Deciphering the Biosynthesis of TDP-β- l -oleandrose in Avermectin

Article abstract of DOI:10.1021/acs.jnatprod.0c00902

Avermectin (AVM) refers to eight macrolides containing a common l-oleandrosyl disaccharide chain indispensable to their antiparasitic bioactivities. We delineated the biosynthetic pathway of TDP-β-l-oleandrose (1), the sugar donor of AVM, by characterizing AveBVIII, AveBV, and AveBVII as TDP-sugar 3-ketoreductase, 5-epimerase, and 3-O-methyltransferase, respectively. On the basis of this pathway, we successfully reconstituted the biosynthesis of 1 in Escherichia coli. Our work completes the biosynthetic pathway of AVM and lays a solid foundation for further studies.

Full text of DOI:10.1021/acs.jnatprod.0c00902

pubs.acs.org/jnp
Article
Deciphering the Biosynthesis of TDP-β‑L‑oleandrose in Avermectin
Yue Tang,§ Min Wang,§ Hua Qin, Xiangxiang An, Zhengyan Guo, Guoliang Zhu, Lixin Zhang,
and Yihua Chen*
Cite This: https://dx.doi.org/10.1021/acs.jnatprod.0c00902
Read Online
sı
*
Metrics & More
Article Recommendations
Supporting Information
ACCESS
ABSTRACT: Avermectin (AVM) refers to eight macrolides containing a
common L-oleandrosyl disaccharide chain indispensable to their
antiparasitic bioactivities. We delineated the biosynthetic pathway of
TDP-β-L-oleandrose (1), the sugar donor of AVM, by characterizing
AveBVIII, AveBV, and AveBVII as TDP-sugar 3-ketoreductase, 5-
epimerase, and 3-O-methyltransferase, respectively. On the basis of this
pathway, we successfully reconstituted the biosynthesis of 1 in Escherichia
coli. Our work completes the biosynthetic pathway of AVM and lays a solid
foundation for further studies.
̅
ing AVM, William C. Campbell and Satoshi Omura, were
vermectin (AVM) refers to a group of microbial natural
awarded the Nobel Prize in physiology or medicine in 2015.4
Structurally, the eight AVM components contain distin-
guishable 16-membered macrolide aglycones (with clear
differences at three positions: C-5, C-22 and C-23, and C-
26) and a common L-oleandrosyl disaccharide chain, which is
necessary for their bioactivities.5 Among the AVM derivatives,
ivermectin (generated by reduction of the double bond
between C-22 and C-23 of AVM B1) and doramectin (with a
cyclohexyl group at C-26) are modified on the macrolide part.
They exhibit a wider safety profile or favorable intrinsic
activity and a longer duration of preventive efficacy against
nematode infections.6,7 Besides, emamectin (4″-epi-methyl-
amino-4″-deoxy-AVM B1) and eprinomectin (4″-epi-acetyla-
mino-4″-deoxy-AVM B1) are obtained by modifications on
the terminal L-oleandrose. The former one is up to 1500-fold
more potent against lepidopterous pests than AVM B1 and
has been used as a pest control agent of crops;8 the latter one
possesses markedly reduced distribution into the milk of
treated cattle and has been used as a topical endectocide for
milking ruminants.9
Aproducts consisting of eight glycosylated macrolide
congeners isolated from Streptomyces avermitilis. AVM and
its derivatives (Figure 1) are renowned antiparasitic drugs for
protecting human, livestock, poultry, and crops.1−3 They can
selectively act on the ligand-gated chloride ion channels of
parasites. Due to the high efficacy of these drugs on human
onchocerciasis and lymphatic filariasis, the scientists discover-
While the biosynthesis of the macrolide aglycones of AVM
has been comprehensively elaborated (Figure 2), the
formation mechanism of its L-oleandrosyl disaccharide chain
Received: August 14, 2020
Figure 1. Structures of AVM and its derivatives.
© XXXX American Chemical Society
and American Society of
Pharmacognosy
https://dx.doi.org/10.1021/acs.jnatprod.0c00902
J. Nat. Prod. XXXX, XXX, XXX−XXX
A

Journal of Natural Products
pubs.acs.org/jnp
Article
Figure 2. Biosynthesis of AVM. (A) Genetic organization of the ave gene cluster. (B) The proposed biosynthetic pathway of AVM. The three Ave
proteins characterized in this study are indicated in blue. The isoenzymes used to reconstitute the biosynthesis of 1 in E. coli are indicated in
green.
remains elusive.10,11 Sequence analysis and heterologous
expression suggested that eight contiguous genes, aveBI-
BVIII (or avrB-I), in the ave gene cluster (Figure 2A) are
involved in the biosynthesis of AVM L-oleandrosyl dis-
accharide.12 However, a lack of biochemical characterization
of the proteins encoded by these genes leaves their functions
uncertain. The only in vitro characterized Ave protein is AveBI
(AvrB), an iterative glycosyltransferase responsible for the
attachment of the L-oleandrosyl disaccharide chain using
TDP-β-L-oleandrose (1) as a sugar donor.13 The intermediacy
of 1 is also supported by the fact that it could be isolated from
the extracts of S. avermitilis.14
Based on the results of isotope labeling experiments, in vivo
studies, and bioinformatic analyses of the ave genes, it was
proposed that the biosynthesis of 1 is started by a
thymidylyltransferase AveBIII, which can activate glucose-1-
phosphate (2) to TDP-α-D-glucose (3). It is then dehydrated
to form TDP-4-keto-6-deoxy-D-glucose (4) by AveBII (Figure
2).15 However, little is known about the following process that
converts 4 to 1, except that its 3-O-methyl is derived from S-
adenosyl-L-methionine (SAM).16 In this study, a detailed
biosynthetic pathway of 1 was delineated by in vitro enzymatic
characterization of three Ave proteins, AveBVIII (AvrI),
AveBV (AvrF), and AveBVII (AvrH). In the end, we validated
this pathway by successful reconstitution of the biosynthesis of
1 in Escherichia coli.
RESULTS AND DISCUSSION
■
Bioinformatic analyses suggested that AveBVI and AveBVIII
were TDP-4-keto-6-deoxy-D-glucose 2,3-dehydratase and
TDP-3,4-diketo-2,6-dideoxy-D-glucose 3-ketoreductase, re-
spectively. We tested different E. coli hosts and various
conditions to express AveBVI and AveBVIII, but only N-His6-
B
https://dx.doi.org/10.1021/acs.jnatprod.0c00902
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
pubs.acs.org/jnp
Article
Figure 3. In vitro characterization of AveBVIII, AveBV, and AveBVII. A proposed biosynthetic pathway of 8 (A) and the HPLC profiles of the
AveBVIII assays (B), the AveBV assays (C), and the AveBVII assays (D). 6*:6 and its isomers; 7*:7 and its isomers.
tagged AveBVIII could be expressed as a soluble protein in E.
coli Arctic Express (DE3) (Figure S1A). To characterize
AveBVIII, a defined TDP-4-keto-6-deoxy-D-glucose 2,3-dehy-
dratase KijB1 (47.8% identity with AveBVI) and two TDP-
3,4-diketo-2,6-dideoxy-D-glucose 3-ketoreductases, TylC117
and KijD10,18 with different stereoselectivities were expressed
and purified (Figure S1B). The combination of KijB1 and
KijD10 could convert 4 to 5, and then to 6. If KijD10 was
changed to TylC1, the final product would be its 3-epimer,
TDP-4-keto-2,6-dideoxy-D-allose (7) (Figure 3A). Although
both of the 3-epimers tend to undergo tautomerizations to
generate enol sugars, the two reactions could be discriminated
by HPLC. When KijB1 and AveBVIII were used, HPLC
analysis showed that 4 was converted to the same products as
those of the KijB1+TylC1 assay (Figure 3B), indicating that
AveBVIII is an isoenzyme of TylC1, which was also supported
by the following combination studies with AveBV.
Scheme 1. Synthesis of 1, 8, and 9
AveBV is proposed to be an epimerase, sharing 37.7%
identity with a defined 5-epimerase KijD11. After purification,
the N-His6-tagged AveBV was added to the KijB1+AveBVIII
assay, and the hybrid reaction generated TDP-4-keto-β-L-
olivose (8) as anticipated (Figure 3C), which was identified
by HRESIMS (Figure S2) and comparison with the
chemically synthesized 8 standard (Scheme 1 and Figures
S3−S6).19 We also tested the hybrid reactions of KijB1+Tyl-
C1+AveBV and KijB1+KijD10+AveBV. The former combina-
tion could produce 8 as in the KijB1+AveBVIII+AveBV assay;
the latter one could not. Overall, these results suggested that
AveBVIII reduces 5 to 7, which is then flipped to 8 via the 5-
epimerization catalyzed by AveBV.
AveBIV and AveBVII may participate in the conversion of 8
to 1 via 4-ketoreduction and 3-O-methylation, while the
functional sequence of the two enzymes was unknown. We
tried to express AveBIV and AveBVII in E. coli, and only
C
https://dx.doi.org/10.1021/acs.jnatprod.0c00902
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
pubs.acs.org/jnp
Article
soluble N-His6-tagged AveBVII was obtained (Figure S1B).
After purification, AveBVII was incubated with 8 using SAM
as a methyl donor. When comparing with the control assay
using boiled AveBVII, neither substrate consumption nor new
product accumulation was detected by HPLC (Figure S7),
indicating that 8 is not a substrate of AveBVII. Another
possibility is that the 4-ketoreduction of 8 takes place prior to
the 3-O-methylation step, which is consistent with the
previous observation that AveBIV (AvrE) could convert
TDP-4-keto-β-L-acosamine to TDP-β-L-acosamine in a
combinatorial biosynthesis effort to produce epirubicin.20
We therefore chemically synthesized TDP-β-L-olivose (9)21,22
from 3,4-di-O-acetyl-6-deoxy-L-glucal (10) (Scheme 1 and
Figures S8−S10) and tested it as a substrate of AveBVII. To
our delight, HPLC analysis showed that AveBVII was able to
catalyze the 3-O-methylation of 9 to generate 1 (Figure 3D),
which was identified by comparing with the synthetic standard
1 (Scheme 1 and Figures S11−S14).23 Therefore, AveBVII
was proposed to be responsible for the last step of the
biosynthesis of 1.
Based on the functional characterizations of AveBVIII,
AveBV, and AveBVII, a detailed biosynthetic pathway of 1
could be delineated. As shown in Figure 2B, 2 is first activated
by AveBIII and then dehydrated by AveBII to form 4, which is
oxidized by AveBVI to generate 5, a common intermediate of
diverse TDP-2,6-dideoxysugars. Compound 5 is reduced to 7
by AveBVIII and then converted to 8 by the 5-epimerase
AveBV. AveBIV reduces 8 to 9, which is then converted to 1
by the 3-O-methylation catalyzed by AveBVII.
To further validate the biosynthetic mechanism of 1 in
AVM, we tried to reconstitute its biosynthesis in E. coli
BW25113 (DE3). Seven Ave proteins are required for the
conversion of 2 to 1, while only two of them, AveBV and
AveBVII, can be expressed as soluble proteins in E. coli
BW25113 (DE3). Therefore, appropriate isoenzymes of the
other five Ave proteins were used to construct the
biosynthetic pathway of 1 in E. coli. For the first two steps
of this pathway, RmlA (50.5% identity with AveBIII) and
RmlB (40.7% identity with AveBII) involved in E. coli
lipopolysaccharide biosynthesis were chosen for the con-
version of 2 to 4. The aforementioned TDP-4-keto-6-deoxy-D-
glucose 2,3-dehydratase (KijB1) and TDP-3,4-diketo-2,6-
dideoxy-D-glucose 3-ketoreductase (TylC1) were used to
convert 4 to 7. RmlD, a TDP-sugar 4-ketoreductase that is
capable of converting 8 to 9,24 was recruited for the
penultimate step of the pathway.
Figure 4. LC-HRESIMS analyses of the reconstitutions of 9 (A) and
1 (B) in E. coli.
add extra evidence supporting the biosynthetic pathway
proposed in Figure 2B.
AVM contains a 16-membered macrolide aglycone and a L-
oleandrosyl disaccharide chain. Here, we delineate the
biosynthetic pathway of 1, the sugar donor of the disaccharide
chain of AVM. The work places the last piece of the AVM
biosynthesis puzzle that allows us to give a complete
description of AVM biosynthesis (Figure 2B). In brief, the
macrolide skeletons of AVM are assembled by four large
modular polyketide synthases in a collinear manner.10,26 After
that, the bifunctional spirocyclase and dehydratase AveC
shapes the 6,6-spiroketal moiety and defines its saturation
characteristics by performing the dehydration between C-22
and C-23 optionally.27 Further modifications by AveE, AveF,
and AveD generate the eight different furan-containing
aglycones. Finally, the iterative glycosyltransferase AveBI
(AvrB) attaches the L-oleandrosyl disaccharide chain using 1
as a sugar donor, which is derived from 2 by seven steps as
depicted in Figure 2B.
Actually, L-oleandrose exists not only in AVM, but also in
some other natural products including another macrolide
antibiotic, oleandomycin, whose biosynthesis has also been
thoroughly investigated. Intriguingly, the biosynthesis of L-
oleandrose in oleandomycin is through a very different route.
The common intermediate 5 is reduced by OleW to form 6,
which is then converted to 8 by OleL, a 3,5-epimerase. After
being reduced to 9, L-olivose is loaded to the macrolide
aglycone by a glycosyltransferase; and the attached L-olivose is
methylated to L-oleandrose by OleY.28,29 It is very interesting
that two different routes are taken by AVM and oleandomycin
for the biosynthesis of a sugar common to both (Figure S16),
which underscores the significant metabolic diversity of
natural product biosynthesis.
At first, we synthesized two DNA cassettes, rmlA-rmlB-kijB1
and tylC1-aveBV-rmlD-aveBVII, and cloned them into plasmid
pAB1s25 to generate pAB1s-1 with both cassettes controlled
by their own arabinose-inducible promoter (PBAD) (Figure
S15). Upon arabinose induction, E. coil BW25113/pAB1s-1,
the recombinant strain harboring pAB1s-1, unexpectedly
accumulated 9 instead of 1 (Figure 4A), indicating a
malfunction of AveBVII. One possible explanation is that
the PBAD promoter is insufficient to drive the transcription of
an operon as long as the tylC1-aveBV-rmlD-aveBVII cassette.
We therefore inserted a PBAD promoter specifically for aveBVII
upstream in pAB1s-1 and introduced the resultant plasmid
into E. coli BW25113 (DE3) to afford E. coil BW25113/
pAB1s-2. As anticipated, E. coil BW25113/pAB1s-2 could
produce 1 when it was induced by L-arabinose (Figure 4B).
Overall, the reconstitutions of 9 and 1 biosynthesis in E. coli
In conclusion, we deciphered the biosynthesis logic of 1 in
AVM by characterizing AveBVIII, AveBV, and AveBVII as
TDP-sugar 3-ketoreductase, 5-epimerase, and 3-O-methyl-
transferase, respectively. Moreover, the proposed biosynthetic
pathway was validated by successful reconstitution of 1
biosynthesis in E. coli. AVM and its derivatives are important
drugs for controlling various diseases caused by nematodes
and arthropod parasites. Our work places the last piece of the
puzzle of AVM biosynthesis and lays a solid foundation for
further combinatorial biosynthesis and synthetic biological
studies of AVM.
EXPERIMENTAL SECTION
■
Bacterial Strains and Growth Conditions. Escherichia coli
JM109 was used for DNA cloning. E. coli BL21 (DE3) and E. coli
Arctic Express (DE3) were used for the expression of recombinant
D
https://dx.doi.org/10.1021/acs.jnatprod.0c00902
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
pubs.acs.org/jnp
Article
proteins. E. coli BW25113 (DE3) was used to produce 1. LB broth
and agar were used for the growth of E. coli strains. LB broth
supplied with 1% glucose was used to produce 1.
(Shimadzu). The column was developed with solvent A (ddH2O)
and solvent B (1.0 M CH3COONH4) at a flow rate of 1.0 mL/min.31
The percentage of solvent B was changed using the following
gradient: 0−2 min, 25%; 2−7 min, 25−45%; 7−20 min, 45−65%;
20−22 min, 65−90%; 22−33 min, 90%; 34−40 min, 25%. The
detection wavelength was 254 nm.
Enzymatic Assays of AveBV. The epimerase activity of AveBV
was tested by a hybrid reaction of KijB1, AveBVIII, and AveBV. The
enzymatic assay of KijB1+AveBVIII+AveBV was set in a 50 μL
volume mixture containing 50 mM Tris-HCl (pH 8.0), 100 mM
NaCl, 2 mM MgCl2, 2 mM NADPH, 2 mM 4, 5 μM KijB1, 5 μM
AveBVIII, and 5 μM AveBV at 30 °C for 3 h. The reaction was
quenched by adding an equal volume of chloroform. After
centrifugation, 10 μL of aqueous sample was analyzed by HPLC.
The assays of KijB1+TylC1+AveBV and KijB1+KijD10+AveBV were
set analogously. HPLC analysis was performed the same as that for
the AveBVIII assays.
Enzymatic Assays of AveBVII. The catalytic activity of AveBVII
was first tested with 8. The enzymatic assay was carried out in a 50
μL volume mixture containing 50 mM Tris-HCl (pH 8.0), 100 mM
NaC1, 2 mM MgCl2, 2 mM SAM, 5 μM AveBVII, and 0.2 mM 8 at
30 °C for 1 h. The reaction was quenched by adding an equal
volume of chloroform. After centrifugation, 10 μL of the upper
aqueous phase was analyzed by HPLC.
When using 9 as a substrate, the AveBVII enzymatic assay was
performed in a 50 μL volume mixture containing 50 mM Tris-HCl
(pH 8.0), 100 mM NaC1, 2 mM MgCl2, 2 mM SAM, 0.2 mM 9, and
5 μM AveBVII at 30 °C for 3 h. The reaction was quenched by
adding an equal volume of chloroform, and after centrifugation, 10
μL of aqueous sample was analyzed by HPLC.
HPLC analysis was performed with a Zorbax SB-AQ column (5
μm, 4.6 × 250 mm, Agilent) and eluted with solvent A (ddH2O
containing 0.1% trifluoroacetic acid) and solvent B (CH3CN) at a
flow rate of 1 mL/min. The percentage of CH3CN was changed
using the following gradient: 0−5 min, 0%; 5−15 min, 0−30%; 15−
30 min, 30−100%; 30−33 min, 100%; 34−40 min, 0%. The
detection wavelength was 254 nm.
Construction of pAB1s-1 and pAB1s-2. The 3.5 kb DNA
cassette rmlA-rmlB-kijB1 flanked with KpnI and BamHI sites was
synthesized, excised, and inserted into the KpnI/BglII (BamHI and
BglII are a pair of isocaudamers) sites of the high-copy-number
plasmid pAB1s to generate plasmid pAB1s-RRK. The successful
construction of pAB1s-RRK was verified by PCR with primers RRK-
1 (GCCGTCACTGC GTCTTTTAC)/RRK-2 (CTCTCGCATG-
GGGAGACC). The 3.8 kb DNA cassette tylC1-aveBV-rmlD-aveBVII
(containing an arabinose-inducible promoter PBAD at the upstream of
tylC1) flanked with BglII and PstI sites was synthesized, excised, and
inserted into the same sites of pAB1s-RRK to generate plasmid
pAB1s-1, which was verified by PCR using primers TARA-1
(GTGTGCTGGGTGCCACCGG)/TARA-2 (CTGCGTTAT-
CGTCGACG).
DNA Manipulations and Sequence Analyses. DNA synthesis
and sequencing were carried out in Generay Co. and Biosune Co.,
respectively. Polymerase chain reactions (PCRs) were performed
with PrimeSTAR HS DNA polymerase (Takara) or Taq DNA
polymerase (TransGene). The one-step cloning method was
employed for plasmid construction according to the manufacturer’s
instructions (Vazyme). A BLASTP search was used to predict protein
functions (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Protein sequence
alignments were performed using Clustal Omega (https://www.ebi.
ac.uk/Tools/msa/clustalo/).
Protein Expression and Purification. The 1.4 kb kijB1 gene
was synthesized and inserted into the NdeI/BamHI sites of pET28a
to afford pET28a-KijB1. A single transformant of E. coli BL21
(DE3)/pET28a-KijB1 was inoculated into LB with 50 μg/mL
kanamycin and cultured overnight at 37 °C, 220 rpm. The overnight
culture was used to inoculate LB medium with 50 μg/mL kanamycin
at 1:100 dilution and incubated at 37 °C, 220 rpm until the OD600
reached 0.6. Expression of KijB1 was then induced by the addition of
isopropyl-β-thiogalactoside (IPTG) at a final concentration of 0.1
mM and cultured at 16 °C, 180 rpm for a further 18 h.
KijB1 was purified with a Ni-NTA affinity column at 4 °C
following the manufacturer’s instructions. After harvested by
centrifugation, the cells were resuspended in binding buffer (20
mM Tris-HCl, 500 mM NaCl, 5 mM imidazole, pH 7.9). After
sonication, cell debris was removed by centrifugation at 16000g for
30 min. The supernatant containing His6-tagged proteins was loaded
onto the Ni-NTA affinity column, which had been equilibrated with
binding buffer, then washed with washing buffer (20 mM Tris-HCl,
500 mM NaCl, 60 mM imidazole, pH 7.9) followed by elution buffer
(20 mM Tris-HCl, 500 mM NaCl, 500 mM imidazole, pH 7.9). The
fractions containing KijB1 were pooled and desalted with PD-10
columns (GE Healthcare) and concentrated by ultracentrifugation
with an Amicon Ultra-4 10K centrifugal filter device (Merck
Millipore). The purified protein was stored in 50 mM Tris-HCl
buffer (pH 8.0) with 100 mM NaC1 and 20% glycerol at −80 °C.
Protein concentration was measured by Bradford assay using bovine
serum albumin as a standard.30
The 1.0 kb aveBVIII gene was synthesized and inserted into the
NdeI/BamHI sites of pET28a to afford pET28a-AveBVIII. A single
transformant of E. coli Arctic Express (DE3)/pET28a-AveBVIII was
inoculated into LB with 50 μg/mL kanamycin and 40 μg/mL
gentamycin and cultured overnight at 37 °C, 220 rpm. The overnight
culture was used to inoculate LB medium with 50 μg/mL kanamycin
and 40 μg/mL gentamycin at 1:100 dilution and incubated at 37 °C,
220 rpm until the OD600 reached 0.6. Expression of AveBVIII was
then induced by adding 0.1 mM IPTG and cultured at 10 °C, 180
rpm for a further 48 h. The purification of AveBVIII was performed
using the same procedure as that for KijB1.
Similarly, the 1.0 kb kijD10, the 1.0 kb tylC1, the 0.7 kb aveBV,
and the 0.8 kb aveBVII genes were also synthesized and inserted into
the NdeI/BamHI sites of pET28a to afford pET28a-KijD10, pET28a-
TylC1, pET28a-AveBV, and pET28a-AveBVII, respectively. Protein
expression and purification of KijD10, TylC1, AveBV, and AveBVII
were performed using the same procedures as those for KijB1.
Enzymatic Assays of AveBVIII. The catalytic activity of
AveBVIII was studied in a hybrid assay together with KijB1. The
enzymatic reaction of KijB1+AveBVIII was carried out in a 50 μL
volume mixture containing 50 mM Tris-HCl (pH 8.0), 100 mM
NaCl, 2 mM MgCl2, 2 mM NADPH, 2 mM 4, 5 μM KijB1, and 5
μM AveBVIII at 30 °C for 3 h. An equal volume of chloroform was
added to quench the reaction. After centrifugation, 10 μL of aqueous
sample was subjected to HPLC analysis. The KijB1+TylC1 and
KijB1+KijD10 assays were set the same as that of KijB1+AveBVIII,
except that AveBVIII were changed to TylC1 and KijD10,
respectively.
To construct plasmid pAB1s-2, the 0.3 kb arabinose-inducible
promoter sequence was amplified using pAB1s as a template with
primer pairs AP-1 (TTACCACCACCACCATTTAACTCGAGAGA-
AGAAACCAATTGTCCAT)/AP-2 (GTCATCTAGTATTC-
TCCTCTTTAATGCCCAAAAAACGGGTATG), and the 0.8 kb
aveBVII was amplified using pET28a-AveBVII as a template with
primers H-1 (CATACCCGTTTTTTGGGCATTAAAGAGGAGAA-
TACTAGATGAC)/H-2 (TGCCGCGCGGCACCAGCTGCAGT-
TAGGCGCCCC AGGTCAT). The two amplicons with overlapping
regions were ligated into the XhoI/PstI sites of pAB1s-1 with a one-
step cloning kit (Vazyme) to generate plasmid pAB1s-2, which was
verified by DNA sequencing using primer pairs RRK-1/RRK-2. The
recombinant E. coli strains BW25113/pAB1s-1 and BW25113/
pAB1s-2 were constructed by introducing pAB1s-1 and pAB1s-2
into E. coli BW25113 (DE3), respectively.
Production of 9 and 1 in E. coli. A single transformant of E. coli
BW25113/pAB1s-1 was inoculated into LB with 50 μg/mL
streptomycin and cultured overnight at 37 °C, 220 rpm. The
overnight culture was used to inoculate LB medium with 1% glucose
HPLC analysis was performed with a Dionex CarboPac PA1
BioLC column (4 × 250 mm) on a Shimadzu HPLC system
E
https://dx.doi.org/10.1021/acs.jnatprod.0c00902
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
pubs.acs.org/jnp
Article
and 50 μg/mL streptomycin at 1:100 dilution and incubated at 37
°C, 220 rpm until the OD600 reached 0.6. After the addition of 10
mM L-arabinose, the strain was cultured at 28 °C, 220 rpm for 24 h.
The cells were harvested by centrifugation, resuspended in 50 mM
Tris buffer (pH 7.5), and disrupted by sonication.32 After
centrifugation at 16 000g for 30 min, the upper aqueous phase was
treated with chloroform to remove proteins. After filtrated through a
0.22 μm membrane, the sample was analyzed by LC-HRESIMS.
Fermentation and analysis of E. coli BW25113/pAB1s-2 were
performed in the same way. The controls were treated with the
same procedure except the addition of L-arabinose.
Spectroscopic Analysis. LC-MS analyses were performed on an
Agilent 1260/6460 triple-quadrupole LC/MS system with an
electrospray ionization source. HRESIMS was performed on an
Agilent 1260 HPLC/6520 QTOF-MS instrument. NMR spectra
were recorded at room temperature on a Bruker-500 NMR
spectrometer.
Na2SO4, and concentrated in vacuo, and the residue was purified by
silica gel flash chromatography to afford (2S,4S)-6-hydroxy-2-methyl-
3-oxotetrahydro-2H-pyran-4-yl benzoate (0.02 g, 53%): MS m/z
251.1 [M + H]+.
To a solution of (2S,4S)-6-hydroxy-2-methyl-3-oxotetrahydro-2H-
pyran-4-yl benzoate (0.02 g, 0.08 mmol) in CH2Cl2 (2 mL) was
added freshly activated molecular sieves (3 Å, 0.2 g), and the mixture
was stirred at room temperature for 30 min under argon. A catalytic
amount of DMF and oxalyl chloride (2 M in CH2Cl2, 0.05 mL, 0.1
mmol) was then added, and stirring was continued for 1 h. The
mixture was filtered, evaporated without heating, and coevaporated
with toluene (three times). The crude glycosyl chloride was dissolved
in CH3CN (5 mL) under argon and adjusted to pH 9.0 by dropwise
addition of DIPEA. After addition of freshly activated molecular
sieves (3 Å, 0.2 g), the mixture was cooled (ice bath) and added with
Bu4NH2PO4 (0.4 M in CH3CN, 0.4 mL, 0.16 mmol). The mixture
was stirred for 3 h while warming to room temperature, filtered, and
evaporated. The residue was purified by silica gel flash chromatog-
Synthesis of 8. A solution of 10 (0.2 g, 1.0 mmol) and K2CO3
(0.1 g) in dry CH3OH (10 mL) was stirred overnight, and the
solvent was removed in vacuo. The residue was purified by silica gel
flash chromatography to produce 6-deoxy-L-glucal (0.12 g, 80%). MS
m/z 131.1 [M + H]+.
1
raphy to afford 13 (0.016 g, 60%): H NMR (500 MHz, CD3OD) δ
7.95 (m, 2H, H-9 and H-13), 7.52 (m, 1H, H-11), 7.37 (m, 2H, H-
10 and H-12), 5.77 (m, 1H, H-3), 5.03 (d, J = 7.5 Hz, 1H, H-1),
4.56 (q, J = 6.5 Hz, 1H, H-5), 2.66; 2.54 (m, 2H, H-2), 1.29 (d, J =
6.5 Hz, 3H, H-6); 13C NMR (125 MHz, CD3OD) δ 205.9, 166.2,
132.8, 130.3, 129.3, 129.2, 128.1, 128.0, 97.9, 74.3, 72.3, 35.1, 16.9;
MS m/z 329.0 [M − H]−; MS, 1H and 13C NMR, and ROESY
spectra, see Figure S5.
Pyridine (62 μL, 0.77 mmol) and benzoyl chloride (89 μL, 0.77
mmol) were added sequentially to a stirred solution of 6-deoxy-L-
glucal (0.1 g, 0.77 mmol) in CH2Cl2 (2 mL) at −20 °C. The reaction
mixture was stirred for 2 h at −20 °C. The product solution was
diluted with saturated aqueous NaHCO3 (5 mL) and transferred to a
separatory funnel. The formed layers were separated, and the
aqueous layer was extracted with CH2Cl2 (3 × 5 mL). The organic
layers were combined and dried over anhydrous Na2SO4. The dried
solution was then filtered and concentrated in vacuo. The residue was
purified by silica gel flash chromatography to produce 11 (0.1 g,
TMP triethylammonium salt (32 mg, 0.11 mmol) was dissolved in
DMF (1 mL). N,N′-Carbonyldiimidazole (21.0 mg, 0.13 mmol) was
then added. After being stirred overnight, CH3OH was added to the
solution and stirred for 30 min to destroy all excess reagents. The
solution was concentrated to yield TMP-imidazolidate. Compound
13 (16 mg, 0.09 mmol) and TMP-imidazolidate were dried by
concentrating three times from dry DMF separately, combined, and
then dissolved in DMF (2 mL). MgCl2 was dried by concentrating
three times from dry DMF. A solution of MgCl2 (36 mg, 0.4 mmol)
in DMF (1 mL) was added to the reaction mixture. After being
stirred overnight, the reaction mixture was concentrated, redissolved
in CH3CN/H2O (2:1), and then added with LiOH·H2O. The
reaction mixture was stirred for 5 h at room temperature,
concentrated, and purified by Sephadex LH-20 to yield 8: 1H
NMR (500 MHz, D2O) δ 7.39 (s, 1H, H-3″), 5.91 (d, J = 7.0 Hz,
1H, H-1′), 5.20 (d, J = 8.0 Hz 1H, H-1), 4.60 (m, 1H), 4.06 (m,
2H), 3.77 (m, 1H), 3.44 (m, 2H), 2.34 (m, 3H), 1.89 (s, 3H, H-5″),
1.84 (m, 1H), 1.31 (d, J = 6.5 Hz, 3H, H-6); HRESIMS m/z
529.0640 [M − H]− (calcd for C16H23N2O14P2, 529.0630);
1
55%): H NMR (500 MHz, CDCl3) δ 8.05 (m, 2H, H-9 and H-13),
7.60 (m, 1H, H-11), 7.46 (m, 2H, H-10 and H-12), 6.50 (dd, J = 1.2
and 6.0 Hz, 1H, H-1), 5.48 (m, 1H, H-3), 4.86 (dd, J = 2.6 and 6.0
Hz, 1H, H-2), 4.03 (m, 1H, H-5), 3.81 (dd, J = 6.4 and 9.2 Hz, 1H,
H-4), 1.47 (d, J = 6.4 Hz, 3H, H-6); HRESIMS m/z 235.0971 [M +
1
H]+ (calcd for C13H15O4, 235.0965); HRESIMS, H NMR, COSY,
and HMBC spectra, see Figure S3.
To a solution of 11 (0.1 g, 0.47 mmol) in CH3CN (4 mL) was
added anhydrous lithium bromide (0.13 g, 1.44 mmol), DOWEX
50W X2 resin (0.07 g), and CH3OH (0.15 mL). The mixture was
stirred at room temperature for 15 min. The reaction mixture was
then filtered and neutralized with trimethylamine, and the solvent
was evaporated to dryness. The residue was dissolved in CH2Cl2 and
washed with H2O; the organic layer was further washed with ice-cold
1 M HCl and saturated aqueous NaHCO3, dried over anhydrous
Na2SO4, and concentrated in vacuo. The residue was purified by silica
gel flash chromatography to produce (2S,3S,4S)-3-hydroxy-6-
methoxy-2-methyltetrahydro-2H-pyran-4-yl benzoate (0.05g, 40%):
MS m/z 267.1 [M + H]+.
1
HRESIMS and H NMR spectra see Figure S6.
Synthesis of 9. To a solution of 10 (0.2 g, 0.94 mmol) in
CH3CN (8 mL) was added anhydrous lithium bromide (0.25 g, 2.88
mmol), DOWEX 50W X2 resin (0.15 g), and H2O (0.3 mL, 16.67
mmol). The mixture was stirred at room temperature for 15 min,
filtered, neutralized with triethylamine, and then evaporated to
dryness. The residue was dissolved in CH2Cl2 and washed with H2O;
the organic layer was further washed with ice-cold 1 M HCl and
saturated aqueous NaHCO3, dried over anhydrous Na2SO4, and
concentrated in vacuo. The residue was purified by silica gel flash
NaHCO3 (0.05 g, 0.6 mmol) and Dess-Martin periodinane (0.12
g, 0.3 mmol) were added to a stirred solution of alcohol (2S,3S,4S)-
3-hydroxy-6-methoxy-2-methyltetrahydro-2H-pyran-4-yl benzoate
(0.05 g, 0.19 mmol) in CH2Cl2 (2 mL) at 0 °C. The reaction
mixture was allowed to warm to room temperature and stirred for 2
h. Volatiles were removed in vacuo, and the residue was purified by
silica gel flash chromatography to produce ketone 12 (0.04 g, 77%):
1H NMR (500 MHz, CDCl3) δ 8.05 (m, 2H, H-9 and H-13), 7.64
(m, 1H, H-11), 7.51 (m, 2H, H-10 and H-12), 5.90 (m, 1H, H-3),
5.02 (dd, J = 0.5 and 3.0 Hz, 1H, H-1), 4.53 (q, J = 6.5 Hz, 1H, H-
5), 3.52 (s, 3H, H-14), 2.68; 2.38 (m, 2H, H-2), 1.29 (d, J = 6.5 Hz,
3H, H-6); 13C NMR (125 MHz, CDCl3) δ 195.0, 168.8, 129.7,
128.0, 123.8, 110.0, 68.6, 62.7, 46.4, 20.8, 13.0; MS m/z 265.1 [M +
1
chromatography to produce 14 (0.15 g, 69%): H NMR (500 MHz,
CDCl3) δ 5.36 (m, 1H, H-1), 5.02 (m, 1H), 4.75 (t, J = 9.6 Hz, 1H),
4.15; 3.55 (m, 1H), 2.29−2.25 (m, 1H, H-2), 2.06−2.01 (s, 6H, H-8
and H-10), 1.81−1.65 (m, 1H, H-2), 1.23−1.17 (d, J = 6.2 Hz, 3H,
H-6); MS m/z 233.1 [M + H]+; MS and 1H NMR spectra, see
Figure S8.
To a solution of 14 (0.1 g, 0.5 mmol) in CH2Cl2 (5 mL) was
added freshly activated molecular sieves (3 Å, 0.5 g), and the mixture
was stirred at room temperature for 30 min under argon. A catalytic
amount of DMF and oxalyl chloride (2 M in CH2Cl2, 0.3 mL, 0.6
mmol) was then added, and stirring was continued for 1 h. The
mixture was filtered, evaporated without heating, and coevaporated
with toluene (three times). The crude glycosyl chloride was dissolved
in CH3CN (5 mL) under argon and adjusted to pH 9.0 by dropwise
addition of DIPEA. After addition of freshly activated molecular
1
H]+; MS, H and 13C NMR, and COSY spectra, see Figure S4.
To a solution of 12 (0.04 g, 0.15 mmol) in CH2Cl2 (2 mL) cooled
to −78 °C in a dry ice/acetone bath was added dropwise, under
argon, boron tribromide solution (1 M in CH2Cl2, 0.13 mL, 0.13
mmol). After 5 min, the reaction was quenched with saturated
aqueous NaHCO3, extracted with ethyl acetate, dried over anhydrous
F
https://dx.doi.org/10.1021/acs.jnatprod.0c00902
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
pubs.acs.org/jnp
Article
1
sieves (3 Å, 0.5 g), the mixture was cooled (ice bath), and
Bu4NH2PO4 (0.4 M in CH3CN, 2.5 mL, 1 mmol) was added. The
mixture was stirred for 3 h while warming to room temperature prior
to filtration. After evaporation, the residue was purified by silica gel
flash chromatography to produce (2S,3S,4S,6R)-2-methyl-6-
(phosphonooxy)tetrahydro-2H-pyran-3,4-diyl diacetate (0.08 g,
60%): MS m/z 311.0 [M − H]−.
55%): H NMR (500 MHz, CD3OD) δ 5.22; 4.75 (m, 1H, H-1),
3.84; 3.46 (m, 1H), 3.42; 3.41 (s, 3H, H-7), 3.27; 3.19 (m, 1H), 2.98
(m, 1H), 2.31, 2.19 (m, 1H, H-2), 2.00, 1.99 (s, 3H, H-9), 1.46, 1.31
(m, 1H, H-2), 1.27, 1.22 (d, J = 6.1 Hz, 3H, H-6); HRESIMS m/z
205.1078 [M + H]+ (calcd for C9H17O5 205.1071); HRESIMS and
1H NMR spectra, see Figure S12.
To a solution of 17 (0.1 g, 0.5 mmol) in CH2Cl2 (5 mL) was
added freshly activated molecular sieves (3 Å, 0.5 g). The mixture
was stirred at room temperature for 30 min under argon. A catalytic
amount of DMF and oxalyl chloride (2 M in CH2Cl2, 0.3 mL, 0.6
mmol) were then added, and stirring was continued for 1 h. The
mixture was filtered, evaporated without heating, and coevaporated
with toluene (three times). The crude glycosyl chloride was dissolved
in CH3CN (5 mL) under argon, and the pH was adjusted to 9.0 by
dropwise addition of DIPEA. After addition of freshly activated
molecular sieves (3 Å, 0.5 g), the mixture was cooled (ice bath), and
Bu4NH2PO4 (0.4 M in CH3CN, 2.5 mL, 1 mmol) was added. The
mixture was stirred for 3 h while warming to room temperature,
filtered, and then evaporated. The residue was purified by silica gel
flash chromatography to produce (2S,3S,4S,6R)-4-methoxy-2-methyl-
6-(phosphonooxy)tetrahydro-2H-pyran-3-yl acetate (0.08 g, 60%):
MS m/z 283.1 [M − H]−.
(2S,3S,4S,6R)-4-Methoxy-2-methyl-6-(phosphonooxy) tetrahydro-
2H-pyran-3-yl acetate (0.1 g, 0.32 mmol) was dissolved in CH3OH/
H2O/Et3N (2:2:1, 5 mL). The solution was stirred for 16 h,
evaporated to dryness, and purified by Sephadex LH-20 to afford 18
(0.02 g, 42%): 1H NMR (500 MHz, D2O) δ 5.17 (d, J = 8.5 Hz, 1H,
H-1), 3.68 (m, 1H, H-3), 3.45 (m, 1H, H-5), 3.41 (s, 3H, H-7), 3.06
(m, 1H, H-4), 2.31; 1.48 (m, 2H, H-2), 1.28 (d, J = 7.4 Hz, 3H, H-
6); 13C NMR (125 MHz, D2O) δ 101.2, 76.0, 72.5, 71.8, 52.2, 37.6,
16.9; HRESIMS m/z 241.0475 [M − H]− (calcd for C6H12O7P,
241.0475); HRESIMS, 1H and 13C NMR, COSY, and ROESY
spectra, see Figure S13.
TMP triethylammonium salt (30 mg, 0.10 mmol) was dissolved in
DMF (1 mL). N,N′-Carbonyldiimidazole (20.0 mg, 0.12 mmol) was
then added. After being stirred overnight, CH3OH was added to the
solution and stirred for 30 min to destroy all excess reagents. The
solution was concentrated to yield TMP-imidazolidate. Compound
18 (20 mg, 0.09 mmol) and TMP-imidazolidate were dried by
concentrating three times from dry DMF separately, combined, and
dissolved in DMF (2 mL). MgCl2 was dried by concentrating three
times from dry DMF. A solution of MgCl2 (36 mg, 0.4 mmol) in
DMF (1 mL) was added to the reaction mixture. After being stirred
overnight, the reaction mixture was concentrated and purified by
Sephadex LH-20 to yield 1 (2 mg, 10%): 1H NMR (500 MHz, D2O)
δ 7.65 (s, 1H, H-3″), 6.16 (d, J = 6.0 Hz, 1H, H-1′), 5.08 (d, J = 8.5
Hz, 1H, H-1), 4.42 (m, 1H), 3.94 (m, 1H), 3.67 (m, 2H), 3.63 (m,
1H), 3.38 (m, 1H), 3.30 (s, 3H, H-7), 3.19 (m, 1H), 2.24 (m, 1H),
2.13 (m, 2H), 1.77 (d, 3H, H-5″), 1.69 (m, 1H), 1.12 (d, J = 6.4 Hz,
3H, H-6); HRESIMS m/z 545.0939 [M − H]− (calcd for
C17H27N2O14P2, 545.0943); HRESIMS and 1H NMR, see Figure
S14.
Compound (2S,3S,4S,6R)-2-methyl-6-(phosphonooxy)tetrahydro-
2H-pyran-3,4-diyl diacetate (0.1 g, 0.32 mmol) was dissolved in
CH3OH/H2O/Et3N (2:2:1, 5 mL). The solution was stirred for 16
h, evaporated to dryness, and purified by Sephadex LH-20 to afford
1
15 (0.03 g, 42%): H NMR (500 MHz, D2O) δ 5.06 (t, J = 9.5 Hz,
1H, H-1), 3.59 (m, 1H, H-3), 3.35 (m, 1H, H-5), 2.98 (m, 1H, H-4),
2.24; 1.48 (m, 2H, H-2), 1.21 (d, J = 7.5 Hz, 3H, H-6); 13C NMR
(125 MHz, D2O) δ 93.1, 76.0, 72.5, 67.5, 39.7, 16.9; HRESIMS m/z
227.0323 [M − H]− (calcd for C6H12O7P, 227.0326); HRESIMS, 1H
and 13C NMR, COSY, and ROESY spectra, see Figure S9.
TMP triethylammonium salt (37 mg, 0.12 mmol) was dissolved in
DMF (1 mL). N,N′-Carbonyldiimidazole (21.9 mg, 0.14 mmol) was
then added. After being stirred overnight, CH3OH was added to the
solution and stirred for 30 min to destroy all excess reagents. The
solution was concentrated to yield TMP-imidazolidate. Compound
15 (20 mg, 0.09 mmol) and TMP-imidazolidate were dried by
concentrating three times from dry DMF separately, combined, and
dissolved in DMF (2 mL). MgCl2 was dried by concentrating three
times from dry DMF. A solution of MgCl2 (36 mg, 0.4 mmol) in
DMF (1 mL) was added to the reaction mixture. After being stirred
overnight, the reaction mixture was concentrated and purified by
Sephadex LH-20 to yield 9 (3 mg, 10%): 1H NMR (500 MHz, D2O)
δ 7.75 (s, 1H, H-3″), 6.41 (m, 1H, H-1′), 5.19 (d, J = 10.0 Hz, 1H,
H-1), 4.45 (m, 1H), 4.05 (m, 1H), 3.75 (m, 3H), 3.29 (m, 6H), 2.20
(m, 3H), 1.87 (s, 3H, H-5″), 1.76 (m, 1H), 1.21 (d, J = 6.5 Hz, 3H,
H-6); HRESIMS m/z 531.0789 [M
−
H]− (calcd for
C16H25N2O14P2, 531.0787); HRESIMS and 1H NMR spectra, see
Figure S10.
Synthesis of 1. 6-Deoxy-L-glucal (0.1 g, 0.8 mmol) and
dibutylstannoxane (0.2 g, 0.8 mmol) were suspended in toluene (5
mL) and brought to reflux for 2.5 h. The solvent was removed by
distillation, CsF (0.2 g, 0.16 mmol) was added, and the last traces of
solvent were removed in vacuo. The residue was dissolved in THF (5
mL), and MeI (0.2 mL, 3.0 mmol) added. After 2.5 days of stirring at
ambient temperature, imidazole (0.1 g, 1.5 mmol) was added, stirred
for 1 h, and filtered through a short column of silica gel, and the
crude product was purified by silica gel flash chromatography to
produce 16 (0.1 g, 70%): 1H NMR (500 MHz, CDCl3) δ 6.34 (dd, J
= 1.4 and 6.2 Hz, 1H, H-1), 4.83 (dd, J = 2.1 and 6.2 Hz, 1H, H-2),
3.88 (m, 1H, H-5), 3.85 (dt, J = 2.1 and 7.2 Hz, 1H, H-3), 3.54 (dd,
J = 7.2 and 9.4 Hz, 1H, H-4), 3.41 (s, 3H, H-7), 1.38 (d, J = 6.4 Hz,
3H, H-6); 13C NMR (125 MHz, CDCl3) δ 145.3, 98.1, 81.4, 74.5,
73.2, 56.4, 13.5; HRESIMS m/z 145.0858 [M + H]+ (calcd for
C7H13O3, 145.0859); HRESIMS, 1H and 13C NMR, COSY, and
HMBC spectra see Figure S11.
Compound 16 (0.1 g, 0.69 mmol) was dissolved in pyridine (16
mL). Ac2O (12 mL) and DMAP (30 mg, 0.24 mmol) were then
added. After being stirred overnight, the solvent was removed in
vacuo. The residue was dissolved in CH2Cl2 and washed with H2O,
and the filtered organic layer was dried over anhydrous Na2SO4 and
evaporated. The residue was purified by silica gel flash chromatog-
raphy to produce (2S,3S,4S)-4-methoxy-2-methyl-3,4-dihydro-2H-
pyran-3-yl acetate (0.1 g, 77%): MS m/z 187.1 [M + H]+.
To a solution of (2S,3S,4S)-4-methoxy-2-methyl-3,4-dihydro-2H-
pyran-3-yl acetate (0.1 g, 0.53 mmol) in CH3CN (3 mL) was added
anhydrous lithium bromide (0.14 g, 1.62 mmol), DOWEX 50W X2
resin (0.1 g), and H2O (0.15 mL). The mixture was stirred at room
temperature for 15 min, filtered, neutralized with triethylamine, and
evaporated to dryness. The residue was dissolved in CH2Cl2 and
washed with H2O, and the organic layer was further washed with ice-
cold 1 M HCl and saturated aqueous NaHCO3, dried over
anhydrous Na2SO4, and concentrated in vacuo. The residue was
purified by silica gel flash chromatography to produce 17 (0.06 g,
ASSOCIATED CONTENT
* Supporting Information
The Supporting Information is available free of charge at
https://pubs.acs.org/doi/10.1021/acs.jnatprod.0c00902.
■
sı
Experimental details and supplementary figures includ-
ing NMR and MS spectra and compound character-
ization (PDF)
AUTHOR INFORMATION
Corresponding Author
■
Yihua Chen − State Key Laboratory of Microbial Resources &
CAS Key Laboratory of Microbial Physiological and Metabolic
Engineering, Institute of Microbiology, Chinese Academy of
Sciences, Beijing 100101, China; University of Chinese
G
https://dx.doi.org/10.1021/acs.jnatprod.0c00902
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
pubs.acs.org/jnp
Article
(7) Toutain, P. L.; Upson, D. W.; Terhune, T. N.; McKenzie, M. E.
Vet. Parasitol. 1997, 72, 3−8.
Academy of Sciences, Beijing 100049, China; orcid.org/
0000-0001-9362-512X; Phone: 86-10-64806121;
Email: chenyihua@im.ac.cn
(8) Jansson, R. K.; Brown, R.; Cartwright, B.; Cox, D.; Dunbar, D.
M.; Dybas, R. A.; Eckel, C.; Lasota, J. A.; Mookerjee, P. K.; Norton,
J. A.; Peterson, R. F.; Starner, V. R.; White, S. Emamectin benzoate: a
novel avermectin derivative for control of lepidopterous pests.
Proceedings of the 3rd International Workshop on Management of
Diamondback Moth and Other Crucifer Pests; MARDI: Kuala Lumpur,
Malaysia, 1997; pp 1−7.
Authors
Yue Tang − State Key Laboratory of Microbial Resources &
CAS Key Laboratory of Microbial Physiological and Metabolic
Engineering, Institute of Microbiology, Chinese Academy of
Sciences, Beijing 100101, China; University of Chinese
Academy of Sciences, Beijing 100049, China
Min Wang − State Key Laboratory of Microbial Resources &
CAS Key Laboratory of Microbial Physiological and Metabolic
Engineering, Institute of Microbiology, Chinese Academy of
Sciences, Beijing 100101, China; University of Chinese
Academy of Sciences, Beijing 100049, China
Hua Qin − State Key Laboratory of Microbial Resources &
CAS Key Laboratory of Microbial Physiological and Metabolic
Engineering, Institute of Microbiology, Chinese Academy of
Sciences, Beijing 100101, China
Xiangxiang An − State Key Laboratory of Microbial Resources
& CAS Key Laboratory of Microbial Physiological and
Metabolic Engineering, Institute of Microbiology, Chinese
Academy of Sciences, Beijing 100101, China
Zhengyan Guo − State Key Laboratory of Microbial Resources
& CAS Key Laboratory of Microbial Physiological and
Metabolic Engineering, Institute of Microbiology, Chinese
Academy of Sciences, Beijing 100101, China; orcid.org/
0000-0001-7138-4206
Guoliang Zhu − State Key Laboratory of Bioreactor
Engineering, and School of Biotechnology, East China
University of Science and Technology, Shanghai 200237, China
Lixin Zhang − State Key Laboratory of Bioreactor Engineering,
and School of Biotechnology, East China University of Science
and Technology, Shanghai 200237, China
(9) Holste, J. E.; Smith, L. L.; Hair, J. A.; Lancaster, J. L.; Lloyd, J.
E.; Langholff, W. K.; Barrick, R. A.; Eagleson, J. S. Vet. Parasitol.
1997, 73, 153−161.
(10) Ikeda, H.; O
(11) Ikeda, H.; Nonomiya, T.; O
Biotechnol. 2001, 27, 170−176.
(12) Ikeda, H.; Nonomiya, T.; Usami, M.; Ohta, T.; O
̅
mura, S. Chem. Rev. 1997, 97, 2591−2610.
̅
mura, S. J. Ind. Microbiol.
̅
mura, S. Proc.
Natl. Acad. Sci. U. S. A. 1999, 96, 9509−9514.
(13) Zhang, C.; Albermann, C.; Fu, X.; Thorson, J. S. J. Am. Chem.
Soc. 2006, 128, 16420−16421.
(14) Schulman, M. D.; Acton, S. L.; Valentino, D. L.; Arison, B. H.
J. Biol. Chem. 1990, 265, 16965−16970.
(15) Wohlert, S. E.; Lomovskaya, N.; Kulowski, K.; Fonstein, L.;
Occi, J. L.; Gewain, K. M.; MacNeil, D. J.; Hutchinson, C. R. Chem.
Biol. 2001, 8, 681−700.
(16) Cane, D. E.; Liang, T. C.; Kaplan, L.; Nallin, M. K.; Schulman,
M. D.; Hensens, O. D.; Douglas, A. W.; Albers-Schoenberg, G. J. Am.
Chem. Soc. 1983, 105, 4110−4112.
(17) Takahashi, H.; Liu, Y. N.; Chen, H.; Liu, H. W. J. Am. Chem.
Soc. 2005, 127, 9340−9341.
(18) Zhang, H.; White-Phillip, J. A.; Melanco̧ n, C. E.; Kwon, H. J.;
Yu, W. L.; Liu, H. W. E. J. Am. Chem. Soc. 2007, 129, 14670−14683.
(19) Kaneko, M.; Herzon, S. B. Org. Lett. 2014, 16, 2776−2779.
(20) Han, A. R.; Park, J. W.; Lee, M. K.; Ban, Y. H.; Yoo, Y. J.; Kim,
E. J.; Kim, B.; Sohng, J. K.; Yoon, Y. J. Appl. Environ. Microbiol. 2011,
77, 4912−4923.
(21) Oberthuer, M.; Leimkuhler, C.; Kahne, D. Org. Lett. 2004, 6,
2873−2876.
(22) Zhang, G.; Shi, L.; Liu, Q.; Wang, J.; Li, L.; Liu, X. Tetrahedron
2007, 63, 9705−9711.
Complete contact information is available at:
https://pubs.acs.org/10.1021/acs.jnatprod.0c00902
(23) Kunst, E.; Kirschning, A. Synthesis 2006, 2006, 2397−2403.
̈
(24) Amann, S.; Drager, G.; Rupprath, C.; Kirschning, A.; Elling, L.
Author Contributions
Carbohydr. Res. 2001, 335, 23−32.
§Y. Tang and M. Wang contributed equally to this work.
(25) Cui, Q.; Zhou, F.; Liu, W.; Tao, Y. Biotechnol. Lett. 2017, 39,
1567−1574.
Notes
(26) Thuan, N. H.; Pandey, R. P.; Sohng, J. K. Appl. Microbiol.
Biotechnol. 2014, 98, 7747−7759.
The authors declare no competing financial interest.
(27) Sun, P.; Zhao, Q.; Yu, F.; Zhang, H.; Wu, Z.; Wang, Y.; Wang,
Y.; Zhang, Q.; Liu, W. J. Am. Chem. Soc. 2013, 135, 1540−1548.
ACKNOWLEDGMENTS
■
́
(28) Rodrıguez, L.; Rodrıguez, D.; Olano, C.; Brana, A. F.; Men-
̃
We thank Dr. J. Ren, G. Ai, and W. Wang, IM, CAS, for NMR
and MS data collection. This work was supported by grants
from MOST of China (2018YFA0900700), Center for Ocean
Mega-Science, CAS (KEXUE2019GZ05), and China NSFC
(31700036, 31720103901). Z.G. is an awardee for the Youth
Innovation Promotion Association of CAS (2017124).
dez, C.; Salas, J. A. J. Bacteriol. 2001, 183, 5358−5363.
(29) Thibodeaux, C. J.; Melancon, C. E., III; Liu, H. W. Angew.
̧
Chem., Int. Ed. 2008, 47, 9814−9859.
(30) Bradford, M. Anal. Biochem. 1976, 72, 248−254.
(31) Tang, W.; Guo, Z.; Cao, Z.; Wang, M.; Li, P.; Meng, X.; Zhao,
X.; Xie, Z.; Wang, W.; Zhou, A.; Lou, C.; Chen, Y. Proc. Natl. Acad.
Sci. U. S. A. 2018, 115, 2818−2823.
́
(32) Useglio, M.; Peiru, S.; Rodríguez, E.; Labadie, G. R.; Carney, J.
REFERENCES
■
R.; Gramajo, H. Appl. Environ. Microbiol. 2010, 76, 3869−3877.
(1) Burg, R. W.; Miller, B. M.; Baker, E. E.; Birnbaum, J.; Currie, S.
A.; Hartman, R.; Kong, Y. L.; Monaghan, R. L.; Olson, G.; Putter, I.;
Tunac, J. B.; Wallick, H.; Stapley, E. O.; Oiwa, R.; O
Antimicrob. Agents Chemother. 1979, 15, 361−367.
(2) O
(3) Gao, Q.; Tan, G.; Xia, X.; Zhang, L. Curr. Opin. Biotechnol.
2017, 48, 251−257.
(4) Shen, B. Cell 2015, 163, 1297−1300.
̅
mura, S.
̅
mura, S.; Crump, A. Nat. Rev. Microbiol. 2004, 2, 984−989.
(5) Burg, R. W.; Miller, B. M.; Baker, E. E.; Birnbaum, J.; Currie, S.
A.; Hartman, R.; Kong, Y. L.; Monaghan, R. L.; Olson, G.; Putter, I.
Antimicrob. Agents Chemother. 1979, 15, 361−367.
(6) Campbell, W. C. Med. Res. Rev. 1993, 13, 61−79.
H
https://dx.doi.org/10.1021/acs.jnatprod.0c00902
J. Nat. Prod. XXXX, XXX, XXX−XXX