Rational design of first generation inhibitors for trehalose 6-phosphate phosphatases

Article abstract of DOI:10.1016/j.tet.2017.01.041

In this study, trehalose 6-phosphate phosphatase (T6PP) was targeted for inhibitor development. T6PP catalyzes the hydrolysis of trehalose-6-phosphate to form trehalose and inorganic phosphate, a reaction essential to important fungal, bacterial, and nematodal pathogens. At the current time, there are no specific inhibitors of T6PP available to serve as tools for interrogating its structure and function nor as leads for pharmaceutical applications. Herein, we describe the synthesis of non-hydrolysable mimics of trehalose-6-phosphate, which incorporate 6-sulfate (1), -phosphonate (2), -fluorophosphonate (3) and –boronate (4) groups in place of the 6-phosphate moiety of the substrate. The inhibitory efficacies of these adducts were evaluated against trehalose 6-phosphate phosphatases selected from evolutionarily distant pathogenic bacteria and nematodes. Phosphonates 2 and 3 were found to display good inhibitory activities against the T6PPs, while the sulfate analog, trehalose-6-sulfate, proved to be a particularly effective broad-spectrum inhibitor of these phosphatases and an ideal prototype for optimization.

Full text of DOI:10.1016/j.tet.2017.01.041

Accepted Manuscript
Rational design of first generation inhibitors for trehalose 6-phosphate phosphatases
Chunliang Liu, Debra Dunaway-Mariano, Patrick S. Mariano
PII:
S0040-4020(17)30064-9
10.1016/j.tet.2017.01.041
TET 28411
DOI:
Reference:
To appear in: Tetrahedron
Received Date: 4 December 2016
Revised Date: 13 January 2017
Accepted Date: 17 January 2017
Please cite this article as: Liu C, Dunaway-Mariano D, Mariano PS, Rational design of first generation
inhibitors for trehalose 6-phosphate phosphatases, Tetrahedron (2017), doi: 10.1016/j.tet.2017.01.041.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT
Graphical abstract
1

ACCEPTED MANUSCRIPT
Rational Design of First Generation Inhibitors for Trehalose 6-phosphate Phosphatases
Chunliang Liu, Debra Dunaway-Mariano* and Patrick S. Mariano*
Department of Chemistry and Chemical Biology, University of New Mexico, Albuquerque, NM
87131.
*Corresponding authors. Address: Department of Chemistry and Chemical Biology, University
of New Mexico, MSC03 2060, 300 Terrace St. NE, Albuquerque, NM 87131-0001, USA. E-mail
addresses: PSM (mariano@unm.edu) and DDM (dd39@unm.edu)
Abstract
In this study, trehalose 6-phosphate phosphatase (T6PP) was targeted for inhibitor development.
T6PP catalyzes the hydrolysis of trehalose-6-phosphate to form trehalose and inorganic
phosphate, a reaction essential to important fungal, bacterial, and nematodal pathogens. At the
current time, there are no specific inhibitors of T6PP available to serve as tools for interrogating
its structure and function nor as leads for pharmaceutical applications. Herein, we describe the
synthesis of non-hydrolysable mimics of trehalose-6-phosphate, which incorporate 6-sulfate (1),
-phosphonate (2), -fluorophosphonate (3) and –boronate (4) groups in place of the 6-phosphate
moiety of the substrate. The inhibitory efficacies of these adducts were evaluated against
trehalose 6-phosphate phosphatases selected from evolutionarily distant pathogenic bacteria and
nematodes. Phosphonates 2 and 3 were found to display good inhibitory activities against the
T6PPs, while the sulfate analog, trehalose-6-sulfate, proved to be a particularly effective broad-
spectrum inhibitor of these phosphatases and an ideal prototype for optimization.
2

ACCEPTED MANUSCRIPT
Keywords:
Trehalose-6-phosphate phosphatase
Trehalose-6-sulfate
Fluorophosphonate
T6P analogs
1. Introduction
The D-glucose disaccharide, α,α-trehalose, is present in a variety of bacteria, fungi,
plants and invertebrates, but not in mammals. This enzyme functions to support cell survival by
serving as a fuel, metabolic regulator, anti-desiccant or outer membrane component. Five
different trehalose biosynthetic pathways are known, the prominent one being the OtsA/OtsB
pathway (Scheme 1) that operates in fungi, parasitic nematodes e.g., Brugia malayi,1 and
numerous pathogenic bacteria including Mycobaterium tuberculosis.2 The first step of this
pathway involves formation of trehalose-6-phosphate (T6P) by reaction of glucose and glucose-
6-phosphate (with UTP) in a process catalyzed by the trehalose 6-phosphate synthase, OtsA. T6P
then undergoes trehalose-6-phosphate phosphatase (T6PP aka OtsB) catalyzed hydrolysis to
form trehalose and inorganic phosphate.3,4 The accumulation of T6P, resulting from reduced
T6PP activity, is expected to be toxic to the host organism5 because the accumulation of sugar-
phosphates acting as “anti-metabolites” can lead to inhibition of metabolic enzymes,
phosphotransferases in particular. Additional known consequences of anti-metabolite action
include mRNA destabilization,6 activation of pyruvate kinase7 and stimulation of gene
expression,8 all of which can negatively effect cell viability.
3

ACCEPTED MANUSCRIPT
Scheme 1. Trehalose biosynthesis via the OtsA/OtsB (T6P synthase/phosphatase) pathway.
To evaluate the essentiality of trehalose production and the lethality of T6P accumulation,
investigators have subjected the T6P synthase and phosphatase encoding genes otsA and otsB to
knockout and knockdown. The results show that both pathway enzymes are essential for growth
of M. tuberculosis in laboratory culture and for its virulence in a mouse model.9 T6P synthase
and phosphatase are also required for trehalose production in the filamentous fungus Fusarium
graminearum, however only T6PP proved to be indispensable for development and virulence.10
RNAi gene silencing, carried out in the nematode model system Caenohabditis elegans, revealed
that the T6PP is essential, and only when the T6P synthase encoding gene is functional.5 In
human fungal pathogens, e.g., Aspergillus fumigatus and Candida albicans, T6PP is required for
virulence and cell wall integrity.11,12 Together, these findings lend strong support to the tenant
that that pathogens reliant on T6P hydrolysis are vulnerable to the action of small molecule T6PP
inhibitors.
Our first objective was to construct a versatile T6PP inhibitor prototype, one amenable to
tailoring to the active sites of T6PP orthologs present in a variety important pathogenic microbes
and nematodes. Below, we describe the design and synthesis of several inhibitors and the
examination of their binding affinities to T6PP derived from the parasitic nematodes Ascaris
4

ACCEPTED MANUSCRIPT
suum (As-T6PP), and the pathogenic bacteria Mycobacterium tuberculosis (Mt-T6PP), Shigella
boydii (Sb-T6PP) and Samonella typhimurium (St-T6PP). This effort has culminated in the
development of a tight binding, substrate-derived T6PP inhibitor prototype.
2. Results and Discussion
2.1. Rational Inhibitor Design
To gain preliminary information about the mechanism of T6P binding, the abilities of the
four T6PP orthologs, As-T6PP, Mt-T6PP, Sb-T6PP and St-T6PP, to bind substrate fragments
(phosphate, trehalose and glucose-6-phosphate), a substrate analog (sucrose-6-phosphate), and a
trigonal bipyramidal-transition state analogue (metavanadate) were evaluated. For this purpose,
the steady-state Ki values for inhibition of T6PP-catalyzed T6P hydrolysis were measured. The
o
T6P kcat and Km values determined for the Mg2+-activated orthologs at pH 7.5 and 25 C are as
follows: As-T6PP: kcat = 3.6 ± 0.5 s-1, Km = 230 ± 70 ꢀM, Mt-T6PP: kcat = 10 ± 1 s-1, Km = 500 ±
100 ꢀM, Sb-T6PP: kcat = 16 ± 1 s-1, Km = 690 ± 70 ꢀM and St-T6PP: kcat = 6.2 ± 0.3 s-1, Km =
310 ± 40 ꢀM.
The phosphate mimetic, tungstate, displays tight binding with Mt-T6PP (Ki = 19 ± 2 ꢀM),
moderate binding affinity towards As-T6PP (Ki = 120 ± 20 ꢀM), and weakly or not at all to Sb-
T6PP or St-T6PP (as evidenced by the absence of T6PP inhibition detected at 600 ꢀM T6P and 2
3-
mM tungstate)
.
We tested the possibility that metavanadate (VO4 ) might form a trigonal
bipyramidal adduct with the T6PP catalytic Asp nucleophile, thereby mimicking the transition
state for the second partial reaction in the phosphatase pathway involving hydrolysis of the
aspartyl-phosphate intermediate. However, with the exception of As-T6PP (Ki = 55 ± 9 µM), the
T6PP orthologs are not inhibited by metavanadate, as determined by a kinetic assay in which the
5

ACCEPTED MANUSCRIPT
T6P concentration (230–690 µM) was at the substrate Km value, and the metavanadate
concentration at 10 mM.
The substrate fragment, glucose-6-P, does not bind to the T6PP orthologs with significant
affinity (Ki > 10 mM), nor does the T6P analog, sucrose-6-phosphate, in which the glucose-6-
phosphate unit is replaced with fructose-6-phosphate. Not surprisingly, neither glucose-6-P nor
sucrose-6-phosphate display measurable substrate activity. Trehalose too lacks measurable
binding affinity towards the T6PP orthologs, a noteworthy observation given that the T6PP
orthologs are specific for T6P. From these findings we surmise that the trehalose unit is critical
for catalyzed phosphoryl transfer from substrate to the active site Asp. In addition, the results
suggest that the amount of favorable binding energy gained through interactions with active site
residues is either small or that much of it is invested in stabilizing the catalytically active
conformation, in which the T6PP cap and catalytic domains are associated, such that the catalytic
site is closed to solvent.
Guided by the binding affinities of the substrate fragments and analogs tested (vide supra)
we hypothesized that T6P analogs, which contain negatively charged moieties in place of the
phosphate group at C6 and that retain the disaccharide structure of trehalose might be inhibitors
of the T6PP orthologs because they should be able to bind to the enzyme in same (and thus
predictable) orientation used by substrate. Sulfate and phosphonate groups are proven substrate
phosphate group mimetics13,14 and, thus, they are obvious candidates for targeting the region of
the T6PP active site that engages the substrate phosphate group in favorable electrostatic
interactions. Accordingly, the sulfate (1), phosphonate (2) and monofluorophosphonate (3)
analogs of T6P (Scheme 2) were explored as first generation inhibitors. In addition, the boronate
analog 4 was synthesized for the purpose of testing covalent modification of an active site
6

ACCEPTED MANUSCRIPT
nucleophile, namely the strategically located catalytic Asp that performs nucleophilic catalysis
(forming an acyl-phosphate covalent enzyme intermediate) during substrate turnover. The
reactivity of the boronate group with enzyme active site nucleophiles (viz. metal hydroxide or
hydroxyl side chain) is known15,16 but to our knowledge no reports of an active site carboxylate
residue forming a stable adduct with the boronate group of an inhibitor have been published.
T6PP appeared to be an ideal system for testing the boronate group as a covalent inhibitor.
Scheme 2. Proposed T6PP Inhibitors
2.2 Inhibitor Synthesis.
The synthetic routes employed to prepare 1-4 begin with the known heptyl-O-benzyl
protected α,α−trehalose 517 (Scheme 3). Following our previously described procedure,1
sulfonation of 5 using the SO3-pyridine complex forms sulfate 6, which upon global catalytic
hydrogenolytic removal of the benzyl protecting groups produces the sulfate derivative 1.
Phosphonates 2 and 3 are generated from 5 by paths involving initial oxidation to form the
aldehyde 7 followed by olefination reactions with the known methylenediphosphonate ester
(EtO)2PO)2CH2 and its fluoro analog (EtO)2PO)2CHF to produce the respective
vinylphosphonates 8 and 9. Combined hydrogenation and hydrogenolysis of these substances
followed by de-esterification then gives rise to the corresponding trehalose phosphonate
derivatives 2 and 3. Finally, simple Wittig olefination of aldehyde 7 starting with methyl-
7

ACCEPTED MANUSCRIPT
triphenylphosphonium bromide provides the alkene 12, which is converted into boronate 4 by
sequential iridium promoted hydroboration with pinacolborane followed by debenzylation and in
situ methanol promoted boronate ester cleavage.
Trehalose
1. (Ph)3CCl
DIPEA, DMF
2. NaH, BnBr, DMF
3.p-TsOH, DCM/MeOH
HO
BnO
BnO
O3SO
OBn
O
CH2
Pd(OH)2/C
MeOH-H2O
SO3-pyridine
pyridine
BnO
O
OBn
OBn
1 (93%)
(BnO)7-trehal
O
6
(93%)
OBn
(BnO)7-trehal
5
(34%)
ClCOCOCl
DMSO, DCM, TEA
PO(OEt)2
PO(OEt)2
X
OH
CHO
X
HO
HO
O
OH
OH
2
(72%) and
TMSBr
H2, Pd/C
EtOH
((EtO)2PO)2CHX
nBuLi, THF
3
(78%)
(BnO)7-trehal
(BnO)7-trehal
MeCN,
HO
O
O
pyridine
7 (90%)
OH
8
(X = H, 90%)
9 (X = F, 71%)
10 (X = H, 100%)
11 (X = F, 80%)
Ph3PCH3Br
nBuLi, THF
O
O
pinacolborane,
[Ir(cod)Cl]2
B
H2, Pd/C
MeOH
4 (100%)
(BnO)7-trehal
dppm, DCM
(BnO)7-trehal
12 (64%)
13 (67%)
Scheme 3. Routes for Synthesis of Inhibitors 1-4.
2.3. Binding Affinities of Inert T6P Analogs.
8

ACCEPTED MANUSCRIPT
The T6P analogs, 1-4, in which the C-6 phosphate of the parent is replaced with
approximate isosteric and isoelectronic functional groups that are resistant to hydrolytic cleavage,
were evaluated as inhibitors of T6PP-catalyzed T6P hydrolysis. No inhibition was detected with
the T6P boronate analog 4. On the other hand, analogs 1-3 do reversibly bind to the T6PP active
site in competition with substrate. The Ki values were determined from initial velocity data,
measured as a function of T6P (0.5 Km to 5 Km) and inhibitor (0, Ki and 2Ki) concentrations.
Plots of the kinetic data (1/velocity vs [T6P] at different inhibitor concentrations) for each
inhibitor-T6PP pair are provided in SI and the steady-state inhibition constants (Ki) are listed in
Table 1. All four T6P analogs display competitive inhibition.
Table 1. Steady-state competitive inhibition constants (Ki) for compounds 1-4 acting on T6PP
o
orthologs Mt-T6PP, Sb-T6PP, As-T6PP and St-T6PP measured at pH 7.5, 25 C and in the
presence of 1 mM Mg2+ cofactor.
Ki (ꢀM)a
Inhibitor
Mt-T6PP
Sb-T6PP
340 ± 40
As-T6PP
50 ± 5
St-T6PP
180 ± 20 ꢀM
130 ± 20
520 ± 20
480 ± 90
NIb
ꢀM
ꢀM
ꢀM
ꢀM
ꢀM
1
2
3
4
>2 mM
>2 mM
NIb
520 ± 80
500 ± 70
NIb
ꢀ
M
>2 mM
>2 mM
NIb
ꢀM
a The reported error is that associated with data fitting to the initial velocity equation.
b No inhibition was observed at sub-saturating T6P (600 µM) and 10 mM inhibitor.
Inspection of the Ki values listed in Table 1 reveals variations in potency of a given
inhibitor across the panel of T6PP orthologs, as might be expected given their distance in
9

ACCEPTED MANUSCRIPT
evolution. Of the four inhibitors, trehalose 6-sulfate 1 proved to be the most potent. This result
indicates that the monoanionic sulfate group provides a more favorable contribution to binding
energy than do the corresponding dianionic phosphonate and flurophosphonate groups in
inhibitors 2 and 3, respectively. In addition to the difference in charge, the S-O-C(6) bridging
oxygen atom of 1 can potentially serve as a hydrogen bond acceptor to the active site catalytic
acid residue, analogous to the P-O-C(6) bridging oxygen atom of the native substrate T6P. The
methylene group present in trehalose 6-methylenephosphonate 2 of course cannot engage in this
type of interaction, accounting in part for its lower binding affinity. Substitution of the methylene
hydrogen atom(s) for fluorine(s) is known to enhance the binding of phosphonate inhibitors to
tyrosine phosphate phosphatases possibly as a consequence of the effect of this halogen on pKa.18
Trehalose-6-monofluoromethylenephosphonate 3 does indeed display an improved binding
affinity to the phosphatases. Lastly, despite our expectation of proximity driven adduct formation
between the boronate group of trehalose 6-methyleneboronate 4, and the carboxylate group of
the T6PP Asp catalytic nucleophile, no inhibition was observed towards any of the T6PP
orthologs.
3. Conclusion
In this study we prepared and evaluated a series of substrate analogues of T6P, the substrate for
trehalose-6-phosphate phosphatase. Trehalose phosphonate derivatives 2 and 3 were found to
have moderate inhibitory activities against T6PP orthologs from four different pathogens. As
expected, the introduction of fluorine atom in 3 causes an increase in binding affinity. The
trehalose-6-methyleneboronate 4 is not an inhibitor of any of the T6PPs. Gratifyingly, the sulfate
analog, trehalose-6-sulfate 1, was found to be a tight binding inhibitor the T6PP orthologs, and in
10

ACCEPTED MANUSCRIPT
future studies will be used as a T6PP co-crystallization ligand and as the platform for discovery
of efficient reversible and covalent irreversible inhibitors.
4. Experimental
4.1 Materials
Except when specified, all commercial solvents and reagents were purchased from
Sigma-Aldrich and used without further purification. Analytical thin-layer chromatography (TLC)
was performed on Sorbent Technologies silica gel plates with fluorescence F254 indicator and
column chromatography was performed using the indicated solvent on Merck 60 silica gel (230-
400 mesh). 1H (300 and 500 MHz), 13C NMR (75 MHz and 125 MHz) were recorded on Bruker
31
Avance 500 and Bruker Avance III 300 spectrometers, and P (121 MHz) NMR spectra were
1
13
31
recorded on Bruker Avance III 300 spectrometers. H, C and P NMR data are reported as
1
follows: for H NMR chemical shifts are reported in ppm relative to residual chloroform (7.26
ppm), methanol (3.31 ppm), water (4.79 ppm), DMSO (2.5 ppm) as internal standards and
multiplicities are given as s = singlet, d = doublet, t = triplet, q = quartet, m =multiplet, coupling
constants (J) are given in Hz; 13C NMR chemical shifts are reported in ppm relative to the peaks
of CDCl3 (77.16 ppm), CD3OD (49 ppm), DMSO-d6 (39.52 ppm) as internal standards. 31P NMR
chemical shifts are reported in ppm using 50% aq H3PO4 as the internal standard. The EnzChek®
Phosphate Assay Kit was purchased from Molecular Probes for use in assays of T6PP activity.
Trehalose-6-sulfate1 and trehalose-6-phosphate (T6P)19 were synthesized by using our previously
described procedures.
4.2. Synthesis
11

ACCEPTED MANUSCRIPT
4.2.1. 2,2’,3,3’,4,4’,6’-Hepta-O-benzyl-α-D-gluco-hexodialdo-1,5-pyranosyl α-D-
glucopyranoside (7)
To a solution of oxalyl chloride (490 mg, 3.86 mmol) in freshly distilled dichloromethane
(DCM) (10 mL) at -60
under argon, was added dimethyl sulfoxide (603 mg, 7.72 mmol)
dropwise. After stirring for 30 min at -60 , a solution of 517 (2.4g, 2.57 mmol) in 5mL freshly
distilled DCM was added dropwise, the resulting mixture was stirred at -60
for 1 h, then
triethylamine (TEA) (1.04 g, 10.3 mmol) was added, and the mixture was allowed to reach to
room temperature over a period of 30 min, then stirred at room temperature for 3 h. The solvent
was concentrated in vacuo and the crude product was purified by silica gel column
1
chromatography (DCM/MeOH, 20:1, v/v) affording 720 (2.15g, 90%). H NMR (500 MHz,
CDCl3) δ (ppm) 3.41-3.45 (2H, m), 3.55-3.61 (3H, m), 3.65 (1H, dd, J1 = 3.5 Hz, J2 = 9.5 Hz),
3.75 (1H, t, J = 9.65 Hz), 4.07 (1H, t, J = 9.3 Hz), 4.14 (1H, t, J = 9.7 Hz), 4.20 (1H, dd, J1 = 3.5
Hz, J2 = 9.8 Hz), 4.44 (1H, d, J = 11.8 Hz), 4,52 (1H, d, J = 10.4 Hz), 4.59-4.63 (2H, m), 4.71-
4.78 (4H, m), 4.86-4.97 (4H, m), 5.05-5.08 (2H, m), 5.20 (1H, d, J = 3.4 Hz), 5.28 (1H, d, J =
3.0 Hz), 7.26-7.45 (35H, m), 9.39 (1H, s). 13C NMR (125 MHz, CDCl3) δ (ppm) 61.0, 63.9, 64.0,
65.7, 66.2, 66.5, 67.6, 68.0, 68.1, 68.6, 68.8, 70.6, 71.3, 71.7, 72.3, 74.5, 74.8, 87.4, 88.1, 120.4,
120.6, 120.6, 120.7, 120.8, 120.9, 121.0, 121.1, 121.2, 121.3, 121.4, 121.4, 121.4, 121.5, 130.4,
130.8, 131.2, 131.3, 131.4, 131.7, 190.7. HRMS (ESI) m/z calcd. for C61H62O11Na [M+Na]+
993.4190, found 993.4256.
4.2.2.
2,2’,3,3’,4,4’,6’-Hepta-O-benzyl-6-deoxy-6-diethoxyphosphinylmethylene-α,α-
trehalose (8)
n-BuLi (371 ꢀL, 2.5M in hexanes) was added to a suspension of tetraethyl
methylenediphosphonate (294 mg, 1.02 mmol) in anhydrous tetrahydrofuran (THF) (4 mL) at -
12

ACCEPTED MANUSCRIPT
78 . The mixture was allowed to warm to -20 over a period of 1 h, then the mixture was
cooled to -78 , and a solution of the aldehyde 7 (600 mg, 0.619 mmol) in THF (2 mL) was
added dropwise. After stirring for 30 min at -78 , the reaction mixture was allowed to warm to
room temperature slowly, and kept stirring at room temperature overnight. Then saturated
NH4Cl(aq) was added, the aqueous phase was extracted with diethyl ether (Et2O), and the
combined organic extracts were dried using anhydrous sodium sulfate, the solvent was removed
in vacuo, and the crude product was purified by silica gel column chromatography (DCM/MeOH,
1
20:1, v/v) affording 8 (2.15g, 90%). H NMR (500 MHz, CDCl3) δ (ppm) 1.32 (6H, t, J = 8.1
Hz), 3.43 (1H, dd, J1 = 3.4 Hz, J2 = 10.25 Hz), 3.55 (1H, dd, J1 = 3.4 Hz, J2 = 10.25 Hz), 3.60-
3.63 (2H, m), 3.72 (1H, t, J = 9.6 Hz), 4.03-4.21 (8H, m), 4.42-5.06 (14H, m), 5.16 (1H, d, J =
3.35 Hz), 5.29 (1H, d, J = 3.3 Hz), 5.99-6.07(1H, m), 6.92-7.00 (1H, m), 7.27-7.43 (35H, m). 13C
NMR (125 MHz, CDCl3) δ (ppm) 9.31, 9.35, 54.6, 61.1, 63.4, 63.6, 63.7, 65.8, 65.9, 66.5, 68.1,
68.5, 68.6, 68.7, 70.7, 71.8, 72.3, 74.4, 74.8, 74.9, 86.8, 87.4, 110.1, 111.6, 120.4, 120.5, 120.6,
120.9, 121.0, 121.2, 121.3, 121.5, 130.6, 130.7, 130.9, 131.0, 131.3, 131.6, 131.8, 141.3. 31P
NMR (121MHz, CDCl3) δ (ppm) 18.6. HRMS (ESI) m/z calcd. for C66H73O13PNa [M+Na]+
1127.4687, found 1127.4668.
4.2.3. 6-Deoxy-6-diethoxyphosphinylmethyl-α,α-trehalose (10)
A mixture of compound 8 (413.4 mg, 0.38 mmol), and Pd/C (10%) (161 mg, 0.16 mmol)
in ethanol (5 mL) was stirred under H2 (1 atm) for 24 h. After completion, the catalyst was
removed by filtration through Celite, and filtrate was concentrated in vacuo. The crude product
1
was purified by silica gel column chromatography (methanol) to give 1021 (180 mg, 100%). H
NMR (500 MHz, CD3OD) δ (ppm) 1.32 (6H, t, J = 7.1 Hz), 1.56-1.66 (1H, m), 1.77-1.87 (1H,
m), 1.96-2.06 (1H, m), 2.09-2.16 (1H, m), 3.07 (1H, t, J = 9.4 Hz), 3.33 (1H, t, J = 9.2 Hz), 3.35
13

ACCEPTED MANUSCRIPT
(1H, dd, J1 = 2.5 Hz, J2 = 8.9 Hz), 3.68 (1H, dd, J1 = 4.9 Hz, J2 = 11.4 Hz), 3.75 (1H, t, J = 9.4
Hz), 3.78-3.84 (4H, m), 4.05-4.12 (4H, m), 5.05 (1H, d, J = 3.5 Hz), 5.08 (1H, d, J = 3.6 Hz).
13C NMR (75 MHz, CD3OD) δ (ppm) 17.5, 17.6, 21.9, 26.6 (d, JC,P = 18.7 Hz ), 63.4, 64.1, 72.7,
31
73.0, 73.2, 74.0, 74.2, 74.7, 75.4, 76.5, 96.0, 96.2. P NMR (121 MHz, D2O) δ (ppm) 34.2.
HRMS (ESI) m/z calcd. for C17H33O13PNa [M+Na]+ 499.1556, found 499.1544.
4.2.4. 6,7-Dideoxy-7-phosphono-α,α-trehalose (2)
To a solution of 10 (77 mg, 0.16 mmol) in anhydrous acetonitrile (2.5 mL) was added
pyridine (25 ꢀL) and bromotrimethylsilane (495 mg, 3.24 mmol) under N2. After stirring at room
temperature for 4 h, the solvent and bromotrimethylsilane were removed in vacuo, then 3 mL of
DI water was added and stirring was continued at room temperature overnight. The aqueous
phase was washed with CH2Cl2, and the aqueous phase was lyophilized, the crude product was
purified by silica gel column chromatography (water/isopropanol/ethyl acetate, 1:4:4, v/v/v) to
give 222 (49 mg, 72%). 1H NMR (300 MHz, D2O) δ (ppm) 1.40-1.62 (2H, m), 1.70-1.87 (2H, m),
3.04 (1H, t, J = 9.4 Hz), 3.22 (1H, t, J = 9.5 Hz), 3.38-3.45 (2H, m), 3.47-3.66 (6H, m), 4.90 (1H,
d, J = 1.4 Hz), 4.91 (1H, d, J = 1.4 Hz). 13C NMR (75 MHz, D2O) δ (ppm) 23.6, 24.4, 60.5, 69.6,
31
69.9, 70.9, 71.1, 71.3, 72.1, 72.4, 73.1, 93.0, 93.3. P NMR (121 MHz, D2O) δ (ppm) 29.3.
HRMS (ESI) m/z calcd. for C13H25O13P [M-H]－ 419.0955, found 419.0941.
4.2.5. 2,2’,3,3’,4,4’,6’-Hepta-O-benzyl-6-deoxy-6-diethoxyphosphinylfluoromethylene-α,α-
trehalose (9).
To a solution of 7 (1.4 g, 1.4 mmol) in anhydrous THF (8 mL) at -78 ℃was added a
solution of n-butyl lithium (0.4 mL, 2.5 M in THF). The mixture was allowed to stir at -78 ℃for
1 h and then a solution of tetraethyl fluoromethylenediphosphonate (337 mg, 1.1 mmol) in
14

ACCEPTED MANUSCRIPT
anhydrous THF (2 mL) was added and the reaction mixture was stirring at -78 for 1 h, then it
was allowed to warm to room temperature in a period of 1 h. The mixture was allowed to stir at
room temperature overnight and the next day the reaction was quenched with aqueous
ammonium chloride and then the aqueous layer was extracted with ethyl acetate, then the organic
layer was washed with brine, the organic layer was then dried with anhydrous sodium sulfate,
filtered, and then the filtrate was concentrated in vacuo. The crude product was purified by silica
1
gel column chromatography (hexane/ethyl acetate, 1:1, v/v) to give 923 (1.3 g, 71%). H NMR
(300 MHz, CDCl3) δ (ppm) 1.20-1.27 (6H, m), 3.37-3.71 (7H, m), 3.97-4.20 (7H, m), 4.38-5.08
(14H, m), 5.15 (1H, d, J = 3.5 Hz), 5.24 (1H, d, J = 3.5 Hz), 6.00-6.19 (1H, m), 7.28-7.40 (35H,
m). 13C NMR (125 MHz, CDCl3) δ (ppm) 9.1, 56.2, 61.1, 63.5, 65.3, 66.4, 68.0, 68.7, 70.6, 70.8,
72.3, 74.1, 74.6, 74.8, 86.9, 87.7, 120.3, 120.5, 120.6, 120.9, 121.3, 130.7, 131.0, 131.1, 131.6,
131.9, 156.0. 31P NMR (121 MHz, CDCl3) δ (ppm) 4.8 (d, JF,P = 245 Hz).
4.2.6. 6-Deoxy-6-diethoxyphosphinylfluoromethylene-α,α-trehalose (11)
To a solution of 9 (1.14g, 1.02 mmol) in ethanol (15 mL) was added a catalytic amount of
20% palladium hydroxide on carbon (432mg, 0.408 mmol) and 3 drops of acetic acid, the
reaction was then subjected to a hydrogen atmosphere (1 atm) and was allowed to stir for 24 h.
Then the reaction mixture was filtered through a pad of Celite to remove all palladium using
methanol as the eluent followed by removal of all solvent in vacuo. The crude product was
purified by flash chromatography (water/isopropanol/ethyl acetate, 1:4:4, v/v/v) to give 1123 (403
1
mg, 80%). H NMR (300 MHz, D2O) δ (ppm) 1.35-1.40 (6H, m), 1.81-2.05 (1H, m), 2.40-2.56
(1H, m), 3.31 (1H, t, J = 9.4 Hz), 3.45 (1H, t, J = 9.4 Hz), 3.62 (1H, dd, J1 = 3.8 Hz, J2 = 9.9 Hz),
3.69 (1H, dd, J1 = 3.8 Hz, J2 = 9.9 Hz), 3.74-3.88 (6H, m), 4.00 (1H, t, J = 9.9 Hz), 4.23-4.34
(4H, m), 5.15 (1H, dd, J = 3.8 Hz), 5.19 (1H, dd, J = 3.8 Hz). 13C NMR (75 MHz, D2O) δ (ppm)
15

ACCEPTED MANUSCRIPT
15.6, 15.7, 31.5, 31.7, 60.5, 64.9 (d, JC,P = 27.8 Hz ), 65.1 (d, JC,P = 26.9 Hz ), 66.4, 66.6, 69.9,
31
70.9, 71.1, 72.1, 72.5, 72.6, 73.4, 93.1, 93.4. P NMR (121 MHz, D2O) δ (ppm) 20.8 (d, JF,P
=187.5 Hz).
4.2.7. 6,7-Dideoxy-7-fluoro-7-phosphono-α,α-trehalose (3)
To a soluton of 11 (57 mg, 0.116 mmol) in anhydrous acetonitrile (2 mL) was added
pyridine (20 ꢀL) and bromotrimethylsilane (353 mg, 2.3 mmol) under N2. After stirring at room
temperature for 4 h, the solvent and bromotrimethylsilane were removed in vacuo, then 3 mL of
DI H2O was added and stirring was continued at room temperature overnight. The aqueous phase
was washed with CH2Cl2, and the aqueous phase was lyophilized, the crude product was purified
by flash chromatography (water/isopropanol/ethyl acetate, 1:1:1, v/v/v) to give 3 (40 mg, 78%).
1H NMR (300 MHz, D2O) δ (ppm) 1.72-1.96 (1H, m), 2.26-2.41 (1H, m), 3.30 (1H, t, J = 9.4
Hz), 3.43 (1H, t, J = 9.3 Hz), 3.58-3.68 (2H, m), 3.72-3.86 (5H, m), 3.96 (1H, t, J = 9.8 Hz),
13
4.62-4.67 (1H, m), 5.15 (1H, dd, J = 3.9 Hz), 5.17 (1H, dd, J = 4.0 Hz). C NMR (75 MHz,
D2O) δ (ppm) 32.69 (d, J = 82.4 Hz), 60.5, 67.6 (d, J = 45.3 Hz), 69.7, 70.9, 71.1, 71.2, 72.1,
72.5, 73.4, 93.0, 93.4. 31P NMR (121 MHz, D2O) δ (ppm) 13.2 (d, JF,P =155.2 Hz). HRMS (ESI)
m/z calcd. for C13H24FO13P [M-H+]－ 437.0860, found 437.0861.
4.2.8. 2,2’,3,3’,4,4’,6’-Hepta-O-benzyl-6,7-dideoxy α-D-gluco-hept-6-enopyranosyl α-D-
glucopyranoside (12).
n-BuLi (240 ꢀL, 2.5 M in hexanes) was added to a suspension of methyltriphenylph-
osphonium bromide (250 mg, 0.7 mmol) in THF (2 mL) at -78 ℃. The reaction mixture was
slowly warm to -20 ℃over a period of 1 h, then it was cooled back to -78 ℃, and a solution of
compound 7 (194 mg, 0.2 mmol) in THF (2 mL) was added dropwise. After 40 min, the reaction
16

ACCEPTED MANUSCRIPT
mixture was allowed to warm to room temperature slowly, and kept stirring at room temperature
overnight. Then saturated NH4Cl(aq) was added, the aqueous phase was extracted with Et2O, and
the combined organic extracts were dried using anhydrous sodium sulfate, the solvent was
removed in vacuo, and the crude product was purified by silica gel column chromatography
1
(Hexane/Ethyl acetate, 5:1, v/v) affording 12 (124 mg, 64%). H NMR (500 MHz, CDCl3) δ
(ppm) 3.35 (1H, t, J = 9.6 Hz), 3.45 (1H, dd, J1 = 2.6 Hz, J2 = 10.6 Hz), 3.58 (1H, dd, J1 = 2.7 Hz,
J2 = 10.6 Hz), 3.65-3.68 (2H, m), 3.76 (1H, t, J = 9.5 Hz), 4.11-4.18 (2H, m), 4.25-5.12 (16H, m),
13
5.28-5.37 (4H, m), 7.32-7.47 (35H, m). C NMR (125 MHz, CDCl3) δ (ppm) 61.2, 63.6, 64.8,
65.7, 65.8, 66.5, 68.0, 68.3, 68.6, 68.7, 70.7, 72.1, 72.5, 74.4, 74.8, 75.6, 87.0, 87.4, 110.5, 120.4,
120.5, 120.7, 120.8, 120.9, 121.1, 121.3, 121.4, 128.3, 130.8, 131.2, 131.2, 131.4, 131.8, 131.9.
HRMS(ESI) m/z calcd. for C62H64O10Na [M+Na]+ 991.4397, found 991.4424.
4.2.9. 2,2’,3,3’,4,4’,6’-Hepta-O-benzyl-6-deoxy-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-
yl) methyl-α,α-trehalose (13)
A round-bottom flask charged with [Ir(cod)Cl]2(7.3 mg, 1.5 mol%) and bis(dipheny-
lphosphino)methane (8.4 mg, 3 mol%) was flushed with argon. DCM (2.5 mL), pinacolborane
(112 mg, 0.874 mmol) and 12 (707 mg, 0.728 mmol) were added successively at room
temperature. The mixture was then stirred at room temperature for 24 h. The reaction was
quenched with methanol and water, the product was extracted with ether, and dried over
magnesium sulfate. The solvent was removed in vacuo, and the crude product was purified by
silica gel column chromatography (Hexane/Ethyl acetate, 10:1 to 5:1, v/v) affording 1324 (531
1
mg, 67%). H NMR (300 MHz, CDCl3) δ (ppm) 0.68-0.91 (2H, m), 1.26 (6H, s), 1.27 (6H, s),
1.58-1.71 (1H, m), 1.89-2.00 (1H, m), 3.34 (1H, t, J = 9.3 Hz), 3.44 (1H, dd, J1 = 1.5 Hz, J2 =
10.4 Hz), 3.53-3.60 (2H, m), 3.63-3.73 (2H, m), 4.02-4.16 (3H, m), 4.18-4.23 (2H, m), 4.41-5.04
17

ACCEPTED MANUSCRIPT
(14H, m), 5.22 (1H, d, J = 3.5 Hz), 5.33 (1H, d, J = 3.5 Hz), 7.16-7.39 (35H, m). 13C NMR (75
MHz, CDCl3) δ (ppm) 24.9, 24.9, 25.8, 68.4, 70.6, 71.9, 72.7, 73.0, 73.5, 75.0, 75.1, 75.6, 77.3,
79.2, 80.0, 81.6, 81.7, 81.8, 82.9, 92.9, 93.3,127.5, 127.6, 127.7, 127.9, 128.0, 128.3, 138.0,
138.3, 138.4, 138.6, 138.7, 138.9, 139.0. HRMS (ESI) m/z calcd.for C68H77BO12Na [M+Na]+
1119.5406, found 1119.5450. calcd. for C68H77BO12K [M+K]+ 1135.5145, found 1135.5183.
4.2.10. 6,7-Dideoxy-7-borono-α,α-trehalose (4)
A mixture of compound 13 (300 mg, 0.27 mmol), and Pd/C (10%) (116 mg, 0.11 mmol)
in methanol (5 mL) was stirred under H2 (1 atm) for 24 h. After completion, the catalyst was
removed by filtration through Celite, and filtrate was concentrated in vacuo. The crude product
was purified by flash chromatography (water/isopropanol/ethyl acetate, 1:4:4, v/v/v) to give 4
1
(107 mg, 100%). H NMR (300 MHz, D2O) δ (ppm) 0.83-1.05 (2H, m), 1.65-1.82 (2H, m),
3.41-3.47 (2H, m), 3.61-3.69 (2H, m), 3.74- 3.78 (6H, m), 5.15 (1H, d, J = 4.1 Hz), 5.17 (1H, d,
13
J=4.0 Hz). C NMR (75 MHz, CDCl3) δ (ppm) 23.5, 24.5, 60.2, 69.3, 70.6, 70.7, 70.9, 71.8,
71.9, 72.2, 75.3, 92.9, 93.0. HRMS (ESI) m/z calcd.for C13H25BO12Na [M+Na]+ 407.1337,
found 407.1344.
5. Protein expression and purification
5.1 Preparation of Recombinant Mycobacterium tuberculosis T6PP
The gene encoding Mt-T6PP was amplified by using the polymerase chain reaction (PCR).
The reaction mixture contained M. tuberculosis genomic DNA (ATCC 25177), Deep Vent DNA
Polymerase and with the forward (5'-GTGAGAGGGTGGCATATGCGCAAG TTGGGC-3') and
reverse (5'-CATGGCCGTCCTCCTCGAGGACGGTCGGAG-3') oligonucleotide primers
containing NdeI and XhoI restriction sites, respectively. Gene amplification was carried out
18

ACCEPTED MANUSCRIPT
under the following conditions: 50 ꢀL reactions contained 5 ꢀL 10×Pfu buffer, 4 ꢀL dNTP mix
(2.5mM), 1 ꢀL Deep Vent DNA Polymerase, 2 ꢀL forward primer (50 ꢀM), 2 ꢀL reverse primer
(50 ꢀM), 2 ꢀL genomic DNA (20ng/ꢀL) and 34 ꢀL DI H2O. The initial denaturation was carried
out at 94°C for 10 min followed by 25 cycles of denaturation at 94 °C for 1 min, annealing at
51.5 °C for 2 min and extension at 72 °C for 5 min. The final extension was carried out at 72 °C
for 10 min. The PCR products were digested with NdeI and XhoI restriction enzymes at 37 °C for
3 h, and the digested products were harvested by agarose gel electrophoresis. At the same time,
pET-15b (+) tev (Boston University) and pET-23a (+) vectors were digested by NdeI and XhoI
restriction enzymes at 37 °C for 3h, and the digested products were harvested in the same
manner. Digested DNA was ligated to corresponding digested pET-15b (+) tev at room
temperature for 5-7 h, The resulting pET-15b (+) tev-T6PP encodes a recombinant Mt-T6PP
enzyme possessing an N-terminal polyhistidine tag, and the cloned products were verified by
DNA sequencing. pET-15b (+) tev-T6PP construct was transformed into T7 Express Iq
Competent E. coli cells (High Efficiency, from New England BioLabs) that were then grown on
an agar plate containing ampicillin. A selected colony was checked for Mt-T6PP expression and
the isolated plasmid was sequenced to verify the correct gene sequence. Over-expression of Mt-
T6PP was induced with 0.4 mM IPTG (isopropyl β-D-thiogalactoside) overnight at 37 °C and
175 rpm in LB cultures at logarithmic phase growth (OD600=0.4-0.6).
Cells containing Mt-T6PP were harvested at 6500 rpm for 15 min and the collected pellet
was suspended in 20 mM HEPES buffer (pH =7.5) containing 100 mM NaCl, 5 mM MgCl2 and
2 mM DTT. The suspended cells were lysed by disruption using a French Pressure Cell and the
lysate was centrifuged at 20,000 rpm for 15 min. The supernatant was loaded onto a nickel
nitrilotriacetic acid (Ni-NTA) agarose affinity column, which was pre-equilibrated with 20 mM
19

ACCEPTED MANUSCRIPT
HEPES buffer (pH =7.5) containing 100 mM NaCl, 5 mM MgCl2, 2 mM DTT and 40 mM
imidazole. The column was subsequently washed with the same buffer for 3-5 column volumes
before the recombinant protein was eluted with similar buffer containing 500 mM imidazole. The
purity of eluted protein was analyzed by 12% SDS-PAGE (Coomassie blue staining).
Recombinant Mt-T6PP protein was dialyzed against 20 mM HEPES buffer (pH 7.5) containing 5
mM MgCl2, 100 mM NaCl and 2 mM DTT in order to remove imidazole. The dialyzed protein
was subjected to steady-state kinetic analysis. Protein concentration was determined using the
Bio-Rad protein assay with bovine serum albumin as the standard.
5.2. Preparation of Recombinant Shigella boydii T6PP
The gene encoding the Sb-T6PP protein was amplified by PCR using DNA synthesized
by GenScript, Deep Vent DNA polymerase, along with a gene-specific oligonucleotide forward
primer
(5'CCTCGCGAATGCATCTAGATCCCAT3')
and
reverse
primer
(5'CAGGCCTCTGCAGTCGACGG3') containing NdeI and XhoI restriction sites, respectively.
The pET-28a vector, digested by NdeI and XhoI restriction enzymes, was ligated to the PCR
product previously digested with the same restriction enzymes. The ligation product was used to
transform T7 Express Iq Competent E. coli cells (High Efficiency) that were then grown on an
agar plate containing ampicillin. A selected colony was checked for Sb-T6PP expression and the
isolated plasmid was sequenced to verify the correct gene sequence. Sb-T6PP was further
prepared using the same method described for Mt-T6PP preparation.
5.3. Preparation of Recombinant Ascaris suum T6PP
The DNA coding the As-T6PP protein was amplified by PCR using template DNA
synthesized by GenScript in PUC-57 with Deep Vent DNA polymerase and an oligonucleotide
20

ACCEPTED MANUSCRIPT
forward primer (5'CGCGAATGCATCTAGATCCCATATGACT3') and reverse primer
(5'GATCGGATCCAATTTATTCAGTGGCTCGTT3') containing NdeI and XhoI restriction
sites. The pET-15b-tev vector, digested by NdeI and XhoI restriction enzymes, was ligated to the
PCR product that had been purified and digested with the same restriction enzymes. The ligation
product was used to transform T7 Express Iq Competent E. coli (High Efficiency) cells that were
then grown on an agar plate containing ampicillin. A selected colony was checked for T6PP
expression, and the isolated plasmid was verified the correct gene sequence by DNA sequencing.
As-T6PP was further prepared using the same method described for Mt-T6PP preparation.
5.4. Preparation of Recombinant Salmonella typhimurium T6PP
The gene encoding St-T6PP was amplified by using the polymerase chain reaction
(PCR). The reaction mixture contained Salmonella typhimurium genomic DNA (ATCC
700720D),
PfuTurbo
DNA
Polymerase
and
with
the
forward
(5'-
AGACCCATATGGCAGAACCGTTA-3') and reverse (5'- CACAACCCTCGAGCCG CTTT-3')
oligonucleotide primers containing NdeI and XhoI restriction sites, respectively. The pET-15b-
tev vector, digested by NdeI and XhoI restriction enzymes, was ligated to the PCR product that
had been purified and digested with the same restriction enzymes. The ligation product was used
to transform T7 Express Iq Competent E. coli (High Efficiency) cells that were then grown on an
agar plate containing ampicillin. A selected colony was checked for T6PP expression, and the
isolated plasmid was sequenced to verify the correct gene sequence. St-T6PP was further
prepared using the same method described for Mt-T6PP preparation.
6. Substrate Activity and Inhibition Determination
21

ACCEPTED MANUSCRIPT
T6PP-catalyzed hydrolyses of S6P and G6P were executed with 500 ꢀL assay solutions that
contained 10 mM sugar phosphate (S6P or G6P), 1 mM MgCl2, 0.1 mM sodium azide, 1.0
unit/mL purine nucleoside phosphorylase, and 0.2 mM MESG, 50 ꢀM T6PP in 50 mM Tris
buffer (pH 7.5). Absorbance changes were monitored at 360 nm (ꢁε = 9.8 mM−1cm−1).
Initial velocities for T6PP-catalyzed hydrolysis of T6P were measured at 25 °C using assay
solutions (500 ꢀL) that contained 1 mM MgCl2, 0.1 mM sodium azide, 1.0 unit/mL purine
nucleoside phosphorylase, and 0.2 mM MESG in 50 mM Tris-HCl (pH 7.5). Absorbance
changes were monitored at 360 nm (ꢁε = 9.8 mM−1cm−1). The steady-state kinetic parameters
(Km and kcat) for trehalose 6-phosphate were determined by fitting the initial velocity data
measured at varying substrate concentration (varied in the range 0.5Km – 5Km) using SigmaPlot
Enzyme Kinetics Module:
V0= Vmax [S]/(Km +[S])
Here, V0 is the initial velocity, Vmax the maximum velocity, [S] the substrate concentration and
Km the Michaelis-Menten constant calculated for trehalose 6-phosphate. The value for kcat was
calculated from the following:
kcat = Vmax /[E]
where [E] is the protein concentration in the assay.
The steady-state kinetic constants for T6PP Competitive inhibition constants, Ki, were
determined for inhibitors by fitting initial velocity data, measured as a function of T6P (0.5 Km to
5Km) and inhibitor (0, Ki, 2Ki) concentration, to the following equation:
V0 = Vmax[S]/[Km(1+[I]/Ki)+[S]]
22

ACCEPTED MANUSCRIPT
Where [I] is the inhibitor concentration and Ki the inhibition constant, using SigmaPlot Enzyme
Kinetics Module.
Acknowledgements
This study was financially supported by NIH grant R21 AI103484. The authors acknowledge
Dr. Karen Allen for helpful discussion.
Supplementary data
Supplementary data associated with this article can be found, in the online version, at
References
1. Farelli, J. D.; Galvin, B. D.; Li, Z.; Liu, C.; Aono, M.; Garland, M.; Hallett, O. E.;
Causey, T. B.; Ali-Reynolds, A.; Saltzberg, D. J.; Carlow, C. K.; Dunaway-Mariano, D.;
Allen, K. N. PLoS Pathog. 2014, 10, e1004245.
2. De Smet, K. A.; Weston, A.; Brown, I. N.; Young, D. B.; Robertson, B. D. Microbiol.
2000, 146, 199.
3. Avonce, N.; Mendoza-Vargas, A.; Morett, E. and Iturriaga, G. BMC Evol. Biol.
2006, 6,109.
4. Behm, C.A. Int. J. Parasitol. 1997, 27, 215.
5. Kormish, J. D.; McGhee, J. D. Dev. Biol. 2005, 287, 35.
6. Morita, T.; El-Kazzaz, W.; Tanaka, Y.; Inada, T.; Aiba, H. J. Biol. Chem. 2003, 278,
15608.
7. Kapoor, R.; Venkitasubramanian, T. Biochem. J., 1981, 193, 435.
8. Foufelle, F.; Gouhot, B.; Pégorier. J. P.; Perdereau, D.; Girard, J.; Ferré, P. J. Biol. Chem.
1992, 267, 20543.
9. Murphy, H. N.; Stewart, G. R., Mischenko, V. V.; Apt, A. S.; Harris, R.; McAlister, M. S.;
Driscoll, P. C.; Young, D. B.; Robertson, B. D. J. Biol. Chem. 2005, 280, 14524.
10. Song, X. S.; Li, H. P.; Zhang, J. B.; Song, B.; Huang, T.; Du, X. M.; Gong, A. D.; Liu, Y.
K.; Feng, Y. N.; Agboola, R. S.; Liao, Y. C. Fungal Genet. Biol. 2014, 63, 24.
11. Puttikamonkul, S.; Willger, S. D.; Grahl, N.; Perfect, J. R.; Movahed, N.; Bothner, B.;
Park, S.; Paderu, P.; Perlin, D. S.; Cramer, R. A. Jr. Mol. Microbiol. 2010, 77, 891.
12. Zaragoza, O.; Virgilio, C.; Pontón, J. and Gancedo, C. Microbiol. 2002, 148, 1281.
13. Tran, K. L.; Aronov, P. A.; Tanaka, H.; Newman, J.W.; Hammock, B. D. and Morisseau,
C. Biochemistry 2005, 44, 12179.
23

ACCEPTED MANUSCRIPT
14. Johnson, T.O.; Ermolieff, J; Jirousek, M. R. Nat. Rev. Drug. Discov. 2002, 1, 696.
15. Di Costanzo, L.; Sabio, G.; Mora, A.; Rodriguez, P. C.; Ochoa, A. C.; Centeno, F. and
Christianson, D. W. Proc. Natl. Acad. Sci. USA 2005, 102, 13058.
16. Usher, K. C.; Blaszczak, L. C.; Weston, G. S.; Shoichet, B. K. and Remington, S. J.
Biochemistry 1998, 37, 16082.
17. Berndt, F.; Sajadi, M.; Ernsting, N. P.; Mahrwald, R. Carbohydr. Res. 2011, 346, 2960.
18. Burke, T. R.; Kole, H. K.; Roller, P. P. Biochem. Biophys. Res. Commun. 1994, 204,129.
19. Liu, C.; Mariano, P. S. Tetrahedron Lett. 2015, 56, 3008.
20. Omura, K.; Swern, D. Tetrahedron 1978, 34, 1651.
21. Belakhov, V.; Dovgolevsky, E.; Rabkin, E.; Shulami, S.; Shoham, Y.; Baasov, T.
Carbohydr. Res. 2004, 339, 385.
22. Vidil, C.; Morère, A.; Garcia, M.; Barragan, V.; Hamdaoui, B.; Rochefort, H.; Montero, J.
L. Eur. J. Org. Chem. 1999, 2, 447.
23. Cui, P.; McCalmont, W. F.; Tomsig, J. F.; Lynch, K. R.; Macdonald, T. L. Bioorg. Med.
Chem. 2008, 16, 2212.
24. Yamamoto, Y.; Fujikawa, R.; Umemoto, T.; Miyaura, N. Tetrahedron 2004, 60, 10695.
24