Modification in the side chain of solomonsterol A: Discovery of cholestan disulfate as a potent pregnane-X-receptor agonist

Article abstract of DOI:10.1039/c2ob25800e

Seven synthetic analogues of the PXR (pregnane-X-receptor) potent natural agonist solomonsterol A were prepared by total synthesis. Their activity toward PXR was assessed by transactivation and RT-PCR assays. The study discloses cholestan disulfate (8) as a new, simplified agonist of PXR. By in vitro studies on hepatic cells we have demonstrated that this compound is a potent PXR agonist and functional characterization in human macrophages and hepatic stellate cells provided evidence that cholestan disulfate (8) has the ability to modulate the immune response triggered by bacterial endotoxin as well as to counter-activate hepatic stellate cell activation induced by thrombin. Because inhibition of immune-driven circuits might have relevance in the treatment of inflammation and liver fibrosis, the present data support the development of cholestan disulfate (8) in preclinical models of inflammatory diseases. The Royal Society of Chemistry 2012.

Full text of DOI:10.1039/c2ob25800e

View Article Online / Journal Homepage / Table of Contents for this issue
Dynamic Article Links
Organic &
Biomolecular
Chemistry
Cite this: Org. Biomol. Chem., 2012, 10, 6350
www.rsc.org/obc
PAPER
Modification in the side chain of solomonsterol A: discovery of cholestan
disulfate as a potent pregnane-X-receptor agonist†
Valentina Sepe,a Raffaella Ummarino,a Maria Valeria D’Auria,a Gianluigi Lauro,b Giuseppe Bifulco,b
Claudio D’Amore,c Barbara Renga,c Stefano Fiorucci‡c and Angela Zampella‡*a
Received 26th April 2012, Accepted 1st June 2012
DOI: 10.1039/c2ob25800e
Seven synthetic analogues of the PXR (pregnane-X-receptor) potent natural agonist solomonsterol Awere
prepared by total synthesis. Their activity toward PXR was assessed by transactivation and RT-PCR
assays. The study discloses cholestan disulfate (8) as a new, simplified agonist of PXR. By in vitro studies
on hepatic cells we have demonstrated that this compound is a potent PXR agonist and functional
characterization in human macrophages and hepatic stellate cells provided evidence that cholestan
disulfate (8) has the ability to modulate the immune response triggered by bacterial endotoxin as well as
to counter-activate hepatic stellate cell activation induced by thrombin. Because inhibition of immune-
driven circuits might have relevance in the treatment of inflammation and liver fibrosis, the present data
support the development of cholestan disulfate (8) in preclinical models of inflammatory diseases.
Moreover rifaximin, a human PXR activator, is in clinical trials
Introduction
for treatment of IBD and has demonstrated efficacy in Crohn’s
disease and active ulcerative colitis.8,9 It is speculated that by
PXR (pregnane-X-receptor) is a master gene regulating the
activity of a variety of genes involved in xeno- and endo-biotic
metabolism in the liver and gastrointestinal tract,1–4 thus prevent-
ing toxic accumulation of metabolites within cells.
activating PXR, rifaximin could contribute to the maintenance of
the intestinal barrier integrity by regulating the metabolism of
xenobiotics and increasing the expression and activity of PXR
and PXR-regulated genes.10
Therefore PXR represents an important pharmacological
target, and the discovery of potent and selective PXR agonists
holds potential in the identification of new drugs for the treat-
ment of human disorders characterized by dysregulation of
innate immunity.
Once activated, PXR heterodimerizes with the retinoid-X-
receptor (RXR), and binds to regulatory DNA sequences in the
promoter of responsive genes modulating their transcription. In
addition, PXR is recognized as an important regulatory factor for
modulation of important effector functions in the immune
system through inhibition of pro-inflammatory transcription
factor NF-κB in epithelial and immune cells.5,6 A role for PXR
in the pathogenesis of inflammatory bowel disease (IBD)
is increasingly supported by genetic and pharmacological
evidences. Thus, gene expression analysis of colon tissues from
patients with ulcerative colitis and Crohn’s disease has revealed
a significant reduction in the expression/function of PXR
and its target genes compared with normal intestinal samples.7
Results and discussion
Recently our research group reported the biochemical decodifica-
tion of several steroids of marine origin as ligands of two
nuclear receptors, FXR and PXR.11–17 Among these, two sul-
fated steroids, solomonsterols A (1) and B isolated from the
sponge Theonella swinhoei,18 were proved to be potent inducers
of PXR transactivation in human hepatocyte cell line (HepG2
cells) stimulating the expression of CYP3A4 and MDR1 (cyto-
chrome P450 3A4 and multidrug resistance 1), two well charac-
terized PXR responsive genes in the same cell line.19 In
addition, through a deep pharmacological investigation on trans-
genic mice expressing the human PXR, we have demonstrated
that solomonsterol A (1) effectively protects against the develop-
ment of clinical signs and symptoms of colitis, reduces the gen-
eration of TNFα and enhances the expression of TGFβ and
IL-10, two potent counter-regulatory cytokines in IBD, via inhi-
bition of NF-κB activation in a PXR dependent mechanism.20
aDipartimento di Chimica delle Sostanze Naturali, Università di Napoli
“Federico II”, via D. Montesano 49, 80131 Napoli, Italy.
E-mail: angela.zampella@unina.it; Fax: (+0039) 081-678552;
Tel: (+0039) 081-678525
bDipartimento di Scienze Farmaceutiche e Biomediche, Università di
Salerno, via Ponte don Melillo, 84084 Fisciano (SA), Italy
cDipartimento di Medicina Clinica e Sperimentale, Università di
Perugia, Nuova Facoltà di Medicina e Chirurgia, Via Gerardo Dottori
1, S, Andrea delle Fratte 06132 Perugia, Italy
†Electronic supplementary information (ESI) available: 1D NMR
spectra for compounds 2–10 and HPLC traces. See DOI:
10.1039/c2ob25800e
‡Contributed equally to this work.
6350 | Org. Biomol. Chem., 2012, 10, 6350–6362
This journal is © The Royal Society of Chemistry 2012

View Article Online
All these data pointed towards the identification of solomon-
sterol A (1) as a new lead in the treatment of IBD. One of the
possible limitations for its use in clinical settings is that, when
administered per os, solomonsterol A (1) could undergo absorp-
tion from the GIT before reaching the colon, causing severe
systemic side effects resulting from the activation of PXR in the
liver.
solomonsterol A (1) to 5-ASA (5-aminosalicylic acid), one of
the oldest anti-inflammatory agents in use for the treatment of
IBD, could produce a dual-drug with enhanced potency. Upon
enzymatic hydrolysis in the colon, this kind of molecule could
release solomonsterol A and 5-ASA, potent agonists of PXR and
PPARγ,21 respectively, two nuclear receptors playing a key role
in colon inflammation diseases.
One of the best approaches used for colon specific drug deliv-
ery is based on the formation of a prodrug through chemical
modification of the drug structure, usually by conjugation with a
suitable carrier, such as amino acids, sugars, glucuronic acid,
dextrans or polysaccharides.
Since a luxuriant microflora is present in the colon, the
prodrug undergoes enzymatic biotransformation in the colon
thus releasing the active drug molecule.
When synthesizing prodrugs, the first step is the introduction
of a functional group on the drug molecule suitable for conju-
gation with a selected carrier (e.g., an hydroxyl group that could
enter into a glycoside linkage with various sugars, or alterna-
tively a carboxyl group to form ester and/or amide conjugates
with cyclodextrins, amino acids etc.).
Inspection of the chemical structure of solomonsterol A (1)
revealed that the presence of three sulfate groups hampered any
further derivatization and/or conjugation. In order to introduce a
functional group suitable for further derivatization, we decided
to prepare several solomonsterol A (1) derivatives with a
Another challenging task is the design of a dual-drug able to
release in the colon two molecules acting in a synergic manner.
For example the possible eventual chemical linkage of
Fig. 1 Solomonsterol A derivatives.
This journal is © The Royal Society of Chemistry 2012
Org. Biomol. Chem., 2012, 10, 6350–6362 | 6351

View Article Online
modified side chain but preserving the steroidal tetracyclic
nucleus (compounds 2–8 in Fig. 1). Moreover we had also the
opportunity to speculate on the pharmacophoric role played by
ring A by preparing derivatives 9–10 with a sulfate group at C-3
in α and β orientation, respectively.
The small library of derivatives obtained (Fig. 1) was sub-
jected to pharmacological evaluation and docking analysis. This
study led to the discovery of a synthetic solomonsterol A
analogue, 2β,3α-cholestan disulfate (8), as a simplified new
potent PXR agonist.
and 5-ASA. Using a versatile coupling agent, DMT-MM [4-(4,6-
dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride],22
the amidation reaction proceeded nearly quantitatively, requiring
the activation of the carboxylate sodium salt by DMT-MM and
triethylamine in DMF at room temperature, and subsequent con-
densation of the resulting acyloxytriazine with glycine ethyl
ester hydrochloride, taurine or 5-ASA afforded the amide deriva-
tives 12, 5 and 6 respectively, as ammonium sulfate salts. Alka-
line hydrolysis of ethylester 12 with NaOH 5% in MeOH–H2O
1 : 1 afforded the sodium carboxylate 4.
Amide derivatives with taurine and 5-ASA were transformed
via ion exchange (Amberlite CG-120, sodium form, MeOH) into
the desired target trisodium salts 5 and 6 in good yields.
Chemistry and biological evaluation
Our synthetic route started from the advanced intermediate 1120
that was sulfated with 10 equivalents of triethylammonium–
sulfur trioxide complex and transformed into the sodium sulfate
salt 2 through Amberlite treatment. The crude product was sub-
sequently hydrolyzed with methanolic NaOH (5%) to remove
the protecting group at the C-24, affording the desired carboxylic
acid functional group. The reaction mixture was adjusted to pH 5
with HCl 1N, and loaded onto a C18 cartridge for reversed-
phase solid extraction (Scheme 1).
Elution with 30% aqueous methanol gave the carboxylic acid
3 as a 2,3,24-trisodium salt in satisfactory yield (85% over two
steps).
With the carboxylate (3) in our hands, we decided to carry on
with the reaction of amidation with glycine ethyl ester, taurine
To investigate whether compounds 3–6 act on PXR and even-
tually PXR regulated genes, we carried out a luciferase reporter
assay on human hepatocyte cell line (HepG2 cells) transiently
transfected with pSG5-PXR, pSG5-RXR, pCMV-βgalactosidase,
and p(CYP3A4)-TK-Luc vectors (Fig. 2). Cells were then stimu-
lated with rifaximin, a well known PXR agonist, and with com-
pounds 3–6 at a concentration of 10 μM each. As shown in
Fig. 2A, despite the close structural resemblance with solomon-
sterol A (1), only carboxylate (3) showed a slight activity in
transactivating PXR. Besides at first sight this behaviour could
be ascribable to scarce bioavailability, the scarce activity also
obtained for the methyl ester 2 (Fig. 2A) and the complete loss
of activity for C-24 alcohol 7 (Fig. 2A), obtained through LiBH4
reduction of 2 (75% yield), pointed towards unfavourable
Scheme 1 (a) Et3N·SO3, DMF, 95 °C; (b) NaOH 5% in MeOH–H2O 5 : 1 v/v, 85% over two steps; (c) DMT-MM, Et3N, GlyOEt, dry DMF; (d)
NaOH 5% in MeOH–H2O 5 : 1 v/v, 58% over two steps; (e) DMT-MM, Et3N, taurine, dry DMF. Then Amberlite CG-120, MeOH, 67%. (f)
DMT-MM, Et3N, 5-ASA, dry DMF. Then Amberlite CG-120, MeOH, 72%; (g) LiBH4, MeOH, THF, 0 °C, 75%.
6352 | Org. Biomol. Chem., 2012, 10, 6350–6362
This journal is © The Royal Society of Chemistry 2012

View Article Online
Fig. 2 Luciferase reporter assay. HepG2 cells were transiently transfected with pSG5-PXR, pSG5-RXR, pCMV-βgalactosidase and p(CYP3A4)-
TK-Luc vectors and then stimulated with (A) 10 μM rifaximin or compounds 1–10 for 18 h, or (B) 10 μM rifaximin alone or in combination with
50 μM of compounds 2, 3, 8 and 9. N.T., not treated. Rif, rifaximin. *P < 0.05 versus cells left untreated. Data are mean SE of three determinations.
pharmacodynamic features. Indeed, although compounds 3–6
possess a negative charge on their side chains, most likely they
are less able to form polar interactions with Lys21020 or alterna-
tively with other polar amino acids of PXR LBD.
introduction of the 2β,3α-dihydroxy functionality was achieved
by epoxidation with m-CPBA followed by acid catalyzed ring
opening of epoxide 14.26 β-Elimination and epoxidation pro-
ceeded with excellent regioselectivity and stereoselectivity, pro-
viding exclusively the desired 2β,3α-diol 15 in excellent yields
(78% over two steps).
Sulfination of diol 15 followed by Amberlite CG-120 treat-
ment and RP-18 chromatography afforded the disodium salt 8 in
good yields. As shown in Fig. 2A, compound 8 with its hydro-
phobic side chain is able to transactivate PXR with a potency
comparable with the parent solomonsterol A (1).
Having set a flexible synthetic strategy, we decided to specu-
late on the pharmacophoric role played by the sulfate groups on
ring A in the PXR agonistic activity of solomonsterol A (1).
Tosylation of methyl 3β-hydroxy-5α-cholan-24-oate (16)20
followed by inversion of configuration at C-3 with potassium
As previously reported, PXR presents a large ligand binding
cavity23,24 allowing the accommodation of different kind of mol-
ecules, and the possible binding modes are characterized by an
adequate balance between hydrogen bond and Van der Waals inter-
actions established between a small molecule and the receptor.
Therefore the lack of a polar interaction should be overcome
by increasing the contribution of the hydrophobic interactions on
the side chain and so the derivative 8, 2β,3α-cholestan disulfate
was prepared according to the synthetic procedure reported in
Scheme 2.25 Δ5 cholesterol reduction (H2, Pd/C, THF–MeOH
1 : 1) followed by tosylation and LiBr elimination afforded
Δ2-cholestane derivative 13 (78% yield in three steps). The
Scheme 2 (a) H2, Pd/C, THF–MeOH 1 : 1, room temperature, 90%; (b) p-TsCl, pyridine; (c) LiBr, Li2CO3, DMF, reflux, 87% over two steps;
(d) m-CPBA, CHCl3 room temperature; (e) H2SO4 1 N, THF, room temperature, 78% over two steps; (f) Et3N·SO3, DMF, 95 °C. Then Amberlite
CG-120, MeOH, 90%.
This journal is © The Royal Society of Chemistry 2012
Org. Biomol. Chem., 2012, 10, 6350–6362 | 6353

View Article Online
Scheme 3 (a) p-TsCl, pyridine; (b) CH3COOK, DMF–H2O 9 : 1, reflux; (c) p-TsOH, CHCl3–MeOH 5 : 3, 75% over three steps; (d) LiBH4, MeOH,
THF, 0 °C, 85%; (e) Et3N·SO3, DMF, 95 °C; then Amberlite CG-120, MeOH, 63%; (f) LiBH4, MeOH, THF, 0 °C, 72%; (g) Et3N·SO3, DMF, 95 °C;
then Amberlite CG-120, MeOH, 78%.
acetate in DMF–H2O and de-acetylation in acidic conditions
(Scheme 3) afforded the 3α-hydroxy derivative 17 (75% over
three steps). Reduction at C-24, sulfination/Amberlite ion
exchange gave the disodium salt 9.
Methyl 3β-hydroxy-5α-cholan-24-oate (16) was also used as
the starting material for the easy transformation into derivative
10 through LiBH4 reduction of the C-24 methyl ester and suc-
cessive sulfination of the alcoholic functions at C-3 and C-24.
As indicated in Fig. 2A, although compound 9 induces a
slight PXR transactivation, the lack of sulfate group at C-2 as
well as the inversion of configuration at C-3 are responsible for a
general loss in the agonistic activity towards PXR.
To investigate whether these compounds could act as potential
antagonists of PXR we have carried out a transactivation exper-
iment in HepG2 cells stimulated with rifaximin (10 μM) and
compounds 2, 3, 8 and 9 at a concentration of 50 μM each. As
shown in Fig. 2B, all compounds failed to reverse the induction
Fig. 3 Real-time PCR of CYP3A4 carried out on cDNA isolated from
of luciferase caused by rifaximin, indicating that none of these
HepG2 not stimulated or primed with 10 μM rifaximin, and compounds
solomonsterol A (1) derivatives is a PXR antagonist.
To further examine the activity of compound 8 as a PXR acti-
vator and further clarify the behavior of compounds 2, 3 and 9,
1–10. N.T., not treated. Rif, rifaximin. *P < 0.05 versus N.T. cells.
we have tested the effects of all members of our series on the
expression of CYP3A4, a canonical PXR target gene (Fig. 3).
Despite compounds 2, 3 and 9 causing a slight transactivation of
PXR, they failed to modulate the expression of CYP3A4 at the
concentration of 10 μM. In contrast, confirming data shown in
Fig. 2, compound 8 effectively increased the expression of
CYP3A4 (Fig. 3) in HepG2 cells, with a magnitude similar to
that of rifaximin and solomonsterol A (1). While these data do
not exclude that compound 3 could also stimulate CYP3A4
expression in this system, the need for higher concentrations to
display a full PXR agonistic activity precluded its further
development.
potent agonist of Toll like receptor (TLR)-4. Previous studies27
have shown that activation of PXR in this setting attenuates
immune response triggered by LPS. Data shown in Fig. 4,
demonstrate that compound 8 effectively attenuates induction of
IL-1β, TNFα and MCP-1 induced by LPS.
Because the above mentioned data indicate that compound 8
effectively modulates immune response in human monocytes,
additional experiments were carried out to investigate the effect
of this compound in another model of inflammation-driven acti-
vation, using hepatic stellate cells (HSCs). HSCs are a liver-resi-
dent cell population that proliferate in response to liver injury. In
response to immune activation, HSCs undergo a complex pheno-
type rearrangement characterized by resetting expression of
nuclear receptors, including PXR, and acquisition of an acti-
vated, myofibroblast-like phenotype whose main characteristic is
the ability to express α-smooth muscle actin (αSMA). HSCs are
To further investigate whether compound 8 displays a full
PXR agonistic activity, we then evaluated the effect of 8 in regu-
lating immune response using THP1 cells, a human macrophage/
monocytic cell line, challenged with lipopolysaccharide (LPS), a
6354 | Org. Biomol. Chem., 2012, 10, 6350–6362
This journal is © The Royal Society of Chemistry 2012

View Article Online
Fig. 4 Effect of compound 8 on cytokine release induced by LPS in THP1 cells. 3 × 106 THP were starved for 24 h and then pre-treated with 10 μM
of compound 8 for 3 h and then stimulated for 18 h with LPS 1 μg mL−1. Cytokine expression was assessed by RT-PCR. Data shown are mean SE
of 9 assays from three different sets of experiments. *P < 0.05 versus control cells; **P < 0.05 versus LPS alone.
Fig. 6 Solomonsterol A (1) (coloured by atom types: C grey, O red, S
yellow) in docking with PXR-LBD (residues are coloured by atom type:
C green, H light grey, O red, N blue). Hydrogen bonds are displayed
with green spheres.
Fig. 5 HSC-T6 cells were starved for 72 h and then stimulated with
thrombin, 10 U mL−1, in the presence of solomonsterol A (1) or com-
pound 8, 10 μM each. αSMA expression was assessed by RT-PCR. Data
the positioning of all the compounds in the binding site of
shown are mean of three experiments. *P < 0.05 versus control cells;
PXR,33 and in particular we analyzed the crucial interactions
**P < 0.05 thrombin versus control cells; ***P < 0.05 versus thrombin
calculations, using the Autodock 4.2 software,32 thus examining
with the Ser247, His407 and finally with the Lys210. These resi-
alone.
dues, in particular the Ser247, are involved in hydrogen bonds
with various PXR ligands.24,33,34 The three sulfate groups of the
recognized as the main source of extracellular matrix production
in the fibrotic liver. Previous studies have shown that, along with
other nuclear receptors, PXR ligands reverse this phenotype and
reduce α-SMA expression.28–30 For this purpose HSCs were
exposed to thrombin, a proteinase activated receptor (PAR)-1
agonist alone or in combination with compound 8. Previous
studies have shown that thrombin drives HSCs trans-differen-
tiation and its inhibition reverses HSCs from an activated to a
quiescent phenotype.31 Results shown in Fig. 5 demonstrate that,
similarly to solomonsterol A (1), not only does compound
8 effectively reduce basal expression of αSMA, but it also
attenuates HSCs trans-differentiation (i.e. induction of αSMA
expression) triggered by thrombin.
agonist solomonsterol A (1) act as key points of interaction with
these amino acids, and contribute to accommodating the steroid
nucleus in a mostly hydrophobic part of the binding site of PXR.
Solomonsterol A (1) establishes hydrogen bonds (Fig. 6) with
the Cys284 (2-O-sulfate) and with the Lys210 (24-O-sulfate) and
electrostatic interactions with the Ser247 (2-O-sulfate) and
His407 (3-O-sulfate).20
Compound 8, featuring the C8 aliphatic side chain of choles-
terol, is well superimposed with the binding pose of 1, and is
able to interact with the Ser247, Cys284 and the His407 through
its two sulfate groups in the ring A (Fig. 7). Moreover, 8 estab-
lishes hydrophobic interactions with almost all the residues
observed for solomonsterol A (1) (Leu209, Val211, Pro228,
Leu239, Met243, Phe281, Phe288, Leu411). The presence of
hydrophobic chain allows the gaining of two more Van der
Waals interactions (with the Leu209 and Val211) that may
counter the loss of electrostatic interaction observed for the
sulfate group at C24 of parent solomonsterol A (1). Nevertheless,
Docking studies
In order to clarify the different activities of the compounds
described here at a molecular level, we performed docking
This journal is © The Royal Society of Chemistry 2012
Org. Biomol. Chem., 2012, 10, 6350–6362 | 6355

View Article Online
the weaker nature of these Van der Waals interactions could
explain the decrease of the activity of 8 on PXR (difference of
predicted binding energies 1–8 = 1.05 kcal mol−1).
On the other hand, the absence of the sulfate group at C-2 in
the steroid nucleus causes the observed decrease of activity, due
to an inability to interact simultaneously with the three key
points of contact previously described. For example, compounds
9 and 10 are able to interact with the Lys210 but they fail to
respect the key interactions involving the internal part of the
binding site (Fig. 8). Concerning compound 3, its tetracyclic
nucleus is well superimposed with 1, but its shorter side chain
causes a poor interaction with the nitrogen of Lys210. The two
oxygens of its terminal carboxylic part are not well overlapped
with the oxygens of the 24-O-sulfate of 1, and the different
arrangement of the side chain causes also a loss of two Van der
Waals interactions with the Leu239 and Pro227 (Fig. 8). In other
cases a displacement of the compounds to the solvent part is
observable. For example, the rings A of compounds 2 and 7 are
in the place occupied by the ring B of 1 and, as a consequence,
the 2-O-sulfate and/or 3-O-sulfate are in a less deep position
(Fig. 8). Compounds 4, 5 and 6 present a longer and more func-
tionalized side chain (Fig. 8) compared with the previous deriva-
tives, but also in these cases the steroid nucleus is placed toward
the external part of the binding site of PXR (4, 6). Moreover,
compound 5 is unable to bind in the above described fashion
and accommodates its steroid nucleus in a reverse orientation
Fig. 7 Compound 8 (coloured by atom types: C light green, O red, S
yellow) in docking with PXR-LBD (residues are coloured by atom type:
C green, H light grey, O red, N blue). Hydrogen bonds are displayed
with green spheres.
Fig. 8 Superimposition between 1 (coloured by atom types: C grey, O red, S yellow) and: (a) 9 (coloured by atom types: C sky-blue, O red, S
yellow); (b) 10 (coloured by atom types: C brown, O red, S yellow); (c) 3 (coloured by atom types: C orange, O red, S yellow); (d) 2 (coloured by
atom types: C purple, O red, S yellow); (e) 7 (coloured by atom types: C turquoise green, O red, S yellow); (f) 4 (coloured by atom types: C dodger
blue, O red, S yellow); (g) 5 (coloured by atom types: C dark green, O red, S yellow); (h) 6 (coloured by atom types: C pink, O red, S yellow) in
PXR-LBD (residues are coloured by atom type: C green, H light grey, O red, N blue).
6356 | Org. Biomol. Chem., 2012, 10, 6350–6362
This journal is © The Royal Society of Chemistry 2012

View Article Online
(a flipping of ∼180° along the major axis of the steroid nucleus)
(Fig. 8). The overall result is an inverted disposition of all the
chemical groups (sulfates/methyl groups, and side chain) in the
binding pocket of PXR and therefore a different pattern of
interactions.
extracellular matrix proteins is likely associated with a function
for the PXR that is not related with its recognized function as a
regulator of genes associated with endobiotic and xenobiotic
clearance, and might be linked to inhibition of intracellular sig-
naling including NF-κB, or involved in the regulation of trans-
differentiation of these fat-storing cells as demonstrated for other
nuclear receptors including PPARγ and farnesoid-X-receptor,
FXR.39
Conclusion
In summary, in the present study we report on the generation
of a series of derivatives of solomonsterol A (1), a marine steroid
that acts as a PXR agonist. By transactivation assay and pharmaco-
logical characterization we have shown that compound 8 is a
robust PXR agonist that modulates immune response in human
macrophages. Because of its simplified structure and efficacy in
attenuating immune activation in macrophages and HSCs, com-
pound 8 is a suitable candidate for further development in precli-
nical models of inflammatory diseases. Further studies aimed at
the evaluation of efficacy of 8 in animal models, together with
the determination of its chemical–physical proprieties, are cur-
rently in progress.
In this study we report the synthesis of several derivatives of
solomonsterol A (1), a potent agonist of PXR of marine origin
and a new lead in the treatment of IBD. Biochemical characteriz-
ation of these analogues, modified in the side chain and in the
ring A, allowed us to delineate a first SAR and, notably, to ident-
ify a simplified derivative, cholestan disulfate (8) as a new PXR
agonist. The ability of this compound to act as a PXR agonist
was first demonstrated in a transactivation assay using HepG2
cells transiently transfected with a PXR vector. The results of
these experiments demonstrate that compound 8, and less effec-
tively compounds 2, 3 and 9, efficiently transactivates human
PXR with a relative potency that was very similar to that of
rifaximin, a well characterized PXR agonist. Moreover, in agree-
ment with transactivation experiments, the PCR data demonstrate
that compound 8 increases the expression of CYP3A4, a well
characterized PXR responsive gene, in liver cells. The function-
ality of the interaction of compound 8 with PXR was further
investigated in two different cell models. Using THP1 cells, a
monocytic cell line, we have provided evidence that compound 8
attenuates cytokine generation induced by LPS. Because pre-
vious studies have provided robust evidence that PXR activation
by rifaximin and solomonsterol A20 exerts anti-inflammatory
activity in rodent models of colitis by attenuating inflammation
driven-immune dysfunction and cytokine accumulation in
inflamed tissues, the present results extend on the role of PXR
ligands in regulating immune function, and pave the way for the
use of compound 8 in preclinical models of inflammation.
Despite the fact that we have not investigated the mechanism
mediating inhibition of cytokines by compound 8, we and others
have provided evidence that PXR agonists inhibit NF-κB
activation.20,35
Extending on the role of PXR as an endogenous braking
signal for inflammation, we have then examined whether com-
pound 8 would have been effective in reducing collagen pro-
duction by HSCs, a myofibroblast-like cell line. HSCs acquire an
activated phenotype in response to liver injury and release
collagen and express αSMA in response to toxic and immuno-
logical stimuli in a variety of liver disorders. Previous studies
have provided evidence that nuclear receptors, including FXR,
SHP and PPARγ, modulate a collagen release by HSCs and
might function as important therapeutic targets for treating liver
fibrosis.36 PXR ligation attenuates liver fibrosis and HSCs acti-
vation.37 Here we have shown that solomonsterol A (1) and com-
pound 8 reduce αSMA accumulation triggered by thrombin.
There is substantial evidence to support the notion that PXR acti-
vators are anti-fibrogenic in human liver myofibroblasts
in vitro38 and in in vivo animal models of liver fibrosis.28–30 The
role of the PXR in regulating HSCs activation has been unequi-
vocally established using mice with a disrupted PXR gene.28
The mechanism throughout which PXR regulates production of
Experimental
Specific rotations were measured on a Perkin-Elmer 243 B
polarimeter. High-resolution ESI-MS spectra were performed
with a Micromass QTOF Micromass spectrometer. ESI-MS
experiments were performed on an Applied Biosystem API 2000
triple-quadrupole mass spectrometer. NMR spectra on all syn-
thetic intermediates were obtained on Varian Inova 400 and
Varian Inova 500 NMR spectrometers (1H at 400 and 500 MHz,
13C at 100 and 125 MHz, respectively) and recorded in CDCl3
(δH = 7.26 and δC = 77.0 ppm) and CD3OD (δH = 3.30 and
δC = 49.0 ppm).
HPLC was performed using a Waters Model 510 pump
equipped with Waters Rheodine injector and a differential
refractometer, model 401.
Reaction progress was monitored via thin-layer chromato-
graphy (TLC) on Alugram silica gel G/UV254 plates. Silica gel
MN Kieselgel 60 (70–230 mesh) from Macherey-Nagel
Company was used for column chromatography. All chemicals
were obtained from Sigma-Aldrich Inc. Solvents and reagents
were used as supplied from commercial sources with the follow-
ing exceptions. Tetrahydrofuran, chloroform and triethylamine
were distilled from calcium hydride immediately prior to use.
All reactions were carried out under argon atmosphere using
flame-dried glassware.
The purities of compounds were determined to be greater than
95% by HPLC.
Diol 11 was prepared according to the synthetic procedure pre-
viously described.20 An analytical sample was obtained by
HPLC on a Nucleodur 100-5 C18 (5 μm; 4.6 mm i.d. ×
250 mm, MeOH–H2O 87 : 13, flow rate 1.5 mL min−1, tR
=
2.6 min).
Synthetic procedures
Methyl 2β,3α-disulfate-5α-cholan-24-oate (2). Triethylamine–
sulfur trioxide complex (1.34 g, 7.4 mmol) was added to diol 11
This journal is © The Royal Society of Chemistry 2012
Org. Biomol. Chem., 2012, 10, 6350–6362 | 6357

View Article Online
(300 mg, 0.74 mmol) in DMF dry (10 mL) under an argon
atmosphere, and the mixture was stirred at 95 °C for 48 h. The
reaction mixture was quenched with water (1.6 mL) and the solu-
tion was poured over a C18 silica gel column to remove excess
Et3N·SO3. The product was eluted by MeOH and followed by
evaporation of the solvent to yield a yellow solid [bis-(triethyl-
ammonium sulfate) salt]. To the solid dissolved in methanol
(30 mL) was added Amberlite CG 120 sodium form (30 g) and
the mixture was stirred for 5 h at room temperature. The resin
was removed by filtration, and the filtrate was concentrated to
obtain compound 2 as a white solid (270 mg, 60%). An analyti-
cal sample was obtained by HPLC on a Nucleodur 100-5 C18
(5 μm; 4.6 mm i.d. × 250 mm, MeOH–H2O 34 : 66, flow rate
1.5 mL min−1, tR = 3.6 min). [α]2D4 = +9.6 (c 0.08, CH3OH);
33.1, 30.5, 29.2, 25.2, 22.0, 18.8, 14.3, 12.6. HR ESIMS m/z
652.1855 [M − Na]−, C26H40NNa2O11S2 requires 652.1838.
2β,3α-disulfate-5α-cholan-24-oyl taurine trisodium salt (5).
Carboxylate 3 (50 mg, 0.08 mmol) in DMF dry (2 mL) was
treated with DMT-MM (66 mg, 0.24 mmol) and triethylamine
(278 μL) and taurine (60 mg, 0.48 mmol) was then added to the
mixture, which was further stirred for 24 h. Then, the reaction
mixture was concentrated under vacuo and dissolved in water
(5 mL). The solution was poured over a C18 silica gel column.
The product was eluted with H2O–MeOH 99 : 1. To the solution
of the solid in methanol (2 mL) was added Amberlite CG 120
sodium form (1 g) and the mixture was stirred for 5 h at room
temperature. The resin was removed by filtration, and the filtrate
was concentrated to obtain compound 5 as a white solid (39 mg,
67%). An analytical sample was obtained by HPLC on a Nucleo-
dur 100-5 C18 (5 μm; 4.6 mm i.d. × 250 mm, MeOH–H2O
30 : 70, flow rate 1.5 mL min−1, tR = 3.4 min). [α]2D4 = +7.1 (c
1
selected H NMR (400 MHz CD3OD): δ 4.69 (1H, br s), 4.66
(1H, br s), 3.61 (3H, s), 2.31 (1H, m), 2.17 (1H, m), 0.96 (3H,
s), 0.90 (3H, d, J = 6.5 Hz), 0.66 (3H, s); 13C NMR (100 MHz
CD3OD): 176.5, 76.5, 76.1, 57.8, 57.4, 56.3, 51.8, 43.8, 41.4,
40.3, 39.1, 36.8, 36.5, 36.4, 33.2, 32.5, 32.4, 30.5, 29.1 (2C),
25.2, 21.9, 18.8, 14.3, 12.5. HR ESIMS m/z 587.1975
[M − Na]−, C25H40NaO10S2 requires 587.1961.
1
0.22, CH3OH); selected H NMR (400 MHz CD3OD): δ 4.73
(1H, br s), 4.70 (1H, br s), 3.57 (2H, t, J = 7.0 Hz), 2.95 (2H, t,
J = 7.0 Hz), 2.23 (1H, m), 2.07 (1H, m), 0.99 (3H, s), 0.95 (3H,
d, J = 6.4 Hz), 0.68 (3H, s); 13C NMR (100 MHz CD3OD): δ
176.7, 76.5, 70.5, 57.9, 57.3, 56.5, 51.5, 43.9, 41.4, 40.2 (2C),
39.2, 36.9, 36.6, 36.4, 36.3, 34.2, 33.2, 33.1, 30.5, 29.1, 25.1,
22.0, 18.8, 14.3, 12.6. HR ESIMS m/z 702.1685 [M − Na]−,
C26H42NNa2O12S3 requires 702.1665.
Disodium 2β,3α-disulfate-5α-cholan-24-oic acid (3). Com-
pound 2 (160 mg, 0.26 mmol) was dissolved in 5% methanolic
NaOH (10 mL) and water (2 mL) and the solution was refluxed
for 5 h. The resulting solution was adjusted to pH 5 and concen-
trated under reduced pressure. Purification by C18 silica gel
column eluting with H2O–MeOH (99 : 1) gave the carboxylate 3
as a white solid (140 mg, 90%). An analytical sample was
obtained by HPLC on a Nucleodur 100-5 C18 (5 μm; 4.6 mm
Trisodium 2β,3α-disulfate-5α-cholan-24-oyl 5-aminosalycilic
acid (6). Carboxylate 3 (50 mg, 0.08 mmol) in DMF dry (2 mL)
was treated with DMT-MM (66 mg, 0.24 mmol), triethylamine
(278 μL) and 5-aminosalicylic acid (5-ASA) (73 mg,
0.48 mmol) as described for compound 5 to obtain 6 as a white
solid (43.3 mg, 72%). An analytical sample was obtained by
HPLC on a Nucleodur 100-5 C18 (5 μm; 4.6 mm i.d. ×
i.d. × 250 mm, MeOH–H2O 30 : 70, flow rate 1.5 mL min−1
,
tR = 3.6 min). [α]D24 = +2.7 (c 0.3, CH3OH); selected H NMR
(400 MHz CD3OD): δ 4.73 (1H, br s), 4.69 (1H, br s), 2.31 (1H,
m), 2.17 (1H, m), 0.99 (3H, s), 0.94 (3H, d, J = 6.0 Hz), 0.69
(3H, s); 13C NMR (100 MHz CD3OD): δ 178.9, 76.4, 76.1,
57.8, 57.4, 56.5, 43.8, 41.4, 40.2, 39.2, 36.8, 36.4, 36.3, 33.2,
32.5 (2C), 30.5, 29.2 (2C), 25.2, 22.0, 18.7, 14.3, 12.6. ESIMS
m/z 595.1636 [M − Na]−, C24H37Na2O10S2 requires 595.1624.
1
250 mm, MeOH–H2O 30 : 70, flow rate 1.5 mL min−1, tR
=
3.4 min). [α]D24 = +8.2 (c 1.8, CH3OH); selected 1H NMR
(400 MHz CD3OD): δ 7.71 (1H, d, J = 3.1 Hz), 7.6 (1H, dd, J =
3.1 and 8.7 Hz), 6.7 (1H, d, J = 8.7 Hz), 4.75 (1H, br s), 4.72
(1H, br s), 2.39 (1H, m), 2.25 (1H, m), 1.02 (3H, d, J = 6.0 Hz),
1.01 (3H, s), 0.72 (3H, s); 13C NMR (100 MHz CD3OD): δ
181.2, 171.4, 142.1, 141.7, 131.8, 131.1, 129.8, 127.0, 76.5,
76.0, 57.9, 57.6, 56.7, 43.5, 41.4, 40.2, 39.2, 37.2, 36.5, 36.4,
36.3, 34.0, 33.2, 33.1, 30.5, 29.2, 24.2, 22.0, 18.9, 14.3, 12.6.
2β,3α-disulfate-5α-cholan-24-oyl glycine trisodium salt (4).
Carboxylate 3 (50 mg, 0.08 mmol) in DMF dry (2 mL) was
treated with DMT-MM (66 mg, 0.24 mmol) and triethylamine
(278 μL) and the mixture was stirred at room temperature for
10 min. Glycine ethyl ester (49.5 mg, 0.48 mmol) was then
added to the mixture and stirring was continued for 24 h. After
adding 5% methanolic NaOH (5 mL) and stirring for 5 h at
room temperature, the alkaline solution was adjusted to pH 5,
diluted with water and loaded onto a C18 silica gel column,
which was washed with water (50 mL). Elution with 10%
methanol gave the compound 4 (31 mg, 58% over two steps).
An analytical sample was obtained by HPLC on a Nucleodur
100-5 C18 (5 μm; 4.6 mm i.d. × 250 mm, MeOH–H2O 30 : 70,
flow rate 1.5 mL min−1, tR = 3.4 min). [α]2D4 = +10.8 (c 0.15,
−
HR ESIMS m/z 708.2135 [M − Na]−, C31H43NNaO12S2
requires 708.2124. HR ESIMS m/z 730.1927 [M − Na]−,
C31H42NNa2O12S2 requires 730.1944.
Sodium 2β,3α-disulfate-5α-cholan-24-ol (7). Dry methanol
(26 μL, 0.65 mmol) and LiBH4 (325 μL, 2 M in THF,
0.65 mmol) were added to a solution of the methyl ester 2
(100 mg, 0.16 mmol) in dry THF (5 mL) at 0 °C under argon
and the resulting mixture was stirred for 4 h at 0 °C. The mixture
was quenched by addition of MeOH (2 mL) and then concen-
trated under vacuo. Purification by C18 silica gel eluting with
H2O–MeOH (7 : 3) gave the product 7 as a white solid (70 mg,
75%). An analytical sample was obtained by HPLC on a Nucleo-
dur 100-5 C18 (5 μm; 4.6 mm i.d. × 250 mm, MeOH–H2O
32 : 68, flow rate 1.5 mL min−1, tR = 3.2 min). [α]2D4 = +7.8
(c 0.24, CH3OH); selected 1H NMR (400 MHz CD3OD): δ 4.69
(1H, br s), 4.74 (1H, br, s), 4.70 (1H, br s), 3.65 (1H, m), 3.50
1
CH3OH); selected H NMR (400 MHz CD3OD): δ 4.73 (1H, br
s), 4.70 (1H, br s), 3.72 (2H, s), 2.28 (1H, m), 2.13 (1H, m),
1.00 (3H, s), 0.97 (3H, d, J = 6.0 Hz), 0.69 (3H, s); 13C NMR
(100 MHz CD3OD): δ 176.5, 172.9, 76.5, 76.2, 57.8, 57.4, 56.6,
44.5, 43.8, 41.4, 40.2, 39.1, 36.9, 36.5, 36.4, 36.3, 34.1, 33.2,
6358 | Org. Biomol. Chem., 2012, 10, 6350–6362
This journal is © The Royal Society of Chemistry 2012

View Article Online
(1H, m), 2.10 (1H, m), 2.00 (1H, m), 1.00 (3H, s), 0.95 (3H, d,
J = 6.5 Hz), 0.69 (3H, s); 13C NMR (100 MHz CD3OD): δ 76.5,
76.2, 63.6, 57.9, 57.6, 56.6, 43.8, 41.5, 40.2, 39.1, 37.0, 36.4,
36.3, 33.2 (2C), 30.4, 30.3, 29.2, 29.1, 25.2, 22.0, 19.2, 14.3,
H2SO4 (3.6 mL, 3.6 mmol) solution and stirred for 24 h at room
temperature. After neutralization with saturated NaHCO3 sol-
ution, the mixture was evaporated to a fifth of the initial volume,
diluted with water (50 mL), and extracted with ethyl acetate (3 ×
50 mL). The combined organic extracts were washed with water,
dried over anhydrous MgSO4, filtered and evaporated to dryness.
Purification on a silica gel column by eluting with hexane–
AcOEt 7 : 3 afforded pure 15 (637 mg, 78% over two steps).
[α]D24 = +13.2 (c 0.2, CH3OH); selected 1H NMR (400 MHz
CD3OD): δ 3.90 (1H, br s), 3.87 (1H, br s), 0.90 (3H, d, J =
−
12.5; HR ESIMS m/z 559.2037 [M − Na]−, C24H40NaO9S2
requires 559.2011.
5α-Cholest-2-ene (13). An oven-dried 250 mL flask was
charged with 10% palladium on carbon (100 mg) and cholesterol
(1.00 g, 2.6 mmol) and the flask was evacuated and flushed with
argon. Absolute methanol (50 mL) and dry THF (50 mL) were
added, and the flask was flushed with hydrogen. The reaction
was stirred at room temperature under H2 (1 atm) for 4 h. The
mixture was filtered through celite and the recovered filtrate was
concentrated. The residue was subjected to column chromato-
graphy on silica gel eluting with hexane–AcOEt (9 : 1) to give
950 mg of pure 5α-cholestan-3β-ol (90%). To a solution of this
latter (950 mg, 2.4 mmol) in dry pyridine (50 mL), p-toluene-
sulfonyl chloride (1.3 g, 7.2 mmol) was added. The solution was
stirred at room temperature for 24 h and then poured into cold
water (30 mL) and extracted with CH2Cl2 (3 × 50 mL). The
combined organic layer was washed with saturated NaHCO3 sol-
ution (50 mL), and water (50 mL), and then dried over anhy-
drous MgSO4 and evaporated in vacuo to give 1.2 g of residue,
which was subjected to next step without any purification.
Lithium bromide (1.9 g, 22.0 mmol) and lithium carbonate
(1.6 g, 22.0 mmol) were added to a solution of tosylate (1.2 g,
2.2 mmol) in dry DMF (150 mL), and the mixture was refluxed
for 1.5 h. After cooling to room temperature, the mixture was
slowly poured into 10% HCl solution (150 mL) and extracted
with CH2Cl2 (3 × 150 mL). The combined organic layer was
washed successively with water, saturated NaHCO3 solution and
water, and then dried over anhydrous MgSO4 and evaporated to
dryness to obtain pure 13 (773.3 mg, 87% over two steps).
[α]D24 = +52.5 (c 0.11, CHCl3); selected 1H NMR (400 MHz
CDCl3): δ 5.60 (2H, m), 0.91 (3H, d, J = 6.4 Hz), 0.87 (6H, d,
J = 6.4 Hz), 0.75 (3H, s), 0.66 (3H, s). 13C NMR (100 MHz
CDCl3): δ 126.0, 125.8, 56.4, 56.2, 54.0, 41.4, 40.0, 39.7,
39.5 (2C), 36.5, 36.1, 35.7, 35.6, 34.6, 31.8, 30.3, 28.7, 28.2,
28.0, 24.2, 22.8, 22.5, 20.9, 18.6, 12.0, 11.6; HR ESIMS m/z
393.3487 [M + Na]+, C27H46Na requires 393.3497.
6.7 Hz), 0.87 (6H, d, J = 6.7 Hz), 0.80 (3H, s), 0.65 (3H, s); 13
C
NMR (100 MHz CD3OD): δ 72.1, 71.0, 56.7, 56.5, 55.4, 42.7,
40.5, 39.9, 39.5, 38.9, 36.2, 36.1, 35.8, 35.7, 35.3, 31.3, 31.0,
28.5, 28.2, 28.0, 24.1, 22.8, 22.5, 20.8, 18.6, 14.6, 12.0; HR
ESIMS m/z 427.3572 ([M + Na]+, C27H48NaO2 requires
427.3552.
2β,3α-Cholestane disulfate (8). Triethylamine–sulfur trioxide
complex (4.07 g, 22.5 mmol) was added to a solution of diol 15
(600 mg, 1.5 mmol) in DMF dry (70 mL) under an argon atmos-
phere, and the mixture was stirred at 95 °C for 48 h. Then, the
reaction mixture was quenched with water (30 mL). The solution
was poured over a C18 silica gel column to remove excess
Et3N·SO3. The product was eluted by MeOH and followed by
evaporation of the solvent to yield a yellow solid [tris-(triethyl-
ammonium sulfate) salt]. To the solution of the solid in methanol
(60 mL) was added Amberlite CG 120 sodium form (60 g). The
mixture was stirred for 5 h at room temperature. The resin was
removed by filtration, and the filtrate was concentrated to obtain
compound 8 as a white solid (821 mg, 90%). An analytical
sample was obtained by HPLC on a Nucleodur 100-5 C18
(5 μm; 4.6 mm i.d. × 250 mm, MeOH–H2O 87 : 13, flow rate
1.5 mL min−1, tR = 2.6 min). [α]2D4 = +16 (c 0.2, CH3OH);
selected 1H NMR (400 MHz CD3OD): δ 4.75 (1H, m), 4.71
(1H, m), 0.97 (3H, s), 0.93 (3H, d, J = 6.4 Hz), 0.88 (6H, d, J =
6.4 Hz), 0.68 (3H, s); 13C NMR (100 MHz CD3OD): δ 76.5,
76.1, 57.8, 57.6, 56.6, 43.8, 41.4, 40.7, 40.2, 39.1, 37.3, 37.1,
36.4, 36.3, 31.8, 30.7, 30.5, 29.3, 29.1 (2C), 25.2, 23.2, 22.9,
22.0, 19.2, 14.3, 12.5; HR ESIMS m/z 585.2527 [M − Na]−,
C27H49NaO8S2 requires 585.2532.
Methyl 3α-hydroxy-5α-cholan-24-oate (17). To a solution of
methyl 3β-hydroxy-5α-cholan-24-oate 1620 (173 mg,
0.44 mmol) in dry pyridine (30 mL), p-toluenesulfonyl chloride
(420 mg, 2.2 mmol) was added. The solution was stirred at room
temperature for 24 h and then poured into cold water (30 mL)
and extracted with CH2Cl2 (3 × 50 mL). The combined organic
layer was washed saturated NaHCO3 solution (50 mL), and
water (50 mL), and then dried over anhydrous MgSO4 and evap-
orated in vacuo to give 200 mg of residue, that was subjected to
next step without any purification.
A solution of methyl 3β-tosyl-5α-cholan-24-oate (200 mg,
0.36 mmol) and CH3COOK (36 mg, 0.36 mmol) dissolved in
water (1 mL) and DMF (7 mL) was refluxed for 5 h. The sol-
ution was cooled at room temperature and then ethyl acetate and
water were added. The separated aqueous phase was extracted
with ethyl acetate (3 × 30 mL). The organic phase was washed
with water, dried (Na2SO4) and evaporated to dryness to give
190 mg of mixture, that was subjected to next step without any
2α,3α-Epoxy-5α-cholestane (14). To
a
solution of 13
(750 mg, 2.02 mmol) in CHCl3 (50 mL) was added slowly
m-chloroperbenzoic acid (488 mg, 2.8 mmol). The mixture was
stirred for 4 h at room temperature, and then CH2Cl2 (50 mL)
and 5% Na2SO3 solution (70 mL) were added. The CH2Cl2
phase was washed with water (70 mL), dried over anhydrous
MgSO4 and evaporated to dryness to give 560 mg of crude
epoxide 14, that was subjected to next step without any purifi-
1
cation. Selected H NMR (400 MHz CDCl3): δ 3.16 (1H, br s),
3.11 (1H, br s), 0.88 (3H, d, J = 6.5 Hz), 0.85 (6H, d, J =
6.5 Hz), 0.73 (3H, s), 0.62 (3H, s); 13C NMR (100 MHz
CDCl3): δ 56.2, 56.1, 53.6, 52.6, 51.3, 42.4, 40.0, 39.8, 39.5,
38.2, 36.2, 36.1, 35.7, 35.6, 33.6, 31.6, 29.0, 28.4, 28.2, 28.0,
24.2, 22.8, 22.5, 20.8, 18.6, 12.9, 11.9; HR ESIMS m/z
409.3458 ([M + Na]+, C27H46NaO requires 409.3446.
5α-Cholestan-2β,3α-diol (15). A solution of epoxide 14
(560 mg, 1.45 mmol) in THF (15 mL) was treated with 1N
This journal is © The Royal Society of Chemistry 2012
Org. Biomol. Chem., 2012, 10, 6350–6362 | 6359

View Article Online
purification. This residue was dissolved in 32 mL of mixture
CHCl3–MeOH (5 : 3) and p-toluensulfonic acid (p-TsOH)
(619 mg, 3.6 mmol) was added. The mixture was quenched by
addition of NaHCO3 solution (30 mL) and then concentrated
under vacuo. Ethyl acetate and water were added and the separ-
ated aqueous phase was extracted with ethyl acetate (3 ×
50 mL). The combined organic phase was washed with water,
dried (Na2SO4) and concentrated. Purification by silica gel
eluting with hexane–AcOEt 99 : 1 gave the alcohol 17 as a white
solid (130 mg, 75% over three steps). [α]D24 = +7.2 (c 0.05,
warm to room temperature and concentrated under vacuo. Ethyl
acetate and water were added and the separated aqueous phase
was extracted with ethyl acetate (3 × 30 mL). The combined
organic phases were washed with water, dried (Na2SO4) and
concentrated to obtain 5β-cholan-3α,24-diol as a white solid
(13 mg, 72%).
The triethylamine–sulfur trioxide complex (63 mg,
0.35 mmol) was added to a solution of diol (13 mg,
0.035 mmol) in DMF dry (2 mL) under an argon atmosphere,
and the mixture was stirred at 95 °C for 3 h. The resulting solu-
tion was concentrated under reduced pressure. To the solution of
the solid in methanol (3 mL) was added Amberlite CG 120
sodium form (1 g). The mixture was stirred for 5 h at room temp-
erature. The resin was removed by filtration, and the filtrate was
concentrated and then diluted with water and loaded onto a C18
silica gel column, which was washed with water (50 mL).
Elution with 30% aqueous methanol gave the compound 10 as a
white solid (15 mg, 78%). An analytical sample was obtained by
HPLC on a Nucleodur 100-5 C18 (5 μm; 4.6 mm i.d. ×
1
CH3OH); selected H NMR (400 MHz CDCl3): δ 4.03 (1H, br
s), 3.66 (3H, s), 2.35 (1H, m), 2.20 (1H, m), 0.90 (3H, d, J = 6.0
Hz), 0.77 (3H, s), 0.64 (3H, s); 13C NMR (100 MHz CDCl3):
δ 175.3, 66.8, 56.8, 56.1, 54.6, 51.8, 42.8, 40.2, 40.0, 39.3,
36.1, 35.7, 35.6, 32.4, 32.2, 31.3, 31.2, 29.2, 28.8, 28.3, 24.4,
21.0, 18.5, 14.2, 12.3; HR ESIMS m/z 413.5867 [M + Na]+,
C25H42NaO3 requires 413.5884.
5α-Cholan-3α,24-diyl-3,24-sodium disulfate (9). Dry metha-
nol (70 μL, 1.8 mmol) and LiBH4 (900 μL, 2 M in THF,
1.8 mmol) were added to a solution of the methyl ester 17
(100 mg, 0.25 mmol) in dry THF (10 mL) at 0 °C under argon
and the resulting mixture was stirred for 4 h at 0 °C. The mixture
was quenched by addition of MeOH (4 mL) and then concen-
trated under vacuo. Ethyl acetate and water were added and the
separated aqueous phase was extracted with ethyl acetate (3 ×
30 mL). The combined organic phase was washed with water,
dried (Na2SO4) and concentrated to obtain 5α-cholan-3α,24-diol
as a white solid (77 mg, 85%).
250 mm, MeOH–H2O 25 : 75, flow rate 1.5 mL min−1, tR
=
2.4 min). [α]D24 = +6.4 (c 1.0, CH3OH); selected 1H NMR
(400 MHz CD3OD): δ 4.59 (1H, m), 3.95 (1H, br s), 0.95 (3H,
d, J = 6.0 Hz), 0.82 (3H, s), 0.78 (3H, s); 13C NMR (100 MHz
CD3OD): δ 79.9, 64.3, 57.9, 57.6, 55.4, 43.8, 41.4 (2C), 38.2,
36.8, 36.7, 36.3, 33.3, 33.1, 32.2, 30.7, 29.2, 28.7, 27.1, 25.2,
22.3, 19.0, 14.4, 12.5. HR ESIMS m/z 543.2075 [M − Na]−,
C24H40NaO8S2 requires 543.2062.
Transactivation assay. HepG2 cells were transfected using
Fugene HD transfection reagent (Roche). The plasmids used for
luciferase assay were pSG5-PXR, pSG5-RXR, pCMV-βgalacto-
sidase and the reporter vector p(CYP3A4)-TK-Luc. 48 h post-
transfection cells were stimulated 18 h and than lysed in 100 μL
diluted reporter lysis buffer (Promega). 20 μL of cellular lysates
were read using the Luciferase Substrate (Promega). Lumines-
cence was measured using the Glomax 10/10 luminometer
(Promega). Luciferase activities were normalized for transfection
efficiencies by dividing the relative light units by β-galactosidase
activity expressed from cotransfected pCMV-βgal.
The triethylamine–sulfur trioxide complex (350 mg, 2 mmol)
was added to a solution of diol (70 mg, 0.2 mmol) in DMF dry
(2 mL) under an argon atmosphere, and the mixture was stirred
at 95 °C for 24 h. Then, the reaction mixture was quenched with
water (1.6 mL) and the solution was poured over a C18 silica gel
column to remove excess Et3N·SO3. The product was eluted by
MeOH and followed by evaporation of the solvent to yield a
yellow solid [tris-(triethylammonium sulfate) salt]. To the sol-
ution of the solid in methanol (4 mL) was added Amberlite CG
120 sodium form (2 g). The mixture was stirred for 5 h at room
temperature. The resin was removed by filtration, and the filtrate
was concentrated to obtain a residue that by purification on C18
[H2O–MeOH (7 : 3)] gave the product 9 as a white solid
(71.3 mg, 63%). An analytical sample was obtained by HPLC
on a Nucleodur 100-5 C18 (5 μm; 4.6 mm i.d. × 250 mm,
MeOH–H2O 25 : 75, flow rate 1.5 mL min−1, tR = 2.4 min).
Cell culture. HepG2 cells were maintained at 37 °C
in E-MEM containing 10% fetal bovine serum (FBS), 1%
L-glutamine and 1% penicillin/streptomycin. HepG2 cells were
stimulated 18 h with 10 μM rifaximin 1 and compounds 2–10
and relative mRNA levels of CYP3A4 were analyzed by
Real-Time PCR.
1
[α]D24 = + 0.42 (c 1.2, CH3OH); selected H NMR (400 MHz
CD3OD): δ 4.55 (1H, br s), 3.96 (2H, m), 0.90 (3H, d, J = 6.5
Hz), 0.80 (3H, s), 0.65 (3H, s); 13C NMR (100 MHz CD3OD): δ
76.5, 69.7, 57.9, 57.6, 55.1, 43.8, 41.6, 41.4, 40.8, 36.9, 36.8,
34.7, 33.8, 33.2, 33.1, 29.6, 29.2, 27.9, 27.2, 25.2, 21.9, 19.0,
14.4, 12.5. HR ESIMS m/z 543.2078 [M − Na]−, C24H40-
NaO8S2 requires 543.2062.
HSC-T6, a rat immortalised HSC line, was cultured at 37 °C
in an atmosphere of 5% CO2 in Dulbecco’s modified minimal
essential medium containing 10% FBS, 2 mmol L−1 L-gluta-
mine, 5000 IU mL−1 penicillin and 5000 g mL−1 streptomycin.
After 72 h serum starvation, cells were stimulated with 10 μM
solomonsterol A (1) or compound 8 alone or in combination of
10 U mL−1 thrombin. Total RNAwas extracted to assess the rela-
tive mRNA levels of alpha smooth muscle actin (αSMA) by
quantitative Real-Time PCR.
THP-1 cells were maintained at 37 °C in RPM-I containing
10% fetal bovine serum (FBS), 1% L-glutamine and 1% penicil-
lin/streptomycin. Cells were serum starved for 24 h and pre-
treated with 10 μM of compound 8 for 3 h before the addition of
5α-Cholan-3β,24-diyl-3,24-sodium disulfate (10). Dry metha-
nol (10 μL, 0.20 mmol) and LiBH4 (100 μL, 2 M in THF,
0.20 mmol) were added to a solution of the methyl ester 16
(20 mg, 0.05 mmol) in dry THF (2 mL) at 0 °C under argon and
the resulting mixture was stirred for 4 h at 0 °C. The mixture was
quenched by addition of MeOH (2 mL) and then allowed to
6360 | Org. Biomol. Chem., 2012, 10, 6350–6362
This journal is © The Royal Society of Chemistry 2012

View Article Online
1 μg mL−1 LPS. After 18 h-stimulation total RNA was extracted
to assess the relative mRNA levels of IL1β, TNFα and MCP-1
by Real-Time PCR.
Acknowledgements
This work was supported by grants from MAREX-Exploring
Marine Resources for Bioactive Compounds: From Discovery to
Sustainable Production and Industrial Applications (Call FP7-
KBBE-2009-3, Project nr. 245137) and from MIUR (PRIN
2009) “Sostanze ad attività antitumorale: isolamento da fonti
marine, sintesi di analoghi e ulteriore sviluppo della chemoteca
LIBIOMOL” and “Design, conformational and configurational
analysis of novel molecular platforms” and from the University
of Salerno (FARB ex 60%). NMR spectra were provided by the
CSIAS, Centro Interdipartimentale di Analisi Strumentale,
Faculty of Pharmacy, University of Naples.
Real-time PCR. Total RNA was extracted using the TRIzol
reagent (Invitrogen), purified of the genomic DNA by DNAase I
treatment (Invitrogen) and random reverse-transcribed with
Superscript II (Invitrogen). Fifty ng template was amplified
using the following reagents: 0.2 μM of each primer and 12.5 μL
of 2×SYBR Green qPCR master mix (Invitrogen). All reactions
were performed in triplicate and the thermal cycling conditions
were: 2 min at 95 °C, followed by 40 cycles of 95 °C for 20 s,
55 °C for 20 s and 72 °C for 30 s in iCycler iQ instrument
(Biorad). The relative mRNA expression was calculated and
References
expressed as 2−(ΔΔCt)
. Primers used for qRT-PCR were:
hGAPDH: GAAGGTGAAGGTCGGAGT and CATGGGTG-
GAATCATATTGGAA; hCYP3A4: CAAGACCCCTTTGTGG-
1 K. L. Rock, E. Latz, F. Ontiveros and H. Kono, Annu. Rev. Immunol.,
2010, 28, 321.
2 X. Ma, Y. M. Shah, G. L. Guo, T. Wang, K. W. Krausz, J. R. Idle and
F. J. Gonzalez, J. Pharmacol. Exp. Ther., 2007, 322, 391.
3 S. Fiorucci, S. Cipriani, F. Baldelli and A. Mencarelli, Prog. Lipid Res.,
2010, 49, 171.
4 A. Mencarelli, M. Migliorati, M. Barbanti, S. Cipriani, G. Palladino,
E. Distrutti, B. Renga and S. Fiorucci, Biochem. Pharmacol., 2010, 80,
1700.
AAAA
and
CGAGGCGACTTTCTTTCATC;
hIL1β:
GGACAAGCTGAGGAAGATGC
and
TCGTTATCCCAT-
GTGTCGAA; hTNFα: AACCTCCTCTCTGCCATCAA and
GGAAGACCCCTCCCAGATAG; hMCP-1: CCCCAGTCA-
CCTGCTGTTAT
and
TCCTGAACCCACTTCTGCTT;
rGAPDH: ATGACTCTACCCACGGCAAG and TACTCAG-
CACCAGCATCACC; rαSMA: GCTCCATCCTGGCTTCTCTA
and TAGAAGCATTTGCGGTGGAC.
5 W. Xie and Y. Tian, Cell Metab., 2006, 4, 177.
6 C. Zhou, M. M. Tabb, E. L. Nelson, F. Grün, S. Verma, A. Sadatrafiei,
M. Lin, S. Mallick, B. M. Forman, K. E. Thummel and B. Blumberg,
J. Clin. Invest., 2006, 116, 2280.
7 T. Langmann, C. Moehle, R. Mauerer, M. Scharl, G. Liebisch, A. Zahn,
W. Stremmel and G. Schmitz, Gastroenterology, 2004, 127, 26.
8 A. S. Day and R. B. Gearry, Dig. Dis. Sci., 2010, 55, 877.
9 J. Cheng, Y. M. Shah, X. Ma, X. Pang, T. Tanaka, T. Kodama,
K. W. Krausz and F. J. Gonzalez, J. Pharmacol. Exp. Ther., 2010, 335,
32.
10 Z. D. Jiang, S. Ke and H. L. DuPont, Int. J. Antimicrob. Agents, 2010,
35, 278.
11 V. Sepe, G. Bifulco, B. Renga, C. D’Amore, S. Fiorucci and
A. Zampella, J. Med. Chem., 2011, 54, 1314.
12 S. De Marino, R. Ummarino, M. V. D’Auria, M. G. Chini, G. Bifulco,
B. Renga, C. D’Amore, S. Fiorucci, C. Debitus and A. Zampella, J. Med.
Chem., 2011, 54, 3065.
13 S. De Marino, V. Sepe, M. V. D’Auria, G. Bifulco, B. Renga, S. Petek,
S. Fiorucci and A. Zampella, Org. Biomol. Chem., 2011, 9, 4856.
14 V. Sepe, R. Ummarino, M. V. D’Auria, M. G. Chini, G. Bifulco,
B. Renga, C. D’Amore, C. Debitus, S. Fiorucci and A. Zampella, J. Med.
Chem., 2012, 55, 84.
15 B. Renga, A. Mencarelli, C. D’Amore, S. Cipriani, M. V. D’Auria,
V. Sepe, M. G. Chini, M. C. Monti, G. Bifulco, A. Zampella and
S. Fiorucci, PLoS One, 2012, 7, e30443.
16 M. G. Chini, C. R. Jones, A. Zampella, M. V. D’Auria, B. Renga,
S. Fiorucci, C. P. Butts and G. Bifulco, J. Org. Chem., 2012, 77, 1489.
17 S. De Marino, R. Ummarino, M. V. D’Auria, M. G. Chini, G. Bifulco,
C. D’Amore, B. Renga, A. Mencarelli, S. Petek, S. Fiorucci and
A. Zampella, Steroids, 2012, 77, 484.
18 C. Festa, S. De Marino, M. V. D’Auria, G. Bifulco, B. Renga,
S. Fiorucci, S. Petek and A. Zampella, J. Med. Chem., 2011, 54, 401.
19 Y. M. Shah, X. Ma, K. Morimura, I. Kim and F. J. Gonzalez,
Am. J. Physiol., 2007, 292, G1114.
20 V. Sepe, R. Ummarino, M. V. D’Auria, A. Mencarelli, C. D’Amore,
B. Renga, A. Zampella and S. Fiorucci, J. Med. Chem., 2011, 54, 4590.
21 C. Rousseaux, B. Lefebvre, L. Dubuquoy, P. Lefebvre, O. Romano,
J. Auwerx, D. Metzger, W. Wahli, B. Desvergne, G. C. Naccari,
P. Chavatte, A. Farce, P. Bulois, A. Cortot, J. F. Colombel and
P. Desreumaux, J. Exp. Med., 2005, 201, 1205.
22 M. Kunishima, C. Kawachi, K. Hioki, K. Terao and S. Tani, Tetrahedron,
2001, 57, 1551.
23 R. E. Watkins, G. B. Wisely, L. B. Moore, J. L. Collins, M. H. Lambert,
S. P. Williams, T. M. Willson, S. A. Kliewer and M. R. Redinbo, Science,
2001, 292, 2329.
Computational details. Prior to docking calculations, we built
and processed the chemical structures of the compounds with
Macromodel 8.5 (Schrödinger, LLC, New York, 2003). Molecu-
lar mechanics/dynamics calculations were performed on a
4× AMD Opteron SixCore 2.4 GHz using Macromodel 8.5 and
the OPLS force field. The Monte Carlo multiple minimum
(MCMM) method (5000 steps) was used first in order to allow a
full exploration of the conformational space. Molecular
Dynamics simulations were performed at 600 K and with a
simulation time of 10 ns. A constant dielectric term, mimicking
the presence of the solvent, was used in the calculations to
reduce artifacts. Finally, we applied an optimization (Conjugate
Gradient, 0.05 Å convergence threshold) of the structures for the
identification of a possible three-dimensional starting models for
the subsequent steps of docking calculations by Autodock 4.2
software. A grid box size of 90 × 108 × 96 with spacing of
0.375 Å between the grid points and centered at 14.282 (x),
74.983 (y), and 0.974 (z) was used for the PXR receptor. We per-
formed 10 calculations consisting of 256 runs, obtaining 2560
structures (256 × 10), using the Lamarckian genetic algorithm
for dockings. An initial population of 450 randomly placed indi-
viduals, a maximum number of 5.0 × 106 energy evaluations,
and a maximum number of 6.0 × 106 generations were taken
into account. A mutation rate of 0.02 and a crossover rate of 0.8
were used. We clustered together results differing by less than
3.0 Å in positional root-mean-square deviation (rmsd). For all
the investigated compounds, all open-chain bonds were treated
as active torsional bonds. Docking results were analyzed with
Autodock Tools 1.4.5. Illustrations of the 3D models were gener-
ated using the Python software.40
This journal is © The Royal Society of Chemistry 2012
Org. Biomol. Chem., 2012, 10, 6350–6362 | 6361

View Article Online
24 S. Ekins, S. Kortagere, M. Iyer, E. J. Reschly, M. A. Lill, M. R. Redinbo
and M. D. Krasowski, PLoS Comput. Biol., 2009, 5, e1000594.
25 G. A. G. Santos, A. P. Murray, C. A. Pujol, E. B. Damonte and
M. S. Maier, Steroids, 2003, 68, 125.
26 R. Cong, Y. Zhang and W. Tian, Tetrahedron Lett., 2010, 51, 3890.
27 K. Wang, I. Damjanov and Y. J. Wan, Lab. Invest., 2010, 90, 257.
28 C. J. Marek, S. J. Tucker, D. K. Konstantinou, L. J. Elrick, D. Haefner,
C. Sigalas, G. I. Murray, B. Goodwin and M. C. Wright, Biochem. J.,
2005, 387, 601.
33 R. E. Watkins, J. M. Maglich, L. B. Moore, G. B. Wisely, S. M. Noble,
P. R. Davis-Searles, M. H. Lambert, S. A. Kliewer and M. R. Redinbo,
Biochemistry, 2003, 42, 1430.
34 L. Xiao, E. Nickbarg, W. Wang, A. Thomas, M. Ziebell, W. W. Prosise,
C. A. Lesburg, S. S. Taremi, V. L. Gerlach, H. V. Le and K. C. Cheng,
Biochem. Pharmacol., 2011, 81, 669.
35 A. Mencarelli, B. Renga, G. Palladino, D. Claudio, P. Ricci, E. Distrutti,
M. Barbanti, F. Baldelli and S. Fiorucci, Eur. J. Pharmacol., 2011, 668,
317.
29 B. Renga, A. Mencarelli, M. Migliorati, S. Cipriani, C. D’Amore,
E. Distrutti and S. Fiorucci, Inflammation Res., 2011, 60, 577.
30 S. Fiorucci, E. Antonelli, G. Rizzo, B. Renga, A. Mencarelli, L. Riccardi,
S. Orlandi, R. PellicciariandA. Morelli, Gastroenterology, 2004, 127, 1497.
31 S. Fiorucci, E. Antonelli, E. Distrutti, B. Severino, R. Fiorentina,
M. Baldoni, G. Caliendo, V. Santagada, A. Morelli and G. Cirino, Hepa-
tology, 2004, 39, 365.
36 M. Trauner and E. Halilbasic, Gastroenterology, 2011, 140, 1120.
37 S. Kakizaki, D. Takizawa, H. Tojima, N. Horiguchi, Y. Yamazaki and
M. Mori, Front. Biosci., 2011, 17, 2988.
38 E. L. Haughton, S. J. Tucker, C. J. Marek, E. Durward, V. Leel,
Z. Bascal, T. Onaghan, M. Koruth, E. Collie-Duguid, D. A. Mann,
J. E. Trim and M. C. Wright, Gastroenterology, 2006, 131, 194.
39 G. Rizzo, M. Disante, A. Mencarelli, B. Renga, A. Gioiello, R. Pellicciari
and S. Fiorucci, Mol. Pharmacol., 2006, 70, 1164.
32 G. M. Morris, R. Huey, W. Lindstrom, M. F. Sanner, R. K. Belew,
D. S. Goodsell and A. J. Olson, J. Comput. Chem., 2009, 30, 2785.
40 M. F. Sanner, J. Mol. Graphics Modell., 1999, 17, 57.
6362 | Org. Biomol. Chem., 2012, 10, 6350–6362
This journal is © The Royal Society of Chemistry 2012