Probing structural requirements for human topoisomerase I inhibition by a novel N1-Biphenyl fluoroquinolone

European Journal of Medicinal Chemistry 172 (2019) 109 e 130

Contents lists available at ScienceDirect

European Journal of Medicinal Chemistry

journal homepage: http://www.elsevier.com/locate/ejmech

Research paper

Probing structural requirements for human topoisomerase I inhibition

by a novel N1-Biphenyl ﬂuoroquinolone

a

b

a

Justine L. Delgado , Sarah R.C. Lentz , Chaitanya A. Kulkarni , Pratik R. Chheda ,

b

a, *

Hailey A. Held , Hiroshi Hiasa , Robert J. Kerns

Division of Medicinal and Natural Products Chemistry, Department of Pharmaceutical Sciences and Experimental Therapeutics, College of Pharmacy,

University of Iowa, 115 S Grand Ave., S321 Pharmacy Building, Iowa City, IA, 52242, USA

a

b

Department of Pharmacology, University of Minnesota Medical School, 6-120 Jackson Hall, 321 Church Street SE, Minneapolis, MN, 55455, USA

a r t i c l e i n f o

a b s t r a c t

Article history:

Received 13 November 2018

Received in revised form

Fluoroquinolones substituted with N-1 biphenyl and napthyl groups were discovered to act as catalyt-

ically inhibitors of human topoisomerases I and II, and to possess anti-proliferative activity in vivo.

Structural requirements for these novel quinolones to inhibit catalytic activity of human topoisomerase I

have not been explored. In this work novel derivatives of the N-1 biphenyl ﬂuoroquinolone were

designed, synthesized and evaluated to understand structural requirements of the C-3 carboxylic acid, C-

13 March 2019

Accepted 16 March 2019

Available online 20 March 2019

6

ﬂuorine, C-7 aminomethylpyrrolidine, C-8 methoxy, and the N-1 biphenyl functional groups for hTopoI

inhibition. Characterization of each analog for inhibition of hTopoI catalytic inhibition reveals critical

insight into structural requirements of these novel quinolones for activity. Additionally, results of DNA

binding and modeling studies suggest that N-1 biphenyl ﬂuoroquinolones intercalate between the DNA

base pairs with the N-1 biphenyl functional group, rather than the quinolone core, and that this mode of

DNA intercalation contributes to inhibition of hTopoI by these novel structures. The results presented

here support further development and evaluation of N-1 biphenyl ﬂuoroquinolone analogs as a novel

class of anti-cancer agents that act through catalytic inhibition of hTopoI.

Keywords:

Fluoroquinolones

Topoisomerase

hTopoI inhibitor

Catalytic inhibitors

Anti-cancer

©

1

. Introduction

type IC topoisomerase [6]. There are two subtypes of type II top-

oisomerases, type IIA and type IIB. Topoisomerase VI from archaea,

some plants, and a few bacteria are type IIB topoisomerases. All

other type II topoisomerases, including bacterial DNA gyrase and

topoisomerase IV, as well as eukaryotic topoisomerase II (Topo II),

belong to the type IIA subtype. Type IIA topoisomerases are cellular

targets of clinically important antibacterial (e.g. ﬂuoroquinolones)

and anticancer (e.g. etoposide) drugs [7e12].

Topoisomerase inhibitors are classiﬁed as either ‘topoisomerase

poisons’ or ‘catalytic inhibitors’ based on their modes of action

[7e12]. Topoisomerase poisons bind a topoisomerase-DNA com-

plex after DNA has been cleaved, block DNA religation, and trap a

DNA topoisomerases are ubiquitous enzymes that control the

topology of DNA [1e5]. They play critical roles in many biological

processes that involve DNA, such as DNA replication, chromosome

segregation, and transcription. There are two types of top-

oisomerases, type I and type II [1e5]. Type I topoisomerases cleave

one DNA strand of duplex DNA to create a nick, passing the other

DNA strand through the nick, and then resealing the broken strand,

whereas type II topoisomerases cleave both DNA strands of duplex

DNA to create a double-strand break (DSB), passing another

segment of duplex DNA through the DSB, and then resealing the

broken DNA strands. Type I topoisomerases are further divided into

type IA, type IB, and type IC subtypes. Type IA subtype includes

topoisomerase III and bacterial topoisomerase I (Topo I). Eukaryotic

Topo I belongs to the type IB subtype and a unique type I enzyme,

topoisomerase V, from Methanopyrus kandleri is the only known

covalent topoisomerase-DNA catalytic intermediate as

a

topoisomerase-drug-DNA ternary complex. Thus, topoisomerase

poisons convert an essential enzyme into a cytotoxic covalently-

attached protein adduct. Ternary complex formation initiates

cytotoxic events, including the inhibition of DNA replication and

the generation of DSBs. Clinically successful antibacterial and

anticancer drugs are topoisomerase poisons [7e12]. These include

ﬂuoroquinolones, which poison DNA gyrase and topoisomerase IV,

*

Corresponding author.

E-mail address: robert-kerns@uiowa.edu (R.J. Kerns).

https://doi.org/10.1016/j.ejmech.2019.03.040

0

110

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

and etoposide and doxorubicin, which poison human Topo II

relaxation activity of hTopo I. These studies identiﬁed preferred

structures at the N-1, C-3, C-7, and C-8 positions. Docking and

modeling experiments suggested that 217 may intercalate into DNA

through either the quinolone core or the N1-biphenyl group. An

antibacterial ﬂuoroquinolone moxiﬂoxacin intercalates into DNA

only through the quinolone core. Thus we propose a model that for

the unique ability of N1-biphenyl ﬂuoroquinolones to inhibit hTopo

I activity is due to the DNA intercalation through the N1-biphenyl

group.

(

hTopo II), as well as irinotecan, which poisons human Topo I

hTopo I). Although topoisomerase poisoning is an effective cell-

killing mechanism, it is also the cause of various genotoxicities,

including the development of therapy-related secondary cancer

[

13,14] because it induces DNA breaks.

Catalytic topoisomerase inhibitors interfere with steps other

than the strand breakage-religation step to inhibit the catalytic

activity of a topoisomerase [8,11,12,15,16]. Simocyclinone D8 and

aclarubicin inhibit the DNA binding step [17e19], and amino-

coumarins and bisdioxopiperazines are ATPase inhibitors [20e23].

Simocyclinone D8 and aminocoumarins target DNA gyrase and

topoisomerase IV whereas aclarubicin and bisdioxopiperazines

target hTopo II [8,11,12,15,16]. Unlike topoisomerase poisons, these

catalytic inhibitors do not induce DNA breaks. However, their

clinical success is limited primarily due to their lower potency

compared to topoisomerase poisons as well as other liabilities in-

dependent of mechanism of action.

In previous studies we discovered that N1-biphenyl ﬂuo-

roquinolone UITT-3-217 (217, Fig. 1) and N1-napthyl ﬂuo-

roquinolone UITT-3-227 (227) could inhibit the catalytic activity of

both hTopo I and hTopo II [24,25]. Fluoroquinolones are normally

selective poisons of bacterial type II topoisomerases [7e12]. How-

ever, a few ﬂuoroquinolones, such as voreloxin and CP-115,955,

have been shown to poison hTopo II [26e28]. Thus, a modest

inhibitory effect of 217 and 227 on hTopo II activity (IC50 values for

2. Results and discussion

2.1. Chemistry

0

Synthesis of a quinazoline-2,4-dione derivative with N-1 1,1 -

biphenyl-4-ylmethyl and naphthalen-2-ylmethyl substitutions,

cognate derivatives of ﬂuoroquinolones 217 and 227, using tradi-

tional top-down or bottom-up approaches to ring closing was un-

successful. The acidic nature of the benzylic protons for these N-1

substituents prevents ring closing using either of the traditional

approaches. Therefore, as outlined in Scheme 1, we developed a

novel route to obtain advanced intermediate 17 which is amenable

to rapid derivatization at the N-1 position. Brieﬂy, commercially

available methyl 2-amino-4,5-diﬂuorobenzoate (14) was reacted

with (R)-(þ)-3-(Boc)-amino)pyrrolidine in presence of base to give

intermediate 15. The aniline moiety of 15 was reacted with 4-

nitrophenylchloroformate to give carbamate 16, upon which tert-

butylcarbazate was employed to displace 4-nitrophenol followed

by cyclization in the presence of base to give Boc-protected qui-

nazoline-2,4-dione (17). Alkylation of 17 with bromomethylbi-

phenyl, followed by deprotection of C-7 substituent Boc group

under acidic conditions gave the desired quinazoline-2,4-dione

UICK-II-215a (1).

The synthesis and chemical analysis of 217 and advanced in-

termediates (18, 19 and 22) have been reported previously [24].

Synthesis of C-3 modiﬁed derivatives using this synthetic route and

these intermediates is shown (Scheme 2). First, aniline 18 was

alkylated with a biphenyl alkyl halide at the N-1 position under

basic conditions, yielding ester intermediate 19. The methyl ester

19 was dissolved in methylamine (neat), 2 mM ammonia in

methanol, or 1 N hydroxylamine in EtOH to form the C-3 N-methyl

amides 20a and 21, amide 20b, or hydroxamic acid 20c, respec-

tively. The C-7 aminomethylpyrrolidine (AMP) group was added via

217 and 227 in a decatenation assay were 127.6 mM and 164.6 mM,

respectively) was not unexpected [24]. However, it was completely

unexpected to ﬁnd that 217 could inhibit the catalytic activity of

hTopo I (IC50 values for 217 and 227 in a relaxation assay were

2

6.0 mM and 43.7 mM, respectively) and that its activity against

hTopo I was signiﬁcantly higher than that against hTopo II [25].

Although the levels of topoisomerase inhibition by 217 appeared to

be modest, the IC50 value of 217 in relaxation assay was similar to

that (27 mM) of camptothecin [29]. These ﬂuoroquinolones did not

poison either hTopo I or hTopo II. To our knowledge, this is the ﬁrst

ﬂuoroquinolone that is capable of inhibiting the catalytic activity of

type I topoisomerases. The 60 DTP Human Tumor Cell Line Screen

at the National Cancer Institute (NCI) showed that 217 and 227

exhibited signiﬁcant growth inhibition (the mean GI50 values of 217

and 227 to be 1.9

of both 217 and 227 are signiﬁcantly lower than that of etoposide

25]. A proof of concept efﬁcacy study in mice with 217 and 227

mM and 3.1 mM, respectively) and the GI50 values

[

using a colon cancer (HT-29) xenograft model showed that 217

inhibited the proliferation of colon cancer in vivo as well as ﬂuo-

rouracil, one of the ﬁrst line drugs used for colon cancer treatment

N

S -aromatic substitution of the C-7 ﬂuorine. Subsequent treatment

with aqueous hydrochloric acid removed the Boc protecting group

to afford 3 a-c (Scheme 2). The C-3 ester analog 2 was synthesized

[

25]. Compound 227 also exhibited activity but was not as effective

N

from intermediate 19 by direct S Ar substitution of the C-7 ﬂuorine

as 217 in the xenograft model.

with the AMP group followed by treatment with aqueous hydro-

chloric acid to remove the Boc protecting group (Scheme 2).

Ester 19 was employed as common intermediate to synthesize a

series of C-7 substituted analogs of 217. Ester hydrolysis using

lithium hydroxide yields carboxylic acid 22, as shown in Scheme 3.

Toward advancing the translation of 217, we designed and

synthesized structural derivatives of 217 in order to determine the

structural requirements of this novel N1-biphenyl ﬂuoroquinolone

to act as a catalytic inhibitor of hTopo I activity (Fig. 1). In addition,

each compound prepared was evaluated for ability to inhibit the

N

The C-7 substituents were subsequently added through S Ar sub-

stitution of the C-7 ﬂuorine with various amines to afford 4 a-i.

Analogs 4 c-i required subsequent treatment with aqueous hy-

drochloric acid to remove the Boc protecting group (Scheme 3).

Analogs of 217 having C-8 hydrogen in place of C-8 methoxy

were synthesized through an alternate route for quinolone core

formation. Commercially available 2,4,5-triﬂuoro-b-oxobenzene-

propanoic acid ethyl ester, 23, was reﬂuxed in triethylorthoformate

and acetic anhydride to afford enol ether intermediate 24 (Scheme

4). Enol ether 24 was then substituted with 4-(aminomethyl)

biphenyl and subsequently treated with 18-crown-6 to effect

cyclization to obtain the quinolone ethyl ester 25. Hydrolysis of

ester 25 under basic conditions with lithium hydroxide affords

Fig. 1. Structural requirements for hTopo I inhibition by 217. Role of structural el-

ements examined in this study are shown.

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

111

ꢀ

Scheme 1. Synthetic route for quinazoline-2,4-dione analog UICK-II-215a (1). (i) (R)-(þ)-3-(Boc)-amino)pyrrolidine, TEA, DMF, 80 C. (ii) 4-nitrophenyl-chloroformate, DIPEA, DCM,

ꢀ

rt. (iii) t-butylcarbazate, DIPEA, THF, reﬂux. (iv) K

2

CO

3

, MeOH, 50 C. (v) 4-bromomethylbiphenyl, K

2

CO

3

, THF, reﬂux. (vi) TFA, reﬂux.

0

Scheme 2. Synthetic route for series of C-3 modiﬁed, C-8 methoxy ﬂuoroquinolones 2, 3 a-c, and 21. Reagents and conditions: (i) 4-(bromomethyl)-1,1 -biphenyl, K

2

CO , CAN; (ii)

3

ꢀ

4

0% Methylamine in H

2

O, ACN, 60 C; (iii) Ammonia in MeOH, 35 C; (iv) hydroxylamineꢁHCl in EtOH, room temperature (rt); (v) (R)-(þ)-3-(Boc)-amino)pyrrolidine, TEA, DMSO,

ꢀ

60

C; and (vi) 3 N HCl, ACN, rt.

ꢀ

Scheme 3. Synthetic route for N-1 biphenyl, C-7 modiﬁed derivatives 4 a-i. (i) 1% LiOH, THF, rt. (ii) 1 or 2 amine, TEA, DMSO or ACN, rt - 60 C. (iii) TFA, rt or 3 N HCl, ACN, rt.

112

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

0

Scheme 4. Synthetic route for series of C-8 hydrogen, C-6 ﬂuorine analogs 5 a-l. (i) Ac

2

O, triethylorthoformate, reﬂux. (ii) [1,1 -biphenyl]-4-ylmethanamine, 1,4-dioxane, rt. (iii)

ꢀ

K

2

CO

3

, 18-crown-6, 85 C. (iv) 1% LiOH, THF, rt - 40 C. (v) 1 or 2 amine, TEA or DIPEA, ACN or DMSO, 35e70 C. (vi) 3 N or 4 N HCl, ACN, rt.

carboxylic acid 26. Intermediate 26 was then substituted at C-7

with selected primary or secondary amines to give 5 a-l. Subse-

quent treatment with aqueous hydrochloric acid was required to

remove Boc protecting groups, when present, to afford 5 a-k.

Two C-6 des ﬂuoro derivatives of 217 were synthesized begin-

ning from commercially available 2,4-diﬂuorobenzoic acid, 27,

which on reaction with ethyl potassium malonate afforded propa-

nate intermediate 28 (Scheme 5). Ethyl 3-(2,4-diﬂuorophenyl)-3-

oxopropanoate, 28, was then reﬂuxed in triethylorthoformate and

acetic anhydride to give enol ether intermediate 29, which was

substituted with 4-(aminomethyl)biphenyl or (4-(1H-pyrazol-1-yl)

phenyl)methanamine and subsequently treated with sodium hy-

droxide to effect cyclization to furnish ethyl esters 30 a-b. The ethyl

esters were hydrolyzed using lithium hydroxide to give carboxylic

acids 31 a-b, to which the AMP group was added substituted at the

C-7 position, followed by treatment with aqueous hydrochloric acid

to remove the Boc protecting group, to afford 6 a-b.

afforded derivatives 7 a-c and 8c, respectively (Scheme 6).

Various C-8 H, N-1 bis-aryl derivatives were synthesized from

intermediate 24. Substitution of enol ether 24 with the appropriate

amine, followed by treatment with sodium hydride to afford

cyclization, and subsequent ester hydrolysis with lithium hydrox-

ide affords intermediates 9e13. Intermediate 9 was substituted at

C-7 with various secondary amines under weakly basic conditions

to give 9 a-f. Subsequent treatement with aqueous hydrochloric

acid was required to remove C-7 Boc protecting groups, when

present, to afford analogs 9 a-e. Similarly, the AMP group was

substituted at the C-7 position of carboxylic intermediates 10e13,

affording 10a, 11a, 12a, and 13a. Subsequent treatement with

aqueous hydrochloric acid was required to remove the Boc pro-

tecting group, as shown in Scheme 7.

2

.2. Activities of 217 derivatives against hTopo I

A series of C-8 OMe, N-1 bis-aryl derivatives was synthesized

starting from intermediate 18 (Scheme 6). The secondary aniline

.2.1. The quinolone core is not required for catalytic inhibiton of

hTopo I

First, we examined if the quinolone core structure is essential

for the ability of N-1-biphenyl quinolones to inhibit the catalytic

activity of hTopo I. An N-1-biphenyl quinazoline-2,4-dione UICK-2-

(N-1) of 18 was alkylated with the selected bis-aryl alkyl halides

under basic conditions to yield compounds 32 a-c. Hydrolysis of

methyl ester under basic conditions yields carboxylic acids 33 a-c.

Subsequent S Ar substitution of the C-7 ﬂuorine with Boc-AMP or

N

Boc-(R)-aminopyrrolidine (Boc-AP), followed by treatment with

aqueous hydrochloric acid to remove the Boc protecting groups,

215a (1), which lacks a C-3-carboxylate group, and has a N-3-amino

group, was synthesized and found to be as active as 217 (Table 1).

To further evaluate the role and/or requirement of the C-3-

ꢀ

Scheme 5. Synthetic route for series of C-8 hydrogen, C-6 hydrogen analogs 6 a-b. (i) Ethyl potassium malonate, TEA, oxalyl chloride, ACN, DCM, 0 C to rt. (ii) Ac

2

O, triethylor-

ꢀ

0

ꢀ

thoformate, 120 C. (iii) [1,1 -biphenyl]-4-ylmethanamine, MeOH, 0 C to rt. (iv) (4-(1H-pyrazol-1-yl)phenyl)methanamine, MeOH, 0 C to rt. (v) NaH, dioxane, 0 C to rt. (vi) 1%

LiOH, THF, 40 C. (vii) (R)-(þ)-3-(Boc)-amino)pyrrolidine, DIPEA, ACN or DMSO, 35e70 ^ꢀC. (viii) 3 N HCl, ACN, rt.

ꢀ

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

113

ꢀ

2 3

Scheme 6. Synthetic route for C-8 methoxy, N-1 aryl ﬂuoroquinolone derivates, 8 a-c, 9c. (i) 1-(4-(bromomethylphenyl)-1H-pyrazole, K CO , ACN, 45 C. (ii) 5-(bromomethyl)-3-

ꢀ

0

ꢀ

phenylisoxazole, K

2

CO3, ACN, 45 C. (iii) 4-ﬂuoro-4 -methyl-1,1 -biphenyl, K

2

CO

3

, DMF, 50 C. (iv) 1% LiOH, THF, rt. (v) (R)-tert-butyl(pyrrolidin-3-ylmethyl)carbamate, TEA, DMSO or

ꢀ

ACN, rt - 60 C. (vi) (R)-(þ)-3-(Boc-amino)pyrrolidine, TEA, ACN. (vii) TFA, rt. (viii) 4 N HCl, ACN, rt.

ꢀ

Scheme 7. Synthetic route for C-8 hydrogen, N-1 bis-aryl ﬂuoroquinolone analogs 9a-f, 10a, 11a, 12a, and 13a. (i) 4-(1H-pyrazol-1-yl)phenyl methanamine, MeOH, 0 C to rt. (ii) 3-

ꢀ

phenylisoxazol-5-yl methylamine, MeOH, 0 C to rt. (iii) 3-(4-pyridinyl)-1,2,4-oxadiazole-5-methanamine, MeOH, rt. (iv) 1-(3-pyridin-4-yl-1,2,4-oxadiazol-5-yl)ethanamine, MeOH,

ꢀ

0

ꢀ

0

C to rt. (v) (4 -ﬂuoro-[1,1 -biphenyl]-4-yl)methanamine, MeOH, rt. (vi) NaH, dioxane, 0 C to rt. (vii) 1% LiOH, THF, rt. (viii) 2 amine, TEA or DIPEA, DMSO, 40 - 70 C. (ix) 4 N HCl,

ACN, rt.

carboxylic acid for hTopo I inhibition, the methyl ester [UIJD-2-224

than 217 (Fig. 2 and Table 1), suggesting that the C-8-OMe group

was not required for the inhibition of hTopoI. In fact, the hydrogen

appeared to be preferred over a methoxy group at the C-8 position.

Substitution of the quinolone core with a C-6 ﬂuorine dramat-

ically enhances antibacterial potency. However, it was not clear if a

C-6 ﬂuorine would or would not play a role in the catalytic inhi-

bition of hTopoI. To directly examine the role of the C-6 ﬂuorine,

UIPC-2-086B (6a), a C-6 desﬂuoro quinolone analog of 5a, was

synthesized. The comparison of the IC50 value of 6a with that of 5a

showed that the loss of the C6-ﬂuorine resulted in an approximate

4-fold reduction in inhibitory potency against hTopoI (Table 1).

Thus, the C6-ﬂuorine can affect, although is not essential for, the

inhibition of hTopo I by N1-biphenyl quinolones.

(2)], N-methyl amide [UIJD-2-242 (3a), hydroxamic acid [UIJD-2-

2

46 (3c)] and amide [UIJD-2-251 (3b)] analogs of 217 were

compared in the relaxation assay with hTopo I (Table 1). Similar to

the quinazoline-2,4-dione (1), the C-3-hydroxamic acid (3c) was as

active as 217. However, C-3- methyl ester (2), N-methyl amide (3a),

and amide (3b) were 3- to 7-fold less active than 217. These results

demonstrated that the C-3-carboxylate group was not required for

the catalytic inhibition of hTopo I activity by N-1-biphenyl com-

pounds, but it could modulate the activity.

Since quinazoline-2,4-dione (1), which has a C-8-hydrogen (C-

8

-H) (C8-H) in place of C-8-methoxy (OMe), was as active as 217,

the C-8-H, N1-biphenyl ﬂuoroquinolone CK-2-065 (5a) was syn-

thesized in order to initially determine potential effect of the C-8-

OMe substituent. The relaxation assay with hTopo I demonstrated

that ﬂuoroquinolone 5a was slightly more active against hTopo I

2.2.2. C7 derivatives of N1-biphenyl ﬂuoroquinolones

Primary amines are susceptible to metabolism due to N-

114

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

Table 1

Effect of changes in the quinolone core on hTopo I inhibition.

Table 2

Effects of C7 modiﬁcations on hTopo I inhibition.

Compound Structure

IC50

(

m

M)^a

Compounds

Structure

hTopo I inhibition^a

None^b

2

0

17

26.0 ± 0.5^b

25.9 ± 5.4

71.4 ± 1.6

82.1 ± 4.6

184.2 ± 6.9

35.9 ± 3.6

15.6 ± 1.1

61.2 ± 0.9

214B/22

15a/1

24/2

2

1

0

2

1

2

1

2

15B/21

15/4a

16/4b

86/4c

97/5f

None^b

> 200^c

42/3a

51/3b

46/3c

65/5a

86B/6a

> 200^c

154.6 ± 26.7

167.6 ± 22.3

92.2 ± 0.6

63.6 ± 6.6

57.7 ± 6.6

34.8 ± 0.3

> 200^c

26/4d

17/5g

28/4e

18/5h

64/4f

a

The IC50 values against hTopo I were determined in the relaxation assays [25].

Data from the previous study [25].

b

Fig. 2. Relaxation assay for hTopo I Inhibition. The activities of 217 and 5a against

hTopo I were determined in the relaxation assays for hTopo I [25]. Representative

results are shown here.

81B/5b

72.8 ± 7.7

acetylation and oxidation by monoaminoxidase and CYP450

[

30,31]. Thus, the primary amine on the C-7-AMP group is a pre-

276B/4g

> 200^c

dicted structural liability due to metabolic instability. Here, we

looked to determine the structural requirements of the C-7 func-

tional group while concomitantly improving likely metabolic sta-

bility of the C-7 side chain. Removal of the C-7-AMP group (UIJD-2-

214B (22) and UIJD-2-215B (21)) completely abolished ability to

inhibit hTopo I (Table 2). Thus, we introduced substitutions for the

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

115

Table 2 (continued )

was signiﬁcantly affected, both exhibited equivalent hTopoI inhib-

itory activity (Table 2). Furthermore, the C-7-AMP group of 217 was

substituted with either an aminopyrrolidine [UIJD-2-226 (4d), with

C-8-OMe] or [UIJD-3-117 (5g) with C-8-H] and a (methylamino)

pyrrolidine [UIJD-2-228 (4e) with C-8-OMe] or [UIJD-3-118 (5h)

with C-8-H] to evaluate the required positioning of the C-7 amine

on the pyrrolidine ring. The activity of the C-8-OMe analogs, with C-

7-(methylamino) pyrrolidine substituted (4e) was about 2-fold

lower than that of 217, whereas the activity of the C-7-

aminopyrrolidine (4d) was more than 3-fold lower than that of

_h_T_o_p_o_I_i_n_h_i_b_i_t_i_o_na

Compounds

Structure

282B/5c

275B/4h

269B/5d

> 200^c

101.0 ± 1.7

63.6 ± 6.0

217 (Table 2). The activity of the C-8-H analogs, with C-7-

aminopyrrolidine substituted (5g) is 4-fold lower than 5a,

whereas the C-7-(methylamino)pyrrolidine analog (5h) was only 2-

fold lower than that of 5a. Both the C-8-H analogs 5g and 5h had

improved inhibition of hTopoI as compared to the cognate C-8-OMe

analogs 4d and 4e. However, all modiﬁcations to the AMP resulted

in reduced inhibition of hTopo I.

2

85B/4i

71B/5e

> 200^c

Results described above demonstrated that structural de-

rivatives having a C-8-H were more potent inhibitors of hTopo I

than those substituted at C-8 with a methoxy group. Therefore,

additional C-8-H derivatives having a secondary amine on the C-7

functional group were synthesized and evaluated [UICK-4-089 (5l),

UICK-4-091 (5k), UICK-4-093 (5i), UICK-4-095 (5j). This panel of 5a

analogs was designed to determine if a secondary amine with more

rigid moieties could maintain activity against hTopo I. Two C-7-

pyrrolidine(methanamine) isomers (5i and 5j) were synthesized

to compare the stereochemistry requirement, if any, at the C-7

position. Both isomers had essentially identical activity against

hTopo I (Table 3). Furthermore, their activities were somewhat

similar to the activity of the C-7 N-methylpropylenediamine (5d)

analog with a secondary amine placed at 5 atoms from the core by a

ﬂexible alkyl chain. Thus, this data suggests that there is no rigid

three-dimensional orientation requirement for the secondary

amine at the C-7 position.

2

88.3 ± 1.1

a

b

c

IC50 values (

None, no inhibition was detected at 200

Compounds with IC50 values > 200 exhibited at least 10% inhibition at 200

m

M) determined in the relaxation assay.

mM.

m

M.

primary amine of AMP with either a secondary amine, or non-

amine, as well as various substitutions of the entire pyrrolidine

ring.

First, the effect of changing the primary amine on the C-7-AMP

group to an amide [UIJD-2-115 (4a)] or hydroxyl [UIJD-2-116 (4b)]

on activity against hTopo I were assessed. Neither the amide (4a)

nor hydroxyl (4b) derivatives retained hTopo I inhibitory activity

Compound 5k, which has the more rigid diazabicyclononane

group substituted at the C-7 position, was 4-fold less active than

the cognate C-7-AMP derivative, 5a (Table 3). However, 5k was

nearly 3-fold more active than the C-7 N-methyl AMP analog, 5f,

which also bears a secondary amine. These results further suggest

(Table 2). Combined, these results showed the terminal amine on

the C-7-AMP group is critical for hTopo I inhibition.

Next, we replaced the pyrrolidine ring with a more ﬂexible alkyl

chain with both C8-OMe [UIJD-1-264 (4f), UIJD-2-276B (4g), UIJD-

Table 3

2

-275B (4h), and UIJD-2-285B (4i)] and C8-H [UIJD-2-281B (5b),

UIJD-2-282B (5c), UIJD-2-269B (5d), and UIJD-2-271B (5e)]

Table 2). Additionally, the effect of the distance of the C7 amine

Effects of C7 modiﬁcations on hTopo I inhibition.

Compounds

93/5i

Structure

hTopo I inhibition^a

(

from the quinolone core was examined by placing the amine at 4, 5,

or 6 atoms away from the quinolone core. Compounds 4f and 4g, as

well as 5b and 5c, have either a primary (4f and 5b) or secondary

amine (4g and 5c) placed at 4 atoms away from the quinolone core.

Compounds 4h and 5d, and 4i and 5e have a secondary amine

placed at 5 and 6 atoms away from the quinolone core, respectively.

All of these analogs with a ﬂexible C-7 side chain had 4-fold or

greater reduced activity as compared to their parent compound,

either 217 or 5a (Table 2), indicating that a certain rigidity of the C-7

side chain is likely important for optimal catalytic inhibition of

hTopo I. Although their activities were reduced, the analogs with a

secondary amine placed at 5 atoms away from the quinolone core

0

103.9 ± 8.4

095/5j

100.4 ± 5.0

61.0 ± 6.2

33.3 ± 1.0

0

91/5k

89/5l

(

4h and 5d) exhibited the highest activity, whereas analogs with a

secondary amine placed at 4 atoms away from the quinolone core

4g and 5c) exhibited lowest activity. As was the case with 5a

(

relative to 217 (Table 1), the C-7 ﬂexible analogs with the C-8-H

core were more active than those with the C-8-OMe core (Table 2).

We also substituted the terminal primary amine of the AMP

group with an N-methyl amine [UIJD-2-086 (4c)] and [UICK-II-097

(5f)]. Although the activity of N-methyl derivatives (4c) and (5f)

a

IC50 values (

m

M) determined in the relaxation assay.

116

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

that increased rigidity of the C-7 side chain may improve the ac-

tivity of N-1-biphenyl ﬂuoroquinolones against hTopo I. To test this

possibility, compound 5l with a rigid diazabicyclooctane group at

the C-7 position was synthesized. Compound 5l turned out to be

one of the most active analogs tested in this study (Table 3), with

only a 2-fold loss in activity compared to 5a. Since 5l is expected to

have improved metabolic stability, it will be further tested for its

in vitro and in vivo anti-proliferative activity as compared to parent

derivative 217.

Table 4

Effects of N-1 modiﬁcations on hTopo I inhibition.

Compounds

92B/7a

Structure

hTopo I inhibition^a

2

>200

290B/9a

91.6 ± 6.5

61.0 ± 3.7

178.4 ± 7.9

2

.2.3. N1 derivatives

As compared to typical antibacterial ﬂuoroquinolones, the N1-

biphenyl modiﬁed derivatives studied above had generally poor

aqueous solubility, which limited the dosing range in the in vivo

studies [25]. To improve aqueous solubility while concomitantly

determining the structural requirements of the N-1 functional

group for hTopo I inhibition, we substituted the phenyl rings of the

biphenyl group with a pyrazole [UIJD-2-292B (7a) and UIJD-2-290B

1

2

59B/6b

94B/7b

(9a)], oxazole [UIJD-2-294B (7b) and UIJD-2-286B (10a)], or pyr-

idinyl diazaoxazole [UIJD-3-130 (11a) and UIJD-3-067C (12a)]. The

N-1 pyrazole (7a) and oxazole (7b) analogs having a C-8-OMe

substituent displayed a 7-fold or greater loss in hTopo I inhibition

as compared to N-1 biphenyl 217 (Table 4). The N-1 pyrazole (9a)

and oxazole (10a) analogs, with unsubstituted C8-H, had a 4-fold to

2

1

0

86B/10a

58.3 ± 2.8

6

-fold loss in hTopo I inhibition as compared to N-1 biphenyl 5a.

Neither of the N-1 diazaoxazole pyridine analogs (11a and 12a)

inhibited hTopoI. These results demonstrated that the 6-membered

bicyclic rings are likely preferred for hTopoI inhibition over the 5-

membered heterocyclic rings. Again, derivatives unsubstituted at

the C-8 position (C-8-H) had lower IC50 values compared to the

cognate C-8-OMe derivatives (Table 4), supporting our earlier

ﬁnding that C-8-H is preferred over C-8-OMe for hTopo I inhibition.

While these modiﬁcations at the N-1 position did not improve

hTopoI inhibitory activity, the N-1 heterocyclic analogs were

designed to improve aqueous solubility of the parent compounds.

Of the N-1 heterocyclic analogs that inhibited hTopo I, the N-1

pyrazole analog 9a was predicted to have the best aqueous solu-

bility based on the calculated logP (Table S1). Combining preferred

structural modiﬁcations, we synthesized UIPC-II-159B (6b), a C-6

desﬂuoro quinolone analog of N-1 pyrazole 9a. Unlike 6a, which

exhibited 4-fold lower activity than its cognate C-6-ﬂuorine analog

30/11a

>200

67C/12a

>200

277/7c

60.9 ± 5.4

58.6 ± 4.6

69.6 ± 3.0

>200

7

a, 6b had a slightly higher activity than 9a (Table 4). These results

support the previous ﬁnding that the C-6-ﬂuorine is not essential

for the inhibition of hTopo I, and that structural change to C-6 af-

fects whether a given N-1 substituent will increase or decrease

potency.

2

1

44/8c

An overriding consideration of 217 as a novel catalytic inhibitor

of hTopo I is that the biphenyl group is predicted to be a promis-

cuous protein binding group and a structural liability, susceptible to

33/13a

0

metabolism [32,33]. Thus, N-1 4 -ﬂuoro biphenyl derivatives, UIJD-

1

-277 (7c), UIJD-2-244 (8c), and UIJD-3-133 (13a) were designed to

protect a predicted site of metabolism on the biphenyl group

Figure S2), and evaluated (Table 4). The 4-ﬂuorobiphenyl (7c)

(

304B/9b

analog exhibited 2-fold lower activity than parent compound 217.

The inhibition of hTopo I by the 4-ﬂuorobiphenyl derivative also

having a C-7-aminopyrrolidine group (8c) was slightly better than

that of the cognate N-1-biphenyl (4d) derivative (Table 4). The

in vivo stability of 7c and 8c, together with 217 and 4d, will be

tested in future studies to determine if, in fact, these modiﬁcations

improve metabolic stability of the N-1-biphenyl functionality

300B/9c

31.3 ± 1.7

(Figure S1 and S2).

A series of N-1-pyrazole, C-7-secondary amine derivatives, UIJD-

2

-299 (9f), UIJD-2-304B (9b), UIJD-2-300B (9c), UIJD-2-303B (9d),

and UIJD-2-298B (9e), were synthesized to combine structural

features likely to both improve aqueous solubility and C-7

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

117

Table 4 (continued )

into DNA (Fig. 1A). Interestingly, the N1-biphenyl group was also

found to intercalate into the DNA intercalation site (Fig. 1B). Anal-

ysis of the top 10 docked poses showed that the quinolone core and

N1-biphenyl group of 217 intercalated into DNA with equivalent

occurrence (data not shown). The top 10 docked poses of Moxi-

ﬂoxacin showed intercalation only through the quinolone core. We

then conducted another set of docking experiments using a 15 bp

sequence of dsDNA d(AGGTCACGGTGGCCA) having four predeﬁne

sites of intercalation, and found that 217 intercalated into DNA

through either the quinolone core (Fig. S3) or the N1-biphenyl

group (Fig. S4) with equivalent occurrence. In contrast, Moxi-

ﬂoxacin intercalated into DNA only through the quinolone core

(Fig. S5). Thus, docking experiments suggest a signiﬁcant difference

between quinolone-based topo II poisons and the quinlone-based

catalytic inhibitors of hTopo I here is that the hTopo I catalytic in-

hibitors possess two modes of DNA intercalation.

_h_T_o_p_o_I_i_n_h_i_b_i_t_i_o_na

Compounds

Structure

303B/9d

298B/9e

299/9f

187.4 ± 4.2

>200

172.5 ± 4.0

Previous studies determined the binding mode of Norﬂoxacin to

calf thymus DNA (Ct-DNA) and reported signiﬁcant quenching of

the ﬂuoroquinolone ﬂuorescence spectra upon addition of Ct-DNA,

and an observed bathochromic shift upon addition of Ct-DNA to

Norﬂoxacin indicating the ﬂuoroquinolone core intercalates be-

tween the DNA base pairs. We evaluated Ct-DNA binding of N1-

biphenyl ﬂuoroquinolones, 217 and 5a, at several ratios of DNA to

FQ and no bathochromic shift was observed under similar condi-

tions to those reported with Norﬂoxacin (Fig. S6 and S7). Modest

ﬂuorescence quenching was observed upon addition of Ct-DNA,

indicating FQ-DNA binding, however the quenching of ﬂuo-

roquinolone ﬂuorescence was much lower than observed with

antibacterial ﬂuoroquinolones. We therefore conducted additional

experiments to evaluate DNA binding of the N1-biphenyl ﬂuo-

roquinolones, 217 and 5a, with a 27-bp sequence, d(CCTTACGTG-

CATAGTCATTCATGACCG), of dsDNA previously used to determine

binding afﬁnity of several clinically used and novel ﬂuo-

roquinolones. The ﬂuorescence spectra and intensity of 217 and 5a

were measured in the absence and presence of dsDNA, ﬂuo-

a

IC50 values (

m

M) determined in the relaxation assay.

metabolic stability. Compound 9f, having a C-7-diazabicyclooctane

group to increase rigidity at the C-7 position exhibited a 2-fold loss

in hTopoI inhibitory activity compared to 9a, with the C-7-AMP

group that contains a primary amine (Table 4). The pyrrolidine

methylamine isomers 9d and 9e, as well as N-methyl pyrrolidine-

methanamine, 9b, had reduced hTopo I inhibition as compared to

the cognate C-7-AMP compound, 9a. We found that compound 9c,

having a C-7-diazabicyclononane group, to be the best inhibitor of

hTopo I as compared to 9a, with a 2-fold improvement of hTopo I

inhibition (Table 4). Thus, 9c together with 5l, will be tested for

in vitro and in vivo anti-proliferative activity in future studies.

2

.3. A model for the interaction of 217 with DNA

We have previously showed that 217 can intercalate into DNA

[

25]. To gain the insight into how 217 may interact with double-

roquinolone ﬂuorescence was quenched in

a concentration-

stranded DNA in a way that is different from antibacterial ﬂuo-

roquinolones, we conducted a series of qualitative docking exper-

iments. We ﬁrst examined if docking could predict (recapitulate)

the interaction of Moxiﬂoxacin, a control ﬂuoroquinolone, into a

predeﬁned intercalation site in a 12 bp sequence of dsDNA

d(CGCGAATTCGCG; PDB ID:1g3x) As expected, the quinolone core

of Moxiﬂoxacin intercalated into the DNA intercalation site

dependent manner upon addition of DNA (Fig. 4A and B). Howev-

er, a bathochromic shift was not observed upon addition of dsDNA

(Figure S8 and S9). Because the innate ﬂuoroquinolone ﬂuores-

cence is attributed to the quinolone core, a bathochromic shift is

observed upon DNA intercalation by the quinolone core. Thus,

these results further suggest that the N-1-biphenyl group over the

quinolone core is primarily responsible for DNA intercalation of

either 217 or 5a.

(Fig. 3C). Next, we examined the docking of 217 into the same DNA.

Similar to Moxiﬂoxacin, the quinolone core of 217 could intercalate

Because 217 and its analogs act differently from normal ﬂuo-

roquinolones, it seems possible that the second mode of DNA

intercalation, through the N-1 biphenyl group, may be important

for activity as a catalytic inhibitor of hTopo I. Unlike normal ﬂuo-

roquinolones, a quinazoline-2,4-dione has shown not to intercalate

into DNA. Thus, the activity of 1 to inhibit hTopo I (Table 1) supports

our model that intercalation through the N-1 bis-aryl group is

important for inhibition of hTopo I activity by the compounds un-

der investigation here. The added N-1 aryl functionality provides an

additional intercalative moiety and may convert these ﬂuo-

roquinolones to be threading intercalators, whereas moxiﬂoxacin

and other quinolone-based topoisomerase poisons are partial or

classic intercalators, blocking interaction with the minor groove of

DNA.

Guided by structural effects on activity of derivatives to inhibit

hTopo I and the binding observations, interactions, and docking of

quinolones with DNA, we propose a model for how 217 and its

derivatives here may inhibit hTopo I activity. The N1-biphenyl

ﬂuoroquinolone intercalates through the N-1-biphenyl group,

which would position the quinolone core in the minor groove of

DNA, where the C-7-group with required basic (cationic) amine is

Fig. 3. Docking of 217 and moxiﬂoxacin into double-stranded DNA. Either 217 or

moxiﬂoxacin was modeled into

a predeﬁned intercalation site of a dodecamer

d(CGCGAATTCGCG) (PDB ID: 1g3x) using the program MOE 2016.08. Out of the top 10

docked poses, 217 intercalated into the DNA through the quinolone core (panel A) and

N-1-biphenyl group (panel B) with equivalent occurrence. Moxiﬂoxacin (panel C)

intercalated only through the quinolone core.

118

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

Fig. 4. Representative ﬂuorescence intensities of 217 and 5a in the absence and presence of increasing concentrations of 27-bp sequence of dsDNA. The ﬂuorescence intensity

of either 217 (panel A) or 5a (panel B) [25

represent S.E.M.

mM] were measured in the absence and presence of increasing concentrations of dsDNA [0e200

mM]. Reported as n ¼ 3, error bars

positioned to interact with a phosphate of the DNA backbone

Fig. 3B). The presence of the quinolone core and/or the interaction

(254 nm) or by analytical HPLC. All analytical HPLC analyses were

performed using a Shimadzu system comprised of an LC-20AT

pump, DGU-14A degasser, CBM-20A system controller, and a SPD-

M10AVP photodiode array detector. The HPLC was operated using

Shimadzu Client/Server Version 7.4 software installed on a Dell

Optiplex GX400 PC. The column used was Restek Allure PFP Propyl

or Restek C-18 unless otherwise indicated. The mobile phase was

composed of water buffered with 0.1% Triﬂuoroacetic acid (TFA)

and acetonitrile also buffered with 0.1% TFA. The HPLC analyses

were obtained by running a gradient of 5%e95% buffered acetoni-

trile over 30 min with a ﬂow rate of 1.000 mL/min. Flash column

chromatography was carried out with the indicated solvents using

(

of the C-7 side chain with DNA may interfere with the binding of

hTopo I to DNA and/or the passing of one DNA strand through a nick

in the other strand by hTopo I. This unique mode of binding allows

the N-1 bis-aryl ﬂuoroquinolones to act as a hTopo I catalytic

inhibitors.

3

. Conclusion

Topoisomerase poisons trap topoisomerase-DNA covalent

complexes as topoisomerase-drug-DNA ternary complexes, which

leads to an increase in the level of topoisomerase-catalyzed double-

strand breaks. This mode of action (topoisomerase poisoning) is an

effective cell-killing mechanism, but it also causes genotoxicities,

including the development of therapy-related secondary cancer. In

the present study we describe initial structural requirements for,

and initial structural effects of, novel ﬂuoroquinolone-derived

structures that act as catalytic inhibitors of hTopo I. Catalytic in-

hibitors of hTopo I do not increase DNA breaks and thus lack a

signiﬁcant liability of hTopo poisons. Results demonstrate that

structure-function relationships for catalytic inhibition of hTopo I

do not compare in any way to known SAR for antibacterial ﬂuo-

roquinolones or to SAR for ﬂuoroquinolones that poison hTopo II.

Moreover, we demonstrate a unique mode of DNA binding, that

being threading intercalation, is likely central to the mechanism by

which these novel anticancer compounds act to inhibit hTopo I

catalytic activity. Combined, the results of this study provide the

structural and functional basis for the continued design, synthesis

and study of structural derivatives of this new type of hTopo I in-

hibitor toward the further development of a new class of anticancer

agents.

1

silica gel 230e400 mesh size. H were recorded at 300 or 400 MHz

19

and F NMR spectra were recorded at 282 MHz and reported in

ppm using appropriate deuterated solvents. Either a Bruker Ultra-

shield 300 MHz or Bruker DRX 400 MHz instrument was used to

collect NMR spectra. The chemical shifts are reported in ppm

relative to tetramethylsilane and solvent. Mass spectrometry data

were obtained in most cases using a Thermo LCQ Deca mass

spectrometer utilizing ESI ionization and quadrupole ion trap mass

analyzer. Final products were puriﬁed using reverse-phase semi-

preparative HPLC. The Shimadzu system was composed of the

following parts: two LC-10AT pumps (one for each solvent), SPD-

M10AVP photodiode array detector, and an SCL-10AVP system

controller. The HPLC system was operated using Shimadzu EZStart

Version 7.4 control software installed on a Dell Optiplex 755 PC. The

stationary phase used for separation was a Phenomenex Luna

PFP(2) or C-18 reverse phase column. The mobile phase was

composed of water buffered with 0.1% TFA and acetonitrile also

buffered with 0.1% TFA. Various gradients were used for separation

of products, but commonly a 5%e95% buffered acetonitrile gradient

over 60 min was used. All ﬁnal products are >95% pure determined

by analytical HPLC as shown in Table S2.

4

. Experimental section

4

.2. Synthesis

4.1. General experimental protocol

.2.1. Methyl (S)-2-amino-4-(3-(((tert-butoxycarbonyl)amino)

All commercially available chemicals and reagents were used

methyl)pyrrolidin-1-yl)-5-ﬂuorobenzoate (UICK-II-189, 15)

without any further puriﬁcation unless otherwise indicated. Reac-

tion progress was monitored by thin-layer chromatography (TLC)

on silica gel 60 ADAMANT plates with ﬂuorescence indicator

Methyl 2-amino-4,5-diﬂuorobenzoate (14) (250 mg, 1.33 mmol)

was dissolved in 4 mL DMF. TEA (2.5 eq) and R-tert-butyl(pyrroli-

din-3-yl methyl) carbamate (298.5 mg, 1.47 mmol) were added and

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

119

ꢀ

stirred at 80 C for 5 h. The reaction mixture was dissolved in 20 mL

DCM and washed with 10 mL water three times. The organic layer

was concentrated by rotary evaporation. The residual DMF was

removed by placing under high vacuum overnight. The residue was

puriﬁed by silica gel chromatography using gradient from 3:1

(analytical HPLC) ¼ 16.7 min.

0

4

.2.5. (S)-Methyl 1-([1,1 -biphenyl]-4-ylmethyl)-7-(3-

(aminomethyl)pyrrolidin-1-yl)-6-ﬂuoro-8-methoxy-4-oxo-1,4-

dihydroquinoline-3-carboxylate (UIJD-II-224, 2)

Hexanes:EtOAc to 1:1 Hexanes:EtOAc to yield pure UICK-II-189

15) Yield 73%. H NMR (300 MHz, CDCl

1

UIJD-II-219 (19) (59 mg, 0.14 mmol) was added to a ﬂame dried

round bottom ﬂask and place under vacuum. 1 mL of anhydrous

DMSO was added under argon atmosphere and stirred. Distilled

(

1

3

)

d

¼ 7.43 (d, J ¼ 15.4 Hz,

H), 5.73 (d, J ¼ 7.8 Hz, 1H), 4.70 (bs, 1H, exchangeable), 3.82 (s, 3H),

.53 (m, 3H), 3.20 (m, 3H), 2.47 (m, 1H), 2.08 (m, 1H), 1.71 (m, 1H),

_.₄₇₍_s_,₉_H₎_.1 F NMR (282 MHz, CDCl

9

TEA (60

mL, 0.4 mmol) and Boc-AMP (42.8 mg, 0.21 mmol) were

1

3

)

d

ꢂ141.00 (s, 1F). MS (ESI)

ꢀ

þ

added and the reaction mixture was heated to 60 C for 30 h 5 mL of

cold water was added and the precipitate was ﬁltered and washed

three times with cold water. The crude reaction product was dis-

solved in 1 mL of 3 N aqueous HCl and 1 mL of distilled ACN. The

reaction mixture was stirred for 48 h at room temperature and the

crude product puriﬁed by semi-preparative HPLC (C-18, 20e95%

calculated for (M þ H) 368.19, found 368.0.

4

.2.2. Methyl (S)-4-(3-(((tert-butoxycarbonyl)amino)methyl)

pyrrolidin-1-yl)-5-ﬂuoro-2-(((4-nitrophenoxy)carbonyl)amino)

benzoate (UICK-II-193, 16)

UICK-II-189

diisopropylamine (60

and allowed to stir for 10 min 4-Nitrophenylchloroformate

70.4 mg, 0.349 mmol) was added and the reaction was stirred for

0 min. White ppt is observed. 25 mL DCM was added to dissolve

the precipitate and the reaction mixture washed with 15 mL water

three times. The organic layer was dried over Na SO , concentrated

in vacuo, and puriﬁed by silica gel chromatography using a gradient

:1 hexanes:EtOAc to pure EtOAc, to give pure UICK-II-193 (16).

(15)

(97.6 mg,

0.32 mmol)

and

N,N-

ACN over 30 min). Affording 14.5 mg of pure 7 (UIJD-II-224), 20.7%

mL, 0.35 mmol) were dissolved in 7 mL DCM

1

yield. H NMR (400 MHz, MeOD)

d

8.96 (s, 1H), 7.77 (d, J ¼ 14.1 Hz,

1H), 7.60e7.52 (m, 4H), 7.44e7.36 (m, 2H), 7.34e7.27 (m, 1H), 7.23

(

3

(

3

d, J ¼ 8.3 Hz, 2H), 5.87 (dd, J ¼ 63.8, 15.4 Hz, 2H), 3.92 (s, 3H),

.71e3.63 (m, 2H), 3.53 (ddd, J ¼ 7.3, 6.6, 3.6 Hz, 1H), 3.50 (s, 3H),

.46 (ddd, J ¼ 10.5, 5.9, 1.8 Hz, 1H), 3.07 (d, J ¼ 7.2 Hz, 2H), 2.55 (dt,

2

4

J ¼ 11.0, 5.5 Hz, 1H), 2.25e2.16 (m, 1H), 1.74 (dq, J ¼ 16.6, 8.2 Hz, 1H).

1

9

F NMR (300 MHz, CDCl

3

)

d

ꢂ121.79 to ꢂ122.05 (m). Retention

5

þ

1

time (analytical HPLC) ¼ 19.7 min. MS ESI calculated for (M þ H)

Yield 90% H NMR (300 MHz, CDCl

3

)

d

¼ 11.21 (bs, 1H, exchange-

516.22, found 516.2.

able), 8.30 (dd, J ¼ 9.6, 2.6 Hz, 2H), 7.65 (d, J ¼ 9.7 Hz, 1H), 7.62 (d,

J ¼ 11.5 Hz, 1H), 7.41 (dd, J ¼ 9.6, 2.6 Hz, 2H), 4.70 (bs, 1H), 3.91 (s,

3

1

(

H), 3.64 (m, 3H), 3.23 (m, 3H), 2.48 (m, 1H), 2.10 (m, 1H), 1.72 (m,

0

4

.2.6. 1-([1,1 -biphenyl]-4-ylmethyl)-6,7-diﬂuoro-8-methoxy-N-

methyl-4-oxo-1,4-dihydroquinoline-3-carboxamide (UIJD-II-215A,

0a)

UIJD-II-196 (19) (90 mg, 0.21 mmol) was added to a ﬂame dried

RBF under argon atmosphere. 1 mL of ACN was added and stirred,

H), 1.46 (s, 9H). ¹F NMR (282 MHz, CDCl3)

9

d

ꢂ135.10 (s, 1F). MS

ESI) calculated for (M þ H)^þ533.69, found 533.20.

2

4

2

.2.3. tert-butyl (S)-((1-(3-((tert-butoxycarbonyl)amino)-6-ﬂuoro-

,4-dioxo-1,2,3,4-tetrahydroquinazolin-7-yl)pyrrolidin-3-yl)

methyl)carbamate (UICK-II-197, 17)

UICK-II-189 (16) (95 mg, 0.179 mmol), N,N-diisopropylamine

mL, 0.196 mmol) and tert-butyl carbazate (117.8 mg,

.895 mmol) were dissolved in 10 mL of tetrahydrofuran and set to

reﬂux for 2 h. Reaction complete as observed on TLC. Reaction

mixture was cooled, tetrahydrofuran was removed in vacuo and the

dark yellow residue was dissolved in 20 mL methanol. K

25 mg, 0181 mmol) was added and the reaction mixture was set to

stir at 50 C overnight. The reaction was diluted with 25 mL DCM

and washed with 15 mL water thrice. The organic layers were

2 4

combined, dried over Na SO , concentrated in vacuo and puriﬁed by

silica gel chromatography using a gradient from 9:1 hexanes: EtOAc

to 1:1 hexanes:EtOAc to give pure UICK-II-197 (17). Quantitative

yield. H NMR (300 MHz, DMSO)

followed by 40% methylamine in H

2

O (200

m

L, 2 mmol). The reac-

ꢀ

tion was heated to 60 C for 16 h 10 mL of NaHCO

3

was added and

the organic solvent removed by rotary evaporation. The compound

was reconstituted in DCM and then extracted three times. The

residue was puriﬁed by silica gel ﬂash chromatography using a

gradient from hexanes to ethyl acetate, producing 35.5 mg pure

UIJD-II-215A (20a), 40.8% yield. H NMR (300 MHz, CDCl

(

34

0

1

3

)

d

9.73 (d,

2 3

CO

J ¼ 4.2 Hz, 1H), 8.82 (s, 1H), 8.24e8.01 (m, 1H), 7.57 (dd, J ¼ 7.2,

(

5

2

.5 Hz, 4H), 7.49e7.33 (m, 3H), 7.13 (d, J ¼ 8.0 Hz, 2H), 5.91e5.71 (m,

ꢀ

19

H), 3.78e3.61 (m, 3H), 3.12e2.95 (m, 3H). F NMR (282 MHz,

CDCl

3

)

d

ꢂ135.64 (dd, J ¼ 21.4, 10.1 Hz), ꢂ142.77 (dd, J ¼ 21.4,

7.1 Hz). Retention time (analytic HPLC) ¼ 23.5 min. MS ESI calcu-

þ

lated (M þ H) 435.14, found 435.2.

1

d

¼ 11.24 (bs, 1H), 9.46 (s, 1H), 7.42

0

(

d, J ¼ 14.1 Hz, 1H), 7.06 (bs, 1H), 6.24 (d, J ¼ 7.5 Hz, 1H), 3.46 (m,

4.2.7. 1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-8-methoxy-N-

4

9

(

H), 3.00 (m, 2H), 2.38 (m, 1H), 2.00 (m, 1H), 1.69 (m, 1H), 1.43 (s,

methyl-7-(methylamino)-4-oxo-1,4-dihydroquinoline-3-

carboxamide (UIJD-II-215B, 21)

UIJD-II-196 (19) (90 mg, 0.21 mmol) was added to a ﬂame dried

RBF under argon atmosphere. 1 mL of ACN was added and stirred,

19

H), 1.38 (s, 9H). F NMR (282 MHz, DMSO)

d

¼ ꢂ133.75 (s, 1F). MS

ESI) calculated for (M þ K)^þ532.20, found 532.65.

0

4

.2.4. (S)-1-([1,1 -biphenyl]-4-ylmethyl)-3-amino-7-(3-

aminomethyl)pyrrolidin-1-yl)-6-ﬂuoroquinazoline-2,4(1H,3H)-

followed by methylamine (200

m

L, 2 mmol). The reaction was

ꢀ

(

heated to 60 C for 16 h 10 mL of NaHCO

3

was added and the

dione (1) (UICK-II-215a)

organic solvent removed by rotary evaporation. The compound was

reconstituted in DCM and then extracted three times. The residue

was puriﬁed by silica gel ﬂash chromatography using a gradient

UICK-II-197 (17) (60 mg, 0.122 mmol), 4-bromomethylbiphenyl

(

2 3

32.5 mg, 0.132 mmol) and K CO (19 mg, 0.136 mmol) were dis-

solved in THF (5 mL) and set to reﬂux for 24 h. TFA (2 mL) was

added and the solution was reﬂuxed for further 2 h. The solution

was concentrated in vacuo, diluted with water and the product (1)

from hexanes to ethyl acetate, yielding 34 mg pure UIJD-II-215B

1

(21), 37% yield. H NMR (300 MHz, Acetone)

d

9.78 (d, J ¼ 4.9 Hz,

1H), 8.82 (s, 1H), 7.70 (d, J ¼ 13.4 Hz, 1H), 7.62e7.57 (m, 4H), 7.43 (t,

J ¼ 7.4 Hz, 2H), 7.33 (t, J ¼ 7.3 Hz, 1H), 7.14 (d, J ¼ 8.2 Hz, 2H), 5.85 (s,

2H), 3.64 (s, 3H), 3.44 (s, 1H), 2.97 (t, J ¼ 4.4 Hz, 3H), 2.85 (d,

1

puriﬁed by preparatory HPLC. Yield 16%. H NMR (300 MHz, DMSO)

d

¼ 7.89 (bs, 2H), 7.49 (m, 10H), 6.31 (d, J ¼ 7.2 Hz, 1H), 5.41 (s, 1H),

1

9

4

1

.44 (bs, 2H), 3.45 (m, 4H), 2.90 (m, 2H), 2.44 (m, 1H), 2.09 (m, 1H),

J ¼ 4.8 Hz, 3H). F NMR (300 MHz, DMSO)

d

ꢂ129.73 to ꢂ130.14

.74 (m,1H). ¹⁹F NMR (282 MHz, DMSO)

d

¼ ꢂ134.10 (s,1F). MS (ESI)

(m). Retention time (analytic HPLC) ¼ 21.8 min. MS ESI calculated

þ

for (M þ Na)^þ468.18, found 468.16.

calculated for (M þ H) 460.21, found 460.05. Retention time

120

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

0

4

.2.8. (S)-1-([1,1 -biphenyl]-4-ylmethyl)-7-(3-(aminomethyl)

evaporation and the crude product was stirred in 3 mL of distilled

ACN and 3 mL of 3 N HCl at 25 C. The product was puriﬁed by

ꢀ

pyrrolidin-1-yl)-6-ﬂuoro-8-methoxy-N-methyl-4-oxo-1,4-

dihydroquinoline-3-carboxamide (UIJD-II-242B) (3a)

UIJD-II-215A (20a) (55 mg, 0.13 mmol) was placed in a ﬂame

dried RBF under argon atmosphere, 1 mL of DMSO was added with

stirring. To the reaction ﬂask distilled TEA (53

Boc-AMP (50.73 mg, 0.25 mmol) was added. The reaction was

heated to 60 C for 24 h, 5 mL of cold water was added. The pre-

cipitate was ﬁltered and washed 3 times with 5 mL of cold water.

The crude reaction mixture was then dissolved in 2 mL of ACN and

mL of 3 N HCl and stirred at 25 C for 20 h. The reaction mixture

preparatory HPLC (C-18, 20e95% ACN over 35 min). Affording

1

22 mg of UIJD-II-246 (3c), 36% yield over two steps. H NMR

(300 MHz, DMSO)

d

11.66 (s, 1H), 8.90 (s, 1H), 7.68 (d, J ¼ 14.1 Hz,

mL, 0.38 mmol) and

1H), 7.61 (d, J ¼ 8.3 Hz, 4H), 7.43 (t, J ¼ 7.5 Hz, 2H), 7.35 (d, J ¼ 7.3 Hz,

1H), 7.22 (d, J ¼ 8.2 Hz, 2H), 5.89 (q, J ¼ 15.6 Hz, 2H), 3.62e3.53 (m,

3H), 3.48 (s, 3H), 3.43e3.31 (m, 2H), 2.98e2.84 (m, 2H), 2.08 (dd,

ꢀ

19

J ¼ 7.8, 4.7 Hz, 1H), 1.76e1.67 (m, 1H). F NMR (282 MHz, DMSO)

d

ꢂ121.96 to ꢂ122.25 (m). Retention time (analytical

ꢀ

þ

2

HPLC) ¼ 21.8 min. MS ESI calculated (M þ H) 517.22, found 517.22.

was diluted with water and puriﬁed by preparatory HPLC (C-18,

0e95% ACN over 20 min), giving 16.5 mg, UIJD-II-242B (3a), 25%

yield over two steps. H NMR (400 MHz, MeOD)

0

3

4.2.11. (R)-1-([1,1 -biphenyl]-4-ylmethyl)-7-(3-

1

d

8.94 (s, 1H), 7.76

carbamoylpyrrolidin-1-yl)-6-ﬂuoro-8-methoxy-4-oxo-1,4

dihydroquinoline-3-carboxylic acid (UIJD-II-115, 4a)

UIJD-II-111 (22) (27 mg, 0.1 mmol) was dissolved in 1 mL of

anhydrous DMSO under inert conditions. TEA (100 mL, 0.72 mmol)

(

d, J ¼ 14.1 Hz, 1H), 7.57e7.49 (m, 4H), 7.41e7.35 (m, 2H), 7.32e7.27

m, 1H), 7.22 (d, J ¼ 8.3 Hz, 2H), 5.87 (dd, J ¼ 67.3, 15.5 Hz, 2H), 3.69

ddd, J ¼ 9.4, 8.0, 4.0 Hz, 2H), 3.55e3.50 (m, 1H), 3.48 (d, J ¼ 8.0 Hz,

3

H), 3.46e3.40 (m, 1H), 3.10e3.04 (m, 2H), 2.98 (s, 3H), 2.57 (dt,

and (R)-pyrrolidin3-carboxamide were added to the solution and

ꢀ

J ¼ 14.5, 7.3 Hz, 1H), 2.21 (dt, J ¼ 10.7, 6.7 Hz, 1H), 1.75 (dq, J ¼ 12.2,

stirred for 4 h at 60 C. The solution was diluted in a 1:1 mixture of

19

8

.3 Hz, 1H). F NMR (282 MHz, MeOD)

d

ꢂ122.16 (d, J ¼ 14.7 Hz).

ACN to H

2

O and the product puriﬁed by preparatory HPLC (PFP,

þ

Retention time (analytical HPLC): 18.45. MS ESI calculated (M þ H)

50e95% ACN over 25 min). Affording 18 mg of pure UIJD-II-115

1

5

15.24, found 515.2.

(4a), 64% yield. H NMR (400 MHz, DMSO) d 9.16e8.98 (m, 1H), 7.69

(

d, J ¼ 13.9 Hz, 1H), 7.61e7.57 (m, 3H), 7.47 (s, 1H), 7.42 (t, J ¼ 7.5 Hz,

0

4

.2.9. (S)-1-([1,1 -biphenyl]-4-ylmethyl)-7-(3-(aminomethyl)

2H), 7.33 (t, J ¼ 7.2 Hz, 1H), 7.23 (d, J ¼ 8.2 Hz, 2H), 5.92 (dd, J ¼ 30.0,

15.4 Hz, 2H), 3.69e3.61 (m, 1H), 3.51 (d, J ¼ 8.2 Hz, 1H), 3.43 (d,

J ¼ 12.1 Hz, 3H), 3.11e3.02 (m,1H), 2.98e2.89 (m,1H), 2.10e1.95 (m,

pyrrolidin-1-yl)-6-ﬂuoro-8-methoxy-4-oxo-1,4-dihydroquinoline-

-carboxamide (UIJD-II-251, 3b)

UIJD-II-196 (19) (55 mg, 0.13 mmol) under argon atmosphere,

was dissolved in 6.5 mL of 2 mM ammonia in methanol and stirred

3

1

9

1H), 1.17 (t, J ¼ 7.1 Hz, 2H). F NMR (282 MHz, DMSO)

d

ꢂ73.49 (d,

J

¼

19.6 Hz), ꢂ120.57 (s). Retention time (analytical

ꢀ

þ

at 35 C for 72 h. The organic solvent was removed by rotary

HPLC) ¼ 19.7 min. MS ESI calculated (M þ H) 516.19, found 516.2.

evaporation and the product reconstituted in DCM and extracted

from water, the combined organic layers were concentrated by

rotary evaporation. The crude product was used without further

puriﬁcation. UIJD-II-249 (20b) (40 mg, 0.1 mmol) placed in ﬂame

dried RBF, under argon atmosphere 1 mL of anhydrous DMSO was

0

4.2.12. (R)-1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-7-(3-

(hydroxymethyl)pyrrolidin-1-yl)-8-methoxy-4-oxo-1,4-

dihydroquinoline-3-carboxylic acid (UIJD-II-116), 4b)

UIJD-II-111B (22) (40 mg, 0.1 mmol) was dissolved in 5 mL of

added with stirring, followed by distilled TEA (100

and Boc-AMP (38 mg, 0.19 mmol). The reaction was heated to 60 C

for 48 h. The DMSO was removed by rotary evaporation. The crude

m

L, 0.72 mmol)

distilled ACN. D-b-propinol (24 mg, 0.24 mmol) and distilled TEA

ꢀ

(66

m

L, 0.48 mmol) were added to the solution and stirred under

ꢀ

argon atmosphere for 36 h at 50 C. The solution was diluted with

reaction mixture was dissolved in 2 mL of distilled ACN and 2 mL of

water and the product puriﬁed by preparatory HPLC (PFP, 65e95%

ꢀ

3

N aqueous HCl. The reaction mixture was stirred at 25 C for 42 h.

ACN over 25 min). After puriﬁcation 11 mg of pure UIJD-II-116 (4b)

1

The reaction mixture was diluted with water and puriﬁed by pre-

was obtained, 22% yield. H NMR (400 MHz, DMSO)

d

9.10 (s, 1H),

paratory HPLC (C-18, 50e95% ACN over 30 min) Pure UIJD-II-251

7.70 (d, J ¼ 14.0 Hz, 1H), 7.63e7.57 (m, 4H), 7.44 (dd, J ¼ 10.3, 4.8 Hz,

2H), 7.38e7.32 (m, 1H), 7.25 (d, J ¼ 8.3 Hz, 2H), 5.94 (dd, J ¼ 30.9,

15.2 Hz, 2H), 3.52 (ddd, J ¼ 11.6, 9.5, 4.2 Hz, 3H), 3.46 (s, 3H),

3.45e3.32 (m, 3H), 2.33 (dt, J ¼ 14.5, 7.2 Hz, 1H), 1.96 (dt, J ¼ 11.3,

1

(3b) was isolated 6.6 mg, 13.8% yield over 2 steps. H NMR

(

300 MHz, CDCl

3

)

d

8.90 (s, 1H), 7.68 (d, J ¼ 14.0 Hz, 1H), 7.59 (t,

J ¼ 10.0 Hz, 4H), 7.47e7.29 (m, 3H), 7.23 (d, J ¼ 8.1 Hz, 2H), 5.86 (q,

19

J ¼ 15.3 Hz, 2H), 4.51 (s, 1H), 3.57 (dd, J ¼ 13.4, 5.7 Hz, 2H), 3.47 (s,

5.8 Hz,1H),1.64 (dq, J ¼ 12.2, 7.8 Hz,1H). F NMR (282 MHz, DMSO)

3

4

H), 3.37 (dd, J ¼ 15.2, 9.0 Hz, 2H), 2.90 (s, 2H), 2.09 (dd, J ¼ 10.6,

d

ꢂ120.50 (s). Retention time (analytical HPLC) ¼ 21.7 min. MS ESI

1

9

þ

.3 Hz, 1H), 1.75e1.66 (m, 1H). F NMR (282 MHz, DMSO)

d

ꢂ122.44

calculated (M þ H) 503.19, found 503.2.

(

d, J ¼ 13.6 Hz). Retention time (analytical HPLC) ¼ 17.4 min. MS ESI

þ

0

calculated (M þ H) 501.22, found 501.23.

4.2.13. (S)-1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-8-methoxy-7-

(3-((methylamino)methyl)pyrrolidin-1-yl)-4-oxo-1,4-

0

4

.2.10. (S)-1-([1,1 -biphenyl]-4-ylmethyl)-7-(3-(aminomethyl)

dihydroquinoline-3-carboxylic acid (UIJD-II-086, 4c)

pyrrolidin-1-yl)-6-ﬂuoro-N-hydroxy-8-methoxy-4-oxo-1,4-

dihydroquinoline-3-carboxamide (UIJD-II-246, 3c)

UIJD-II-061B (22) (35 mg, 0.09 mmol) was dissolved in 3 mL of

distilled ACN. (R)-tert-butyl methyl(pyrrolidin-3-ylmethyl)carba-

UIJD-II-196 (19) (70 mg, 0.16 mmol) was dissolved in 1 N

mate (12.4 mg, 0.06 mmol) and distilled TEA (16 mL, 0.12 mmol)

hydroxylamine∙HCl in EtOH (3.2 mL) and TEA was added

were added to the reaction ﬂask and stirred under argon atmo-

sphere for 4 days at 60 C. Triﬂuoroacetic acid (2 mL) was added to

ꢀ

(

0.8 mmol, 112

mL). The reaction was stirred at 25 C for 72 h, and

the pH was adjusted as needed to pH 9e10 as the reaction pro-

gressed. The EtOH was removed by rotary evaporation and the

product reconstituted in DCM and precipitated out of ether. The

crude precipitated product was used without further puriﬁcation.

UIJD-II-217 (20c) (50 mg, 0.12 mmol) was added to a ﬂame dried

round bottom ﬂask under argon atmosphere and 1 mL of anhydrous

the reaction ﬂask and stirred at room temperature for 12 h. The

solution was diluted with water and the product puriﬁed by pre-

paratory HPLC (PFP, 50e85% ACN over 25 min). Pure UIJD-II-086

1

was obtained, 12.3 mg, 28% yield over two steps. H NMR (400 MHz,

DMSO)

d

15.17 (s, 1H), 9.10 (s, 1H), 8.79 (s, 2H), 7.71 (d, J ¼ 13.9 Hz,

1H), 7.60 (d, J ¼ 8.2 Hz, 4H), 7.42 (t, J ¼ 7.7 Hz, 2H), 7.33 (t, J ¼ 7.3 Hz,

1H), 7.24 (d, J ¼ 8.2 Hz, 2H), 5.93 (dd, J ¼ 31.4, 15.3 Hz, 2H), 3.60 (t,

J ¼ 7.6 Hz,1H), 3.52 (d, J ¼ 8.0 Hz,1H), 3.47 (s, 3H), 3.39 (d, J ¼ 7.2 Hz,

3H), 2.99 (d, J ¼ 6.4 Hz, 2H), 2.54 (t, J ¼ 4.8 Hz, 3H), 2.14e2.02 (m,

DMSO was added. Distilled TEA (60

mL, 0.45 mmol) and Boc-AMP

(

46 mg, 0.23 mmol) was added with stirring. The reaction mixture

ꢀ

was heated to 65 C for 17 h. DMSO was removed by rotary

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

121

1

d

H), 1.71 (dd, J ¼ 12.1, 8.0 Hz, 1H). ¹⁹F NMR (282 MHz, DMSO)

462.18, found 462.18.

ꢂ120.45 (d,

J

¼

13.3 Hz). Retention time (analytical

þ

0

HPLC) ¼ 23.9 min MS ESI calculated (M þ H) 516.22, found 515.22.

4.2.17. 1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-8-methoxy-7-((2-

(

methylamino)ethyl)amino)-4-oxo-1,4-dihydroquinoline-3-

carboxylic acid (UIJD-II-276B, 4g)

UIJD-II-219B (22) (50 mg, 0.12 mmol) was placed in a ﬂame

dried RBF under inert conditions. 200 L of anhydrous DMSO was

added, followed by distilled TEA (82 L, 0.59 mmol) and n-boc, n-

0

4.2.14. (R)-1-([1,1 -biphenyl]-4-ylmethyl)-7-(3-aminopyrrolidin-1-

yl)-6-ﬂuoro-8-methoxy-4-oxo-1,4-dihydroquinoline-3-carboxylic

acid (UIJD-II-226B, 4d)

UIJD-II-214B (22) (64 mg, 0.15 mmol) placed in ﬂame dried

round bottom ﬂask, 1 mL of anhydrous DMSO was added and stir-

m

methyl ethylene diamine (41

m

L, 0.24 mmol). The reaction mixture

ꢀ

red under inert conditions. 70

mL (0.5 mmol) of TEA and Boc-AMP

was stirred and heated to 60 C for 17 h. Cold water (2 mL) was

added to the reaction mixture and the precipitate was ﬁltered and

washed three times with cold water (2 mL). The crude reaction

product was dissolved in 4 mL of distilled ACN and 2 mL of 3 N HCl

and stirred for 24 h. The reaction mixture was diluted with water

and puriﬁed by preparatory HPLC (C-18, 40e95% ACN over 35 min).

(

46.3 mg, 0.25 mmol) were added and the reaction heated to

ꢀ

6

0 C for 24 h. To the crude reaction product, 2 mL of ACN and 2 mL

ꢀ

of 3 N aqueous HCl were added and stirred at 25 C for 22 h. The

crude product was puriﬁed by preparatory HPLC (C-18, 10e95 over

1

4

0 min) Yielding 12.5 mg of pure UIJD-II-226, 17%, over 2 steps. H

1

NMR (400 MHz, MeOD)

d

8.97 (s, 1H), 7.77 (d, J ¼ 13.6 Hz, 1H), 7.54

Yielding 17 mg of pure UIJD-II-276B (4g), 33% over two steps. H

NMR (400 MHz, DMSO) d 9.08 (s, 1H), 8.85 (s, 2H), 7.79 (d,

(

1

d, J ¼ 7.2 Hz, 4H), 7.38 (t, J ¼ 7.3 Hz, 2H), 7.31 (dd, J ¼ 13.6, 6.6 Hz,

H), 7.24 (s, 2H), 5.89 (s, 2H), 4.09e3.81 (m, 2H), 3.74 (s, 2H), 3.56

J ¼ 12.9 Hz, 1H), 7.59 (d, J ¼ 8.1 Hz, 4H), 7.42 (t, J ¼ 7.6 Hz, 2H), 7.34

(d, J ¼ 7.4 Hz, 1H), 7.16 (d, J ¼ 8.3 Hz, 2H), 6.40 (d, J ¼ 5.4 Hz, 1H),

5.93 (s, 2H), 3.71 (s, 3H), 3.65 (d, J ¼ 5.4 Hz, 2H), 3.05e2.97 (m, 2H),

(

1

d, J ¼ 9.3 Hz, 3H), 3.51 (dd, J ¼ 12.6, 6.0 Hz, 1H), 2.41 (s, 1H), 2.10 (s,

19

H). F NMR (282 MHz, DMSO)

d

ꢂ120.22 (d, J ¼ 12.7 Hz). Reten-

þ

tion time (analytical HPLC) ¼ 19.8 min. MS ESI calculated (M þ H)

2.47 (d, J ¼ 5.4 Hz, 3H). 19F NMR (282 MHz, DMSO)

d

ꢂ126.55 (d,

4

88.19, found 488.2.

J ¼ 19.6 Hz). Retention time (analytical HPLC) ¼ 19.7 min. MS ESI

calculated (M þ H)^þ476.19, found 476.19.

0

4.2.15. (R)-1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-8-methoxy-7-

0

(

3-(methylamino)pyrrolidin-1-yl)-4-oxo-1,4-dihydroquinoline-3-

4.2.18. 1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-8-methoxy-7-((3-

carboxylic acid (UIJD-II-228B, 4e)

UIJD-II-214B (22) (66 mg, 0.16 mmol) was added to a ﬂame

dried round bottom ﬂask under inert conditions. 1 mL of anhydrous

(methylamino)propyl)amino)-4-oxo-1,4-dihydroquinoline-3-

carboxylic acid (UIJD-II-275B, 4h)

UIJD-II-219B (22) (37.6 mg, 0.09 mmol) was added to a ﬂame

DMSO was added and stirred. Distilled TEA (70

mL, 0.5 mmol) and

dried RBF under inert conditions. Anhydrous DMSO (100

mL) was

Boc-AMP (50 mg, 0.24 mmol) were then added and the reaction

mixture was heated to 60 C for 24 h 5 mL of cold water was added

and the precipitate was collected, ﬁltered, and washed three times

added with stirring, followed by distilled TEA (100 L, 0.71 mmol)

m

ꢀ

and Boc-n-Me-1,3,-diaminopropane (40 mg, 0.17 mmol). The reac-

ꢀ

tion was heated to 60 C and stirred for 48 h. Cold water (5 mL) was

with 5 mL of cold water. To the crude reaction product 2 mL of ACN

and 2 mL of 3 N aqueous HCl were added at 25 C. The reaction was

stirred for 24 h. The reaction mixture was diluted with water and

added to the reaction mixture and the precipitate ﬁltered and

washed three times with cold water (5 mL). To the crude reaction

product 3 mL of 3 N HCl and 6 mL of distilled ACN were added and

ꢀ

puriﬁed by preparatory HPLC (C-18, 10e95% ACN over 40 min).

stirred at 25 C for 24hr. The crude product was puriﬁed by pre-

1

Yielding pure UIJD-II-228B (4e) 26 mg, 39% yield over two steps. H

paratory HPLC (C-18, 40e95% ACN over 40 min). Yielding 13 mg of

1

NMR (400 MHz, MeOD)

d

8.93 (s, 1H), 7.69 (d, J ¼ 13.5 Hz, 1H), 7.53

pure UIJD-II-275B (4h), 29% yield over two steps. H NMR

(

d, J ¼ 7.9 Hz, 4H), 7.38 (t, J ¼ 7.3 Hz, 2H), 7.28 (dd, J ¼ 19.6, 12.4 Hz,

(400 MHz, DMSO)

d

9.04 (s,1H), 8.72 (s, 2H), 7.77 (d, J ¼ 13.1 Hz,1H),

3

2

d

H), 5.88 (s, 2H), 3.86 (d, J ¼ 26.0 Hz, 2H), 3.73 (s, 3H), 3.55 (s, 3H),

7.59 (d, J ¼ 8.2 Hz, 4H), 7.42 (t, J ¼ 7.6 Hz, 2H), 7.33 (t, J ¼ 7.3 Hz, 1H),

7.16 (d, J ¼ 8.2 Hz, 2H), 6.46 (s, 1H), 5.93 (s, 2H), 3.68 (s, 3H), 3.42 (d,

19

.75 (s, 3H), 2.44 (s, 1H), 2.16 (s, 1H). F NMR (282 MHz, DMSO)

ꢂ121.37 (d,

J

¼

13.4 Hz). Retention time (analytical

J ¼ 2.1 Hz, 2H), 2.86e2.76 (m, 2H), 2.45 (t, J ¼ 5.4 Hz, 3H), 1.83e1.75

þ

19

HPLC) ¼ 20.7 min. MS ESI calculated (M þ H) 502.2, found 502.2.

(m, 2H). F NMR (282 MHz, CDCl

3

)

d

ꢂ127.30 to ꢂ127.74 (m).

Retention time (analytical HPLC) ¼ 20.2 min. MS ESI calculated

0

(M þ H)^þ490.21, found 490.21.

4

.2.16. 1-([1,1 -biphenyl]-4-ylmethyl)-7-((2-aminoethyl)amino)-6-

ﬂuoro-8-methoxy-4-oxo-1,4-dihydroquinoline-3-carboxylic acid

0

(

UIJD-II-264B, 4f)

4.2.19. 1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-8-methoxy-7-((4-

UIJD-II-214B (22) (50 mg, 0.1 mmol) was added to a ﬂamed

dried round bottom ﬂask and 1 mL of anhydrous DMSO was added

to the reaction ﬂask with stirring under argon atmosphere, fol-

(methylamino)butyl)amino)-4-oxo-1,4-dihydroquinoline-3-

carboxylic acid (UIJD-II-285B, 4i)

UIJD-II-219B (22) (46 mg, 0.11 mmol) was placed in a ﬂame

dried round bottom ﬂask, under inert conditions. Anhydrous DMSO

lowed by distilled TEA (50

36.5

m

L, 0.36 mmol) and ethylene diamine

ꢀ

(

m

L, 0.23 mmol). The reaction was heated to 60 C and stirred

(500

mL) was added with stirring, followed by distilled TEA (100

m

L,

for 7 h 5 mL of cold water was added and the precipitate was

ﬁltered and washed three times with 5 mL cold water. The crude

precipitate was dissolved in 2 mL of distilled ACN and 2 mL of 3 N

0.71 mmol) and tert-butyl N-(4-aminopropyl)-N-methyl (45

ꢀ

0.22 mmol). The reaction was heated to 40 C for 18 h. Cold water

(5 mL) was added and the precipitate ﬁltered and washed three

times with cold water (5 mL). To the crude reaction product 2 mL of

ꢀ

HCl and stirred for 24 h at 25 C. The ACN was removed by rotary

ꢀ

evaporation, the remaining aqueous solution was extracted three

3 N HCl and 6 mL of ACN were added and stirred at 25 C for 24 h.

times with DCM and concentrated in vacuo. The pure product was

The crude product was puriﬁed by preparatory HPLC (C-18, 40e95%

collected from the frit, affording 25.2 mg of UIJD-II-264B (4f), 44%

ACN over 40 min). Affording 24 mg of pure UIJD-II-285B (4i), 43%

1

over 2 steps. H NMR (400 MHz, DMSO)

d

15.23 (s, 1H), 9.06 (s, 1H),

over two steps. H NMR (400 MHz, DMSO)

d

9.05 (s, 1H), 8.82 (s,

8

.24 (s, 3H), 7.77 (d, J ¼ 12.9 Hz, 1H), 7.59 (d, J ¼ 8.2 Hz, 4H), 7.37 (dt,

2H), 7.75 (d, J ¼ 13.0 Hz, 1H), 7.63e7.55 (m, 4H), 7.42 (dd, J ¼ 10.4,

4.8 Hz, 2H), 7.33 (ddd, J ¼ 7.3, 6.0, 1.0 Hz, 1H), 7.14 (d, J ¼ 8.3 Hz, 2H),

6.40 (s, 1H), 5.92 (s, 2H), 3.66 (s, 3H), 3.33 (t, J ¼ 5.5 Hz, 2H),

J ¼ 35.8, 7.3 Hz, 3H), 7.18 (d, J ¼ 8.2 Hz, 2H), 6.41 (t, J ¼ 5.3 Hz, 1H),

5

2

.93 (s, 2H), 3.71 (s, 3H), 3.65 (d, J ¼ 5.9 Hz, 2H), 2.95 (d, J ¼ 5.8 Hz,

19

H). F NMR (282 MHz, DMSO)

d

ꢂ126.65 (d, J ¼ 12.9 Hz). Retention

2.76e2.64 (m, 2H), 2.36 (t, J ¼ 5.4 Hz, 3H), 1.53 (dt, J ¼ 15.2, 7.6 Hz,

þ

19

time (analytical HPLC) ¼ 18.8 min. MS ESI calculated (M þ H)

2H), 1.45e1.33 (m, 2H). F NMR (282 MHz, CDCl

3

)

d

ꢂ127.58

122

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

to ꢂ127.83 (m). Retention time (analytical HPLC) ¼ 20.8. MS ESI

0.26 mmol) and distilled TEA (89

m

L, 0.64 mmol). The reaction

þ

ꢀ

calculated (M þ H) 504.22, found 504.22.

mixture was heated to 45 C for 18 h. Cold water (5 mL) was added

and the precipitate was ﬁltered and washed three times with cold

water (5 mL). To the crude reaction product 3 mL of 4 N HCl and

0

4

.2.20. Ethyl 1-([1,1 -biphenyl]-4-ylmethyl)-6,7-diﬂuoro-4-oxo-1,4-

ꢀ

dihydroquinoline-3-carboxylate. (UICK-III-195, 25)

6 mL of distilled ACN was added and stirred for 19 h at 25 C. The

Commercially available ethyl 3-oxo-3-(2,4,5-triﬂuorophenyl)

propanoate (23) (5.0 g, 20.31 mmol) was reﬂuxed in triethylortho-

formate (5.0 mL, 30.5 mmol) and acetic anhydride (5.8 mL,

organic solvent was removed by rotary evaporation and the

remaining aqueous solution frozen and lyophilized. UIJD-II-281B

(5b) was isolated as a pure product collecting 21 mg, 40% yield over

1

6

0.9 mmol) for 4 h to yield enol ether 24. After the reaction was

two steps. H NMR (400 MHz, DMSO)

d

9.17 (s, 1H), 7.83 (d,

complete, the mixture was concentrated in vacuo and then dis-

solved in 1,4-dioxane (170 mL). 4-Phenylbenzylamine (3.5 g,

J ¼ 11.7 Hz, 1H), 7.68e7.60 (m, 4H), 7.44 (t, J ¼ 8.4 Hz, 4H), 7.35 (dd,

J ¼ 8.3, 6.4 Hz, 1H), 6.89 (d, J ¼ 7.2 Hz, 1H), 5.89 (s, 2H), 3.50 (q,

1

9

19.3 mmol) was added and the reaction stirred at room tempera-

J ¼ 5.9 Hz, 2H), 3.05 (s, 2H). F NMR (282 MHz, CDCl

3

)

d

ꢂ131.78

ture for 6 h K

2

CO

3

(4.2 g, 30.5 mmol) and 18-crown-6 (1.0 g,

to ꢂ132.05 (m). Retention time (analytical HPLC) ¼ 18.0 min. MS ESI

ꢀ

calculated (M þ H)^þ432.16, found 432.17.

4

.1 mmol) was added and the reaction was heated to 85 C and

stirred for an additional 2 h. The reaction mixture was then

concentrated in vacuo and the resultant precipitate was washed

with water and then puriﬁed by ﬂash chromatography using a

gradient starting with 1% MeOH in DCM and ending with 7% MeOH

in DCM to give pure compound 25 (UICK-III-195). Yield ¼ 6.4 g, 75%

0

4.2.24. 1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-7-((2-

(methylamino)ethyl)amino)-4-oxo-1,4-dihydroquinoline-3-

carboxylic acid (UIJD-II-282B, 5c)

UIJD-II-267A (26) (50 mg, 0.13 mmol) was added to a ﬂame

over 3 steps. ¹H NMR (300 MHz, DMSO)

d

8.98 (s, 1H), 8.11 (dd,

dried RBF under inert conditions. Anhydrous DMSO (500

mL) was

J ¼ 10.5, 9.1 Hz, 1H), 7.92 (dd, J ¼ 12.2, 6.6 Hz, 1H), 7.66 (dd, J ¼ 12.1,

added with stirring, followed by Boc-N-Me ethylene diamine

7

.7 Hz, 4H), 7.45 (t, J ¼ 7.5 Hz, 2H), 7.36 (m, 3H), 5.72 (s, 2H), 4.26 (q,

(45

m

L, 0.24 mmol) and distilled TEA (89

m

L, 0.64 mmol). The reac-

19

ꢀ

J ¼ 7.1 Hz, 2H), 1.30 (t, J ¼ 7.1 Hz, 3H). F NMR (282 MHz, DMSO)

tion was heated to 45 C for 18 h, cold water was added (5 mL). The

precipitate was then ﬁltered and washed three times. The crude

product was then dissolved in 6 mL of distilled ACN. 3 mL of 4 N HCl

d

6

ꢂ124.64 (dd, J ¼ 23.4, 9.2 Hz, 1F), ꢂ135.28 (ddd, J ¼ 17.6, 10.7,

þ

.3 Hz, 1F). MS ESI calculate for (M þ H) 420.14, found 420.14.

ꢀ

Retention time (analytical HPLC) ¼ 22.8 min.

was added and stirred for 24 h at 25 C. The ACN was removed by

rotary evaporation and the aqueous solution was frozen and

0

4

.2.21. 1-([1,1 -biphenyl]-4-ylmethyl)-6,7-diﬂuoro-4-oxo-1,4-

lyophilized. UIJD-II-282B (5c) was obtained as a pure product

1

dihydroquinoline-3-carboxylic acid (UICK-III-197, 26)

25 mg, 44% yield over two steps. H NMR (400 MHz, DMSO)

d

15.61

UICK-III-195 (25) (6.4 g, 15.3 mmol) was dissolved in 250 mL of

:1 THF: 1% aqueous LiOH and stirred at room temperature for 24 h.

The reaction was diluted with water and acidiﬁed to pH 1 with HCl.

The aqueous layer was extracted three times with 300 mL DCM. The

combined organic layers were washed with brine, dried over

(s, 1H), 9.16 (s, 1H), 8.87 (s, 2H), 7.83 (d, J ¼ 11.7 Hz, 1H), 7.69e7.60

(m, 4H), 7.43 (dd, J ¼ 8.0, 6.9 Hz, 4H), 7.34 (t, J ¼ 7.3 Hz, 1H), 7.09 (d,

J ¼ 2.1 Hz, 1H), 6.91 (d, J ¼ 7.2 Hz, 1H), 5.93 (s, 2H), 3.56 (dd, J ¼ 11.6,

1

19

3

5.8 Hz, 2H), 2.96 (s, 2H), 2.47 (s, 3H). F NMR (282 MHz, CDCl )

d

ꢂ131.68 to ꢂ131.96 (m). Retention time (analytical

þ

Na

97 (26) in quantitative yield. H NMR (300 MHz, DMSO)

bs, exchangeable, 1H), 9.34 (s, 1H), 8.30 (dd, J ¼ 10.2, 8.8 Hz, 1H),

2

SO

4

, ﬁltered and concentrated in vacuo to give pure UICK-III-

HPLC) ¼ 18.7 min. MS ESI calculated (M þ H) 446.18, found 446.19.

1

(

8

5

1

3

d 14.80

0

4.2.25. 1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-7-((3-

.17 (dd, J ¼ 12.3, 6.6 Hz, 1H), 7.65 (dd, J ¼ 10.6, 7.8 Hz, 4H), 7.42 (m,

(methylamino)propyl)amino)-4-oxo-1,4-dihydroquinoline-3-

carboxylic acid (UIJD-II-269B, 5d)

UIJD-II-267A (26) (40 mg, 0.1 mmol) was added to a ﬂame dried

round bottom ﬂask under inert conditions. Anhydrous DMSO

H), 5.91 (s, 2H). ¹⁹F NMR (282 MHz, DMSO)

F), ꢂ137.14 (m, 1F). MS ESI calculate for (M þ H) 392.11, found

91.98. Retention time (analytical HPLC) ¼ 23.9 min.

d

ꢂ126.00 (m,

þ

(1 mL) was added with stirring, followed by distilled TEA (70 mL,

0

4

.2.22. (S)-1-([1,1 -biphenyl]-4-ylmethyl)-7-(3-(aminomethyl)

0.5 mmol) and Boc-n-me-1,3,-diaminopropane (45 mg, 0.2 mmol).

ꢀ

pyrrolidin-1-yl)-6-ﬂuoro-4-oxo-1,4-dihydroquinoline-3-carboxylic

acid (UICK-II-065, 5a)

UICK-III-197 (1.5 g, 3.8 mmol) was dissolved in 40 mL ACN to

which was added Boc-(R)-aminomethylpyrrolidine (921.1 mg,

The reaction mixture was heated to 60 C for 24hrs. Cold water

(5 mL) was added and the precipitate washed three times with cold

water (5 mL) and concentrated in vacuo. To the crude reaction

product 2 mL of 4 N HCl and 4 mL of distilled ACN were added and

ꢀ

4

.600 mmol) and DIPEA (1 mL, 5.7 mmol). The reaction was set to

stirred for 5 h at 25 C. The ACN was removed by rotary evaporation

ꢀ

stir at 70 C for 4 h. 25 mL 4 N HCl was then added and the reaction

was stirred for additional 12 h. The resultant precipitate was

and the aqueous solution frozen and lyophilized. UIJD-II-269B (5d)

1

was collected as a pure product 27 mg, 54% yield over two steps. H

ﬁltered and washed with ACN to give pure UICK-II-065 (5a) (Batch

NMR (400 MHz, DMSO)

d

9.13 (s, 1H), 7.80 (d, J ¼ 11.8 Hz, 1H),

1

CK-III-199). Yield 1.5 g, 77%. H NMR (300 MHz, DMSO)

d

15.61 (s,

7.69e7.61 (m, 4H), 7.47e7.40 (m, 4H), 7.34 (t, J ¼ 7.3 Hz, 1H), 6.80 (d,

J ¼ 7.2 Hz, 1H), 5.87 (s, 2H), 3.30 (dd, J ¼ 12.3, 6.2 Hz, 2H), 2.90e2.81

1

H, exchangeable), 9.19 (s, 1H), 8.16 (bs, 2H), 7.80 (d, J ¼ 14.3 Hz,

19

H), 7.66 (dd, J ¼ 12.5, 7.9 Hz, 4H), 7.42 (m, 5H), 6.67 (d, J ¼ 7.5 Hz,

(m, 2H), 2.43 (t, J ¼ 5.2 Hz, 3H), 1.80 (dd, J ¼ 13.6, 7.0 Hz, 2H). F

H), 5.83 (s, 2H), 3.68 (m, 1H), 3.48 (m, 3H), 2.90 (m, 2H), 2.55 (m,

NMR (282 MHz, CDCl

3

)

d

ꢂ132.24 to ꢂ132.45 (m). Retention time

19

þ

H), 2.11 (m,1H),1.79 (m,1H). F NMR (282 MHz, DMSO)

d

ꢂ126.75

(analytical HPLC) ¼ 19.2 min. MS ESI calculated (M þ H) 460.20,

þ

(

s, 1F). MS ESI calculated for (M þ H ) 472.20, found 472.20.

found 460.20.

Retention time (analytical HPLC) ¼ 19.0 min.

0

4

.2.26. 1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-7-((4-

0

4

.2.23. 1-([1,1 -biphenyl]-4-ylmethyl)-7-((2-aminoethyl)amino)-6-

(methylamino)butyl)amino)-4-oxo-1,4-dihydroquinoline-3-

carboxylic acid (JD-II-271B, 5e)

ﬂuoro-4-oxo-1,4-dihydroquinoline-3-carboxylic acid (UIJD-II-

2

81B, 5b)

UIJD-II-267A (26) (35 mg, 0.1 mmol) was added to a ﬂame dried

round bottom ﬂask under inert conditions. Anhydrous DMSO

UIJD-II-267A (26) (50 mg, 0.12 mmol) was added to a ﬂame

dried RBF under inert conditions. Anhydrous DMSO (500

mL) was

(1 mL) was added with stirring, followed by distilled TEA (37

mL,

added with stirring, followed by Boc-ethylene diamine (41

mL,

0.27 mmol) and tert-butyl N-(4-aminopropyl)-N-methyl (36 mg,

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

123

ꢀ

0

5

.18 mmol). The reaction was heated to 60 C and stirred for 24 h.

mL of cold water was added to the reaction mixture and the

MeOD) d 9.45 (exchangeable) (bs, 2H), 9.22 (s, 1H), 7.86 (d,

J ¼ 14.2 Hz, 1H), 7.67 (dd, J ¼ 15.0, 7.8 Hz, 3H), 7.49e7.41 (m, 3H),

7.37 (d, J ¼ 7.2 Hz, 1H), 6.75 (d, J ¼ 7.4 Hz, 1H), 5.86 (s, 2H),

3.85e3.66 (m, 4H), 3.58e3.46 (m, 1H), 2.59 (m, 3H), 2.31 (m, 2H).

precipitate ﬁltered and washed three times with cold water. The

crude reaction product was dissolved in 6 mL of distilled ACN and

mL of 4 N HCl and stirred for 21 h. The ACN was removed by rotary

evaporation and the remaining aqueous solution frozen and

lyophilized. UIJD-II-271B (5e) was collected as pure product 30 mg,

1% yield over two steps. H NMR (400 MHz, DMSO)

1

9

3

F NMR (282 MHz, MeOD)

d

ꢂ126.52 to ꢂ126.83 (m). MS ESI

þ

calculated for (M þ H) 472.2, found 472.2. Retention time

(analytical HPLC) ¼ 19.5 min.

1

7

d

9.15 (s, 1H),

0

.79 (d, J ¼ 11.9 Hz, 1H), 7.70 (d, J ¼ 8.3 Hz, 2H), 7.67e7.62 (m, 2H),

4.2.30. (R)-1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-4-oxo-7-

.45 (t, J ¼ 7.6 Hz, 2H), 7.36 (dd, J ¼ 9.6, 5.1 Hz, 3H), 6.65 (d,

((pyrrolidin-3-ylmethyl)amino)-1,4-dihydroquinoline-3-carboxylic

acid (UICK-IV-093, 5i)

UICK-III-197 (26) (100 mg, 0.26 mmol) was dissolved in 2 mL

DMSO to which was added (S)-3-(Aminomethyl)-1-N-Boc-pyrroli-

J ¼ 7.2 Hz, 1H), 5.85 (s, 2H), 3.16 (dd, J ¼ 12.6, 6.5 Hz, 2H), 2.61 (q,

J ¼ 12.7 Hz, 2H), 2.32 (t, J ¼ 5.3 Hz, 3H), 1.55e1.46 (m, 2H), 1.34e1.25

(

m, 2H). ¹⁹F NMR (282 MHz, CDCl

3

)

d

ꢂ132.46 to ꢂ132.79 (m).

Retention time (analytical HPLC) ¼ 19.5 min. MS ESI calculated

dine (76.9 mg, 0.38 mmol) and DIPEA (89

m

L, 0.51 mmol). The re-

þ

ꢀ

(

M þ H) 474.21, found 474.21.

action was set to stir at 40 C for 1.5 h. To the reaction mixture 1 mL

of 6 N HCl was added and stirred for 18 h. To the reaction mixture

water was added and the resulting mixture was centrifuged and the

supernatant removed. The remaining precipitant was washed with

water and centrifuged again. The resulting precipitate was lyophi-

0

4

(

.2.27. (S)-1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-7-(3-

(methylamino)methyl)pyrrolidin-1-yl)-4-oxo-1,4-

dihydroquinoline-3-carboxylic acid (UICK-IV-097, 5f)

UICK-III-197 (26) (100 mg, 0.26 mmol) was dissolved in 2 mL of

DMSO to which was added (methylamino)methyl pyrrolidine

1

lized and pure UICK-IV-093 (5i) was isolated, 95.5 mg, 68%. H NMR

(300 MHz, DMSO) d 9.15 (s, 1H), 9.03 (bs, 1H, exchangeable), 7.82 (d,

(

82.3 mg, 0.38 mmol) and DIPEA (89

m

L, 0.51 mmol). The reaction

J ¼ 11.9 Hz, 1H), 7.67 (m, 4H), 7.42 (m, 5H), 7.22 (bs, 1H, exchange-

ꢀ

was set to stir at 40 C for 24 h. To the reaction mixture 4 mL of 3 N

HCl was added and stirred for 24 h. To the reaction mixture water

was added and the resulting mixture was centrifuged and the su-

pernatant removed. The remaining precipitant was washed with

water and centrifuged again. The resulting precipitate was lyophi-

lized. Yield 91.8 mg, 68%. H NMR (300 MHz, DMSO)

able), 6.81 (d, J ¼ 7.1 Hz, 1H), 5.88 (s, 2H), 3.29 (m, 2H), 3.16 (m, 2H),

19

2.92 (m, 2H), 2.36 (m, 1H), 1.87 (m, 1H), 1.57 (m, 1H). F NMR

þ

(282 MHz, DMSO)

d

ꢂ132.24 (s, 1F). MS ESI calculated for (M þ H)

472.20, found 472.20. Retention time (analytical HPLC) ¼ 19.1 min.

1

0

d

15.59 (s, 1H),

4.2.31. 1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-7-((3aS,7aS)-

9

.19 (s, 1H), 8.92 (bs, 1H, exchangeable), 7.82 (d, J ¼ 14.3 Hz, 1H),

hexahydro-1H-pyrrolo[3,4-c]pyridin-2(3H)-yl)-4-oxo-1,4-

dihydroquinoline-3-carboxylic acid (UICK-IV-091, 5k)

UICK-III-197 (26) (100 mg, 0.26 mmol) was dissolved in 4 mL

DMSO to which was added tert-butyl(3aR, 7aS)-octahydro-5H-

7

1

.66 (m, 4H), 7.45 (m, 4H), 7.37 (d, J ¼ 7.2 Hz, 1H), 6.68 (d, J ¼ 7.5 Hz,

H), 5.83 (s, 2H), 3.70 (m, 1H), 3.53 (m, 3H), 3.00 (m, 2H), 2.61 (m,

19

H), 2.55 (s, 3H), 2.16 (m, 1H), 1.78 (m, 1H). F NMR (282 MHz,

þ

DMSO)

d

ꢂ126.79 (s, 1F). MS ESI calculated for (M þ H ) 486.2187,

pyrrolo [3,4-c] pyridine-5-carboxylate (87 mg, 0.38 mmol) and

ꢀ

found 486.2162. Retention time (analytical HPLC) ¼ 20.0 min.

DIPEA (89

mL, 0.51 mmol). The reaction was set to stir at 40 C for

1.5 h. To the reaction mixture 1 mL of 6 N HCl was added and stirred

0

4.2.28. (R)-1-([1,1 -biphenyl]-4-ylmethyl)-7-(3-aminopyrrolidin-1-

for 18 h. To the reaction mixture water was added and the resulting

mixture was centrifuged and the supernatant removed. The

remaining precipitant was washed with water and centrifuged

yl)-6-ﬂuoro-4-oxo-1,4-dihydroquinoline-3-carboxylic acid (UIJD-

III-117, 5g)

UILK-I-17 (26) (50 mg, 0.13 mmol) was dissolve in DMSO (1 mL)

and (R)-tert-Butyl [[pyrrolidin-3-yl]methyl]carbamate (49 mg,

again. The resulting precipitate was lyophilized and pure UICK-IV-

1

091 (5k) was isolated 97 mg, 70%. H NMR (300 MHz, DMSO)

d

15.60

0

.26 mmol) and DIPEA (100

m

L) were added. The reaction was

(bs, 1H, exchangeable), 9.19 (s, 1H), 8.96 (bs, 1H, exchangeable), 7.82

(d, J ¼ 14.2 Hz, 1H), 7.66 (dd, J ¼ 14.8, 8.1 Hz, 4H), 7.42 (m, 5H), 6.69

(d, J ¼ 7.5 Hz, 1H), 5.82 (s, 2H), 3.67 (s, 1H), 3.53 (m, 3H), 3.09 (m,

ꢀ

heated to 30 C and stirred for 20 h. To the crude reaction product

1

and stirred for 24 h. The ACN was removed by rotatory evaporation

and the remaining aqueous layer was frozen and lyophilized. Pure

UIJD-III-117 (5g) was isolated, 20 mg, 32% over 2 steps. H NMR

mL of 4 N aqueous hydrochloric acid and 4 mL of ACN were added

19

4H), 2.60 (m, 2H), 1.88 (m, 1H), 1.69 (m, 1H). F NMR (282 MHz,

þ

DMSO)

d

ꢂ126.90 (s, 1F). MS ESI calculated for (M þ H) 498.22,

1

found 498.22. Retention time (analytical HPLC) ¼ 19.9 min.

(

300 MHz, MeOD)

d 9.22 (s,1H), 8.48 (exchangeable) (s, 3H), 7.85 (d,

0

J ¼ 14.4 Hz, 1H), 7.67 (dd, J ¼ 13.7, 8.0 Hz, 4H), 7.45 (t, J ¼ 7.6 Hz, 4H),

4.2.32. (S)-1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-4-oxo-7-

7

.37 (d, J ¼ 7.1 Hz,1H), 6.72 (d, J ¼ 7.7 Hz,1H), 5.85 (s, 2H), 3.97e3.77

((pyrrolidin-3-ylmethyl)amino)-1,4-dihydroquinoline-3-carboxylic

acid (UICK-IV-095, 5j)

UICK-III-197 (26) (100 mg, 0.26 mmol) was dissolved in 2 mL

DMSO to which was added (R)-tert-butyl-3-(aminomethyl)pyrro-

(

m, 2H), 3.69e3.46 (m, 3H), 2.26 (dt, J ¼ 14.7, 7.2 Hz, 1H), 2.16e1.97

19

m, 1H). F NMR (282 MHz, MeOD)

d

ꢂ126.70 to ꢂ127.04 (m). MS

ESI calculated for (M þ H)þ458.18, found 458.18. Retention time

(

analytical HPLC) ¼ 18.6min.

lidine-1-carboxylate (76.9 mg, 0.38 mmol) and DIPEA (89

m

L,

ꢀ

0.51 mmol). The reaction was set to stir at 40 C for 1.5 h. To the

0

4.2.29. (R)-1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-7-(3-

reaction mixture 1 mL of 6 N HCl was added and stirred for 18 h. To

the reaction mixture water was added and the resulting mixture

was centrifuged and the supernatant removed. The remaining

precipitant was washed with water and centrifuged again. The

(

methylamino)pyrrolidin-1-yl)-4-oxo-1,4-dihydroquinoline-3-

carboxylic acid (UIJD-III-118, 5h)

UILK-I-17 (26) (50 mg, 0.13 mmol) was dissolve in DMSO (1 mL)

and (R)-tert-Butyl [[pyrrolidin-3-yl]methyl]carbamate (53 mg,

resulting precipitate was lyophilized and pure UICK-IV-095 (5j)

1

0

.26 mmol) and DIPEA (100

mL) were added. The reaction was

was isolated 97.2 mg, 69% H NMR (300 MHz, DMSO)

d

9.15 (s, 1H),

ꢀ

heated to 30 C and stirred for 21 h. To the crude reaction product

1

and stirred for 24 h. The ACN was removed by rotatory evaporation

and the remaining aqueous layer was frozen and lyophilized. Pure

UIJD-III-118 (5h) was isolated, 60 mg, 75%. H NMR (300 MHz,

8.97 (bs, 1H, exchangeable), 7.82 (d, J ¼ 11.9 Hz, 1H), 7.67 (m, 4H),

7.39 (m, 5H), 7.21 (bs, 1H, exchangeable), 6.81 (d, J ¼ 7.2 Hz, 1H),

5.88 (s, 2H), 3.28 (m, 2H), 3.17 (m, 2H), 2.92 (m, 2H), 2.34 (m, 1H),

mL of 4 N aqueous hydrochloric acid and 5 mL of ACN were added

19

1.85 (m, 1H), 1.57 (m, 1H). F NMR (282 MHz, DMSO) ꢂ132.26 (s,

1

1F). MS ESI calculated for (M þ H)^þ472.20, found 472.20. Retention

124

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

time (analytical HPLC) ¼ 19.1 min.

402.1455,

HPLC) ¼ 22.1 min.

found

402.14.

Retention

time

(analytical

0

4

.2.33. 1-([1,1 -biphenyl]-4-ylmethyl)-6-ﬂuoro-7-

0

(

hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl)-4-oxo-1,4-

4.2.36. 1-([1,1 -biphenyl]-4-ylmethyl)-7-ﬂuoro-4-oxo-1,4-

dihydroquinoline-3-carboxylic acid (UIPC-II-085, 31a)

dihydroquinoline-3-carboxylic acid (UICK-IV-089, 5l)

UICK-III-197 (100 mg, 0.26 mmol) was dissolved in 4 mL DMSO

to which was added octahydropyrrolo [3,4-c] pyrrole (72 mg,

UIPC-II-083 (30a) (100 mg, 0.26 mmol) was dissolved in 30 mL

of 1:1 THF: 1% aqueous LiOH and stirred at 40 C for 2 h. The re-

ꢀ

0

.64 mmol) and DIPEA (115

m

L, 0.67 mmol). The reaction was set to

action was diluted with water and acidiﬁed to pH 1 with HCl. The

aqueous layer was extracted three times with 20 mL EtOAc. The

combined organic layers were washed with brine, dried over

ꢀ

stir at 40 C for 4 h. To the reaction mixture water was added and

the resulting mixture was centrifuged and the supernatant

removed. The remaining precipitant was washed with water and

2 4

Na SO , ﬁltered and concentrated in vacuo to give UIPC-02-083

centrifuged again. The resulting precipitate was lyophilized and

(31a) in quantitative yield which was used for next step without

1

þ

pure UICK-IV-089 (5l) was isolated, 100 mg, 74%.

300 MHz, DMSO)

J ¼ 14.2 Hz, 1H), 7.67 (m, 4H), 7.42 (m, 5H), 6.78 (d, J ¼ 7.4 Hz, 1H),

H

NMR

puriﬁcation. MS ESI calculate for (M þ H) 374.11, found 374.11.

(

d

9.37 (bs,1H, exchangeable), 9.22 (s, 1H), 7.85 (d,

Retention time (analytical HPLC) ¼ 22.9 min.

19

0

5

.84 (s, 2H), 3.58 (m, 4H), 3.40 (m, 2H), 3.08 (m, 4H). F NMR

4.2.37. (S)-1-([1,1 -biphenyl]-4-ylmethyl)-7-(3-(aminomethyl)

(

4

282 MHz, DMSO)

84.20, found 484.20. Retention time (analytical HPLC) ¼ 19.8 min.

d

ꢂ124.68 (s, 1F). MS ESI calculated for (M þ H)þ

pyrrolidin-1-yl)-4-oxo-1,4-dihydroquinoline-3-carboxylic acid (PC-

II-086B) (6a)

UIPC-II-085 (31a) (100 mg, 0.26 mmol) was dissolved in 5 mL

ACN to which was added Boc-(R)-aminomethylpyrrolidine (64 mg,

0.32 mmol) and DIPEA (0.07 mL, 0.40 mmol). The reaction was set

4

0

.2.34. Ethyl 3-(2,4-diﬂuorophenyl)-3-oxopropanoate (UIPC-II-

78, 28)

Commercially available ethyl potassium malonate (622 mg, 1

ꢀ

to stir at 50 C for 48 h. Once complete, 3 mL 4 N HCl was added and

eq.) was dissolved in distilled ACN to which was added trimethyl-

the reaction was stirred for additional 12 h. The crude product was

ꢀ

amine (509

mL, 1 eq.) and allowed to stir at 0 C. To this was added

puriﬁed on a C-18 reverse phase HPLC column, 5e95% ACN over

1

magnesium chloride (414 mg, 1.2 eq.) and the reaction was allowed

to stir at RT for 4 h. In another RBF commercially available 2,4-

30 min to give 6a in 72% yield over 2 steps. H NMR (300 MHz,

MeOD)

d

8.75 (s, 1H), 8.13 (d, J ¼ 9.1 Hz, 1H), 7.81e7.20 (m, 9H), 6.84

diﬂuorobenzoic acid (27) (300 mg, 1 eq.) was dissolved in dry

(d, J ¼ 9.0 Hz, 1H), 6.36 (s, 1H), 5.63 (s, 2H), 3.51 (d, J ¼ 29.4 Hz, 3H),

ꢀ

DCM at 0 C. To this was added oxalyl chloride (192

DMF (13

m

L, 1.3 eq.) and

3.14 (d, J ¼ 30.4 Hz, 3H), 2.86e2.59 (m, 1H), 2.43e2.20 (m, 1H),

ꢀ

þ

mL, 0.1 eq.) at 0 C and the reaction was allowed to stir at RT

2.06e1.77 (m, 1H). MS ESI calculated for (M þ H) 454.20, found

for 2 h. Upon completion of 2 h, the reaction was slowly added to

the ﬁrst RBF contacting the ethyl potassium malonate reaction and

upon complete addition, the reaction mixture was allowed to stir at

RT for 16 h. Upon completion, the reaction was concentrated,

washed with 4 N HCl and the extracted thrice with 25 mL ethyl

acetate. The combined organic layers were washed with brine,

454.20. Retention time (analytical HPLC) ¼ 18.1 min.

4.2.38. Ethyl 1-(4-(1H-pyrazol-1-yl)benzyl)-7-ﬂuoro-4-oxo-1,4-

dihydroquinoline-3-carboxylate (UIPC-II-151C, 30b)

Ethyl 3-(2,4-diﬂuorophenyl)-3-oxopropanoate (UIPC-II-278)

(28) (60 mg, 0.26 mmol) was reﬂuxed in triethylorthoformate

(0.110 mL, 0.65 mmol) and acetic anhydride (0.10 mL, 1.05 mmol)

for 24 h to yield the intermediate enol ether (29). After the reaction

was complete, the mixture was concentrated in vacuo and then

dissolved in ethanol. To this was added (4-(1H-pyrazol-1-yl)

phenyl)methanamine (55 mg, 0.30 mmol) and the reaction was

allowed to stir at room temperature for 2 h. The reaction was

concentrated in vacuo and puriﬁed by ﬂash chromatography using a

gradient of dichloromethane:methanol. The reaction intermediate

was then dissolved in dioxanes, sodium hydride (13 mg,

2 4

dried over Na SO , ﬁltered and concentrated in vacuo and then

puriﬁed by ﬂash chromatography using a gradient of hexanes:ethyl

1

acetate to afford compound UIPC-II-078 (28) in 70% yield. H NMR

(

7

1

300 MHz, Chloroform-d)

.06e6.82 (m, 2H), 4.37e4.14 (m, 2H), 3.97 (d, J ¼ 3.7 Hz, 2H),

.43e1.17 (m, 3H). 19F NMR (282 MHz, CDCl3)

d

7.97 (dtd, J ¼ 34.9, 8.7, 6.6 Hz, 1H),

d

ꢂ100.10 (dt,

J ¼ 20.5, 7.7 Hz), ꢂ104.98 to ꢂ105.38 (m), ꢂ105.97 (d, J ¼ 9.1 Hz). MS

þ

ESI calculate for (M þ H) 229.06, found 229.06.

0

ꢀ

4

.2.35. Ethyl 1-([1,1 -biphenyl]-4-ylmethyl)-7-ﬂuoro-4-oxo-1,4-

0.52 mmol) was added at 0 C and the reaction was allowed to stir

dihydroquinoline-3-carboxylate (UIPC-II-083, 30a)

for 1 h. Once complete, the reaction was concentrated in vacuo and

diluted with water and extracted thrice with 10 mL ethyl acetate.

The combined organic layers were washed with brine, dried over

Ethyl 3-(2,4-diﬂuorophenyl)-3-oxopropanoate (28) (777 mg,

3

.4 mmol) was reﬂuxed in triethylorthoformate (1.42 mL,

8

.5 mmol) and acetic anhydride (1.30 mL, 13.6 mmol) for 24 h to

2 4

Na SO , ﬁltered and concentrated in vacuo to afford 30b in 89%

yield the intermediate enol ether (29). After the reaction was

complete, the mixture was concentrated in vacuo and then dis-

solved in ethanol. To this was added [1,1 -biphenyl]-4-

yield. 30b was used for the next step without further puriﬁcation.

þ

MS ESI calculate for (M þ H) 392.136, found 392.13. Retention time

0

(analytical HPLC) ¼ 18.1 min.

ylmethanamine (750 mg, 4.08 mmol) and the reaction was

allowed to stir at room temperature for 2 h. The reaction was

concentrated in vacuo and puriﬁed by ﬂash chromatography using a

gradient of dichloromethane:methanol. The reaction intermediate

4.2.39. 1-(4-(1H-pyrazol-1-yl)benzyl)-7-ﬂuoro-4-oxo-1,4-

dihydroquinoline-3-carboxylic acid (UIPC-II-157, 31b)

UIPC-II-151C (30b) (70 mg, 0.17 mmol) was dissolved in 20 mL

ꢀ

was then dissolved in dioxanes, sodium hydride was added at 0 C

of 1:1 THF to 1% aqueous LiOH and stirred at 40 C for 2 h. The

and the reaction was allowed to stir at the same temperature for

reaction was diluted with water and acidiﬁed to pH 1 with HCl. The

aqueous layer was extracted three times with 20 mL EtOAc. The

combined organic layers were washed with brine, dried over

1

h. Once complete, the reaction was concentrated in vacuo and

diluted with water. The precipitated product (30a) was ﬁltered,

1

dried and used for the next step. Yield: 84%. H NMR (300 MHz,

2 4

Na SO , ﬁltered and concentrated in vacuo to give UIPC-II-157

CDCl3)

d

8.65 (s, 1H), 8.58 (dd, J ¼ 9.0, 6.4 Hz, 1H), 7.66e7.54 (m,

(31b) in quantitative yield which was used for next step without

1

4

2

H), 7.53e7.30 (m, 4H), 7.23 (d, J ¼ 9.4 Hz, 1H), 7.14 (ddd, J ¼ 8.9, 8.0,

puriﬁcation. H NMR (300 MHz, DMSO)

8.59e8.34 (m, 2H), 7.92e7.65 (m, 4H), 7.59e7.36 (m, 3H), 6.63e6.41

(m, 1H), 5.95e5.77 (m, 2H). 19F NMR (282 MHz, DMSO)

ꢂ102.26

d 14.99 (s, 1H), 9.32 (s, 1H),

.3 Hz, 1H), 7.04 (dd, J ¼ 10.3, 2.2 Hz, 1H), 5.40 (s, 2H), 4.44 (q,

þ

J ¼ 7.1 Hz, 2H), 1.44 (t, J ¼ 7.1 Hz, 3H). MS ESI calculate for (M þ H)

d

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

125

(

3

dd, J ¼ 18.4, 7.2 Hz). MS ESI calculate for (M þ H)^þ364.10, found

(d, J ¼ 13.5 Hz). MS ESI calculated (M þ H)^þ492.2, found 492.2.

Retention time (analytical HPLC) ¼ 23 min.

64.10. Retention time (analytical HPLC) ¼ 18.9 min.

4

2

.2.40. (S)-7-(3-(aminomethyl)pyrrolidin-1-yl)-1-(4-(cyclopenta-

,4-dien-1-yl)benzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic acid

4.2.43. Methyl 6,7-diﬂuoro-8-methoxy-4-oxo-1-((3-

phenylisoxazol-5-yl)methyl)-1,4-dihydroquinoline-3-carboxylate

(UIJD-II-293A, 32b)

(UIPC-IIe159B, 6b)

UIPC-II-157 (31b) (40 mg, 0.11 mmol) was dissolved in 3 mL

DMSO to which was added Boc-(R)-aminomethylpyrrolidine

UIJD-II-202 (18), (150 mg, 0.55 mmol) was placed in a ﬂame

dried round bottom ﬂask under vacuum. Under argon atmosphere,

5-(bromomethyl)-3-phenylisoxazole (278 mg, 1.17 mmol) and

(

33 mg, 0.16 mmol) and DIPEA (0.04 mL, 0.2 mmol). The reaction

ꢀ

was set to stir at 50 C for 1 h. Once complete, 3 mL 4 N HCl was

added and the reaction was stirred for additional 12 h. The crude

product was puriﬁed on a C-18 reverse phase HPLC column, 5e95%

2 3

dried K CO (231 mg, 1.7 mmol) were added to the reaction ﬂask.

Distilled ACN (1.5 mL) was then added and the reaction mixture

ꢀ

stirred at 45 C for 24 h. The crude product was puriﬁed by silica gel

1

ACN over 30 min to give 6b in 51% yield over 2 steps. H NMR

ﬂash chromatography using a gradient of hexanes to ethyl acetate,

1

(

7

1

3

7

300 MHz, MeOD)

d

9.44 (s, 18H), 8.30 (dd, J ¼ 16.5, 6.0 Hz, 36H),

yielding 185 mg of UIJD-II-293A (32b), 77% yield.

(300 MHz, DMSO)

H NMR

.93e7.66 (m, 54H), 7.62e7.46 (m, 34H), 7.22 (dd, J ¼ 9.4, 1.9 Hz,

d

8.88 (s, 1H), 7.97e7.89 (m, 1H), 7.84 (m, 2H),

8H), 6.67 (d, J ¼ 2.0 Hz, 18H), 6.55 (dd, J ¼ 2.6, 1.9 Hz, 17H), 5.99 (s,

7.51e7.44 (m, 3H), 7.00 (s, 1H), 5.97 (s, 2H), 3.85 (d, J ¼ 1.9 Hz, 3H),

19

4H), 3.60 (ddd, J ¼ 26.8, 18.4, 9.4 Hz, 54H), 3.39 (d, J ¼ 1.7 Hz, 3H),

.28e3.24 (m, 5H), 3.13 (dd, J ¼ 9.9, 7.4 Hz, 37H), 2.72 (dd, J ¼ 15.1,

3.78 (s, 3H). F NMR (300 MHz, DMSO)

d

ꢂ135.56 (m), ꢂ143.03 (m).

þ

MS ESI calculated (M þ H) 429.12, found 429.18. Retention time

.4 Hz, 18H), 2.36 (dd, J ¼ 11.2, 5.8 Hz, 19H), 2.03e1.80 (m, 18H). MS

(analytical HPLC) ¼ 20.8 min.

þ

ESI calculated for (M þ H) 442.20, found 442.20. Retention time

(

analytical HPLC) ¼ 14.7 min.

4.2.44. (S)-7-(3-(aminomethyl)pyrrolidin-1-yl)-6-ﬂuoro-8-

methoxy-4-oxo-1-((3-phenylisoxazol-5-yl)methyl)-1,4-

4

.2.41. Methyl 1-(4-(1H-pyrazol-1-yl)benzyl)-6,7-diﬂuoro-8-

methoxy-4-oxo-1,4-dihydroquinoline-3-carboxylate (UIJD-II-291A,

2a)

UIJD-II-202 (18) (55 mg, 0.2 mmol) was added to a ﬂame dried

round bottom ﬂask and placed under vacuum. Under argon atmo-

sphere 1-(4-(bromomethyl)phenyl)-1H-pyrazole (99 mg,

.42 mmol) and K CO (85 mg, 0.61 mmol) were added. Distilled

dihydroquinoline-3-carboxylic acid (UIJD-II-294B, 7b)

To UIJD-II-293A (32b), (180 mg, 0.43 mmol) 2 mL of 1% LiOH and

4 mL of distilled THF were added and stirred at room temperature

for 6 h. The solvent was removed by rotary evaporation and the

crude product used without further puriﬁcation. Carboxylic acid

UIJD-II-293B (33b), (180 mg, 0.43 mmol) was placed in a ﬂame

dried ﬂask under vacuum, the reaction ﬂask was placed under

argon atmosphere and anhydrous DMSO was added (1 mL) with

stirring. Next, (R)-tert-butyl (pyrrolidin-3-ylmethyl)carbamate

3

0

2

3

ACN (1.5 mL) was added to the reaction ﬂask and the mixture was

stirred at 45 C for 20 h. The crude reaction product was puriﬁed by

ꢀ

silica gel ﬂash chromatography using a gradient of hexanes to ethyl

acetate, yielding 25 mg of pure UIJD-II-291A (32a), 33% yield. H

(129 mg, 0.6 mmol) and triethylamine (300

m

L, 2.15 mmol) were

1

ꢀ

added. The reaction was heated to 40 C for 24 h, the crude reaction

product was dissolved in 4 mL of 1:1 ACN to water and puriﬁed on a

C-18 reverse phase HPLC column, 25e95% ACN over 30 min. To the

puriﬁed product 1 mL of ACN and 1 mL of 4 N HCl were added and

NMR (300 MHz, DMSO)

d

8.60e8.42 (m, 1H), 8.12 (dd, J ¼ 10.0,

8

.7 Hz, 1H), 7.92 (d, J ¼ 2.4 Hz, 1H), 7.72 (d, J ¼ 8.5 Hz, 3H), 7.17 (d,

J ¼ 8.5 Hz, 2H), 6.56e6.39 (m, 1H), 5.82e5.62 (m, 2H), 4.04e3.84

1

9

ꢀ

(

m, 3H), 3.78e3.58 (m, 3H). F NMR (282 MHz, CDCl

3

)

d

ꢂ135.54

the reaction was stirred at 25 C for 12 h, to remove the tert-buty-

dd, J ¼ 21.5, 10.2 Hz), ꢂ142.98 to ꢂ143.35 (m). MS ESI calculated

loxycarbonyl protecting group. The puriﬁed product was lyophi-

þ

M

þ

H) 426.12, found 426.14. Retention time (analytical

lized and 12 mg of UIJD-II-294B (7b), was obtained, 7% yield over 3

1

HPLC) ¼ 18.9 min.

steps. H NMR (400 MHz, DMSO)

d

9.07 (s, 1H), 7.99 (s, 3H),

7

.83e7.78 (m, 2H), 7.74 (d, J ¼ 13.8 Hz, 1H), 7.46 (d, J ¼ 3.5 Hz, 3H),

4.2.42. (S)-1-(4-(1H-pyrazol-1-yl)benzyl)-7-(3-(aminomethyl)

7.01 (s, 1H), 6.12e5.99 (m, 2H), 3.61e3.55 (m, 2H), 3.53 (d,

J ¼ 8.0 Hz, 1H), 3.50e3.44 (m, 1H), 3.41 (s, 3H), 3.37 (d, J ¼ 7.6 Hz,

1H), 2.94e2.85 (m, 2H), 2.07 (dd, J ¼ 11.6, 5.3 Hz, 1H), 1.72e1.63 (m,

pyrrolidin-1-yl)-6-ﬂuoro-8-methoxy-4-oxo-1,4-dihydroquinoline-

3-carboxylic acid (UIJD-II-292B, 7a)

1

9

UIJD-II-291A (32a), (25 mg, 0.06 mmol) was placed in a reaction

1H). F NMR (300 MHz, DMSO)

d

ꢂ120.43 to ꢂ120.63 (m). MS ESI

þ

ﬂask and 1.5 mL of 1% LiOH and 3 mL of distilled THF were added.

The reaction mixture was stirred for 3.5 h. The solvent was removed

by rotary evaporation and the crude product used without further

puriﬁcation. The carboxylic acid (33a) was then placed in a ﬂame

dried round bottom ﬂask under vacuum. Under argon atmosphere

calculated (M þ H) 493.2, found 493.19. Retention time (analytical

HPLC) 18.3 min.

0

4.2.45. Methyl 6,7-diﬂuoro-1-((4 -ﬂuoro-[1,1 -biphenyl]-4-yl)

methyl)-8-methoxy-4-oxo-1,4-dihydroquinoline-3-carboxylate

DMSO (800

m

L) was added with stirring, followed by tert-butyl

(UIJD-I-265, 32c)

0

(

pyrrolidin-3-ylmethyl)carbamate (18.5 mg, 0.09 mmol) and trie-

UIJD-I-207 (18) (27.2 mg, 0.1 mmol), 4-ﬂuoro-4 -methyl-1,1 -

thylamine (45

m

L, 0.31 mmol). The reaction mixture was heated to

2 3

biphenyl (Scheme S1, 37) (80 mg, 0.3 mmol) and K CO (414.9 mg,

ꢀ

4

5 C and stirred for 24 h. The reaction mixture was diluted with

0.3 mmol) were added to a ﬂame dried reaction ﬂask. The reaction

ﬂask was ﬂushed three times with argon and the reagents were

1

:1 ACN to water and puriﬁed on a C-18 reverse phase HPLC col-

ꢀ

umn, 25e95% ACN over 30 min. To the puriﬁed product 1 mL of ACN

and 1 mL of 4 N HCl were added and the reaction was stirred at RT

for 10 h, to remove the tert-butyloxycarbonyl protecting group. The

puriﬁed product was lyophilized and 10 mg of UIJD-II-292B (7a)

dissolved in 2 mL of anhydrous DMF at 50 C. The reaction was

stirred for 20 h. The DMF was removed by rotary evaporation,

NaHCO

times with 10 mL of DCM. The combined organic layers were dried

over Na SO , ﬁltered and concentrated in vacuo. The residue was

3

was added and the aqueous phase was extracted three

1

was obtained, 34% yield over 3 steps. H NMR (300 MHz, DMSO)

2

4

d

9.12 (s, 1H), 8.53e8.37 (m, 1H), 8.27 (s, 3H), 7.77 (d, J ¼ 8.3 Hz, 2H),

then puriﬁed by normal phase silica gel ﬂash chromatography us-

7

5

.69 (d, J ¼ 13.4 Hz, 2H), 7.30 (d, J ¼ 8.4 Hz, 2H), 6.60e6.41 (m, 1H),

ing a gradient of hexanes to ethyl acetate. Yielding pure, UIJD-I-265

1

.91 (q, J ¼ 15.1 Hz, 2H), 3.76e3.51 (m, 2H), 3.48 (s, 3H), 3.46e3.30

(32c), 37 mg, 81% yield. H NMR (300 MHz, CDCl

3

)

d

8.55 (s, 1H),

(

5

m, 2H), 2.99e2.83 (m, 2H), 2.56 (d, J ¼ 7.4 Hz,1H), 2.09 (dd, J ¼ 11.5,

8.20 (ddd, J ¼ 18.8, 9.3, 7.5 Hz, 1H), 7.57e7.50 (m, 4H), 7.16 (ddd,

19

.9 Hz, 1H), 1.74e1.64 (m, 1H). F NMR (300 MHz, DMSO) ꢂ120.44

J ¼ 10.1, 8.5, 5.4 Hz, 5H), 5.76 (s, 2H), 3.96 (s, 3H), 3.72 (d, J ¼ 2.3 Hz,

126

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

3

4

H). ¹⁹F NMR (282 MHz, Acetone)

d

ꢂ114.87 (td, J ¼ 8.4,

30 min before 5 mL of cold water was added. The resulting pre-

cipitate was collected, ﬁltered, and washed three times with cold

water. The crude product was dried in vacuo. Next, the ester in-

termediate was dissolved in a 1% LiOH in THF solution with stirring

.9 Hz), ꢂ135.37 (dd, J ¼ 21.2, 10.4 Hz), ꢂ142.73 to ꢂ143.35 (m). MS

þ

ESI calculated (M þ H) 453.12, found 453.65. Retention time

(

analytical HPLC) ¼ 23.4 min.

ꢀ

and heated to 40 C. After 1 h the reaction was complete. The THF

0

4.2.46. (S)-7-(3-(aminomethyl)pyrrolidin-1-yl)-6-ﬂuoro-1-((4 -

was removed by rotary evaporation. The aqueous layer was acidi-

ﬁed to pH ¼ 1 and the precipitate collected, ﬁltered and washed

three times with 1 mL of water. The carboxylic UIJD-II-289C (9),

0

ﬂuoro-[1,1 -biphenyl]-4-yl)methyl)-8-methoxy-4-oxo-1,4-

dihydroquinoline-3-carboxylic acid (UIJD-I-277, 7c)

1

UIJD-I-265 (32c), (37 mg, 0.08 mmol), was dissolved in 1% LiOH

was collected 43.1 mg, 50% over three steps. H NMR (300 MHz,

ꢀ

in THF (1:2) and stirred at 25 C for 2 h. The THF was removed by

rotary evaporation and then 1 mL of 4 N HCl was added to acidify to

pH of 1. The aqueous phase was extracted three times with DCM,

washed with brine, dried over Na

vacuo. The crude product (33c) was used in the next step without

puriﬁcation. UIJD-I-271 (33c), (50 mg, 0.11 mmol) and (R)-tert-

DMSO)

d

9.09 (s, 1H), 8.47 (d, J ¼ 2.6 Hz, 1H), 8.23e8.12 (m, 1H), 7.98

(dd, J ¼ 12.2, 6.7 Hz, 1H), 7.83 (d, J ¼ 8.6 Hz, 2H), 7.73 (d, J ¼ 1.7 Hz,

19

1H), 7.37 (d, J ¼ 8.5 Hz, 2H), 6.56e6.50 (m, 1H), 5.74 (s, 2H). F NMR

2

SO

4

ﬁltered and concentrated in

(282 MHz, CDCl

3

)

d

ꢂ129.80 (s), ꢂ140.73 (s). MS ESI calculated

þ

(M þ Na) 404.08, found 404.08. Retention time (analytical

HPLC) ¼ 20.4 min.

butyl (pyrrolidin-3-ylmethyl)carbamate (270

mL, 0.23 mmol) were

placed in a ﬂame dried ﬂask. 1 mL of anhydrous DMSO was added

under inert conditions. Finally, triethylamine (466

was added and stirred at 25 C for 42 h. Without puriﬁcation, 2 mL

m

L, 0.34 mmol)

4

.2.49. (S)-1-(4-(1H-pyrazol-1-yl)benzyl)-7-(3-(aminomethyl)

ꢀ

pyrrolidin-1-yl)-6-ﬂuoro-4-oxo-1,4-dihydroquinoline-3-carboxylic

acid (UIJD-II-290B, 9a)

UIJD-II-289C (9), (40 mg, 0.11 mmol) was placed in a ﬂame dried

ﬂask with an oven dried stir bar and dissolved in 1 mL of anhydrous

DMSO. Under argon atmosphere distilled TEA (73 mL, 0.524 mmol)

and Boc-AMP (31.5 mg, 0.15 mmol) were added and stirred. The

reaction was warmed to 60 C for 2 h, 5 mL of cold water was added.

The resulting precipitate was collected and washed three times

with 5 mL of water. The crude reaction mixture was dissolved in

of triﬂuoroacetic acid was added and the mixture was stirred for

ꢀ

2

4 h at 25 C. The solution was then diluted with water and puriﬁed

by semi-preparative HPLC (PFP). Pure UIJD-I-277 (7c) was isolated,

1

2

0 mg, 48% over 3 steps. H NMR (300 MHz, CDCl

3

) d 9.13 (s, 1H),

7

.73 (d, J ¼ 13.9 Hz, 1H), 7.65 (dd, J ¼ 8.8, 5.6 Hz, 2H), 7.59 (d,

J ¼ 8.3 Hz, 2H), 7.31e7.22 (m, 4H), 5.94 (d, J ¼ 9.9 Hz, 2H), 3.64e3.58

ꢀ

(

m, 2H), 3.47 (s, 3H), 3.42e3.37 (m, 3H), 2.97e2.88 (m, 2H), 2.08

19

(

dd, J ¼ 8.2, 6.2 Hz, 1H), 1.75e1.65 (m, 1H). F NMR (300 MHz,

MeOD)

d

ꢂ118.28 (ddd, J ¼ 19.0, 11.2, 5.6 Hz), ꢂ122.35 to ꢂ122.62

2

mL of 4 N HCl and 2 mL of ACN with stirring. After 20 h the re-

þ

(

m).). MS ESI calculated M þ H 520.20, found 519.95. Retention

action was complete, the ACN was removed and remaining aqueous

layer was lyophilized. Pure UIJD-II-290B (9a), was collected

time (analytical HPLC) ¼ 20.8 min.

19

13.1 mg, 27% yield over two steps. F NMR (282 MHz, DMSO)

0

4.2.47. (R)-7-(3-aminopyrrolidin-1-yl)-6-ﬂuoro-1-((4 -ﬂuoro-[1,1 -

1

d

8

ꢂ126.78 (d, J ¼ 12.5 Hz H NMR (400 MHz, DMSO)

d 9.16 (s, 1H),

biphenyl]-4-yl)methyl)-8-methoxy-4-oxo-1,4-dihydroquinoline-3-

carboxylic acid (UIJD-II-244, 8c)

UIJD-I-271 (33c), (16 mg, 0.36 mmol) was placed in a ﬂame

dried round bottom ﬂask with oven dried stir bar and dissolved in

.47 (d, J ¼ 2.5 Hz, 1H), 7.81 (m, 3H), 7.72 (d, J ¼ 1.6 Hz, 1H), 7.48 (d,

J ¼ 8.6 Hz, 2H), 6.63 (d, J ¼ 7.5 Hz, 1H), 6.54e6.49 (m, 1H), 5.80 (s,

H), 3.70e3.63 (m, 2H), 3.46e3.36 (m, 3H), 2.92e2.85 (m, 2H), 2.11

2

19

(

dd, J ¼ 11.6, 5.3 Hz, 1H), 1.80e1.72 (m, 1H). F NMR (282 MHz,

1

mL of ACN. Under argon atmosphere distilled TEA (152

mL,

þ

DMSO)

d

ꢂ126.67 to ꢂ126.85 (m).). MS ESI calculated (M þ H)

1.09 mmol) and (R)-tert-butyl pyrrolidin-3-ylcarbamate (18 mg,

4

62.19, found 462.19. Retention time (analytical HPLC) ¼ 15.71 min.

0

6

.09 mmol) were added with stirring. The reaction was heated to

0 C for 27 h. The ACN was removed by rotary evaporation. The

ꢀ

crude product was reconstituted in DCM, extracted three times

from water and dried in vacuo. To the crude reaction product 2 mL

of 3 N HCl and 2 mL of ACN was added and stirred at RT for 24 h. The

crude product was puriﬁed on a PFP propyl reverse phase HPLC

column, 20e95% ACN over 25 min. UIJD-II-244 (8c), was isolated as

4.2.50. (S)-1-(4-(1H-pyrazol-1-yl)benzyl)-6-ﬂuoro-7-(3-

((methylamino)methyl)pyrrolidin-1-yl)-4-oxo-1,4-

dihydroquinoline-3-carboxylic acid (UIJD-II-304B,9b)

UIJD-II-301C (9), (50 mg, 0.13 mmol) was added to a ﬂame dried

round bottom ﬂask with an oven dried stir bar and dissolved in

anhydrous DMSO (1 mL) with stirring. Under argon atmosphere

(R)-tert-butyl methyl(pyrrolidin-3-ylmethyl)carbamate (34 mg,

1

the pure product, 8.1 mg, 44% yield over 2 steps. H NMR (400 MHz,

MeOD)

d

8.99 (s, 1H), 7.82 (d, J ¼ 13.7 Hz, 1H), 7.56 (dd, J ¼ 14.5,

.8 Hz, 4H), 7.23 (d, J ¼ 7.8 Hz, 2H), 7.13 (t, J ¼ 8.7 Hz, 2H), 5.90 (s,

H), 3.96 (d, J ¼ 0.4 Hz, 1H), 3.86 (dd, J ¼ 10.7, 5.6 Hz, 1H), 3.77e3.70

8

2

0.15 mmol) and distilled TEA (55

m

L, 0.39 mmol) were added. The

ꢀ

(

1

d

m, 2H), 3.58 (s, 3H), 3.56e3.46 (m, 1H), 2.41 (dd, J ¼ 13.1, 6.4 Hz,

reaction was stirred at 40 C for 24 h. Cold water (5 mL) was added

to the reaction mixture, the precipitate was collected, ﬁltered, and

washed three times with 2 mL of water. To the crude reaction

product 2 mL of 4 N HCl and 2 mL of ACN were added and stirred for

12 h at room temperature. The ACN was removed by rotary evap-

oration and the remaining aqueous layer lyophilized. Pure UIJD-II-

19

H), 2.07 (dd, J ¼ 12.6, 5.9 Hz, 1H). F NMR (300 MHz, MeOD)

ꢂ117.37 to ꢂ117.58 (m), ꢂ121.26 (d, J ¼ 14.3 Hz). MS ESI calculated

þ

(

M

þ

H) 506.18, found 506.2. Retention time (analytical

HPLC) ¼ 20.7 min.

1

4.2.48. 1-(4-(1H-pyrazol-1-yl)benzyl)-6,7-diﬂuoro-4-oxo-1,4-

304B (9b), was collected 32 mg, 50% over two steps. H NMR

dihydroquinoline-3-carboxylic acid (UIJD-II-289C, 9)

(400 MHz, DMSO) d 15.57 (s, 1H), 9.19 (s, 1H), 9.15 (s, 1H), 8.47 (d,

UIJD-II-270 (24), (70 mg, 0.23 mmol) was dissolved in 500

m

L of

J ¼ 2.5 Hz, 1H), 7.80 (dd, J ¼ 17.1, 11.4 Hz, 3H), 7.71 (d, J ¼ 1.7 Hz, 1H),

7.50 (d, J ¼ 8.5 Hz, 2H), 6.64 (d, J ¼ 7.4 Hz, 1H), 6.55e6.49 (m, 1H),

5.81 (s, 2H), 3.66 (t, J ¼ 7.5 Hz, 1H), 3.53 (s, 1H), 3.48e3.40 (m, 2H),

2.97 (s, 2H), 2.65 (dd, J ¼ 13.9, 7.2 Hz, 1H), 2.53 (d, J ¼ 1.7 Hz, 3H),

ꢀ

MeOH with stirring and cooled to 0 C. (4-(1H-pyrazol-1-yl)phenyl)

methanamine (48 mg, 0.28 mmol) was added, the reaction allowed

to warmed to room temperature, and stirred for 30 min. The MeOH

was removed by rotary evaporation and concentrated in vacuo.

19

2.14 (td, J ¼ 11.9, 6.7 Hz, 1H), 1.78 (dt, J ¼ 17.1, 6.3 Hz, 1H). F NMR

Crude product was dissolved in 500

mL of dioxane and cooled to

(282 MHz, DMSO)

d

ꢂ122.36 to ꢂ122.65 (m). MS ESI calculated

ꢀ

þ

0

C. After 5 min, sodium hydride was added (22 mg, 0.92 mmol)

and the reaction allowed to warm to RT. The reaction was stirred for

(M

þ

H) 476.2, found 476.21. Retention time (analytical

HPLC) ¼ 16.2 min.

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

127

4

.2.51. 1-(4-(1H-pyrazol-1-yl)benzyl)-6-ﬂuoro-7-((3aS,7aS)-

J ¼ 8.1 Hz, 2H), 7.77 (d, J ¼ 1.7 Hz,1H), 7.50 (d, J ¼ 8.1 Hz, 2H), 6.88 (d,

J ¼ 6.4 Hz, 1H), 6.64e6.47 (m, 1H), 6.04 (s, 2H), 3.44 (d, J ¼ 3.0 Hz,

2H), 3.40e3.35 (m, 1H), 3.26 (dd, J ¼ 3.2, 1.6 Hz, 1H), 3.18e2.93 (m,

2H), 2.44 (ddd, J ¼ 9.6, 5.3, 2.2 Hz, 1H), 2.12e1.98 (m, 1H), 1.71 (ddd,

hexahydro-1H-pyrrolo[3,4-c]pyridin-2(3H)-yl)-4-oxo-1,4-

dihydroquinoline-3-carboxylic acid (UIJD-II-300B, 9c)

UIJD-II-297C (9), (34 mg, 0.01 mmol) was placed in a ﬂame

dried round bottom ﬂask with an oven dried stir bar and dissolved

in 1 mL of anhydrous DMSO. Under argon atmosphere (3aS, 7aR)-

19

J ¼ 15.9, 13.7, 8.8 Hz, 1H). F NMR (282 MHz, CDCl

3

)

d

ꢂ130.06

þ

to ꢂ130.55 (m). MS ESI calculated (M þ H) 462.19, found 462.19.

tert-butyl

hexahydro-1H-pyrrolo[3,4-c]pyridine-5(6H)-carbox-

L, 0.45 mmol)

Retention time (analytical HPLC) ¼ 15.6 min.

ylate (30.3 mg, 0.13 mmol) and distilled TEA (62

m

ꢀ

were added. The reaction mixture was heated to 45 C for 5 h. Cold

water (5 mL) was added and the resulting precipitate was collected

and washed three times with 2 mL of water. To the crude reaction

product 1 mL of 4 N HCl and 2 mL of ACN were added and the re-

action was stirred for 5 h at room temperature. The puriﬁed product

4.2.54. 1-(4-(1H-pyrazol-1-yl)benzyl)-6-ﬂuoro-7-

(hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl)-4-oxo-1,4-

dihydroquinoline-3-carboxylic acid (UIJD-II-299, 9f)

UIJD-II-297C (9), (45 mg, 0.12 mmol) was placed in a ﬂame dried

round bottom ﬂask with an oven dried stir bar and dissolved in

2 mL of anhydrous DMSO. Under argon atmosphere octahy-

dropyrrolo[3,4-c]pyrrole (33.7 mg, 0.3 mmol) and distilled TEA

was lyophilized and 18 mg of UIJD-II-300B (9c), was collected, 42%

yield over two steps. H NMR (400 MHz, DMSO)

1

d

15.57 (s, 1H), 9.60

(

2

1

2

d, J ¼ 50.1 Hz, 1H), 9.26 (d, J ¼ 20.8 Hz, 1H), 9.15 (s, 1H), 8.50e8.42

(54 mL, 0.4 mmol) were added. The reaction mixture was heated to

ꢀ

m, 1H), 7.91e7.74 (m, 3H), 7.72 (d, J ¼ 1.6 Hz, 1H), 7.48 (d, J ¼ 8.5 Hz,

40 C for 3 h. Cold water (5 mL) was added and the resulting pre-

cipitate was collected and washed three times with 2 mL of water.

The puriﬁed product was lyophilized and 5.2 mg of UIJD-II-299

H), 6.66 (d, J ¼ 7.5 Hz, 1H), 6.56e6.43 (m, 1H), 5.79 (d, J ¼ 2.4 Hz,

H), 3.92e3.68 (m, 1H), 3.49 (d, J ¼ 5.0 Hz, 2H), 3.25e2.94 (m, 6H),

19

1

.67e2.58 (m, 1H), 1.94e1.81 (m, 1H), 1.68 (m, 1H). F NMR

(9f), was collected, 9% yield over two steps. H NMR (400 MHz,

þ

(

300 MHz, DMSO)

d

ꢂ120.65 (s). MS ESI calculated (M þ H) 488.2,

DMSO)

d

9.53 (s, 1H), 9.17 (d, J ¼ 2.5 Hz, 1H), 8.47 (d, J ¼ 1.9 Hz, 1H),

found 488.21. Retention time (analytical HPLC) ¼ 16.2 min.

7.88e7.79 (m, 4H), 7.72 (dd, J ¼ 2.9, 1.6 Hz, 1H), 7.46 (dd, J ¼ 8.3,

5

.2 Hz, 2H), 6.70 (dd, J ¼ 31.1, 7.3 Hz, 1H), 6.52 (dd, J ¼ 4.3, 2.6 Hz,

4

(

.2.52. (S)-1-(4-(1H-pyrazol-1-yl)benzyl)-6-ﬂuoro-4-oxo-7-

(pyrrolidin-3-ylmethyl)amino)-1,4-dihydroquinoline-3-carboxylic

1H), 5.81 (s, 2H), 4.22e4.14 (m, 1H), 3.94 (d, J ¼ 14.0 Hz, 1H),

3.73e3.69 (m, 2H), 3.65 (d, J ¼ 7.8 Hz, 2H), 3.40 (d, J ¼ 4.9 Hz, 1H),

19

acid (UIJD-II-303B, 9d)

UIJD-II-301C (9), (50 mg, 0.13 mmol) was placed in a ﬂame dried

round bottom ﬂask with an oven dried stir bar and dissolved in

1

3

3.23 (d, J ¼ 1.7 Hz, 1H), 3.05 (dd, J ¼ 13.4, 6.1 Hz, 2H). F NMR

(300 MHz, DMSO)

d

ꢂ124.61 to ꢂ124.77 (m). MS ESI calculated

þ

(M

þ

H) 474.19, found 474.19. Retention time (analytical

mL of anhydrous DMSO. Under argon atmosphere (R)-tert-butyl

-(aminomethyl)pyrrolidine-1-carboxylate (31.5 mg, 0.16 mmol)

HPLC) ¼ 15.8 min.

and distilled TEA (55

m

L, 0.39 mmol) were added. The reaction

4.2.55. 6,7-diﬂuoro-4-oxo-1-((3-phenylisoxazol-5-yl)methyl)-1,4-

dihydroquinoline-3 carboxylic acid (UIJD-II-280, 10)

ꢀ

mixture was heated to 70 C for 20 h. Cold water (5 mL) was added

and the resulting precipitate was collected and washed three times

with 2 mL of water. To the crude reaction product 1 mL of 4 N HCl

and 2 mL of ACN were added and the reaction was stirred for 4 h at

room temperature. The crude product was puriﬁed on a PFP propyl

reverse phase HPLC column, 30e95% ACN over 30 min. The puriﬁed

product was lyophilized and 12.5 mg of UIJD-II-303B (9d), was

UIJD-II-270 (24), (87 mg, 0.29 mmol) was dissolved in MeOH

ꢀ

(500

mL) with stirring and the reaction mixture was cooled to 0 C.

Next, (3-phenylisoxazol-5-yl)methanamine (60 mg, 0.35 mmol)

and warmed to room temperature and stirred for 3 h. The MeOH

was removed by rotary evaporation and concentrated in vacuo. The

ꢀ

crude product was dissolved in dioxane (3 mL) and cooled to 0 C

1

collected, 20% yield over two steps. H NMR (300 MHz, DMSO)

and stirred for 5 min before sodium hydride was added (13.7 mg,

0.57 mmol). The reaction mixture was allowed to warm to room

temperature and was stirred for 1 h 5 mL of cold water was added,

the resulting precipitate collected, and washed three times with

2 mL of water. The crude product was then dissolved in a 1% LiOH in

THF solution (6 mL) the reaction mixture was stirred for 1 h at

d

1

3

9.43 (s, 1H), 9.15 (s, 1H), 8.64e8.45 (m, 1H), 7.84 (dd, J ¼ 17.4,

0.2 Hz, 2H), 7.73 (d, J ¼ 1.6 Hz, 1H), 7.48 (d, J ¼ 8.6 Hz, 2H), 7.23 (s,

H), 6.79 (d, J ¼ 7.1 Hz, 1H), 6.56e6.50 (m, 1H), 5.87 (s, 3H),

.46e3.25 (m, 2H), 3.17 (ddd, J ¼ 19.2, 10.9, 7.6 Hz, 2H), 3.06e2.82

19

(

m, 2H), 2.42e2.25 (m, 1H), 1.96e1.79 (m, 1H), 1.65e1.49 (m, 1H). F

ꢀ

NMR (300 MHz, DMSO)

d

ꢂ130.18 (dd, J ¼ 11.4, 7.0 Hz). MS ESI

40 C. The organic layer was removed by rotary evaporation and the

þ

calculated (M þ H) 462.19, found 462.19. Retention time (analyt-

ical HPLC) ¼ 15.5 min.

product was extracted three times with DCM. The resulting product

was concentrated in vacuo, yielding 30 mg of UIJD-II-280 (10), 27%

1

over three steps. H NMR (300 MHz, DMSO)

d 14.67 (s, 5H), 9.33 (s,

4

.2.53. (R)-1-(4-(1H-pyrazol-1-yl)benzyl)-6-ﬂuoro-4-oxo-7-

6H), 8.40e8.26 (m, 10H), 7.81 (dd, J ¼ 6.7, 3.0 Hz, 8H), 7.57e7.40 (m,

19

(

(pyrrolidin-3-ylmethyl)amino)-1,4-dihydroquinoline-3-carboxylic

17H), 7.09 (s, 6H), 6.13 (s,11H). F NMR (282 MHz, CDCl

3

)

d

ꢂ125.68

acid (UIJD-II-298B, 9e)

UIJD-II-297C (9), (50 mg, 0.13 mmol) was placed in a ﬂame dried

round bottom ﬂask with an oven dried stir bar and dissolved in

to ꢂ125.95 (m), ꢂ137.11 to ꢂ137.36 (m). MS ESI calculated

þ

(M þ Na) 405.07, found 405.07. Retention time (analytical

HPLC) ¼ 22.2 min.

1

mL of anhydrous DMSO. Under argon atmosphere (S)-3-(amino-

methyl)-1-boc-pyrrolidine (39.4 mg, 0.19 mmol) and distilled TEA

200 L, 0.66 mmol) were added. The reaction mixture was heated

4.2.56. (S)-7-(3-(aminomethyl)pyrrolidin-1-yl)-6-ﬂuoro-4-oxo-1-

((3-phenylisoxazol-5-yl)methyl)-1,4-dihydroquinoline-3-carboxylic

acid (UIJD-II-286B, 10a)

UIJD-II-280 (10), (30 mg, 0.08 mmol) was placed in a ﬂame

dried RBF under argon. Anhydrous DMSO (500 mL) was added with

(

m

ꢀ

to 70 C for 20 h. Cold water (5 mL) was added and the resulting

precipitate was collected and washed three times with 2 mL of

water. To the crude reaction product 1 mL of 4 N HCl and 2 mL of

ACN were added and the reaction was stirred for 7 h at room

temperature. The crude product was puriﬁed on a PFP propyl

reverse phase HPLC column, 30e95% ACN over 30 min. The puriﬁed

stirring, followed by distilled TEA (54

m

L, 0.39 mmol) and Boc-AMP

ꢀ

(23 mg, 0.11 mmol). The reaction was heated to 45 C and stirred for

22 h. The crude product was concentrated in vacuo and dissolved in

4 mL of distilled ACN and 2 mL of 4 N HCl. The reaction mixture was

stirred for 18 h. The ACN was removed by rotary evaporation and

the remaining aqueous solution was frozen and lyophilized. Pure

product was lyophilized and 7.1 mg of UIJD-II-298B (9e), was

collected,12% yield over two steps. H NMR (300 MHz, CDCl

1

3

)

d

9.39

(

s, 1H), 8.28 (d, J ¼ 2.4 Hz, 1H), 8.03 (d, J ¼ 11.5 Hz, 1H), 7.84 (d,

128

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

UIJD-II-286B (10a) was collected, 19.1 mg, 53% yield. ¹H NMR

400 MHz, DMSO) 9.12 (s, 1H), 8.06 (s, 3H), 7.88e7.79 (m, 3H),

J ¼ 14.1 Hz, 1H), 6.97 (s, 1H), 5.01 (s, 3H), 3.78e3.70 (m, 1H), 3.60 (s,

1H), 3.51 (dd, J ¼ 16.6, 8.1 Hz, 1H), 3.46e3.37 (m, 1H), 2.87 (s, 2H),

(

d

19

7

3

2

.52e7.43 (m, 3H), 7.21 (s, 1H), 6.71 (d, J ¼ 7.3 Hz, 1H), 6.07 (s, 2H),

2.62e2.51 (m, 1H), 2.11 (s, 1H), 1.77 (dd, J ¼ 17.2, 8.7 Hz, 1H).

F

.75 (t, J ¼ 7.2 Hz, 1H), 3.60 (s, 1H), 3.52 (dd, J ¼ 16.8, 8.1 Hz, 1H),

.95e2.85 (m, 2H), 2.61e2.52 (m, 1H), 2.14 (dd, J ¼ 11.5, 5.1 Hz, 1H),

NMR (300 MHz, DMSO) ꢂ126.74 (ddd, J ¼ 12.7, 8.8, 4.6 Hz). MS ESI

þ

calculated (M þ H) 479.18, found 479.18. Retention time (analyt-

1

9

1.78 (dd, J ¼ 12.4, 8.1 Hz, 1H). F NMR (282 MHz, CDCl

3

)

d

ꢂ126.59

ical HPLC) ¼ 13.4 min.

þ

to ꢂ126.85 (m). MS ESI calculated (M þ H) 463.17, found 463.17.

Retention time (analytical HPLC) ¼ 17.4 min.

0

4.2.59. (S)-7-(3-(aminomethyl)pyrrolidin-1-yl)-6-ﬂuoro-1-((4 -

0

ﬂuoro-[1,1 -biphenyl]-4-yl)methyl)-4-oxo-1,4-dihydroquinoline-3-

4.2.57. (S)-7-(3-(aminomethyl)pyrrolidin-1-yl)-6-ﬂuoro-4-oxo-1-

carboxylic acid (UIJD-III-133, 13a)

(

(3-(pyridin-4-yl)-1,2,4-oxadiazol-5-yl)methyl)-1,4-

UIJD-III-116 (24) (170 mg, 0.58 mmol) was dissolved in meth-

ꢀ

0

dihydroquinoline-3-carboxylic acid (UIJD-III-130,11a)

anol (10 mL), cooled to 0 C and (4 -ﬂuoro-[1,1 -biphenyl]-4-yl)

methanamine (Scheme S2, 40) (140 mg, 0.7 mmol) was added. The

reaction stirred at room temperature for 48 h. The reaction mixture

was then concentrated in vacuo and the resultant crude product

was used without further puriﬁcation. The crude intermediate was

UIJD-III-116 (24) (104 mg, 0.34 mmol) was dissolved in meth-

ꢀ

anol (5 mL), cooled to 0 C and [3-pyridin-4-yl-1,2,4-oxadiazol-5-

yl] methanamine (103 mg, 0.41 mmol) was added. The reaction

stirred at room temperature for 48 h. The reaction mixture was

then concentrated in vacuo and the resultant crude product was

used without further puriﬁcation. The crude product was dissolved

ꢀ

dissolved in dioxane (10 mL), cooled to 0 C, and sodium hydride

(50 mg, 2.1 mmol) was added to facilitate ring closing. The reaction

was allowed to warm to room temperature was stirred for 28 h. The

reaction mixture was concentrated in vacuo and the crude product

was used without puriﬁcation. The crude product was dissolve in

DMSO (1 mL) and (R)-tert-Butyl [[pyrrolidin-3-yl]methyl]carba-

ꢀ

in dioxane (5 mL), cooled to 0 C, and sodium hydride (24 mg, 1.0)

mmol) was added. The reaction was allowed to warm to room

temperature was stirred for 28 h. The reaction mixture was

concentrated in vacuo and the crude product was used without

further puriﬁcation. To the crude intermediate 5 mL of 1% LiOH and

mate (223 mg, 1.14 mmol) and DIPEA (100

m

L) were added. The

ꢀ

1

0 mL of THF were added and the reaction stirred for 25 min. The

reaction was heated to 45 C and stirred for 24 h. To the crude re-

action product 15 mL of 4 N aqueous hydrochloric acid and 15 mL of

ACN were added and stirred for 48 h. The boc deprotected product

was puriﬁed by semi-preparative HPLC on a C-18 column, 30e95%

crude product was concentrated in vacuo and used in the next step

without puriﬁcation. The crude intermediate was dissolve in DMSO

(

1 mL) and (R)-tert-Butyl [[pyrrolidin-3-yl]methyl]carbamate

34 mg, 0.18 mmol) and DIPEA (100

mL) were added. The reaction

over 30 min. UIJD-III-133 (13a) was isolated, 60 mg, 20% yield over

ꢀ

1

was heated to 45 C and stirred for 1 h. To the crude reaction

product 2 mL of 4 N aqueous hydrochloric acid and 4 mL of ACN

were added and stirred for 24 h. The boc deprotected product was

puriﬁed by semi-preparative HPLC on a C-18 column, 10e50% over

4 steps. H NMR (300 MHz, MeOD)

d

9.19 (s, 1H), 8.14 (exchange-

able) (s, 3H), 7.81 (d, J ¼ 14.2 Hz, 1H), 7.73e7.62 (m, 4H), 7.48e7.39

(m, 2H), 7.27 (m, 2H), 6.67 (d, J ¼ 7.4 Hz, 1H), 5.82 (s, 2H), 3.53 (m,

19

1H), 3.44 (m, 2H), 2.90 (t, 2H), 2.12 (m, 1H), 1.80e1.74 (m, 1H).

F

3

0 min. Pure UIJD-III-130 (11a) was isolated, 20 mg, 7% yield over 5

NMR (282 MHz, DMSO)

ESI calculated for (M þ H ) 490.19, found 490.19. Retention time

(analytical HPLC) ¼ 19.8 min.

d

ꢂ115.13 (m), ꢂ126.61 to ꢂ126.89 (m). MS

1

þ

steps. H NMR (300 MHz, DMSO)

d

9.13 (s, 1H), 8.78 (d, J ¼ 6.0 Hz,

H), 7.87 (dt, J ¼ 5.9, 4.0 Hz, 4H), 6.66 (d, J ¼ 7.3 Hz, 1H), 6.34 (s, 2H),

.84e3.71 (m, 1H), 3.62e3.45 (m, 3H), 3.44e3.35 (m, 2H),

2

3

2

19

.97e2.86 (m, 1H), 2.18e2.03 (m, 1H), 1.75 (m, 1H). F NMR

4.3. Relaxation assay for eukaryotic Topo I

(

4

282 MHz, CDCl

3

)

d

ꢂ126.65 (m). MS ESI calculated for (M þ H)þ

65.16, found 465.16. Retention time (analytical HPLC) ¼ 12.5 min.

hTopo I purchased from Inspiralis was used in this study. One

unit of hTopo I was deﬁned as the amount of topoisomerase

4.2.58. 7-((S)-3-(aminomethyl)pyrrolidin-1-yl)-6-ﬂuoro-4-oxo-1-

required to completely relax 0.3

mg of the negatively-supercoiled

(

1-(3-(pyridin-4-yl)-1,2,4-oxadiazol-5-yl)ethyl)-1,4-

pBR322 plasmid DNA under the conditions described below.

dihydroquinoline-3-carboxylic acid (UIJD-III-067C, 12a)

Relaxation reaction mixtures (20

(pH 7.5 at 23 C), 100 mM NaCl, 10 mM MgCl

m

L) contained 50 mM Tris-HCl

, 1 mM dithiothreitol

g of the super-

ꢀ

UIJD-II-296A (24), (300 mg, 0.99 mmol) was dissolved in MeOH

2

ꢀ

(

3 mL) and cooled to 0 C. 1-(3-(pyridin-4-yl)-1,2,4-oxadiazol-5-yl)

(DTT), 50

mg/mL bovine serum albumin (BSA), 0.3

m

ethanamine (272 mg, 0.89 mmol) was added, the reaction allowed

to warm to room temperature, and stirred for 1 h. The MeOH was

removed by rotary evaporation and the product concentrated in

vacuo. To the crude product 1 mL of dioxane was added and the

coiled plasmid DNA, 1 unit of hTopo I, and the various concentra-

tions of ﬂuoroquinolones. Reaction mixtures were incubated at

ꢀ

37 C for 15 min and terminated by adding ethylenediaminetetra-

acetic acid (EDTA) to 25 mM. The DNA products were analyzed by

electrophoresis through vertical 1.2% agarose gels at 2 V/cm for 15 h

ꢀ

reaction mixture cooled to 0 C. After 5 min, sodium hydride

(

48 mg, 1.99 mmol) was added and stirred for 24 h to facilitate ring

in TAE buffer. Gels were stained with 0.5 mg/mL ethidium bromide,

closing. The reaction product was concentrated and used in the

next step without puriﬁcation, 5 mL of 1% LiOH and 10 mL THF were

added and the reaction stirred at rt for 1 h. The crude product was

concentrated in vacuo. The hydrolyzed product (12) was placed in a

ﬂame dried round bottom ﬂask with an oven dried stir bar and

dissolved in 1 mL of anhydrous DMSO. Under argon atmosphere

and then photographed and quantiﬁed using a MyECL Imager

(Thermo Fisher Scientiﬁc).

4.4. Docking

Docking was preformed using the program MOE 2016.08. The

DNA receptor sequences d(CGCGAATTCGCG) [PDB ID: 1G3X] and

d(AGGTCACGGTGGCCA) [PDB ID: 2MG8] were downloaded from

the protein data bank (http://rcsb.org/pdb ). The solvent, molecular

ions, and co-crystallized compounds were removed from the re-

ceptor. The protonate 3D function was used to prepare the receptor.

This function determines the lowest potential energy conﬁguration,

places hydrogens and assigns the ionization state throughout the

system. Next the site ﬁnder function in MOE was used to determine

distilled TEA (418

m

L, 3.0 mmol) and Boc-AMP (237.9 mg,

ꢀ

1.18 mmol) were added to the reaction mixture and heated to 40 C

for 24hrs. Upon reaction completion 3 mL of ACN and 3 mL of 4 N

HCl were added and stirred for 24 h. The crude product was puriﬁed

on a PFP propyl reverse phase HPLC column, 20e95% ACN over

3

0 min. Pure UIJD-III-067C (12a), was collected 18 mg, 4% yield

1

over 5 steps. H NMR (400 MHz, DMSO)

d 8.99 (s, 1H), 8.85 (d,

J ¼ 5.2 Hz, 3H), 8.16 (s, 3H), 8.00 (d, J ¼ 4.9 Hz, 2H), 7.87 (d,

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

129

potential sites for ligand binding docking calculations. Corre-

4.6. Calculated logP

sponding atoms within 4.5 A of the binding sites were selected and

all other atoms deselected. For receptor 1G3X, site 1 and 2 were

chosen. For receptor 1DNH, site 1 was chosen. The active site is

deﬁned as the selected receptor atoms. Ligand conformations are

generated with the bond rotation method. These are then placed in

the site with the triangle matcher method, and ranked with the

London dG scoring function. The retain option is set to 30 and

speciﬁes the number of poses to pass to reﬁnement which is set to

rigid receptor, for energy minimization in the pocket, before

rescoring with the GBVI/WSAdGscoring function.

For Canvas:

The AlogP values of the compounds were calculated using

Canvas cheminformatics (part of Schrodinger Suite), which were

used preliminarily to predict the lipophilicity of the synthesized

compounds. The compounds were imported into a canvas database

and their AlogP values were calculated by utilizing the Physico-

chemical Descriptors utility within the Molecular Properties

calculation Table 1. (Schr o€ dinger Release 2018e3: Canvas,

Schr o€ dinger, LLC, New York, NY, 2018.)

The ﬂuoroquinolones were drawn in ChemDraw, converted to a

mol ﬁle and appended to a MOE ligand database. The molecules

were prepared using the database wash application in MOE. This

application rebalances the protonation states at pH ¼ 7.0, adds or

deletes explicit hydrogen atoms, regenerates the 3D coordinates,

and places molecules in the lowest energy conformation state.

For MOE:

The AlogP/clogP/clogD values of the compounds were calculated

using Cheminformatics tools in Molecular Operating Environment

(Chemical Computing Group), which were used preliminarily to

predict the lipophilicity of the synthesized compounds. The com-

pounds were imported into a MOE database followed by energy

minimization and protonation. Their AlogP/clogP/clogD values

were calculated by utilizing the Molecular Descriptors utility1 [34].

4.5. DNA binding assay

Acknowledgements

The ﬂuorescence spectra and intensities were measured on a

Perkin Elmer EnVision multi-label plate reader using UV-Star 96-

well black, clear bottom plates. The ﬁnal volume in each well was

We would like to thank Nicholas R. Vance for expert assistance

and guidance. This work was supported in part by the National

Institutes of Health (NIH) grants R01 AI087671 (to RJK) and

HL127479 (to HH). We also received a Drug Discovery Pilot Program

Award from the Department of Pharmacology (to HH). JLD, CAK,

and PRC acknowledge support of training fellowships from the

University of Iowa Center for Biocatalysis and Bioprocessing and of

the NIH-sponsored Predoctoral Training Program in Biotechnology

100 mL. DNA purity and concentration was determined on a BioTek

Synergy 2 multi-detection microplate reader. Gen5 reader software

and the nucleic acid quantiﬁcation protocol was used. All experi-

ments were done in presence of 10 mM Tris-HCl buffer (pH ¼ 7.4) at

room temperature. Appropriate ﬂuoroquinolone excitation and

max emission wavelengths were determined in the absence of

DNA. All stock solutions of the tested compounds were prepared in

DMSO and then diluted in 10 mM Tris-HCl buffer (pH ¼ 7.4), the

ﬁnal DMSO content did not exceed 5%. Data is reported as technical

replicates, n ¼ 3. The error bars represent standard error of the

means shown for each of the three trials. Data was plotted and

analyzed with GraphPad Prism 7 software. Data was normalized to

ﬂuoroquinolone ﬂuorescence in the absence of DNA (100%) and

appropriate blanks corresponding to the buffer were subtracted to

correct the background ﬂuorescence. The difference in the ﬂuo-

rescence observed at each DNA concentration from the initial

ﬂuorescence of the drug and plotted as the concentration of DNA in

(GM008365).

Appendix A. Supplementary data

Supplementary data to this article can be found online at

https://doi.org/10.1016/j.ejmech.2019.03.040 .

References

[1] K.D. Corbett, J.M. Berger, Structure, molecular mechanisms, and evolutionary

relationships in DNA topoisomerases, Annu. Rev. Biophys. Biomol. Struct. 33

mM versus the percent (%) ﬂuoroquinolone (FQ) ﬂuorescence

(2004) 95 e 118 .

compared to untreated control. The 27-bp sequence

d(CCTTACGTGCATAGTCATTCATGACCG) was purchased from IDT as

the complimentary ssDNA, DNA was annealed per IDT protocols.

The concentration of ssDNA stock solutions was determined spec-

trophotometrically using the appropriate molar extinction coefﬁ-

cient for each ssDNA sequence. Brieﬂy, ssDNA complimentary

[

2] J.L. Nitiss, DNA topoisomerase II and its growing repertoire of biological

functions, Nat. Rev. Canc. 9 (5) (2009) 327 e 337 .

3] S.M. Vos, et al., All tangled up: how cells direct, manage and exploit topo-

isomerase function, Nat. Rev. Mol. Cell Biol. 12 (12) (2011) 827 e 841 .

4] S.H. Chen, N.L. Chan, T.S. Hsieh, New mechanistic and functional insights into

DNA topoisomerases, Annu. Rev. Biochem. 82 (2013) 139 e 170 .

5] Y. Pommier, et al., Roles of eukaryotic topoisomerases in transcription,

replication and genomic stability, Nat. Rev. Mol. Cell Biol. 17 (11) (2016)

ꢀ

strands were incubated in a 1:1 ratio heated to 95 C for 2 min and

703 e 721 .

then allowed to cool to room temperature.

[6] B. Taneja, et al., Structure of the N-terminal fragment of topoisomerase V

reveals a new family of topoisomerases, EMBO J. 25 (2) (2006) 398 e 408 .

Ct-DNA was purchased from Worthington Biochemical Corpo-

ration, as lyophilized dsDNA. The Ct-DNA was suspended in 10 mM

[7] J.L. Nitiss, Targeting DNA topoisomerase II in cancer chemotherapy, Nat. Rev.

Canc. 9 (5) (2009) 338 e 350 .

[8] F. Collin, S. Karkare, A. Maxwell, Exploiting bacterial DNA gyrase as a drug

target: current state and perspectives, Appl. Microbiol. Biotechnol. 92 (3)

ꢀ

Tris-HCl buffer (pH ¼ 7.4) at 4 C and was mixed over 24 h to pro-

duce a homogenous solution. The purity of DNA was recorded by

using the absorbance ratio A260/A280. The attenuance ratio was

between 1.8 and 1.9 and required no further puriﬁcation. Various

concentrations of Ct-DNA were used and the concentration was

determined spectrophotometrically using the average molar

(2011) 479 e 497 .

[9] Y. Pommier, Drugging topoisomerases: lessons and challenges, ACS Chem.

Biol. 8 (1) (2013) 82 e 95 .

[10] K.J. Aldred, R.J. Kerns, N. Osheroff, Mechanism of quinolone action and

resistance, Biochemistry 53 (10) (2014) 1565 e 1574 .

11] H. Hiasa, DNA topoisomerases as targets for antibacterial agents, Methods

[

ꢂ1

extinction coefﬁcient value of 6600 M cm of a single nucleotide

Mol. Biol. 1703 (2018) 47 e 62 .

at 260 nm. To determine if a bathochromic shift is observed upon

[12] J.L. Delgado, et al., Topoisomerases as anticancer targets, Biochem. J. 475 (2)

2018) 373 e 398 .

(

addition of Ct-DNA the ﬂuoroquinolone concentration was 25

and the Ct-DNA concentration was 0 or 400 M. The ﬂuorescence

spectra of the ﬂuoroquinolone was obtain from 320 nme600 nm.

mM

[

13] A.M. Azarova, et al., Roles of DNA topoisomerase II isozymes in chemotherapy

and secondary malignancies, Proc. Natl. Acad. Sci. U. S. A. 104 (26) (2007)

11014 e 11019 .

m

130

J.L. Delgado et al. / European Journal of Medicinal Chemistry 172 (2019) 109e130

[

14] M. Pendleton, et al., Topoisomerase II and leukemia, Ann. N. Y. Acad. Sci. 1310

2014) 98 e 110 .

15] A.K. Larsen, A.E. Escargueil, A. Skladanowski, Catalytic topoisomerase II in-

hibitors in cancer therapy, Pharmacol. Ther. 99 (2) (2003) 167 e 181 .

16] C. Bailly, Contemporary challenges in the design of topoisomerase II inhibitors

for cancer chemotherapy, Chem. Rev. 112 (7) (2012) 3611 e 3640 .

17] R.H. Flatman, et al., Simocyclinone D8, an inhibitor of DNA gyrase with a novel

mode of action, Antimicrob. Agents Chemother. 49 (3) (2005) 1093 e 1100 .

18] S.J. Hearnshaw, et al., A new crystal structure of the bifunctional antibiotic

simocyclinone D8 bound to DNA gyrase gives fresh insight into the mecha-

nism of inhibition, J. Mol. Biol. 426 (10) (2014) 2023 e 2033 .

tyrosine of gyrase, Bioorg. Med. Chem. Lett 28 (10) (2018) 1903 e 1910 .

(

[25] L.M. Oppegard, et al., Novel N-1 substituted ﬂ uoroquinolones inhibit human

topoisomerase I activity and exhibit anti-proliferative activity, Investig. New

Drugs 37 (2019) in press .

[26] M.J. Robinson, et al., Effects of quinolone derivatives on eukaryotic topo-

isomerase II. A novel mechanism for enhancement of enzyme-mediated DNA

cleavage, J. Biol. Chem. 266 (22) (1991) 14585 e 14592 .

[27] R.E. Hawtin, et al., Voreloxin is an anticancer quinolone derivative that in-

tercalates DNA and poisons topoisomerase II, PLoS One 5 (4) (2010), e10186 .

[28] K.J. Aldred, et al., Activity of quinolone CP-115,955 against bacterial and hu-

man type II topoisomerases is mediated by different interactions, Biochem-

istry 54 (5) (2015) 1278 e 1286 .

[

19] B.S. Sorensen, et al., Mode of action of topoisomerase II-targeting agents at a

speci ﬁ c DNA sequence. Uncoupling the DNA binding, cleavage and religation

events, J. Mol. Biol. 228 (3) (1992) 778 e 786 .

[29] L.M. Oppegard, T. Nguyen, K.C. Ellis, H. Hiasa, Inhibition of human top-

oisomerases

I and II by simocyclinone D8, J. Nat. Prod. 75 (8) (2012)

[

20] K. Mizuuchi, M.H. O'Dea, M. Gellert, DNA gyrase: subunit structure and ATPase

activity of the puri ﬁ ed enzyme, Proc. Natl. Acad. Sci. U. S. A. 75 (12) (1978)

1485 e 1489 .

[30] A.L. Simplicio, J.M. Clancy, J.F. Gilmer, Prodrugs for amines, Molecules 13 (3)

(2008) 519 e 547 .

5960 e 5963 .

[

21] A. Sugino, et al., Energy coupling in DNA gyrase and the mechanism of action

of novobiocin, Proc. Natl. Acad. Sci. U. S. A. 75 (10) (1978) 4838 e 4842 .

22] E.H. Herman, et al., Biological properties of ICRF-159 and related bis(diox-

opiperazine) compounds, Adv. Pharmacol. Chemother. 19 (1982) 249 e 290 .

23] R. Ishida, et al., Inhibition of intracellular topoisomerase II by antitumor

bis(2,6-dioxopiperazine) derivatives: mode of cell growth inhibition distinct

from that of cleavable complex-forming type inhibitors, Cancer Res. 51 (18)

[31] S.T. Seger, P. Rydberg, L. Olsen, Mechanism of the N-hydroxylation of primary

and secondary amines by cytochrome P450, Chem. Res. Toxicol. 28 (4) (2015)

597 e 603 .

[32] K. Halpaap, M.G. Horning, E.C. Horning, Metabolism of biphenyl in the rat,

J. Chromatogr. 166 (2) (1978) 479 e 490 .

[33] Z. Li, et al., Human Health effects of biphenyl: key ﬁ ndings and scienti ﬁ c is-

sues, Environ. Health Perspect. 124 (6) (2016) 703 e 712 .

[34] P. Labute, A widely applicable set of descriptors, J. Mol. Graph. Model. 18

(4 e 5) (2000) 464 e 477 .

(

1991) 4909 e 4916 .

[24] T.R. Towle, et al., Design, synthesis, and evaluation of novel N-1 ﬂ uo-

roquinolone derivatives: probing for binding contact with the active site

Article Doi

Probing structural requirements for human topoisomerase I inhibition by a novel N1-Biphenyl fluoroquinolone

DOI: 10.1016/j.ejmech.2019.03.040

Source and publish data:

Authors:

Article abstract of DOI:10.1016/j.ejmech.2019.03.040

Full text of DOI:10.1016/j.ejmech.2019.03.040

Products guided by the article

R&D Labs maybe for 101799-75-1

Relevant to this article

Hot Product