case of esterase H9Est from a
metagenomics library, which was also inhibited by Cu2+
(67.4 6.6%) and Zn2+ (32.3 4%).22 With the increasing
demand of esterases under extreme conditions, esterases
with salt‐tolerant ability are also in great demand in many
industries, especially in food industry.23,24 Before our
work, there were some reports about the identification
of salt‐tolerant esterases. The hydrolytic activity of one
salt‐tolerant esterase Est9X from a marine metagenomic
library was enhanced by 1.9‐fold in the presence of 4M
NaCl.25 An esterase EstKT7 from a metagenomic library
was also characterized to be well tolerant to NaCl, with
its hydrolytic activity increased by 1.7‐fold in the presence
of 0.5M NaCl.26 The hydrolytic activity of WDEst17 could
remain more than 160% of its initial activities after incu-
bation in solution containing 4M NaCl for 12 hours, sug-
gesting that esterase WDEst17 is a salt‐tolerant enzyme.
All above results showed that esterase WDEst17 was a
robust esterase, which behaved high resistance to various
organic solvents, surfactants, and NaCl.
FIGURE 3 The effect of substrate concentration on the kinetic
resolution of ( )‐ethyl 3‐hydroxybutyrate by WDEst17
FIGURE 4 The effect of enzyme concentration on the kinetic
resolution of ( )‐ethyl 3‐hydroxybutyrate by WDEst17
The two enantiomers of ethyl 3‐hydroxybutyrate are
important building blocks for the synthesis of valuable
pharmaceuticals,3-5 which can principally be prepared
either by organic synthesis8,9 or by biocatalytic
methods.12,13 However, traditional organic synthesis gen-
erally uses expensive chiral metal catalysts, harsh work-
ing conditions, and toxic organic solvents, thus bringing
great pollutions to our environments.9,13 The develop-
ment of biocatalysis methods is of great importance in
the preparation of valuable chiral building blocks repre-
sented by chiral ethyl 3‐hydroxybutyrate. The preparation
of chiral ethyl 3‐hydroxybutyrate using lipases or ester-
ases through enzymatic kinetic resolution was quite diffi-
cult. Before our study, the reports about the enzymatic
kinetic resolution of ethyl 3‐hydroxybutyrate were also
quite rare, possibly because the structural difference
between the two enantiomers of ethyl 3‐hydroxybutyrate
was very small.
FIGURE 5 The effect of reaction time on the kinetic resolution of
( )‐ethyl 3‐hydroxybutyrate by WDEst17
putative esterases. The protein sequence of WDEst17
exhibited a maximum similarity of 79% with one putative
esterase (WP_052386699) from D aurantiacum by blasting
against the NCBI protein sequence database. WDEst17
preferred short‐chain p‐NP esters as the substrates, with
Herein, we developed esterase WDEst17 as a green
biocatalyst in the kinetic resolution of ( )‐ethyl 3‐
hydroxybutyrate through direct hydrolytic reactions and
generated ethyl (R)‐3‐hydroxybutyrate with high enantio-
meric excess (ees > 99%) and conversion rate (65.05%)

WANG ET AL.
7
TABLE 2 Comparison of esterases WDEst17 and PHE21 in the
kinetic resolutions of ( )‐ethyl 3‐hydroxybutyrate
preparation of chiral ethyl 3‐hydroxybutyrate. We
previously identified one novel microbial esterase
PHE21 and used esterase PHE21 to generate ethyl (S)‐3‐
hydroxybutyrate with high enantiomeric excess and con-
version. In this study, we also identified and functionally
characterized one novel salt‐tolerant microbial esterase
WDEst17. Esterase WDEst17 was further developed as
an efficient biocatalyst for the synthesis of ethyl (R)‐3‐
hydroxybutyrate with high enantiomeric excess and con-
version through direct asymmetric hydrolytic reactions.
Notably, the enantio‐selectivity of esterase WDEst17 was
opposite than that of esterase PHE21. The identification
of esterases WDEst17 and PHE21 provides novel
biocatalysts for the synthesis of valuable chiral drug inter-
mediates through kinetic resolutions.
Esterases
WDEst17
PHE21
Configuration of products
Optimal pH
R
S
8.0
35
—
8.0
40
Optimal temperature, °C
Effect of organic solvents
and surfactants
ees increased by
Triton X‐100
Optimum substrate
concentration, mol/L
0.05
0.1
e.e., %
>99
>99
65.15
17
Conversion, %
Ref.
65.05
This work
“—” denotes no facilitation.
ACKNOWLEDGMENTS
after process optimization. Notably, the enantio‐selectiv-
ity of esterase WDEst17 was opposite than that of ester-
ase PHE21 during the kinetic resolution of ( )‐ethyl 3‐
hydroxybutyrate from our previous report.17 The protein
sequence analysis showed that both WDEst17 and
PHE21 belong to the α/β hydrolase family with the con-
served signature (Gly‐X‐Ser‐X‐Gly) in the open reading
frames (Figure S7). The three‐dimensional structure of
WDEst17 that consists of nine β strands and eight α heli-
ces is different from that of PHE21, which consists of
eight β strands and nine α helices. The catalytic triads
This work was supported by the Strategic Priority
Research Program of the Chinese Academy of Sciences
(XDA11030404), Scientific and Technological Project of
Ocean and Fishery from Guangdong Province
(A201701C12), and Guangzhou Science and Technology
Plan Projects (201510010012).
ORCID
Yunfeng Hu http://orcid.org/0000-0001-9258-7205
of WDEst17 and PHE21 are formed by Ser94‐Asp200
‐
His228 and Ser164‐Asp260‐His290, respectively (Figures S8
and S9). The differences in protein sequences and struc-
tures of the two enzymes should be the main reasons
leading to the different stereo‐preference.27,28 However,
just like we cannot predict the detailed characteristics
of one enzyme simple based upon protein sequence
analysis and structure analysis, we cannot predict the
stereo‐preference and the stereo‐selectivity of one
enzyme, at least at current stage. Next, the studies of
the crystals of WDEst17 and PHE21 and the interaction
of the two esterases with the two enantiomers of ( )‐
ethyl 3‐hydroxybutyrate may provide more information
for the explanation of opposite stereo‐preference. Com-
parison results of esterases WDEst17 and PHE21 in the
kinetic resolutions of ( )‐ethyl 3‐hydroxybutyrate are
showed in Table 2.
REFERENCES
1. Beary JF. Chirality and drug development. Lancet. 1992;339:495.
2. Sukanya M, Puneet C. Chirality and anaesthetic drugs: a review
and an update. Indian J Anaesth. 2011;55:556‐562.
3. Tschaen DM, Fuentes LM, Lynch JE, Laswell WL, Volante RP,
Shinkai I. ChemInform abstract: an efficient synthesis of 4‐
benzoyloxyazetidinone: an important carbapenem intermediate.
Chem. 1988;29:2779‐2782.
4. Nakai T, Chiba T. Azetidinone derivative and processes for pro-
duction thereof. EP, EP19850109880;1986.
5. Clark JS, Fessard TC, Whitlock GA. A concise enantioselective
synthesis of the fungal metabolite (+)‐decarestrictine L. Tetrahe-
dron. 2006;62:73‐78.
6. Mori K. A simple synthesis of (S)‐(+)‐sulcatol, the pheromone of
Gnathotrichus retusus, employing baker's yeast for asymmetric
reduction. Tetrahedron. 1981;37:1341‐1342.
7. Mori K, Sugai T. ChemInform Abstract: ethyl (S)‐3‐
hydroxybutanoate as a starting material for the synthesis of (S)‐
(−)‐citronellol and other chiral alcohols. Synthesis.
1982;1982:752‐753.
5 | CONCLUSION
The two enantiomers of chiral ethyl 3‐hydroxybutyrate
are crucial building blocks for the synthesis of many
valuable drugs. The asymmetric hydrolysis of racemic
ethyl 3‐hydroxybutyrate presents one useful way for the
8. Berthod M, Saluzzo C, Mignani G, Lemaire M. 4,4′ and 5,5′‐
DiamBINAP as a hydrosoluble chiral ligand: syntheses and use
in Ru(II) asymmetric biphasic catalytic hydrogenation. Tetrahe-
dron: Asymmetry. 2004;15:639‐645.

8
WANG ET AL.
9. Nakamura K, Yamanaka R, Matsuda T, Harada T. Recent devel-
opments in asymmetric reduction of ketones with biocatalysts.
Chem. 2003;14:2659‐2681.
21. Shao H, Xu L, Yan YJ. Isolation and characterization of a ther-
mostable esterase from a metagenomic library. J Ind Microbiol
Biot. 2013;40:1211‐1222.
10. Sheldon RA. Chirotechnology. New York: Marcel Dekker.
22. De SC, Zhai L, Ambrosino L, et al. Identification and character-
ization of a novel salt‐tolerant esterase from a Tibetan glacier
metagenomic library. Biotechnol Prog. 2015;31:890‐899.
1993;105.
11. Moore JC, Pollard DJ, Kosjek B, Devine PN. Advances in the
enzymatic reduction of ketones. Accounts Chem Res.
2007;40:1412‐1419.
23. Rao L, Zhao X, Pan F, et al. Solution behavior and activity of a
halophilic esterase under high salt concentration. PLoS One.
2009;4:e6980.
12. Gulevich AY, Skorokhodova AY, Sukhozhenko AV, Debabov
VG. Biosynthesis of enantiopure (S)‐3‐hydroxybutyrate from glu-
cose through the inverted fatty acid β‐oxidation pathway by
24. Jiang X, Huo Y, Cheng H, Zhang X, Zhu X, Wu M. Cloning,
expression and characterization of a halotolerant esterase from
metabolically engineered Escherichia coli.
2017;244:16‐24.
J
Biotechnol.
a
marine bacterium Pelagibacterium halotolerans B2T.
Extremophiles. 2012;16:427‐435.
13. Nakashimada Y, Kubota H, Takayose A, Kakizono T, Nishio N.
Asymmetric reduction of ethyl acetoacetate to ethyl (R)‐3‐
hydroxybutyrate coupled with nitrate reduction by Paracoccus
denitrificans. J Biosci Bioeng. 2001;91:368‐372.
25. Fang ZM, Li JJ, Wang Q, et al. A novel esterase from a marine
metagenomic library exhibiting salt tolerance ability. J Microbiol
Biotechnol. 2014;24:771‐780.
26. Jeon JH, Lee HS, Kim JT, et al. Identification of a new subfamily
of salt‐tolerant esterases from a metagenomic library of tidal flat
sediment. Appl Microbiol Biot. 2012;93:623‐631.
14. Liang JY, Zhang Y, Sun AJ, Deng D, Hu YF. Enantioselective
resolution of ( )‐1‐phenylethanol and ( )‐1‐phenylethyl acetate
by a novel esterase from Bacillus sp. SCSIO 15121. Appl Biochem
Biotech. 2016;178:558‐575.
27. Whicher JR, Florova G, Sydor PK, et al. Structure and function
of the RedJ protein, a thioesterase from the prodiginine biosyn-
15. Wang YL, Zhang Y, Sun AJ, Hu YF. Characterization of a novel
marine microbial esterase and its use to make D‐methyl lactate.
Chinese J Catal. 2016;37:1396‐1402.
thetic pathway in Streptomyces coelicolor.
2011;286:22558‐22569.
J Biol Chem.
28. Pereira MR, Maester TC, Mercaldi GF, Lemos EGM, Hyvönen
M, Balan A. From a metagenomic source to a high‐resolution
structure of a novel alkaline esterase. Appl Microbiol Biot.
2017;101:1‐15.
16. Deng D, Zhang Y, Sun AJ, Liang JY, Hu YF. Functional charac-
terization of a novel marine microbial GDSL lipase and its
utilization in the resolution of (+/−)‐1‐phenylethanol. Appl
Biochem Biotechnol. 2016;179:75‐93.
17. Wang YL, Zhang Y, Hu YF. Functional characterization of a
robust marine microbial esterase and its utilization in the ste-
reo‐selective preparation of ethyl (S)‐3‐hydroxybutyrate. Appl
Biochem Biotech. 2016;1196‐1212.
SUPPORTING INFORMATION
Additional Supporting Information may be found online
in the supporting information tab for this article.
18. Bradford MM. A rapid and sensitive method for quantitation of
microgram quantities of protein utilizing principle of protein‐
dye binding. Anal Biochem. 1976;72:248‐254.
How to cite this article: Wang Y, Xu Y, Zhang Y,
Sun A, Hu Y. Functional characterization of salt‐
tolerant microbial esterase WDEst17 and its use in
the generation of optically pure ethyl (R)‐3‐
hydroxybutyrate. Chirality. 2018;1–8. https://
doi.org/10.1002/chir.22847
19. Arpigny JL, Jaeger KE. Bacterial lipolytic enzymes: classification
and properties. Biochem J. 1999;343:177‐183.
20. Soliman NA, Knoll M, Abdel‐Fattah YR, Schmid RD, Lange S.
Molecular cloning and characterization of thermostable esterase
and lipase from Geobacillus thermoleovorans YN isolated from
desert soil in Egypt. Process Biochem. 2007;42:1090‐1100.