Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum Resistance

Article abstract of DOI:10.1016/j.chembiol.2018.05.018

Pathogens such as non-typeable Haemophilus influenzae (NTHi) evade the immune system by presenting host-derived sialic acids. NTHi cannot synthesize sialic acids and therefore needs to utilize sialic acids originating from host tissue. Here we report sialic acid-based probes to visualize and inhibit the transfer of host sialic acids to NTHi. Inhibition of sialic acid utilization by NTHi enhanced serum-mediated killing. Furthermore, in an in vitro model of the human respiratory tract, we demonstrate efficient inhibition of sialic acid transfer from primary human bronchial epithelial cells to NTHi using bioorthogonal chemistry. Molecular mimicry of non-typeable Haemophilus influenzae (NTHi) with host sialic acid sugars mediates resistance to serum killing and increases virulence. Heise et al. have developed sialic acid derivatives that allow either visualization or inhibition of host sialic acid transfer to NTHi, the latter enhancing serum-mediated killing.

Full text of DOI:10.1016/j.chembiol.2018.05.018

Brief Communication
Selective Inhibition of Sialic Acid-Based Molecular
Mimicry in Haemophilus influenzae Abrogates Serum
Resistance
Graphical Abstract
Authors
Torben Heise, Jeroen D. Langereis,
Emiel Rossing, Marien I. de Jonge,
€
Gosse J. Adema, Christian Bull,
Thomas J. Boltje
Correspondence
jeroen.langereis@radboudumc.nl (J.D.L.),
t.boltje@science.ru.nl (T.J.B.)
In Brief
Molecular mimicry of non-typeable
Haemophilus influenzae (NTHi) with host
sialic acid sugars mediates resistance to
serum killing and increases virulence.
Heise et al. have developed sialic acid
derivatives that allow either visualization
or inhibition of host sialic acid transfer to
NTHi, the latter enhancing serum-
mediated killing.
Highlights
d
d
d
d
NTHi expresses host sialic acids on its surface to evade the
immune system
Ac5SiaNAz enables visualization of host sialic acid transfer
to NTHi
SiaNAc-3Fax blocks sialic acid incorporation in NTHi, but not
in host cells
Sialic acid blockade with SiaNAc-3Fax enhances serum-
mediated killing of NTHi
Heise et al., 2018, Cell Chemical Biology 25, 1–7
September 20, 2018 ª 2018 Elsevier Ltd.
https://doi.org/10.1016/j.chembiol.2018.05.018

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
Cell Chemical Biology
Brief Communication
Selective Inhibition of Sialic Acid-Based
Molecular Mimicry in Haemophilus influenzae
Abrogates Serum Resistance
1
4,6
Torben Heise,1,5 Jeroen D. Langereis,2,3,5, Emiel Rossing, Marien I. de Jonge,2,3 Gosse J. Adema,4,6 Christian Bull,
€
*
and Thomas J. Boltje1,7,
*
1Cluster of Molecular Chemistry, Institute for Molecules and Materials, Radboud University, Nijmegen 6525 AJ, the Netherlands
2Section Pediatric Infectious Diseases, Laboratory of Medical Immunology, Radboud Institute for Molecular Life Sciences, Radboudumc,
Nijmegen 6525 GA, the Netherlands
3Radboud Centre for Infectious Diseases, Radboudumc, Nijmegen 6525 GA, the Netherlands
4Radiotherapy & OncoImmunology Laboratory, Department of Radiation Oncology, Radboudumc, Nijmegen 6525 GA, the Netherlands
5These authors contributed equally
6Senior author
7Lead Contact
*Correspondence: jeroen.langereis@radboudumc.nl (J.D.L.), t.boltje@science.ru.nl (T.J.B.)
https://doi.org/10.1016/j.chembiol.2018.05.018
SUMMARY
nistic pathogen is associated with uptake and expression of
host sialic acids. Sialic acids are complex nine-carbon sugars
Pathogens such as non-typeable Haemophilus influ- abundantly expressed on human glycoconjugates (Severi
et al., 2007) and can be released by the action of sialidases.
Unbound sialic acids can be taken up by NTHi using a tripar-
enzae (NTHi) evade the immune system by present-
ing host-derived sialic acids. NTHi cannot synthesize
sialic acids and therefore needs to utilize sialic acids
originating from host tissue. Here we report sialic
acid-based probes to visualize and inhibit the trans-
fer of host sialic acids to NTHi. Inhibition of sialic acid
utilization by NTHi enhanced serum-mediated killing.
Furthermore, in an in vitro model of the human
tite ATP-independent periplasmic (TRAP) transporter system
(Cross et al., 2003; Vimr et al., 2004) and enzymatically
incorporated into the variable outer core of the NTHi lipooligo-
saccharide (LOS) (Figure 1) (Apicella, 2012). LOS sialylation is
an important NTHi virulence factor that confers resistance to
serum killing and increases biofilm formation, although the
¨
underlying mechanisms are still poorly understood (Hallstrom
respiratory tract, we demonstrate efficient inhibition
of sialic acid transfer from primary human bron-
and Riesbeck, 2010; Langereis and Hermans, 2013).
NTHi strains defective in sialic acid utilization are no longer
chial epithelial cells to NTHi using bioorthogonal virulent in animal models for otitis media, making the sialic
acid utilization pathway a promising therapeutic target (Jen-
kins et al., 2010).
chemistry.
Herein we report a sialic acid-based inhibitor (SiaNAc-3Fax
)
that prevents sialic acid incorporation into NTHi LOS at low
micromolar concentrations, which led to enhanced serum-medi-
ated killing of NTHi (Figure 1). Furthermore, we report the use of
sialic acid-based probes and bioorthogonal chemistry to visu-
alize the transfer of sialic acids from host to NTHi using a model
system of the human airway.
INTRODUCTION
Several pathogens that colonize the human host have evolved
the ability to engage in ‘‘molecular mimicry,’’ the expression of
host-like molecular structures at the cell surface. These struc-
tures are used by pathogens as a molecular cloak to avoid
detection and clearance by the host immune system. A prime
example of an opportunistic pathogen that uses molecular RESULTS AND DISCUSSION
mimicry is non-typeable Haemophilus influenzae (NTHi). NTHi
is a commensal organism in the upper respiratory tract micro- Visualization and Inhibition of NTHi LOS Sialylation
biome, which can become an opportunistic pathogen mainly in To evaluate the efficacy of sialic acid-based inhibitors on LOS
children and the elderly (Van Eldere et al., 2014; Langereis and sialylation, we have developed a fast and reliable assay to mea-
de Jonge, 2015). NTHi infections are found in 55%–95% of sure LOS sialylation in NTHi. Sialic acid incorporation into NTHi
children suffering from otitis media, an inflammatory disease LOS was visualized using a metabolic sialic acid glycoengineer-
that affects 65–300 million people globally and is a major ing approach with azidoacetyl (SiaNAz)- and propargyloxycar-
cause of hearing loss (Van Eldere et al., 2014). In addition, bonyl (SiaNPoc)-modified sialic acids (Figures 2A and S1A)
NTHi is found in up to 87% of patients with acute exacerbation (Sletten and Bertozzi, 2009; Tra and Dube, 2014; Lantos et al.,
of chronic obstructive pulmonary disease, a leading cause of 2016). NTHi bacteria were grown in sialic acid-deficient medium
death worldwide (Van Eldere et al., 2014). The switch of supplemented with SiaNAz or SiaNPoc and incorporation
NTHi from a symbiotic colonizing bacterium to an opportu- of these sialic acid analogs into LOS was detected by reacting
Cell Chemical Biology 25, 1–7, September 20, 2018 ª 2018 Elsevier Ltd.
1

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
Figure 1. Sialic Acid Utilization by NTHi
Host sialic acids are released by sialidases and
taken up by NTHi via active uptake using a tripartite
ATP-independent periplasmic (TRAP) transporter
system. Incorporation of sialic acids in NTHi LOS
leads to resistance to serum-mediated killing.
100 mM). SiaNAc-3Fax blocked the incor-
poration of SiaNAz and SiaNPoc in a
dose-dependent manner with
maximal inhibitory concentration (IC50
a half
)
of 700 nM for SiaNAz and 90 nM for
SiaNPoc (Figures 2D and S2A–S2C).
Even though SiaNAz was present in a
100-fold access,
1 mM SiaNAc-3Fax
showed over 50% reduction of SiaNAz
incorporation into LOS (Figure 2D).
In line with the findings obtained with
protected SiaNAz and SiaNPoc sialic
acid analogs, no inhibition was observed
with the protected fluorinated sialic acid
(Ac5SiaNAc-3Fax) (Figures 2E and S2D).
In human THP-1 cells, however, treat-
ment with protected Ac5SiaNAc-3Fax
effectively decreased sialic acid expres-
them to biotin-alkyne or biotin-azide, respectively, using copper- sion, whereas this was not the case for the non-protected analog
catalyzed alkyne-azide cycloaddition (CuAAC) followed by stain- SiaNAc-3Fax (Figures S2E and S2F). Importantly, treatment of
ing with fluorescent streptavidin (Figure 2A).
THP-1 cells with up to 1 mM sialic acid mimetics for 24 or
Incorporation of SiaNAz and SiaNPoc sialic acid analogs was 48 hr did not affect cell viability or proliferation (Figures S2G
dose dependent (Figures 2B, S2B, and S2C) and required a func- and S2H).
tional TRAP sialic transporter, because no labeling was detected
for siaP transporter mutant NTHi (DsiaP) (Figures S2D and S2E). Inhibition of NTHi LOS Sialylation Increases Serum-
To assess if passive diffusion of sialic acid analogs over the NTHi Mediated Killing
membrane was possible, we tested the incorporation of the pro- Having demonstrated that SiaNAc-3Fax potently inhibited NTHi
tected (peracetylated and methyl-ester protected) sialic acid an- LOS sialylation, we next investigated the functional conse-
€
alogs Ac5SiaNAz and Ac5SiaNPoc (Bull et al., 2015, 2017; Cheng quences on serum-mediated killing. NTHi was grown in
et al., 2016). Neither Ac5SiaNAz nor Ac5SiaNPoc were incorpo- defined media containing natural sialic acid (SiaNAc) and sub-
rated in NTHi LOS (Figures 2B and S2F), indicating that they jected to a killing assay with pooled normal human serum.
were not able to enter the bacteria via diffusion and also not With increasing sialic acid concentrations, NTHi acquired
recognized as substrates for the TRAP system. Vice versa, hu- resistance to serum-mediated killing (Figure 3A). This process
man THP-1 cells utilized only protected sialic acid analogs for required a functional sialic transporter, because SiaNAc addi-
sialoglycan synthesis, but not the non-protected sialic acid ana- tion had no effect on serum resistance of the DsiaP mutant
logs (Figure 2C).
(Figure 3B). No difference in factor H binding to NTHi strain
Having established a fast, robust, and selective assay to 86-028NP and DsiaP mutant grown with or without SiaNAc
measure NTHi LOS sialylation, we set out to selectively block was detected (Figure S3A), indicating that resistance to
this process with sialic acid-based inhibitors. Recently it has serum-mediated killing is independent of factor H, which is
been shown that protected, fluorinated sialic acid can be taken consistent with previous findings (Langereis et al., 2014; Fig-
up by passive diffusion and metabolized into CMP-SiaNAc- ueira et al., 2007). Having established that sialylation increased
3Fax, which acts as a competitive inhibitor of sialyltransferases serum resistance, we investigated whether inhibition of LOS
€
in mammalian cells (Rillahan et al., 2012; Bull et al., 2013; Bur- sialylation could mitigate this effect. Therefore, NTHi was
kart et al., 1999). We reasoned that non-protected fluorinated grown in defined media containing 1,000 mM SiaNAc as well
sialic acid could be actively taken up through the TRAP trans- as increasing concentrations of SiaNAc-3Fax (1–100 mM) and
porter system of NTHi and inhibit NTHi sialyltransferases to subjected to serum-mediated killing. Increasing concentra-
prevent LOS sialylation. Therefore, a non-protected fluorinated tions of SiaNAc-3Fax completely abolished sialic acid-medi-
sialic acid analog, SiaNAc-3Fax, was synthesized and its effect ated serum resistance of NTHi in a dose-dependent manner
on NTHi LOS sialylation was assessed (Gantt et al., 1964). NTHi (Figure 3C), with an IC50 of 1.2 mM (Figure 3D). On the other
was grown in defined media containing 100 mM SiaNAz and hand, no inhibition was observed with the protected fluori-
SiaNPoc and increasing concentrations of SiaNAc-3Fax (0.01– nated sialic acid inhibitor, Ac5SiaNAc-3Fax (Figure S3B).
2
Cell Chemical Biology 25, 1–7, September 20, 2018

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
Figure 2. Visualization and Selective Inhibition of Sialylation in NTHi
(A) Schematic presentation of labeling and inhibition of NTHi LOS sialylation with sialic acid mimetics.
(B and C) NTHi 86-028NP bacteria or THP-1 cells were grown in the presence of 100 mM SiaNAz, SiaNPoc, Ac5SiaNAz, or Ac5SiaNPoc. Bar diagrams show
incorporation of sialic acid analogs in NTHi (B) or THP-1 cells (C) as determined by CuAAC and flow cytometry (n = 4 SEM).
(D) IC50 curve of the effect of SiaNAc-3Fax on the incorporation of 100 mM SiaNAz by NTHi.
(E) NTHi 86-028NP bacteria were grown in medium with 100 mM SiaNAz and 1, 10, or 100 mM Ac5SiaNAc-3Fax. Incorporation of SiaNAz by NTHi was determined
by CuAAC followed by flow cytometric analysis (n = 4 SEM). One-way ANOVA with Tukey’s multiple comparison test was used for statistical analysis. NS, not
significant.
Cell Chemical Biology 25, 1–7, September 20, 2018
3

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
Figure 3. Inhibition of Sialylation Reduces
Serum Resistance of NTHi
(A) NTHi 86-028NP bacteria were grown in RPMI-
1640 medium with 1, 10, 100, or 1,000 mM SiaNAc,
and serum survival in 20% normal human serum
(NHS) was determined (n = 3–7 SEM).
(B) NTHi 86-028NP wild-type (WT) or DsiaP mutant
bacteria were grown in medium supplemented
with 1,000 mM SiaNAc, and serum survival was
determined (n = 7 SEM).
(C) NTHi 86-028NP bacteria were grown with
1,000 mM SiaNAc and 0.01, 0.1, 1, 10, or 100 mM
SiaNAc-3Fax. Serum survival was determined for
1 hr with 20% pooled NHS (n = 3 SEM).
(D) IC50 curve of the effect of SiaNAc-3Fax on
SiaNAc-mediated serum resistance. One-way
ANOVA with Dunnett’s multiple comparison test
was used for statistical analysis.
*p < 0.05, **p < 0.01, ***p < 0.001.
Ac5SiaNAz and Ac5SiaNPoc are incor-
porated with comparable efficiency (Fig-
ures 2B and 2C). Recently, we showed
that Poc, but not azide-modified sialic
acids, was largely resistant to cleavage
by bacterial sialidases (also known as
neuraminidases) (Heise et al., 2017).
This difference in sensitivity toward
release by sialidase could explain the
lower transfer of SiaNPoc compared
with SiaNAz.
To confirm the requirement for sialidase
activity for sialic acid transfer, sialidase
inhibitor N-acetyl-2,3-dehydro-2-deoxy-
Visualization and Inhibition of Sialic Acid Transfer from
Primary Human Bronchial Epithelial Cells to NTHi
neuraminic acid (DANA) was added 2 days prior to NTHi infec-
tion. Treatment with DANA significantly reduced transfer from
These results demonstrate that SiaNAc-3Fax effectively inhibits host cell sialic acids to NTHi (Figure 4C). Combined with the
LOS sialylation thereby decreasing resistance to serum-medi- reduced transfer of SiaNPoc, these data strongly suggest that
ated killing. However, it remains elusive how sialic acid is sialidase activity is required for the transfer of host cell sialic
released from host tissue and transferred to NTHi. Hence, acids to NTHi. So far, sialidase activity by Haemophilus influen-
we constructed a model system of the respiratory tract to zae has not been conclusively demonstrated (Apicella, 2012),
study transfer of host sialic acids to NTHi in a physiological therefore it is possible that endogenous host sialidases
setting (Figure 4A). Primary human bronchial epithelial cells contribute to the release of the sialic acid analogs from host
(PHBECs), which express mucins at the apical side, were cell glycans.
differentiated in a transwell system using basolateral medium
Next, we determined whether sialic acid transfer could be
supplemented with Ac5SiaNAz or Ac5SiaNPoc, and incorpora- inhibited with SiaNAc-3Fax. NTHi wild-type and DsiaP mutant
tion of SiaNPoc into secreted glycoproteins released on the strain were grown at the apical side of the transwell, both with
apical side of the PHBEC culture was confirmed by western and without the SiaNAc-3Fax inhibitor, for 24 hr, and subse-
blot analysis (Figure S4A). Noteworthy, only protected sialic quently the uptake and incorporation of SiaNAz sialic acid
acid analogs, but not the non-protected versions, were incor- analogs into LOS was determined. Clear incorporation of
porated into the secreted proteins (Figure S4A). Subsequently, PHBEC-derived SiaNAz sialic acid was detected for NTHi
NTHi was grown at the apical side of the transwell for 24 hr, wild-type strain, but not for the DsiaP mutant strain (Fig-
and uptake and incorporation of SiaNAz or SiaNPoc sialic ure 4D), while treatment with 1 mM SiaNAc-3Fax completely
acids into the LOS was determined using CuAAC and flow cy- inhibited SiaNAz incorporation into wild-type NTHi. Further-
tometry. Incorporation of PHBEC-derived azide sialic acids by more, wild-type NTHi grown on PHBECs showed higher
NTHi was clearly detected when Ac5SiaNAz was added to the survival in serum compared with the siaP mutant, (Fig-
PHBEC growth medium at the basolateral side (Figure 4B). ure 4E). Increased survival was also observed for DMSO-
Similar results were obtained with PHBECs grown in the and Ac5SiaNAz-treated PHBEC cultures, suggesting that
presence of Ac5SiaNPoc, albeit to a lower extent even though both normal and azide sialic acids mediate NTHi serum
4
Cell Chemical Biology 25, 1–7, September 20, 2018

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
Figure 4. Visualization and Inhibition of Sialic Acid Transfer from PHBECs to NTHi
(A) Schematic presentation of sialic acid transfer from PHBECs to NTHi in the presence of the inhibitors DANA and SiaNAc-3Fax
.
(B) PHBECs were grown with 100 mM Ac5SiaNAz or Ac5SiaNPoc in basolateral medium for 3 days. NTHi 86-028NP bacteria were grown in Dulbecco’s PBS on the
apical side for 24 hr, and SiaNAz or SiaNPoc transfer was determined by CuAAC and flow cytometry (n = 4 SEM).
(C) PHBECs were grown with 100 mM Ac5SiaNAz in basolateral medium for 3 days with sialidase inhibitor DANA at the apical and basolateral side. NTHi 86-028NP
bacteria were grown in Dulbecco’s PBS on the apical side for 24 hr, and SiaNAz transfer was determined by CuAAC followed by flow cytometric analysis
(n = 5 SEM).
(D and E) PHBECs were grown with 100 mM Ac5SiaNAz and/or 1 mM SiaNAc-3Fax for 3 days. NTHi 86-028NP WT or DsiaP mutant bacteria were grown in
Dulbecco’s PBS on the apical side for 24 hr. SiaNAz transfer was determined by CuAAC followed by flow cytometric analysis (D) and serum survival was
determined for 1 hr with 20% pooled NHS (E) (n = 4 SEM). An unpaired t test (B), one-way ANOVA with Dunnett’s multiple comparison test (C) or two-way
ANOVA with Bonferroni post-tests (D and E) was used for statistical analysis.
*p < 0.05, **p < 0.01, ***p < 0.001.
Cell Chemical Biology 25, 1–7, September 20, 2018
5

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
SUPPLEMENTAL INFORMATION
resistance after transfer. Importantly, bacterial growth was
similar in all conditions, and PHBEC viability was not signifi-
Supplemental Information includes four figures and one data file and can be
cantly affected by NTHi growth (Figures S4B and S4C). In
found with this article online at https://doi.org/10.1016/j.chembiol.2018.
accordance with our data obtained with defined culture me-
dium, addition of SiaNAc-3Fax abrogated sialic acid-mediated
05.018.
serum resistance of NTHi (Figure 4E).
In conclusion, we have shown that sialic acid mimetics are
ACKNOWLEDGMENTS
useful tools to visualize or inhibit sialic acid utilization in NTHi.
In a model for the human respiratory tract we demonstrated
that sialic acids were release by sialidases and subsequently
taken up by NTHi. Moreover, we showed that pharmacological
inhibition of NTHi LOS sialylation abolished the resistance to
serum-mediated killing. Given the crucial role of sialylation in
NTHi infections, these sialic acid mimetics might therefore
enable the development of NTHi-specific therapies.
This work was supported by a Radboud University Medical Center PhD grant
awarded to C.B. and a KWF grant (KUN2015-7604) awarded to G.J.A., T.J.B.,
and C.B., and funding from the NWO Netherlands Research School for Chem-
ical Biology (NRSCB).
AUTHOR CONTRIBUTIONS
Conceptualization, T.H., J.D.L., M.I.d.J., G.J.A., C.B., and T.J.B.; Methodol-
ogy, T.H., J.D.L., C.B., and T.J.B.; Validation, J.D.L. and C.B.; Formal Analysis
J.D.L., C.B., and T.J.B.; Investigation, T.H., J.D.L., E.R., and C.B.; Resources,
T.H., J.D.L., E.R., C.B., and T.J.B.; Writing – Original Draft, T.H., J.D.L., G.J.A.,
C.B., and T.J.B.; Writing – Review & Editing, J.D.L., C.B., and T.J.B.; Visualiza-
tion, T.H., J.D.L., C.B., and T.J.B.; Supervision, J.D.L., M.I.d.J., G.J.A., and
T.J.B.; Project Administration, J.D.L. and T.J.B.; Funding Acquisition, J.D.L.,
M.I.d.J., G.J.A., C.B., and T.J.B.
SIGNIFICANCE
The potent sialic acid-based glycotools developed herein
can be used to visualize or inhibit sialic acid utilization in
NTHi. Exploiting the fact that the sialic acid uptake mecha-
nism differs in host and NTHi makes it possible to orthogo-
nally label and inhibit host or NTHi sialylation. This is an
important feature that enables the study of sialic acid ex-
change between host and NTHi. In addition, the inhibition
of sialylation could be achieved in a selective manner
thereby reducing the potential for side effects. Given the
crucial role of sialylation in NTHi infections, these tools
might therefore enable the development of NTHi-specific
therapies. Since NTHi sialic acid utilization is phase variable,
it may be a non-invasive way to clear the opportunistic sub-
population of NTHi with minimal consequences to rest of the
host microbiome.
DECLARATION OF INTERESTS
The authors declare no competing interests.
Received: October 13, 2017
Revised: February 26, 2018
Accepted: May 25, 2018
Published: July 5, 2018
REFERENCES
Apicella, M.A. (2012). Nontypeable Haemophilus influenzae: the role of
N-acetyl-5-neuraminic acid in biology. Front. Cell. Infect. Microbiol. 2, 19.
€
Bull, C., Boltje, T.J., Wassink, M., de Graaf, A.M., van Delft, F.L., Den Brok,
M.H., and Adema, G.J. (2013). Targeting aberrant sialylation in cancer cells us-
ing a fluorinated sialic acid analog impairs adhesion, migration, and in vivo tu-
mor growth. Mol. Cancer Ther. 12, 1935–1946.
STAR+METHODS
€
Bull, C., Heise, T., Beurskens, D.M.H., Riemersma, M., Ashikov, A., Rutjes,
Detailed methods are provided in the online version of this paper
and include the following:
F.P.J.T., Van Kuppevelt, T.H., Lefeber, D.J., Den Brok, M.H., et al. (2015).
Sialic acid glycoengineering using an unnatural sialic acid for the detection
of sialoglycan biosynthesis defects and on-cell synthesis of siglec ligands.
ACS Chem. Biol. 10, 2353–2363.
d KEY RESOURCES TABLE
d CONTACT FOR REAGENT AND RESOURCE SHARING
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Bacterial Strains
€
Bull, C., Heise, T., Van Hilten, N., Pijnenborg, J.F., Bloemendal, V.R., Gerrits,
L., Kers-Rebel, E.D., Ritschel, T., Den Brok, M.H., et al. (2017). Steering si-
glec-sialic acid interactions on living cells using bioorthogonal chemistry.
Angew. Chem. Int. Ed. 56, 3309–3313.
B Cell Lines
d METHOD DETAILS
Burghout, P., Bootsma, H.J., Kloosterman, T.G., Bijlsma, J.J., de Jongh, C.E.,
Kuipers, O.P., and Hermans, P.W. (2007). Search for genes essential for pneu-
mococcal transformation: the RADA DNA repair protein plays a role in genomic
recombination of donor DNA. J. Bacteriol. 189, 6540–6550.
B Generation of DsiaP Gene Deletion Mutants
B Treatment with Sialic Acid Mimetics and NTHi Co-
Culture
Burkart, M.D., Vincent, S.P., and Wong, C.H. (1999). An efficient synthesis of
CMP-3-fluoroneuraminic acid. Chem. Commun. 1525–1526.
B CuAAC and Flow Cytometry Analysis
B Lectin Staining
Cheng, B., Xie, R., Dong, L., and Chen, X. (2016). Metabolic remodeling of
cell-surface sialic acids: principles, applications, and recent advances.
Chembiochem 17, 11–27.
B Lipooligosaccharide Isolation and SDS-PAGE
B Silver Staining
B Western Blot Analysis
Coleman, H.N., Daines, D.A., Jarisch, J., and Smith, A.L. (2003). Chemically
defined media for growth of Haemophilus influenzae strains. J. Clin.
Microbiol. 41, 4408–4410.
B Serum Survival Assays
B MTS Cell Proliferation Assay
B General Synthetic Procedures
B List of Abbreviations
Cross, A.S., Sakarya, S., Rifat, S., Held, T.K., Drysdale, B.E., Grange, P.A.,
Cassels, F.J., Wang, L.X., Stamatos, N., Farese, A., et al. (2003).
Recruitment of murine neutrophils in vivo through endogenous sialidase activ-
ity. J. Biol. Chem. 278, 4112–4120.
B Synthetic Experimental
d QUANTIFICATION AND STATISTICAL ANALYSIS
6
Cell Chemical Biology 25, 1–7, September 20, 2018

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
de Vries, S.P., Burghout, P., Langereis, J.D., Zomer, A., Hermans, P.W., and
Bootsma, H.J. (2013). Genetic requirements for Moraxella catarrhalis growth
under iron-limiting conditions. Mol. Microbiol. 87, 14–29.
Langereis, J.D., and Hermans, P.W. (2013). Novel concepts in nontypeable
Haemophilus influenzae biofilm formation. FEMS Microbiol. Lett. 346, 81–89.
Langereis, J.D., Zomer, A., Stunnenberg, H.G., Burghout, P., and Hermans,
P.W. (2013). Nontypeable Haemophilus influenzae carbonic anhydrase is
important for environmental and intracellular survival. J. Bacteriol. 195,
2737–2746.
Figueira, M.A., Ram, S., Goldstein, R., Hood, D.W., Moxon, E.R., and Pelton,
S.I. (2007). Role of complement in defense of the middle ear revealed by
restoring the virulence of nontypeable Haemophilus influenzae siaB mutants.
Infect. Immun. 75, 325–333.
Lantos, A.B., Carlevaro, G., Araoz, B., Ruiz Diaz, P., Camara Mde, L.,
Buscaglia, C.A., Bossi, M., Yu, H., Chen, X., Bertozzi, C.R., et al. (2016).
Sialic acid glycobiology unveils trypanosoma cruzi trypomastigote membrane
physiology. PLoS Pathog. 12, E1005559.
Gantt, R., Millner, S., and Binkley, S.B. (1964). Inhibition of N-acetylneuraminic
acid aldolase by 3-fluorosialic acid. Biochemistry 3, 1952–1960.
Hallstro¨ m, T., and Riesbeck, K. (2010). Haemophilus influenzae and the com-
plement system. Trends Microbiol. 18, 258–265.
Rillahan, C.D., Antonopoulos, A., Lefort, C.T., Sonon, R., Azadi, P., Ley, K.,
Dell, A., Haslam, S.M., and Paulson, J.C. (2012). Global metabolic inhibitors
of sialyl- and fucosyltransferases. Nat. Chem. Biol. 8, 661–668.
€
Heise, T., Bull, C., Beurskens, D.M., Rossing, E., de Jonge, M.I., Adema, G.J.,
Boltje, T.J., and Langereis, J.D. (2017). Metabolic oligosaccharide engineering
with alkyne sialic acids confers neuraminidase resistance and inhibits influ-
enza reproduction. Bioconjug. Chem. 28, 1811–1815.
Severi, E., Hood, D.W., and Thomas, G.H. (2007). Sialic acid utilization by bac-
terial pathogens. Microbiology 153, 2817–2822.
Sletten, E.M., and Bertozzi, C.R. (2009). Bioorthogonal chemistry: fishing for
Herriott, R.M., Meyer, E.M., and Vogt, M. (1970). Defined nongrowth media for
stage II development of competence in Haemophilus influenzae. J. Bacteriol.
101, 517–524.
selectivity in a sea of functionality. Angew. Chem. Int. Ed. 48, 6974–6998.
Suzuki, K., and Bakaletz, L.O. (1994). Synergistic effect of adenovirus type 1
and nontypeable Haemophilus influenzae in a chinchilla model of experimental
otitis media. Infect. Immun. 62, 1710–1718.
Jenkins, G.A., Figueira, M., Kumar, G.A., Sweetman, W.A., Makepeace, K.,
Pelton, S.I., Moxon, R., and Hood, D.W. (2010). Sialic acid mediated transcrip-
tional modulation of a highly conserved sialometabolism gene cluster in
Haemophilus influenzae and its effect on virulence. BMC Microbiol. 10, 48.
Tra, V.N., and Dube, D.H. (2014). Glycans in pathogenic bacteria - potential for
targeted covalent therapeutics and imaging agents. Chem. Commun. 50,
4659–4673.
Jones, P.A., Samuels, N.M., Phillips, N.J., Munson, R.S., Jr., Bozue, J.A.,
Arseneau, J.A., Nichols, W.A., Zaleski, A., Gibson, B.W., and Apicella, M.A.
(2002). Haemophilus influenzae type b strain A2 has multiple sialyltransferases
involved in lipooligosaccharide sialylation. J. Biol. Chem. 277, 14598–14611.
Van Eldere, J., Slack, M.P., Ladhani, S., and Cripps, A.W. (2014). Non-typeable
Haemophilus influenzae, an under-recognised pathogen. Lancet Infect. Dis.
14, 1281–1292.
Vimr, E.R., Kalivoda, K.A., Deszo, E.L., and Steenbergen, S.M. (2004).
Diversity of microbial sialic acid metabolism. Microbiol. Mol. Biol. Rev. 68,
132–153.
Langereis, J.D., and de Jonge, M.I. (2015). Invasive disease caused by non-
typeable Haemophilus influenzae. Emerg. Infect. Dis. 21, 1711–1718.
Langereis, J.D., de Jonge, M.I., and Weiser, J.N. (2014). Binding of human fac-
tor H to outer membrane protein P5 of non-typeable Haemophilus influenzae
contributes to complement resistance. Mol. Microbiol. 94, 89–106.
Williams, B.J., Morlin, G., Valentine, N., and Smith, A.L. (2001). Serum resis-
tance in an invasive, nontypeable Haemophilus influenzae strain. Infect.
Immun. 69, 695–705.
Cell Chemical Biology 25, 1–7, September 20, 2018
7

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE
Antibodies
SOURCE
IDENTIFIER
Sheep polyclonal anti-Factor H
Donkey polyclonal anti-mouse IgG Alexa Fluor 488
Bacterial and Virus Strains
R2866
Abcam
Cat# ab8842; RRID: AB_2291797
Jackson immunoresearch
Cat# 713-095-003; RRID: AB_2340718
(Williams et al., 2001)
This study
N/A
N/A
N/A
N/A
R2866DsiaP
86-028NP
(Suzuki and Bakaletz, 1994)
This study
86-028NPDsiaP
Biological Samples
Normal human serum
Chemicals, Peptides, and Recombinant Proteins
SiaNAz
Immucor
Cat# PHS-N100
This study
N/A
€
(Bull et al., 2015)
Ac5SiaNAz
N/A
SiaNPoc
This study
N/A
€
(Bull et al., 2015)
Ac5SiaNPoc
N/A
SiaNAc-3Fax
This study
N/A
Ac5SiaNAc-3Fax
(Rillahan et al., 2012)
Carbosynth
N/A
SiaNAc, N-Acetylneuraminic acid
N-Acetyl-2,3-dehydro-2-deoxyneuraminic acid (DANA)
Copper(II) sulfate pentahydrate
L-histidine
Cat# MA00746; CAS: 131-48-6
Cat# D9050; CAS: 24967-27-9
Cat# C8027; CAS: 758-99-8
Cat# H8000; CAS: 71-00-1
Cat# A7631; CAS:134-03-2
Cat# 764213
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Invitrogen
Sodium ascorbate
Alkyne-PEG4-biotin
Azide-PEG3-biotin
Cat# 762024
Streptavidin-PE
Cat# S866
Biotinylated MAIII
Vector Laboratories
Vector Laboratories
Thermo Scientific
Cat# B-1265
Biotinylated SNA-I
Cat# B-1305
Streptavidin-HRP
Cat# 21130
Critical Commercial Assays
CellTiter AQueous One Solution Cell Proliferation Assay (MTS)
DNeasy Blood and Tissue Kit
Experimental Models: Cell Lines
THP-1
Promega
Qiagen
Cat# G3582
Cat# 69504
ATCC
Lonza
TIB-202
PHBEC
Cat# CC-2540; lot#0000205863
Oligonucleotides
R2866_0441_L1: TCAACAGAATTGACCGCACT
This study
This study
N/A
N/A
R2866_0441_L2:
CCACTAGTTCTAGAGCGGCCGCTGCTAAACCAGCAACTA
R2866_0441_R1: CTATGGCTTGGCAGGCTTAC
This study
This study
N/A
N/A
R2866_0441_R2:
GCGTCAATTCGAGGGGTATCTTATCGCTTGTCTTGCTCCA
R2866_0441_C: GGAAAGATCCTTGACCAGCTT
PBpR412_L: GCCGCTCTAGAACTAGTGG
PBpR412_R: GATACCCCTCGAATTGACGC
PBMrTn9: CAATGGTTCAGATACGACGAC
This study
N/A
(Burghout et al., 2007)
(Burghout et al., 2007)
(de Vries et al., 2013)
N/A
N/A
N/A
(Continued on next page)
e1 Cell Chemical Biology 25, 1–7.e1–e8, September 20, 2018

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
Continued
REAGENT or RESOURCE
Software and Algorithms
FlowJo10.2
SOURCE
IDENTIFIER
Tree Star Inc.
https://www.flowjo.com/
GraphPad Prism version 5.03
GraphPad Software
https://www.graphpad.com/scientific-
software/prism/
CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact,
Thomas J. Boltje (t.boltje@ru.nl).
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Bacterial Strains
NTHi strains used in this study are listed in the Key Resources Table. Growth on plates was performed on brain heart infusion (BHI)
broth (Becton Dickinson) agar plates supplemented with 10 mg/mL hemin (Sigma-Aldrich) and 2 mg/mL b-nicotinamide adenine
dinucleotide (Merck) (sBHI) at 37ꢀC + 5 % CO2. For gene deletion mutants, sBHI plates contained 150 mg/mL of spectinomycin (Cal-
biochem). NTHi was grown shaking with 250 rpm at 37ꢀC in supplemented RPMI-1640 medium as described previously
(Coleman et al., 2003).
Cell Lines
THP-1 cells (human acute monocytic leukemia, male) were obtained from and authenticated by ATCC (TIB-202). The cells were
cultured in RRMI-1640 medium (Life Technologies) supplemented with 10 % FBS (Greiner Bio-one), 2 mM glutamine (Lonza) and
antibiotic-antimycotic solution (Life Technologies) in a humidified CO2 incubator at 37ꢀC. PHBECs (primary human bronchial epithe-
lial cells, male) obtained from (Lonza, CC-2540) were cultured in Bronchial Epithelial Cell Growth (BEGM) medium (Lonza) containing
50 mg/mL gentamycin (Sigma-Aldrich) and 50 ng/mL fungizone (Life Technologies) to 70 % confluence in a T75 tissue culture flask in a
humidified CO2 incubator at 37ꢀC.
METHOD DETAILS
Generation of DsiaP Gene Deletion Mutants
Genomic DNA was isolated from mid-log phase cultures with a DNeasy Blood and Tissue Kit (Qiagen). Directed R2866DsiaP gene
deletion mutant was generated by allelic exchange of the target gene with a spectinomycin resistance cassette, as described pre-
viously (Langereis et al., 2013). Overlap extension PCR was performed, which inserted the spectinomycin resistance cassette ampli-
fied from the pGSF8 plasmid with primers PBpR412_L and PBpR412_R between the two ꢁ1000-bp flanking sequences surrounding
the target gene R2866_0441. R2866DsiaP gene deletion mutants were obtained by transformation of the final PCR product by the
method of Herriott et al. (Herriott et al., 1970) and selected by plating on sBHI agar plates containing 150 mg/mL of spectinomycin.
Directed 86-028NPDsiaP gene deletion was generated by transformation of a PCR product obtained with primers R2866_0441_L1 +
R2866_0441_R1 covering the spectinomycin cassette and ꢁ1000-bp flanking sequences from the R2866DsiaP mutant. Gene dele-
tion mutants were validated by PCR with primer sets R2866_0441_L1 + R2866_0441_C and R2866_0441_L1 + PBMrTn9 that control
for the presence of the gene or spectinomycin cassette, respectively. Gene deletions were crossed back to the WT strain by using
chromosomal DNA of the mutant strains as donor during transformation.
Treatment with Sialic Acid Mimetics and NTHi Co-Culture
NTHi medium was supplemented with SiaNAz, SiaNPoc, SiaNAc-3Fax, Ac5SiaNAz, Ac5SiaNPoc, Ac5SiaNAc-3Fax or N-Acetylneur-
aminic acid (SiaNAc) for ꢁ8 generations before use in experiments. Viable bacterial counts were determined by plating serial dilutions
in phosphate-buffered saline (PBS) on sBHI agar plates. THP-1 cells were cultured 3 days with 100 mM of the sialic acid analogues
SiaNAz, SiaNPoc, SiaNAc-3Fax, Ac5SiaNAz, Ac5SiaNPoc, Ac5SiaNAc-3Fax or solvent control. PHBECs were seeded on 24-wells
transwells (Greiner) and grown to confluence in PHBEC:DMEM containing 50 mg/mL gentamycin (Sigma-Aldrich) and 50 ng/mL
fungizone. PHBECs were differentiated on air-liquid interface with BEGM:DMEM medium containing 50 mg/mL gentamycin
(Sigma-Aldrich) and 50 ng/mL fungizone at the basolateral side. Basolateral medium was refreshed and apical side was washed
with 200 mL Dulbecco’s PBS (Lonza) every 2-3 days for 3 weeks. One week before NTHi growth, antibiotics were omitted. PHBECs
were grown with 100 mM Ac5SiaNAz or Ac5SiaNPoc for 2-3 days. Sialidase inhibitor N-Acetyl-2,3-dehydro-2-deoxyneuraminic acid
Cell Chemical Biology 25, 1–7.e1–e8, September 20, 2018 e2

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
(DANA) was added 2 days prior to NTHi growth. 1 x 104 NTHi bacteria in 50 mL in Dulbecco’s PBS were added to the apical side of
PHBEC with or without DANA or SiaNAc-3Fax inhibitor and grown for 24 hours. After 24 hours, 200 mL Dulbecco’s PBS was added to
the apical side to collect the NTHi bacteria for CFU counts, flow cytometry or serum resistance assay. PHBEC integrity was measured
by transendothelial electrical resistance (TEER) before and after NTHi co-culture using a electrical resistance system (Millipore).
CuAAC and Flow Cytometry Analysis
To detect azide and propargyloxycarbonyl groups at the bacterial and cell surface, the cells were reacted for 20 minutes at 37ꢀC with
click buffer (1 x PBS, 250 mM CuSO4, 200 mM L-histidine, 500 mM sodium ascorbate) containing 50 mM alkyne-PEG4-biotin conjugate
or azide-PEG3-biotin conjugate, respectively, and stained with streptavidin-PE for 10 minutes at room temperature. Bacteria or cells
were resuspended in 1 x PBS containing 1 % BSA for analysis. Surface binding of factor H (fH) was performed by incubating bacteria
with heat-inactivated (20 min 56ꢀC) pooled normal human serum (NHS) in Hank’s buffered salt solution (HBSS) without phenol red
containing Ca2+/Mg2+ for 1 hour at 37ꢀC. Bacteria were fixed in 2 % paraformaldehyde, and incubated with 1:100 diluted sheep anti-
human fH in HBSS without phenol red containing Ca2+/Mg2+ + 5 % FCS for 30 min at 4ꢀC, followed by an incubation with 1:200 diluted
donkey anti-goat-Alexa488 conjugated antibodies in HBSS without phenol red containing Ca2+/Mg2+ + 5 % FCS 30 minutes at 4ꢀC.
Bacteria were washed and taken up in PBS for flow cytometry analysis. Fluorescence was assessed using a LSR II (BD Biosciences)
or CyAn ADP flow cytometer (Beckman-Coulter) followed by analysis with FlowJo software.
Lectin Staining
THP-1 cells were stained for 1 hour with biotinylated MALII (5 mg/ml) (Vector Laboratories, Inc.) or SNA-I (1 mg/ml) (Vector Labora-
tories, Inc.), recognizing a2,3-linked or a2,6-linked sialic acids sialic acids, respectively, in carbo-free blocking solution containing
1 mM CaCl2+ and 1 mM MgCl2+ at 4ꢀC. The cells were washed in 1 x PBS containing 1 % BSA and cell-bound biotinylated lectins
were conjugated for 10 minutes at 4ꢀC with 2 mg/ml streptavidin-PE and analyzed by flow cytometry. Untreated cells stained only with
streptavidin-PE were used as background control and the percentage lectin binding was calculated by normalizing the mean fluo-
rescence intensity values from the bound lectins to the respective control.
Lipooligosaccharide Isolation and SDS-PAGE
LOS was isolated as described previously (Jones et al., 2002). Bacteria were grown in sBHI to OD600 ꢁ 0.9 and washed twice with
PBS and suspended in 150 uL lysis buffer (60 mM Tris, 10 mM EDTA, 2% SDS, pH 6.8) and boiled 5-10 min. 30 mL proteinase K
(2.5 mg/mL) was added and incubated 16-24h at 37ꢀC. The LOS was precipitated with 20 mL 3M sodium acetate and 400 mL
100% EtOH and incubated 1h at -20ꢀC and centrifuged 5 minutes at 15.000g. The pellets were washed twice with 70% EtOH
and suspended in 180 mL H2O. LOS samples were separated on a Tris-Tricine SDS-PAGE gel with a Protean II xi cell electrophoresis
system (Bio-Rad) and visualized by silver staining or transferred to PVDF membrane for Western blotting.
Silver Staining
The Tris-Tricine SDS-PAGE gel was fixed for 1 h (45 % methanol, 10 % acetic acid), washed 3 times 20 min. with 50 % methanol and
incubated 1 min. in sensitizing solution (0.02 % sodium thiosulfate). The gel was washed 3 times with distilled water and incubated for
20 min. in impregnation solution (0.2 % silver nitrate, 0.075 % formaldehyde). After washing the gel twice with distilled water, it was
treated with develop solution (6 % sodium carbonate, 0.02 % sodium thiosulfate, 0.05 % formaldehyde) until the bands were clearly
visible. Developing was stopped by incubation in 0.1% acetic acid followed by 30 min. wash with distilled water.
Western Blot Analysis
Membranes were blocked with 5 % BSA in PBS for 1 hour, washed 5 times with PBS. To detect SiaNPoc, membrane was reacted for
20 minutes at 37ꢀC with click buffer (1 x PBS, 250 mM CuSO4, 500 mM sodium ascorbate) containing 50 mM azide-PEG3-biotin con-
jugate, followed by 3 washes with PBS. Biotin was stained with streptavidin-HRP for 30 minutes at room temperature, followed by 3
washes with PBS. Chemoluminescent signal was detected by ECL plus reagent (GE healthcare).
Serum Survival Assays
NTHi were washed with PBS and diluted to an OD620 of 0.1 in HBSS without phenol red containing Ca2+/Mg2+ + 0.1 % gelatin
(HBSS3+). Samples were finally diluted 10,000-fold in HBSS3+ to obtain a concentration of ꢁ20,000 CFU/mL. 50 mL of the bacteria
was mixed with 50 mL 40 % pooled NHS or heat-inactivated (HI)-NHS, diluted in HBSS3+ and incubated 30 min. or 1 h at 37ꢀC. Serial
dilutions were plated on sBHI plates and incubated overnight at 37ꢀC in 5 % CO2. Survival was determined by dividing the CFU
counts in 20 % NHS with the CFU count in 20 % HI-NHS after incubation.
MTS Cell Proliferation Assay
Five thousand human monocytic THP-1 were cultured in a 96-wells plate with sialic acid analogues SiaNAz, SiaNPoc, SiaNAc-3Fax
,
Ac5SiaNAz, Ac5SiaNPoc, Ac5SiaNAc-3Fax or solvent control in a total volume of 100 mL for 24h or 48h in a humidified CO2 incubator at
37ꢀC. After 24h or 48h, 20 mL of CellTiter 96ꢀAQueous was added to each well and incubated for 4 hours in a humidified CO2 incubator
at 37ꢀC. Absorbance was recorded at 492 nm using a and medium control was subtracted.
e3 Cell Chemical Biology 25, 1–7.e1–e8, September 20, 2018

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
General Synthetic Procedures
1H and 13C NMR spectra were recorded on a Varian Inova 400 MHz or Bruker Avance III 500 MHz spectrometer. Chemical shifts are
reported in parts per million (ppm) relative to tetramethylsilane (TMS) as the internal standard. NMR data is presented as follows:
Chemical shift, multiplicity (s = singlet, bs = broad singlet, d = doublet, t = triplet, dd = doublet of doublet, dt = doublet of
triplet, m = multiplet and/or multiple resonances), integration, coupling constant in Hertz (Hz). All NMR signals were assigned on
the basis of 1H, 13C, 19F NMR, COSY and HSQC experiments. Mass spectra were recorded on a JEOL JMS-T100CS AccuTOF
mass spectrometer. Automatic column chromatography was performed on Biotage Isolera Spektra One, using SNAP cartridges
˚
10-50g filled with normal silica (Biotage, 30-100 mm, 60 A) or water resistant iatro beads. Microwave reactions were perfomed on
a Biotage Initiator 4.1.3. TLC analysis was conducted on TLC Silicagel, 60, F254, Merck, with detection by UV absorption
(254 nm) where applicable, and by spraying with 20% sulfuric acid in methanol followed by charring at ꢁ150ꢀC or by spraying
.
with a solution of (NH4)6Mo7O24 H2O (25 gl-1) in 10% sulfuric acid in methanol followed by charring at ꢁ300ꢀC. DCM, ACN and
Tol were freshly distilled. All reactions were carried out under an argon atmosphere.
List of Abbreviations
Ac2O
= Acetic anhydride, Acet = Acetone, ACN = Acetonitrile, AzOSu = Azidoaceticacid-Hydroxysuccinimide ester,
.
BF3 Et2O = Boron trifluoride etherate, CD3OD = Deuterated methanol, CDCl3 = Deuterated chloroform, D2O = Deuterium oxide,
DMF = N,N-Dimethylformamide, DCM = Dichloromethane, EtOAc = Ethyl acetate, LiOH = Lithium hydroxide, MeOH =
Methanol, NaOH = Sodium hydroxide, PocOSu =Propargylcarboxycarbonyl hydroxysuccinimide carbonate, Pyr = Pyridine, TEA =
Triethylamine, TFA = Trifluoroacetic acid, TFAA = Trifluoroacetic acid anhydride, TMSOTf = Trimethylsilyl trifluoromethanesulfonate,
Tol = Toluene, I2 = Iodine, SAda = Adamantyl-thiol.
Synthetic Experimental
Methyl (5-acetamido-3,5-dideoxy-5-D-glycero-D-galacto)onate (1)
The Dowex H+ resin was washed with MeOH three times before adding 0.2 g resin to a solution of N-acetylneuraminic acid
(1 g; 3.24 mmol) in MeOH (20 mL; 0.16 M). After stirring at 80ꢀC for 1 h under microwave radiation, the colorless mixture was filtered.
The filtrate was concentrated in vacuo affording 1 (1.05 g; 3.24 mmol; quant.) as a white foam. TLC: (H2O:ACN, 20:80 v/v) Rf = 0.39. 1H
NMR (500 MHz, CD3OD) d 4.07 – 3.98 (m, 2H, H-4; H-6), 3.85 – 3.79 (m, 2H, H-5; H-9a), 3.78 (s, 3H, OMe), 3.70 (ddd, J = 8.8, 5.7,
2.8 Hz, 1H, H-8), 3.62 (dd, J = 11.3, 5.7 Hz, 1H, H-9b), 3.48 (dd, J = 9.2, 1.1 Hz, 1H, H-7), 2.22 (dd, J = 12.9, 4.9 Hz, 1H, H-3eq),
2.02 (s, 3H, Me, Ac), 1.89 (dd, J = 12.8, 11.5 Hz, 1H, H-3ax). 13C NMR (126 MHz, CD3OD) d 175.10 (C-1), 171.78 (CO, Ac), 96.65
(C-2), 72.06 (C-6), 71.62 (C-8), 70.16 (C-7), 67.83 (C-4), 64.82 (C-9), 54.29 (C-5), 53.71 (OMe), 40.68 (C-3), 22.68 (Me, Ac).
HR-ESI-TOF/MS (m/z): [M+Na]+ calcd. for C12H21NNaO9, 346.11140; found, 346.11286.
Methyl (5-acetamido-2,4,7,8,9-penta-O-acetyl-3,5-dideoxy-5-D-glycero-D-galacto)onate (2)
To a solution of sialic acid methyl ester 1 (20.9 g; 64.6 mmol) in Pyr (250 mL; 3.09 mol; 47.8 eq.), Ac2O (125 mL; 1.59 mol; 24.6 eq.)
was slowly added. After stirring at r.t. for 24 h, the mixture was concentrated in vacuo with Tol co-evaporation. The residue was dis-
solved in EtOAc and washed successively with HCl (0.1 M) and sat. aq. NaHCO3. The organic layer was dried over MgSO4 and
filtered. The filtrate was concentrated in vacuo affording 2 (34.5 g; 64.6 mmol; quant.) as white foam. TLC: (Acet:DCM, 40:60 v/v)
Rf = 0.51. 1H NMR (500 MHz, CDCl3, major anomer) d 5.38 – 5.37 (m, 1H, H-7), 5.26 (ddt, J = 10.1, 7.5, 4.9 Hz, 1H, H-4), 5.07
(ddd, J = 6.8, 5.1, 2.5 Hz, 1H, H-8), 4.50 (dd, J = 12.5, 2.6 Hz, 1H, H-9a), 4.15 – 4.10 (m, 3H, H-9b; H-6; H-5), 3.80 (s, 3H, OMe),
2.55 (dd, J = 13.5, 5.0 Hz, 1H, H-3eq), 2.15 (s, 3H, Me, OAc), 2.14 (s, 3H, Me, OAc), 2.10 – 2.09 (m, 1H, H-3ax), 2.07 (s, 3H, Me,
OAc), 2.05 – 2.03 (m, 6H, 2xMe, OAc), 1.90 (s, 3H, Me, NHAc). 13C NMR (126 MHz, CDCl3, major anomer) d 171.15 (CO, Ac),
170.75 (CO, Ac), 170.41 (2xCO, Ac), 170.38 (CO, Ac), 168.37 (C-1), 166.46 (CO, Ac), 97.65 (C-2), 73.00 (C-6), 71.52 (C-8), 68.44
(C-4), 67.98 (C-7), 62.27 (C-9), 53.35 (OMe), 49.49 (C-5), 36.05 (C-3), 23.33 (Me, Ac), 21.05 (Me, Ac), 20.99 (Me, Ac), 20.93 (2xMe,
Ac) 20.91 (Me, Ac). HR-ESI-TOF/MS (m/z): [M+Na]+ calcd. for C22H31NNaO14, 556.16422; found, 556.16487.
Cell Chemical Biology 25, 1–7.e1–e8, September 20, 2018 e4

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
Methyl 5-acetamido-4,7,8,9-penta-O-acetyl-2,3,5-tri-deoxy-2-thioadamantyl-D-glycero-a-galacto-non-2-
ulopyranosonate (3)
Peracetylated sialic acid 2 (5 g; 9.37 mmol) was solved in DCM (60 ml; 0.16 M) and HSAda (1.735 g; 10.31 mmol; 1.1 eq) was added.
BF3,Et2O (2.375 ml; 18.74 mmol; 2 eq) was added slowly and the reaction was stirred at room temperature for 16 h. Diluted with DCM
and ice-cold sat. aq. NaHCO3. The organic layer was separated, dried with MgSO4 and filtered. The filtrate was concentrated in va-
cuo. Silicagel flash column chromatography (0% / 25% Acet in DCM) afforded 3 (4.95 g; 9.37 mmol; 82%) as a white foam. TLC:
(Acet:DCM, 25:75 v/v) Rf = 0.46. 1H NMR (500 MHz, CDCl3, major anomer) d 5.88 (d, J = 10.2 Hz, 1H, NH), 5.43 (dd, J = 2.8, 1.4 Hz,
1H, H-7), 5.29 – 5.17 (m, 1H, H-4), 5.10 (dt, J = 8.9, 1.7 Hz, 1H, H-8), 4.96 (dd, J = 12.4, 1.8 Hz, 1H, H-9a), 4.52 (dd, J = 10.5, 2.7 Hz,
1H, H-6), 4.16 (ddd, J = 11.7, 9.0, 2.4 Hz, 1H, H-9b), 4.01 (d, J = 10.4 Hz, 1H, H-5), 3.77 (s, 3H, OMe), 2.48 (dd, J = 13.5,
4.6 Hz, 1H, H-3eq), 2.07 (s, 3H, Me, Ac), 2.03 (s, 3H, Me, Ac), 2.01 – 1.78 (m, 19H, 3xMe, Ac; H-3ax; (CH2)3CS, SAda; 3x(CH2CH),
SAda), 1.66 – 1.54 (m, 6H, 3x(CH2CH), SAda). 13C NMR (126 MHz, CDCl3, major anomer) d 171.33 (CO, Ac), 170.74 (CO, Ac),
170.29 (CO, Ac), 170.26 (CO, Ac), 170.09 (CO, Ac), 169.80 (C-1), 86.04 (C-2), 74.00 (C-8), 72.57 (C-6), 69.20 (C-7), 68.91 (C-4),
63.24 (C-9), 52.69 (OMe), 50.36 ((CH2)3CS, SAda), 49.31 (C-5), 43.38 ((CH2)3CH, SAda), 39.84 (C-3), 35.84 (3x(CH2CH), SAda),
29.64 (3x(CH2CH), SAda), 22.99 (Me, Ac), 20.98 (Me, Ac), 20.75 (Me, Ac), 20.62 (Me, Ac), 20.52 (Me, Ac). HR-ESI-TOF/MS
(m/z): [M+Na]+ calcd. for C30H43NNaO12S, 664.24036; found, 664.23780.
Methyl 5-trifluoroacetamido-4,7,8,9-penta-O-acetyl-2,3,5-tri-deoxy-2-thioadamantyl-D-glycero-a-galacto-non-2-
ulopyranosonate (4)
Thioadamantyl sialic acid 3 (100 mg; 0.156 mmol) was solved in ACN (4 ml; 0.04 M) and TFAA (88 mL; 0.623 mmol; 4 eq.) was added.
The reaction vessel was sealed and stirred at 135ꢀC and 6 bar for 10 min under microwave radiation. After cooling to room temper-
ature, the reaction was quenched by an excess of TEA and MeOH, diluted in EtOAc and washed three times with sat. aq. NaHCO3.
The organic layer was separated, dried with MgSO4 and filtered. The filtrate was concentrated in vacuo. Silicagel flash column chro-
matography (0% / 10% Acet in DCM) afforded 4 (80 mg; 0.12 mmol; 74%) as a white foam. TLC: (Acet:DCM, 10:90 v/v) Rf = 0.75. 1H
NMR (500 MHz, CDCl3, major anomer) d 5.48 (t, J = 2.1 Hz, 1H, H-7), 5.43 (ddd, J = 11.8, 10.4, 4.7 Hz, 1H, H-4), 5.18 (dt, J = 8.7,
1.9 Hz, 1H, H-8), 4.98 (dd, J = 12.3, 1.8 Hz, 1H, H-9a), 4.75 (dd, J = 10.4, 2.7 Hz, 1H, H-6), 4.25 (dd, J = 12.4, 8.7 Hz, 1H, H-9b),
4.08 (q, J = 10.1 Hz, 1H, H-5), 3.84 (s, 3H, OMe), 2.59 (dd, J = 13.6, 4.7 Hz, 1H, H-3eq), 2.14 (s, 3H, Me, OAc), 2.10 (s, 3H, Me,
OAc), 2.04 – 1.83 (m, 16H, 2xMe, OAc; H-3ax; (CH2)3CS Sada; 3x(CH2CH), SAda), 1.71 – 1.62 (m, 6H, 3x(CH2CH), SAda). 13C
NMR (126 MHz, CDCl3, major anomer) d 171.39 (CO, Ac), 170.84 (CO, Ac), 170.37 (CO, Ac), 169.80 (CO, Ac), 169.67 (C-1),
157.72 (q, J = 37.8 Hz, COCF3), 115.47 (q, J = 288.3 Hz, COCF3), 86.03 (C-2), 73.61 (C-8), 71.56 (C-6), 69.11 (C-7), 68.43 (C-4),
63.15 (C-9), 52.81 (OMe), 50.61 ((CH2)3CH, SAda), 50.34 (C-5), 43.38 ((CH2)3CS, SAda), 39.86 (C-3), 35.84 (3x(CH2CH), SAda),
29.75 (3x(CH2CH), SAda), 21.04 (Me, Ac), 20.59 (Me, Ac), 20.56 (Me, Ac), 20.53 (Me, Ac). HR-ESI-TOF/MS (m/z): [M+Na]+ calcd.
for C30H40F3NNaO12S, 718.21210; found, 718.21045.
5-amido-2,3,5-tri-deoxy-2-thioadamantyl-D-glycero-a-galacto-non-2-ulopyranosonate (5)
TFA protected sialic acid 4 (1g; 1.437 mmol) was solved in MeOH (10 ml; 0.144 M) and LiOH (482 mg; 20.12 mmol; 14 eq.) and H2O
(5 ml) were added. The reaction vessel was sealed and stirred at 120ꢀC and 2 bar for 30 min under microwave radiation. The reaction
was filtered and silica was added to the filtrate. After concentration in vacuo, the crude product on silica was loaded on water-resis-
tant iatro-beads crosslinked-silicagel flash column chromatography (0% / 20% H2O (+1% TFA) in ACN) afforded 5 (591 mg;
1.1416 mmol; 98%) as a white foam. TLC: (H2O:ACN, 20:80 v/v) Rf = 0.19. 1H NMR (500 MHz, D2O, major anomer) d 4.17
(dd, J = 10.0, 1.0 Hz, 1H, H-5), 3.93 – 3.81 (m, 5H, H-7; H-8; H-5; H-9a; H-4), 3.80 – 3.72 (m, 1H, H-9b), 2.68 (t, J = 9.8 Hz,
1H, H-6), 2.42 (dd, J = 13.5, 4.6 Hz, 1H, H-3eq), 2.03 – 1.95 (m, 9H, (CH2)3CS, SAda; 3x(CH2CH), SAda), 1.74 – 1.60
e5 Cell Chemical Biology 25, 1–7.e1–e8, September 20, 2018

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
(m, 7H, H-3ax; 3x(CH2CH), SAda). 13C NMR (126 MHz, D2O, major anomer) d 177.24 (C-1), 88.40 (C-2), 73.36 (C-5), 70.14 (C-7), 69.58
(C-8), 68.94 (C-4), 63.32 (C-9), 53.44 (C-6), 49.44 ((CH2)3CS, SAda), 43.63 (C-3), 43.32 ((CH2)3CS, SAda), 35.66 (3xCH2CH, SAda),
29.68 (3xCH2CH, SAda). HR-ESI-TOF/MS (m/z): [M+H]+ calcd. for C19H32NO7S, 418.18995; found, 418.19152.
5-propargyloxycarbamado-2,3,5-tri-deoxy-2-thioadamantyl-D-glycero-a-galacto-non-2-ulopyranosonate (6)
Sialic acid amine 5 (50 mg; 0.12 mmol) was solved in H2O (0.5 ml). PocOSu (28 mg; 0.144 mmol; 1.2 eq) was solved in ACN (1 ml)
and added to the sialic acid solution. The reaction was stirred at r.t. for 16 h, diluted with an excess of MeOH and concentrated on
silica. The product was purified on water-resistant iatro-beads crosslinked-silicagel flash column chromatography (0% / 20% H2O
(+1% TFA) in ACN) affording 7 (50 mg; 0.12 mmol; 84%) as a white foam. TLC: (H2O:ACN, 25:75 v/v) Rf = 0.57. 1H NMR (500 MHz,
D2O, major anomer) d 4.71 (dd, J = 4.8, 2.4 Hz, 2H, CH2, Poc), 4.30 (d, J = 10.5 Hz, 1H, H-6), 4.04 (ddd, J = 11.9, 10.0, 4.8 Hz, 1H, H-4),
3.91 – 3.83 (m, 2H, H-8; H-9a), 3.73 (dd, J = 11.8, 5.1 Hz, 1H, H-9b), 3.61 (d, J = 9.2 Hz, 1H, H-7), 3.55 (t, J = 10.3 Hz, 1H, H-5), 2.92
(t, J = 2.4 Hz, 1H, ChCH, Poc), 2.50 (dd, J = 13.5, 4.9 Hz, 1H, H-3ax), 2.04 – 1.95 (m, 9H, (CH2)3CS, SAda; 3xCH2CH, SAda), 1.74
(dd, J = 13.6, 12.0 Hz, 1H, H-3ax), 1.68 (d, J = 2.9 Hz, 6H, 3xCH2CH, SAda). 13C NMR (126 MHz, D2O) d 176.82 (C-1), 157.52
(CO, Poc), 88.10 (ChCH, Poc), 78.52 (C-2), 75.67 (ChCH, Poc), 70.99 (C-6), 69.87 (C-8), 68.93 (C-7), 67.39 (C-4), 63.28 (C-9),
54.31 (C-5), 52.88 (CH2, Poc), 49.46 ((CH2)3CS, SAda), 43.56 (C-3), 43.20 ((CH2)3CH, SAda), 35.59 (3xCH2CH, SAda), 29.64
(3xCH2CH, SAda). HR-ESI-TOF/MS (m/z): [M+Na]+ calcd. for C23H33NNaO9S, 522.17737; found, 522.17847.
5-azidoacetamido-2,3,5-tri-deoxy-2-thioadamantyl-D-glycero-a-galacto-non-2-ulopyranosonate (7)
Sialic acid amine 5 (50 mg; 0.12 mmol) was solved in H2O (0.5 ml). AzOSu (31 mg; 0.156 mmol; 1.3 eq) was solved in ACN (1 ml) and
added to the sialic acid solution. The reaction was stirred at r.t. for 16 h, diluted with an excess of MeOH and concentrated on silica.
The product was purified on water-resistant iatro-beads crosslinked-silicagel flash column chromatography (0% / 20% water (+1%
TFA) in ACN) affording 7 (45 mg; 0.09 mmol; 75%) as a white foam. Note: Surprisingly, the conversion was not complete - 5 mg amine
starting material was retrieved. TLC: (H2O:ACN, 25:75 v/v) Rf = 0.50. 1H NMR (500 MHz, D2O, major anomer) d 4.39 (d, J = 10.6 Hz,
1H, H-6), 4.17 (ddd, J = 11.8, 10.0, 4.7 Hz, 1H, H-4), 4.11 (s, 2H, CH2, Az), 3.93 (t, J = 10.2 Hz, 1H, H-5), 3.89 – 3.81 (m, 2H, H-8; H-9a),
3.72 (dd, J = 12.1, 5.2 Hz, 1H, H-9b), 3.54 (d, J = 9.4 Hz, 1H, H-7), 2.52 (dd, J = 13.6, 4.7 Hz, 1H, H-3eq), 2.06-1.98 (m, 9H, (CH2)3CS,
SAda; 3xCH2CH, SAda), 1.91 (dd, J = 13.6, 11.8 Hz, 1H, H-3ax), 1.68 (d, J = 2.9 Hz, 6H, 3xCH2CH, SAda). 13C NMR (126 MHz, D2O,
major anomer) d 176.47 (C-1), 175.04 (CO, Az), 86.50 (C-2), 70.78 (C-6), 69.67 (C-8), 68.65 (C-7), 66.56 (C-4), 63.09 (C-9), 52.52 (C-5),
51.93 (CH2, Az), 50.44 ((CH2)3CS, SAda), 43.10 ((CH2)3CS, SAda), 42.53 (C-3), 35.46 (3xCH2CH, SAda), 29.65 (3xCH2CH, SAda).
HRMS (m/z): [M+Na]+ calcd for C21H32N4NaO8S, 523.18385; found, 523.18332.
5-propargyloxycarbamado-3,5-dideoxy-D-glycero-a-galacto-non-2-ulopyranosonate (8)
Sialic acid 6 (55 mg; 0.11 mmol) was solved in H2O (1 ml; 0.11 M) and I2 (31 mg; 0.121 mmol; 1.1 eq.) was added. The reaction was
stirred vigourisly for 30 min and diluted with an excess of EtOAc. The reaction was left stirring for 1 min and then washed with water.
The water layer was lyophilized to yield compound 8 (33 mg; 0.110 mmol; 86%) as a white foam. TLC: (H2O:ACN, 20:80 v/v) Rf = 0.11.
1H NMR (500 MHz, D2O, major anomer) d 4.63 (dd, J = 4.1, 2.4 Hz, 2H, CH2, Poc), 3.98 – 3.88 (m, 2H, H-6; H-4), 3.78 (dd, J = 11.9,
2.7 Hz, 1H, H-9a), 3.69 (ddd, J = 9.2, 6.6, 2.7 Hz, 1H, H-8), 3.58 (t, J = 10.2 Hz, 1H, H-5), 3.56 – 3.51 (m, 2H, H-7; H-9b), 2.84
(t, J = 2.4 Hz, 1H, ChCH, Poc), 2.13 (dd, J = 12.9, 4.9 Hz, 1H, H-3eq), 1.75 (t, J = 12.3 Hz, 1H, H-3ax). 13C NMR (126 MHz, D2O, major
anomer) d 176.71 (C-1), 157.47 (CO, Poc), 92.41 (C-2), 78.52 (ChCH, Poc), 75.66 (ChCH, Poc), 70.46 (C-8), 70.27 (C-6) , 68.50 (C-7),
67.37 (C-4), 63.31 (C-9), 53.79 (C-5), 52.87 (CH2, Poc), 39.35 (C-3). HRMS (m/z): [M+Na]+ calcd for C13H19NO10, 372.09066; found,
372.09041.
Cell Chemical Biology 25, 1–7.e1–e8, September 20, 2018 e6

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
5-azidoacetamido-3,5-dideoxy-D-glycero-a-galacto-non-2-ulopyranosonate (9)
Sialic acid 7 (6 mg; 0.012 mmol) was solved in H2O (1 ml; 0.012 M) and I2 (9 mg; 0.036 mmol; 3 eq.) was added. The reaction was
stirred vigourisly for 10 min and diluted with an excess of EtOAc. The reaction was left stirring for 1 min and then washed with water.
The water layer was lyophilized to yield compound 9 (4 mg; 0.011 mmol; 95%) as a white foam. TLC: (H2O:ACN, 20:80 v/v) Rf = 0.09.
1H NMR (500 MHz, D2O, major anomer) d 4.20 – 4.11 (m, 2H, H-4; H-6), 4.11 (s, 2H, CH2, Az), 4.03 (d, J = 10.3 Hz, 1H, H-5), 3.85
(dd, J = 12.1, 2.7 Hz, 1H, H-9a), 3.81 – 3.73 (m, 1H, H-8), 3.63 (dd, J = 11.9, 6.4 Hz, 1H, H-9b), 3.57 (d, J = 9.1 Hz, 1H, H-7), 2.32
(dd, J = 13.0, 5.0 Hz, 1H, H-3eq), 1.90 (t, J = 12.2 Hz, 1H, H-3ax). 13C NMR (126 MHz, D2O, major anomer) d 176.47 (C-1), 173.82
(CO, Az), 95.52 (C-2 hardly visible) 70.20 (C-8), 68.20 (C-6), 52.17 (C-5), 51.92 (CH2, Az), 38.93 (C-3). HRMS (m/z): [M+Na]+ calcd
for C11H18N4NaO9, 373.09715; found, 373.09913.
Methyl (5-acetamido-4,7,8,9-tetra-O-acetyl-3-dehydro-2,3,5-trideoxy-5-b-D-glycero-D-galacto)onate (10)
Peracetylated sialic acid 2 (1.02 g, 1.912 mmol) was dissolved in ACN (4 ml; 0.478 M) and cooled to 0ꢀC. TMSOTf (1.03 ml;
5.736 mmol; 3 eq.) was added dropwise to the solution which turned slightly yellow. After 4 hours, the reaction was diluted with
an excess EtOAc and washed three times with sat. aqueous NaHCO3 (30 mL). The organic layer was concentrated in vacuo and
the product was purified on silicagel flash column chromatography (0 / 30% Acet in DCM), and a white solid was obtained
(0.552 g, 1.166 mmol, 61% yield as a white foam). TLC: (Acet:DCM, 30:70 v/v) Rf = 0.50. 1H NMR (400 MHz, CDCl3) d 6.05
(d, J = 8.9 Hz, 1H, NH), 5.99 (d, J = 3.1 Hz, 1H, H-3), 5.54 – 5.48 (m, 2H, H4; H7), 5.35 (ddd, J = 7.5, 4.4, 3.1 Hz, 1H, H-8), 4.65
(dd, J = 12.3, 3.1 Hz, 1H, H-9a), 4.40 (dd, J = 7.8, 5.1 Hz, 2H, H-6; H-5), 4.20 (dd, J = 12.3, 7.3 Hz, 1H, H-9b), 3.81 (s, 3H, OMe),
2.13 (s, 3H, Me, Ac), 2.08 (s, 3H, Me, Ac), 2.07 (s, 3H, Me, Ac), 2.06 (s, 3H, Me, Ac), 1.93 (s, 3H, Me, Ac). 13C NMR
(101 MHz, CDCl3) d 170.82 (CO, Ac), 170.61 (CO, Ac), 170.19 (CO, Ac), 170.17 (CO, Ac), 161.63 (C-1), 145.06 (C-2), 107.98 (C-3),
76.64 (C-6), 70.85 (C-8), 68.03 (C-7), 67.64 (C-4), 61.97 (C-9), 52.57 (OMe), 46.46 (C-5), 23.09 (Me, Ac), 20.85 (Me, Ac), 20.76
(Me, Ac), 20.72 (Me, Ac), 20.70 (Me, Ac). HRMS (m/z): [M+Na]+ calcd for C20H27NO12, 496.1431; found, 496.1430.
Methyl (5-acetamido-4,7,8,9-tetra-O-acetyl-3-dehydro-3,5-dideoxy-3-fluoro-5-b-D-glycero-D-galacto)onate (11)
Sialic acid glycal 10 (1.5 g, 3.17 mmol) was solved in DMF (23.8 ml) and H2O (7.9 ml; 0.1 M). Selectfluor (3.37 g, 9.51 mmol; 3 eq.)
was added and the reaction was heated to 60ꢀC for 16 hours, then concentrated in vacuo. The compound was redissolved in EtOAc
washed with sat. aqueous NaHCO3, dried with MgSO4, filtered, concentrated in vacuo. TLC: (Acet:DCM, 30:70 v/v) Rf = 0.40. HRMS
(m/z): [M+Na]+ calcd for C20H28FNO13, 532.1443; found, 532.1442. The crude fluorinated alcohol was dissolved in PYR (14.5 ml)
and Ac2O (7.3 ml), stirred for 16 hours at r.t. and was evaporated in vacuo. The resulting solid dissolved in EtOAc and sat. aqueous
NaHCO3. The organic phase was separated and the solvent evaporated in vacuo and purified on silica flash-column chromatography
(0 / 30% Acet in DCM) affording 11 (1.46 g, 2.54 mmol, 80% yield over two steps) as a slightly yellow foam. TLC: (Acet:DCM,
30:70 v/v) Rf = 0.55. 1H-NMR (500 MHz, CD3OD, major anomer) d 5.58 (d, J = 8.9 Hz, 1H, NH), 5.46 (dd, J = 27.9, 10.7 Hz,
1H, H-4), 5.29 (dd, J = 5.0, 1.8 Hz, 1H, H-7), 5.05 (ddd, J = 6.7, 5.2, 2.5 Hz, 1H, H-8), 4.87 (dd, J = 49.1, 2.5 Hz, 1H, H-3), 4.51
(dd, J = 12.5, 2.5 Hz, 1H, H-9a), 4.21 – 4.10 (m, 3H, H-9b; H-5; H-6), 3.77 (s, 3H, OMe), 2.12 – 2.09 (m, 6H, 2xMe, OAc), 2.04 (s,
3H, Me, OAc), 1.98 (s, 3H, Me, OAc), 1.97 (s, 3H, Me, OAc), 1.85 (s, 3H, Me, NHAc).; 13C-NMR (126 MHz, CD3OD) d 170.58
(CO, Ac), 170.56 (CO, Ac), 170.50 (CO, Ac), 170.34 (CO, Ac), 167.11 (C-1), 95.16 (d, J = 28.8 Hz, C-2), 86.95 (d, J =
185.3 Hz, C-3), 71.91 (C-6), 71.37 (C-8), 68.40 (d, J = 17.2 Hz, C-4), 67.93 (C-7), 62.09 (C-9), 53.49 (OMe), 45.53 (C-5), 29.27
(Me, Ac), 20.88 (Me, Ac), 20.79 (Me, Ac) , 20.74 (Me, Ac), 20.65 (Me, Ac), 20.51 (Me, Ac); HRMS (m/z): [M+Na]+ calcd
for C22H30FNO14, 574.1548; found, 574.1548.
e7 Cell Chemical Biology 25, 1–7.e1–e8, September 20, 2018

Please cite this article in press as: Heise et al., Selective Inhibition of Sialic Acid-Based Molecular Mimicry in Haemophilus influenzae Abrogates Serum
Resistance, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.05.018
(5-acetamido-3-dehydro-3,5-dideoxy-3-fluoro-5-b-D-glycero-D-galacto)onate (12)
Fluorinated sialic acid 11 (150 mg; 0.294 mmol) was solved in a 1 molar solution of NaOH (0.8 g; 0,02 mol) in MeOH (19 ml) and H2O
(1 ml) and stirred at r.t. for 16 h. Silica powder was added to the solution before concentrating in vacuo and purification on water-
resistant iatro-beads crosslinked-silicagel flash column chromatography (0% / 20% H2O (+1% TFA) in ACN) to afford 12
(52 mg; 0.15 mmol; 51%) as a white foam. TLC: (H2O:ACN, 25:75 v/v) Rf = 0.27. 1H NMR (500 MHz, D2O, major anomer) d 4.78
(dd, J = 49.3, 2.5 Hz, 1H, H-3), 4.17 (t, J = 10.6 Hz, 1H, H-5), 4.04 (ddd, J = 30.0, 10.8, 2.5 Hz, 1H, H-4), 3.97 (d, J = 10.6 Hz,
1H, H-6), 3.86 – 3.75 (m, 3H, H-8; H-9a), 3.57 (dd, J = 12.5, 7.0 Hz, 1H, H-9b), 3.47 (dd, J = 8.8, 1.1 Hz, 1H, H-7), 1.98 (s,
3H, Me, NHAc). 13C NMR (126 MHz, D2O,) d 174.89 (CO, NHAc), 171.43 (C-1), 94.49 (d, J = 26.5 Hz, C-2), 89.59 (d, J =
177.4 Hz, C-3), 70.35 (C-8), 70.10 (C-6), 68.11 (C-7), 67.69 (d, J = 18.3 Hz, C-4)., 63.10 (C-9), 47.26 (C-5), 22.03 (Me, NHAc). 19F
NMR (470 MHz, D2O) d -208.11 (dd, J = 49.3, 30.0 Hz, major anomer), -217.73 (dd, J = 51.3, 30.0 Hz, minor anomer). HRMS
(m/z): [M+Na]+ calcd for C11H18FNNaO9, 350.08633; found, 350.08670.
QUANTIFICATION AND STATISTICAL ANALYSIS
Data are presented as mean values standard error of the mean (SEM). Statistical analyses were performed with GraphPad Prism
version 5.03 for Windows (GraphPad Software, Inc.). A student T-test was used to compare two variables tested in a single condition.
A One-way ANOVA with Tukey’s Multiple Comparison Test was used to compare more than two variables with each other. An one-
way ANOVA with Dunnett’s Multiple Comparison Test was used to compare more than two variables with a control condition. A Two-
way ANOVA with Bonferroni was used to compare two variables under multiple conditions. Differences were considered significant at
P < 0.05. NS, not significant, * = p<0.05, ** = p<0.01, *** = p<0.001.
Cell Chemical Biology 25, 1–7.e1–e8, September 20, 2018 e8