Highly efficient chemoenzymatic synthesis of α-galactosyl epitopes with a recombinant α(1→3)-galactosyltransferase

Article abstract of DOI:10.1021/ja9808898

α-Galactosyl epitopes are carbohydrate structures bearing a Galα1-3Galβ terminus. The interaction of these epitopes on the surface of animal cells with anti-α-galactosyl antibodies in human serum is believed to be the main cause in antibody-mediated hyper

Full text of DOI:10.1021/ja9808898

VOLUME 120, NUMBER 27
J ULY 15, 1998
©
Copyright 1998 by the
American Chemical Society
Highly Efficient Chemoenzymatic Synthesis of R-Galactosyl Epitopes
with a Recombinant R(1f3)-Galactosyltransferase
†
Jianwen Fang, Jun Li, Xi Chen, Yingnan Zhang, Jianqiang Wang, Zhengmao Guo,
†
Wei Zhang, Libing Yu, Keith Brew, and Peng George Wang*
Contribution from the Department of Chemistry, Wayne State UniVersity, Detroit, Michigan 48202, and
Department of Biochemistry & Molecular Biology, School of Medicine, UniVersity of Miami,
P.O. Box 016129, Miami, Florida 33101
ReceiVed March 17, 1998
Abstract: R-Galactosyl epitopes are carbohydrate structures bearing a GalR1-3Galâ terminus. The interaction
of these epitopes on the surface of animal cells with anti-R-galactosyl antibodies in human serum is believed
to be the main cause in antibody-mediated hyperacute rejection in xenotransplantation. This report describes
an efficient chemoenzymatic approach based on the use of recombinant R(1f3)-galactosyltransferase (R1,3-
GalT) for the synthesis of xenoactive R-galactosyl epitopes, which are highly desired in the research of
xenotransplantation and immunotherapy. A truncated bovine R1,3-GalT (80-368) was cloned into the pET15b
vector and subsequently transformed into E. coli BL21 strain. This expression system efficiently produced
the soluble recombinant enzyme on a large scale with highly specific activity. A variety of R(1f3)-
galactosylated epitopes were synthesized using such a recombinant enzyme. In a unique fashion, R-galactosyl
pentasaccharide was synthesized via a one-pot, two-step enzymatic synthesis with in situ cofactor regeneration.
Introduction
World primates. The unique enzyme responsible for the
formation of R-Gal epitopes is R(1f3)-galactosyltransferase
Organ transplantation as one of the miracles of modern
medicine is overshadowed by the severe worldwide shortage
of human organ donors. One solution to this problem is the
(R1-3GalT) (EC 2.4.1.151), a protein which is absent in humans,
apes, and other Old World primates due to mutational inactiva-
tion of the gene. Conversely, anti-Gal antibodies exist in
humans, constituting 1-2% of total serum IgG and 3-8% of
total serum IgM (Figure 1). The discovery of the interaction
of anti-Gal and R-Gal epitopes has led to experimental attempts
to overcome hyperacute rejection by either depleting the
recipient’s anti-Gal through R-Gal immobilized affinity columns
or antagonizing anti-Gal by infusing soluble synthetic R-Gal
1
use of animal organssxenotransplantation. Pigs are considered
the best organ donor candidates. However, human antibody
mediated hyperacute rejection presents a formidable barrier. The
major xenoactive antigens on porcine endothelial cells are
carbohydrate structures bearing a GalR1-3Galâ terminus. Trisac-
charides (GalR1-3Galâ1-4Glcâ-R and GalR1-3Galâ1-4GlcNAcâ-
R) and pentasaccharide (GalR1-3Galâ1-4GlcNAcâ1-3Galâ1-
2
b,3
4
Glcâ-R) are considered as R-Gal epitopes binding specifically
oligosaccharides.
However, such procedures would require
2
to human anti-Gal antibodies during the xenotransplantation.
Such epitopes are abundantly expressed on the cells of most
mammals with the exception of humans, apes, and other Old
access to a substantial amount of R-Gal oligosaccharides as well
(2) (a) Cooper, D. K. C.; Koren, E.; Oriol, R. Immunol. ReV. 1994, 141,
†
University of Miami.
31. (b) Galili, U. Immunol. Today 1993, 14, 480. (c) Sandrin, M. S.;
Vaughan, H. A.; McKenzie, I. F. C. Transplant. ReV. 1994, 8, 134. (d)
Samuelsson, B. E.; Rydberg, L.; Breimer, M. E.; Backer, A.; Gustavsson,
M.; Holgersson, J.; Karlsson, E.; Uyterwaal, A.-C.; Cairns, T.; Welsh, K.
Immunol. ReV. 1994, 141, 151.
*
To whom correspondence should be addressed. Telephone: (313) 993-
759. Fax: (313) 577-5831. E-mail: pwang@chem.wayne.edu.
1) (a) Nature 1998 (January, special issue), 391, 309. (b) Rother, R. P.;
Squinto, S. P. Cell 1996, 36, 185.
6
(
S0002-7863(98)00889-0 CCC: $15.00 © 1998 American Chemical Society
Published on Web 06/24/1998

6636 J. Am. Chem. Soc., Vol. 120, No. 27, 1998
Fang et al.
Figure 1. Interplay of R-galactosyl epitopes and anti-R-Gal antibody.
as synthetically derived R-Gal analogues and mimetics with high
affinity to anti-Gal antibodies.
Previous chemical syntheses of GalR1-3Galâ1-4Glcâ-R and
GalR1-3Galâ1-4GlcNAcâ-R required lengthy protection and
deprotection sequences.4 Enzymatic synthesis of GalR-3Gal
sequence was reported using glycosidase-catalyzed transglyco-
,5
6
sylation reactions. Unfortunately, low yields and unpredictable
regioselectivities for the formation of desired glycosidic linkages
plague this approach. Alternatively, the “one enzyme-one
7
linkage” concept of glycosyltransferases makes them a viable
strategic choice for the preparative synthesis of complicated
oligosaccharides and glycoconjugates. Nevertheless, the amount
of R1-3 GalT available from natural sources is very limited.
Although several studies on cloning and characterization of R1-
8
3
GalT have been reported, no practical production of the
Figure 2. Genetic map of R(1f3)-galactosyltransferase expression
recombinant enzyme has been accomplished. We describe here
a novel expression system which produces truncated, soluble
R1-3GalT on a large scale. Using this enzyme, a variety of
R-Gal epitopes and derivatives have been synthesized.
plasmid.
thymus, which is the tissue with the highest known specific
8a
activity. Thus, this expression system provides a viable access
to a large quantity of R1-3GalT essential for the enzymatic
synthesis of R-galactosyl epitopes.
Results and Discussion
Full length bovine R1-3GalT is a type-II membrane protein
with a short N-terminal cytosolic domain, a membrane spanning
Using the recombinant enzyme, R-galactosyl epitopes and a
variety of derivatives were synthesized on preparative scales.
The acceptors that were used in this study include lactose 1a,
region, a stem, and a C-terminal catalytic region.8a It was found
that a truncated catalytic domain of 80-368 was the minimal
sequence for the enzymatic activity. Thus, the corresponding
gene plus a six-histidine tag at the N-terminus was cloned into
pET 15b vector (Novagen, Madison) which contained an
ampicillin-resistant gene and a T7 promoter (Figure 2). The
recombinant enzyme was expressed in E. coli BL21(DE3)
1
0
11
â-lactosyl azide 1b, â-thiophenyl lactoside 1c, N-acetyllac-
1
2
13
tosamine derivatives 1d,e, and lactosamine 1f. All of these
disaccharides served as good acceptors and produced the
corresponding R-Gal epitopes and derivatives 2a-f in good
yields (see the Experimental Section for details). It is worth
noticing that 1f, which has an unprotected amino group, still
served as a good acceptor. The product 2f bearing an amino
group was easily isolated by cation-exchange resin chromatog-
raphy. Another advantage of this trisaccharide is that the
amino group can be utilized for further synthetic manipulation.14
Compounds 2b,c can be directly used as trisaccharide building
blocks for the convergent synthesis of larger R-galactosyl
epitopes and glycopeptides.
(
Novagen, Madison) transformed with pET15b-RGalT. In the
cell lysate, the enzyme was expressed at a level of approximately
0 unit (U)/L. The tag of six histidines fused on the N-terminal
6
1
3
simplified the purification of active soluble enzyme by Ni-
NTA affinity chromatography.9 The purified enzyme has an
expected MW 36 000 with a specific activity of 10.6 U/mg.
The specific activity is 100-fold higher than that reported from
the bovine R1-3GalT expressed in Sf9 insect cells and 100 000-
fold higher than that reported for the enzyme present in calf
(8) (a) Joziasse, D. H.; Shaper, J. H.; Eijnden, D. H.; Tunen, A. J. V.;
Shaper, N. L. J. Biol. Chem. 1989, 264, 14290. (b) Joziasse, D. H.; Shaper,
N. L.; Salyer, L. S.; Eijnden, D. H.; Spoel, A. C.; Shaper, J. H. Eur. J.
Biochem. 1990, 191, 75. (c) Larsen, R. D.; Pajan, V. P.; Ruff, M. M.;
Kukowska-Latallo, J.; Cummings, R. D.; Lowe, J. B. Proc. Natl. Acad.
Sci. U.S.A. 1989, 86, 8227. (d) Joziasse. D. H.; Shaper, N. L.; Kim, D.;
Eijnden, D. H.; Shaper, J. H. J. Biol. Chem. 1992, 267, 5534. (e) Strahan,
K. M.; Gu, F.; Preece. A. F.; Gustavsson, I.; Andersson, L.; Gustafsson, K.
Immunogenetics 1995, 41, 101. (f) Henion, T. R.; Macher, B. A.; Anaraki,
F.; Galili, U. Glycobiology 1994, 4, 193.
(
3) Rieben, R.; Von Allmen, E.; Korchagina, E.; Nydegger, U.; Neethling,
F. A.; Kujundzic, M.; Koren, E.; Bovin, N.; Cooper, D. K. C. Xenotrans-
plantation 1995, 2, 98.
(4) (a) Jacquinet, J.-C.; Duchet, D.; Milat, M.-L.; Sinay, P. J. Chem.
Soc., Perkin Trans. 1 1981, 326. (b) Koike, K.; Sugimoto, M.; Sato, S.;
Ito, Y.; Nakahara, Y.; Ogawa, T. Carbohydr. Res. 1987, 163, 189.
(5) (a) Matsuzaki, Y.; Ito, Y.; Nakahara, Y.; Ogawa, T. Tetrahedron
Lett. 1993, 34, 1061. (b) Reddy, G. V.; Jain, R. K.; Bhatti, B. S.; Matta, K.
L. Carbohydr. Res. 1994, 263, 67.
(
(
9) Hoffmann, A.; Roeder, R. G. Nucleic Acids Res. 1991, 19, 6337.
10) Tropper, F. D.; Andersson, F. O.; Braun, S.; Roy, R. Synthesis 1992,
(
6) (a) Nilsson, K. G. I. Tetrahedron Lett. 1997, 38, 133. (b) Vic, G.;
Tran, C. H.; Scigelova, M.; Crout, D. H. G. Chem. Commun. 1997, 169.
c) Vic, G.; Scigelova, M.; Hastings, J. J.; Howarth, O. W.; Crout, D. H.
6
18.
(
(
(
(
11) Ferrier, R.; Furneaux, R. Methods Carbohydr. Chem. 1980, 8, 251.
12) Li, J.; Wang, P. G. Tetrahedron Lett. 1997, 38, 7967.
13) Fang, J.; Xie, W.; Li, J.; Wang, P. G. Tetrahedron Lett. 1998 39,
G. Chem. Commun. 1996, 1473. (d) Mstsuo, I.; Fujimoto, H.; Isomura, M.;
Ajisaka, K. Bioorg. Med. Chem. Lett. 1997, 7, 255.
(7) Beyer, A. T.; Sadler, J. E.; Rearick, J. I.; Paulson, J. C.; Hill, R. L.
9
19.
14) Banoub, J.; Boullanger, P.; Lafont, D. Chem. ReV. 1992, 92, 1167.
AdV. Enzymol. 1981, 52, 24.
(

Chemoenzymatic Synthesis of R-Galactosyl Epitopes
J. Am. Chem. Soc., Vol. 120, No. 27, 1998 6637
Scheme 1. Synthesis of R(1f3)-Galactosyl Trisaccharides Using R(1f3)-Galactosyltransferase and
UDP-Galactose-4-epimerase
Scheme 2. Synthesis of GalR1-3Galâ1-4GlcNAcâ1-3Galâ1-4GlcâN3 Pentasaccharide with in Situ Cofactor Regeneration
To synthesize the GalR1-3Galâ1-4GlcNAcâ1-3Galâ1-4Glcâ-R
pentasaccharide, we designed a one-pot enzymatic synthesis
which included two sequential enzymatic glycosylations using
R(1f3)-galactosyltransferase and â(1f4)-galactosyltransferase
that share a common UDP-galactose donor. In situ cofactor
regeneration cycles of the donor16 were applied to avoid
stoichiometric use of the expensive nucleotide sugar donor and
product inhibition of the transferases. The starting trisaccharide
successfully achieved by the use of a novel recombinant R-
(1f3)-galactosyltransferase. This approach provides an easy
access to a wide spectrum of R-galactosyl epitopes and their
derivatives to support the continuous studies on xenotransplan-
tation as well as other pharmaceutical research.
15
Experimental Section
General Method. 1H and 13C spectra were recorded on 400-MHz
Varian VXR400 NMR and 500-MHz Varian Unity spectrometers. Mass
spectra (FAB or ESI) were run at the mass spectrometry facility at the
University of California, Riverside. Thin-layer chromatography was
conducted on Baker Si250F silica gel TLC plates with a fluorescent
indicator.
3
was prepared through an established stereospecific glycosy-
1
7
lation. The azido group was purposefully introduced for its
synthetic flexibility in the solid-phase synthesis of glycopep-
tides,18 glycopolymers, or glycodendrimers. It can also be
transformed to other useful glycosylation functionalities such
19
20
as glycosyl fluorides for orthogonal oligosaccharide synthesis.
T7 promoter and T7 terminator primers and pET15b vector were
purchased from Novagen. Ni2 -NTA resin and DNA miniprep spin
kit were from Qiagen. Taq DNA polymerase, DNA ligase, and Magic
PCR Preps DNA purification systems were obtained from Promega
Corp. DNA ligase, BamHI, and Nde I were from New England
+
It is noteworthy that almost all of the starting trisaccharide 3
was consumed in this high-yielding and efficient one-pot
synthesis. The corresponding intermediate 4 and product 5 were
obtained in 53% and 35% yields, respectively.
3
Biolabs. UDP-galactose-[galactose-6- H] was purchased from Amer-
sham. UDP-galactose and DOWEX 1×8 resin were obtained from
Conclusion
Sigma.
In summary, efficient chemoenzymatic syntheses of a variety
of R-galactosyl epitopes with different functionalities were
The plasmid containing the gene sequence of bovine R1-3GalT in
pSV-SPORT vector was obtained from Dr. L. Inverardi (Diabetes
Research Institute, Cell Transplant Center, University of Miami School
of Medicine, Miami, FL). Both E. coli cell lines DH5R (Gibco-BRL)
and BL21(DE3) (Novagen) are commercially available.
Amplification of the r(1f3)-Galactosyltransferase Gene. PCR
amplifications were performed in a 50-µL reaction mixture containing
(
15) Hokke, C. H.; Zervosen, A.; Elling, L.; Joziasse, D. H.; Van Den
Eijnden, D. H. Glycoconjugate J. 1996, 13, 687.
16) (a) Wong, C.-H.; Haynie, S. L.; Whitesides, G. M. J. Org. Chem.
(
1
1
982, 47, 5416. (b) Auge, C.; Mathieu, C.; Merienne, C. Carbohydr. Res.
986, 151, 147. (c) Thiem, J.; Wiemann, T. Synthesis 1992, 141. (d) Wong,
C.-H.; Wang, R.; Ichihawa, Y. J. Org. Chem. 1992, 57, 4343. (e) Zervosen,
A.; Elling, L. J. Am. Chem. Soc. 1996, 118, 1836.
5
µL of template DNA, 1 µM primers BE80GT-N (5′CGAATAT-
CATATGGAAAGCAAGCTTAAGCTATCG3′) and BGT-C (5′CGCG-
GATCCCAAAGTCAGACATTATTTCTAACCAC3′), 2.5 mM MgCl
µL of 10× buffer (100 mM Tris-HCl, 500 mM KCl, pH 8.3), 1 mM
of dNTPs, and 2.5 U of Taq DNA polymerase. The reaction mixture
(
(
(
(
17) Abbas, S.; Matta, K. L. Carbohydr. Res. 1983, 123, 53.
18) Kunz, H.; Dombo, B. Angew. Chem., Int. Ed. Engl. 1988, 27, 711.
19) Roy, R. Curr. Opin. Struct. Biol. 1996, 6, 692.
2
,
5
20) Broder, W.; Kunz, H. Bioorg. Med. Chem. 1997, 5, 1.

6638 J. Am. Chem. Soc., Vol. 120, No. 27, 1998
Fang et al.
was overlayed with 50 µL of mineral oil and subjected to 30 cycles of
amplifications with an annealing temperature of 55 °C.
Construction of the r(1f3)-Galactosyltransferase Expression
Plasmid. The DNA obtained from the first PCR amplification
J ) 7.5 Hz, 1H), 4.48 (d, J ) 8.0 Hz), 4.96 (d, J ) 4.0 Hz, 1H), 5.04
(d, J ) 3.5 Hz). Selected anomeric 13C NMR (D
O): δ 91.69, 95.28,
32
H O16 (M + Na): 527.1588.
2
95.64, 102.70. HRFABMS calcd for C18
Found: 527.1582.
(
Extension PCR) was used as the template for the second amplification
b (155 mg, 61%). 1H NMR (D
2
O): δ 3.13 (t, J ) 9.0 Hz, 1H),
.46-3.84 (m, 15H), 4.00 (d, J ) 2.5 Hz, 1H), 4.01 (t, J ) 6.5 Hz,
2
after purification by agarose gel electrophoresis. The DNA product
of the second PCR was directly used for TA cloning. Positive colonies
were picked up and screened by restriction mapping with NdeI and
BamHI. The appropriate insert was selected and was cloned into the
pET15b vector previously cleaved by the same restriction enzymes after
purification by a agarose gel electrophoresis. The resulting R1-3GalT-
pET15b plasmid was transformed into E. coli DH5R competent cells,
and a selected clone was grown up for minipreps and characterization
by restriction mapping and DNA sequencing. The plasmids from the
same culture were transformed into E. coli strain BL21(DE3) for
overexpression of the enzyme.
3
1
3
6
8
5
H), 4.34 (d, J ) 8.0 Hz, 1H), 4.59 (d, J ) 8.5 Hz, 1H), 4.96 (d, J )
13
.5 Hz, 1H). C NMR (D
2
O): δ 59.78, 60.80, 60.90, 64.69, 68.08,
9.00, 69.16, 69.45, 70.71, 72, 38, 74.30, 74.94, 76.55, 77.03, 77.77,
31 3
9.84, 95.30, 102.67. HRFABMS calcd for C18H N O15 (M + Na):
52.1652. Found: 552.1639.
2
c (132 mg, 46%). 1H NMR (D
O): δ 3.25 (t, J ) 9.5 Hz, 1H),
2
3
1
(
6
7
.47-3.86 (m, 15H), 4.02 (d, J ) 3.0 Hz, 1H), 4.03 (t, J ) 6.5 Hz,
H), 4.36 (d, J ) 8.0 Hz, 1H), 4.67 (d, J ) 10.0 Hz, 1H, H-1), 4.98
1
3
d, J ) 4.0 Hz, 1H). C NMR (D
2
O): δ 60.06, 60.91, 62.36, 64.71,
8.09, 69.01, 69.16, 69.46, 70.71, 71.30, 74.93, 75.74, 77.05, 78.02,
8.57, 87.04, 95.30, 102.66, 128.04, 129.22, 131.53. HRFABMS calcd
15S (M + Na): 619.1672. Found: 619.1665.
d (188 mg, 67%). 1H NMR (D
O): δ 1.84 (s, 3H), 3.38-4.02
m, 19H), 4.15 (dd, J ) 5.0, 13.0 Hz, 1H), 4.35 (d, J ) 8.0 Hz, 1H),
4.39 (d, J ) 8.5 Hz, 1H), 4.95 (d, J ) 3.5 Hz, 1H), 5.06-5.14 (m,
Preparation of r(1f3)-GalT from Transformed E. coli Strain.
Cells were cultured in LB medium containing 100 µg/mL ampicillin
with rapid shaking (250 rpm) at 37 °C in a C25 incubator shaker. The
cultures were monitored by absorbance at 600 nm using a Beckman
DU-600 spectrometer. When the A600 nm of the culture reached 0.8-
36
for C24H O
2
2
(
1
.0, IPTG (isopropyl-1-thio-â-D-galactopyranoside) was added to a
13
concentration of 400 µM to induce the expression of R1-3GalT. After
shaking at 37 °C (250 rpm), the cells were harvested by centrifugation
at 4000 rpm for 20 min and washed with washing buffer (pH 8.5, 20
mM Tris-HCl, 20% sucrose). Lysis buffer (pH 8.5, 20 mM Tris-HCl,
2H), 5.67-5.75 (m, 1H). C NMR (D O): δ 22.01, 54.88, 59.98,
2
60.78, 60.88, 64.66, 68.07, 68.98, 69.15, 69.47, 70.36, 70.70, 72.43,
74.62, 74.92, 77.00, 78.49, 95.27, 99.85, 102.65, 118.07, 133.13, 174.46.
HRFABMS calcd for C23
608.2169.
H39NO16 (M + Na): 608.2167. Found:
1
mM EDTA, 1% Triton ×100, 200 µg/mL lysozyme) was added, and
the mixture was stirred vigorously for 10 min at room temperature.
DNaseI (2 µg/mL) was added. The mixture was shaken at 37 °C in a
water bath for 40 min, and the lysate was collected by centrifugation
at 11 000 rpm for 20 min.
Purification of Recombinant r(1f3)-Galactosyltransferase. The
enzyme was purified using a Ni-NTA affinity column (Qiagen) which
binds to the six-histidine-containing sequence. Purification was
1
2
e (147 mg, 56%). Selected anomeric H NMR (D
2
O): δ 4.39 (d,
J ) 8.0 Hz, 1H), 4.57 (d, J ) 7.5 Hz), 4.99 (d, J ) 4.0 Hz, 1H), 5.05
13
(
9
d, J ) 2.0 Hz). Selected anomeric C NMR (D
5.34, 102.75.
f (120 mg, 50%). Selected anomaric 1H NMR (D
J ) 7.5 Hz, 1H), 4.79 (d, J ) 8.1 Hz), 4.96 (d, J ) 3.6 Hz, 1H), 5.27
2
O): δ 90.44, 94.80,
2
2
O): δ 4.35 (d,
13
(
9
d, J ) 3.6 Hz). Selected anomeric C NMR (D
5.21, 102.70. HRFABMS calcd for C18
Found: 504.1955.
One-Pot Enzymatic Synthesis of Pentasaccharide Galr1-3Galâ1-
Gluâ1-3Galâ1-4GlcNAcâN (5). To trisaccharide 3 (60 mg, 0.11
2
O): δ 88.68, 92.35,
34NO15 (M ): 504.1928.
2
+
performed at 4 °C. The Ni column was equilibrated with 3 volumes
of 1× binding buffer (5 mM imidazole, 20 mM Tris-HCl (pH 7.9), 0.5
M NaCl) before loading the cell lysate. The column was then washed
exclusively with 6 volumes of 1× binding buffer, followed by 6
volumes of 1× washing buffer (60 mM imidazole, 20 mM Tris-HCl
+
H
4
3
mmol), glucose 1-phosphate (67 mg, 0.22 mmol), KCl (28 mg, 0.37
mmol), PEP (48 mg, 0.23 mmol), and UTP (11 mg, 0.02 mmol) in
(
pH 7.9), 0.5 M NaCl)) and 6 volumes of 1× elution buffer (200 mM
imidazole, 20 mM Tris-HCl (pH 7.9), 0.5 M NaCl). Elution buffer
containing the purified enzyme was dialyzed at 4 °C against dialysis
buffer (10% glycerol, 20 mM Tris-HCl, pH 7.9) before using in
synthesis.
r(1f3)-Galactosyltransferase Assay. Enzyme activity for different
acceptors was assayed at 37 °C for 12 min in a final volume of 100
µL containing 10 mM Tris-HCl (pH 7.0), 10 mM MnCl
0
mg/mL enzyme, and 50 mM acceptor. Acceptor was omitted for the
blank. The reaction was stopped by adding 100 µL of ice-cold 0.1 M
EDTA, and the mixture was passed through 2 mL of Dowex 1×8-200
chloride anion exchange column and washed with 0.5 mL and 1 mL
Tris-buffer (100 mM, pH 7.0, 10 mL) were added BSA (0.1%), MgCl
10 mg, 0.1 mmol), and MnCl (16 mg, 0.1 mmol). The solution was
2
(
2
degassed with argon followed by addition of the enzymes (UDP-
glucose-pyrophosphorylase (5 U), inorganic pyrophosphatase (10 U),
UDP-galactose-4-epimerase (5 U), R(1f3)-galactosyltransferase (10
U), â(1f4)-galactosyltransferase (5 U), and pyruvate kinase (20 U)).
The reaction was conducted at room temperature for 4 days. The
mixture was passed through Dowex-Cl anion-exchange resin and
2
, 0.1% BSA,
3
.3 mM UDP-[6- H]Gal (final specific activity of 500 cpm/nmol), 0.04
purified with gel permeation chromatography (Bio-Gel P2) to afford
1
pentasaccharide 5 (33 mg, 35%). Selected anomeric H NMR (D
2
O):
δ 4.24 (d, J ) 8.0 Hz, 1H), 4.36 (d, J ) 8.0 Hz, 1H), 4.51 (d, J ) 8.5
Hz, 1H), 4.58 (d, J ) 9.0 Hz, 1H), 4.95 (d, J ) 3.5 Hz, 1H). Selected
2
of H O consecutively. The flow-through was collected in a 20-mL
anomeric 13C NMR (D
HRFABMS calcd for C32
917.3008.
O): δ 89.83, 95.31, 102.66, 102.66, 102.78.
25 (M + Na): 917.2975. Found:
plastic vial. ScintiVerse BD (5 mL, Fisher) was added, and the vial
was vortexed completely. The radioactivity of the enzyme was counted
in a liquid scintillation counter (Beckmann LS counter). One unit (U)
of enzyme activity is defined as the amount of enzyme that catalyzes
the transfer of 1 µmol of galactose from UDP-Gal to lactose per minute
at 37 °C.
2
54 4
H N O
Acknowledgment. We acknowledge the generous support
from NIH (GM54074), NSF(BES-9728366), ACS-PRF(301616-
G1), American Cancer Society, FL Division (F95UM-2),
American Heart Association, FL Affiliate (9701760), Mizutani
Foundation (138A), Herman Frash Foundation (449-HF97), and
Hercules Inc. for our research programs.
General Procedure for Galactosylation of Lactose and LacNAc
Acceptors (1a-f) Using the Two-Enzyme System. Trisaccharides
2
(
(
a-f. To a mixture of the acceptor (480 µmol, 40 mM), UDP-glucose
576 µmol, 48 mM), MnCl (10 mM), and bovine serum albumin (BSA)
0.1%) in Tris-HCl buffer (100 mM, pH ) 7.0, 12 mL) were added
2
the enzymes UDP-galactose-4-epimerase (10 U) and R(1f3)-galacto-
syltransferase (7 U). The reaction was shaken under an argon
atmosphere at room temperature (ca. 25 °C) for 3 days. The mixture
was passed through Dowex-Cl anion-exchange resin and purified with
gel permeation chromatography (Bio-Gel P2). The following R-ga-
Supporting Information Available: Spectral data for
compounds 2a-f and 3-5 (22 pages, print/PDF). See any
current masthead page for ordering information and Web access
instructions.
lactosyl trisaccharides were prepared according to this method:
1
2
a (126 mg, 52%). Selected anomeric H NMR (D
2
O): δ 4.33 (d,
JA9808898