Full text of DOI:10.1038/labinvest.3780415

0023-6837/02/8202-231$03.00/0
LABORATORY INVESTIGATION
Vol. 82, No. 2, p. 231, 2002
Copyright © 2002 by The United States and Canadian Academy of Pathology, Inc.
Printed in U.S.A.
Rho GTPase Inactivation Impairs Lens Growth
and Integrity
Vasantha Rao, Eric Wawrousek, Ernst R. Tamm, and Samuel Zigler, Jr.
Department of Ophthalmology (VR) and Department of Pharmacology and Cancer Biology (VR), Duke University
Medical School, Durham, North Carolina; National Eye Institute (EW, SZ), National Institutes of Health, Bethesda,
Maryland; and Anatomisches Institut (ERT), Lehrstuhl II, Universitaet Erlangen-Nuernberg, Germany
SUMMARY: To elucidate the significance of Rho GTPase signaling on lens growth and structural integrity, we have selectively
inactivated Rho GTPase in the ocular lens. To achieve this tissue-specific inactivation, a transgene encoding the C3-exoenzyme
from Clostridium botulinum has been expressed in mice under transcriptional control of the lens-specific ␣A-crystallin promoter.
C3-exoenzyme is known to selectively inactivate all Rho GTPase isoforms by ADP-ribosylating an asparagine residue at position
41. Mice expressing the C3-exoenzyme transgene exhibited selective ocular defects, including cataract and microphthalmia.
Extralenticular effects included ocular hemorrhage (blood accumulation in the anterior and posterior chambers of the eye) and
abnormalities of the iris including focal attachments to lens and cornea (synechiae). C3-transgene expression was found only in
the lens and not in the other ocular tissues as determined by RT-PCR analysis. Histologic examination of the eyes of C3
transgenic mice from two independent lines revealed extensive abnormalities of the lens, including defective fiber cell
differentiation and elongation, ruptured posterior lens capsule, and thickened anterior lens capsule. Electron microscopic analysis
of hemorrhaged C3 eyes showed abnormalities in the posterior hyaloid vessels. Collectively these data reveal the importance of
Rho GTPase signaling in regulating lens growth and maintenance of lens transparency. (Lab Invest 2002, 82:231–239).
he normal development and growth of the ver-
Members of the Rho family of GTPases (Rac,
T tebrate lens is a complex process that requires CDC42, and Rho) are known to regulate cell motility,
morphology, adhesion, cytokinesis, and gene expres-
sion through their interactions with the cellular actin
network (Alest and D’Souza-Schorey, 1997; Hall,
1998). The formation of filopodia and lamellipodia, for
instance, involves CDC42 and Rac, respectively,
whereas assembly of focal adhesions and stress fibers
is regulated by Rho (Hall, 1998). Because the actin
cytoskeleton constitutes a primary target of the Rho
GTPases, the cytoskeleton could be intimately in-
volved in signaling pathways regulating lens epithelial
cell elongation and differentiation.
We hypothesize that Rho GTPases play an impor-
tant role in the regulation of lens growth and develop-
ment and in the maintenance of lens transparency. To
address this possibility, we initially characterized ex-
pression and distribution profiles of the Ras-related
GTP-binding proteins (Maddala et al 2001a; Rao et al,
1997b) and accessory proteins regulating Ras and
Rho GTPase function, including Ras-GAP, Rho-GAP,
and Rho GDI, in different regions of the lens. We also
found that lovastatin, which prevents isoprenylation
and thereby membrane localization and function of the
small GTPases, causes extensive morphologic alter-
ations and impairs cell proliferation in lens epithelial
cell cultures and induces opacification in organ cul-
tured lenses (Maddala et al, 2001b; Rao et al, 1997a).
Based on these preliminary observations in the lens,
together with the currently understood biologic roles
of the Rho GTPases in general, our goal in this study
was to elucidate the effects of Rho GTPase on lens
growth, development, and integrity. To that end, we
the precise spatial and temporal control of prolifera-
tion of epithelial cells and their differentiation into fiber
cells. Fiber cell differentiation is accompanied by cell
elongation and remodeling of cytoskeletal structures,
cessation of DNA replication and of cell division,
expression of lens fiber-specific proteins such as the ␤
and ␥ crystallins, and finally the loss of nuclei and
other subcellular organelles during the late stages of
maturation (McAvoy, 1978; Piatigorsky, 1981). Al-
though insights have emerged regarding genes con-
trolling the early stages of lens formation, little is
known about lens fiber cell differentiation and elonga-
tion. Lens epithelial cells maintain a lifelong commit-
ment to the programs of proliferation and differentia-
tion. Therefore knowledge of the inductive factors that
regulate these processes, and more importantly, the
signaling pathways that serve to transduce the bio-
logic information conveyed by these external factors
(such as growth factors and hormones) into appropri-
ate responses in cells of the developing lens is critical
for understanding both normal and deranged lens
development.
Received December 10, 2001.
This work was supported by United States Public Health Service grant
R01-EY12201 (VR) and SFB539 and IZKF (ERT).
Address reprint requests to: Dr. P. Vasantha Rao, Department of Ophthal-
mology, Duke University Medical Center, Erwin Road, P.O. Box 3802,
Durham, NC 27710-3802. E-mail: rao00011@mc.duke.edu
Laboratory Investigation • February 2002 • Volume 82 • Number 2 231

Rao et al
have produced transgenic mice in which the Rho
GTPase has been specifically inactivated in the lens.
This report describes the ocular phenotypes and his-
tologic changes in the C3 transgenic mice.
mice were pooled (Fig. 2A). Although lenses obtained
from line ODO4-11 and line ODO4-21 mice showed
the expected 316-bp (partial fragment) PCR product
amplified using C3-exoenzyme specific primers, line
ODO4-16 mice showed no detectable C3 product.
Reactions performed in the absence of reverse tran-
scriptase (RT) showed no C3 product, indicating the
amplified C3 product is not a result of DNA contami-
nation; furthermore, before RT reaction, total RNA was
also treated with DNase-1. Because C3 mice exhibit
some extralenticular ocular phenotype, C3-
exoenzyme transgene expression in other ocular tis-
sues was tested by first removing the lens and then
performing RT-PCR analysis on the rest of the eye. No
expression of C3-exoenzyme message was observed,
although GAPDH expression was detected, indicating
Results
Generation of C3 Transgenic Mice
To explore the importance of Rho GTPase signaling in
the regulation of lens development, growth, and func-
tion, we have generated a transgenic mouse model in
which Rho GTPase function has been targeted by
tissue-specific expression of C3-exoenzyme in the
ocular lens. C3-exoenzyme from Clostridium botuli-
num specifically and irreversibly inactivates Rho GTP-
ase (A, B, and C isoforms) through ADP-ribosylation
(Dillon and Feig, 1995; Rubin et al, 1988; Yamamoto et
al, 1993), generating ADP-ribosylated Rho GTPase,
which can behave in a dominant negative manner by
competing for downstream effector molecules
(Yamamoto et al, 1993). The mouse ␣A-crystallin
promoter was used to drive C3-exoenzyme expres-
sion in the lens. This promoter, the expression of
which is confined mainly to lens fibers, has been used
extensively to drive expression of various transgenes
in the lens (Lovicu and Overbeek, 1998; Robinson et
al, 1995; Stolen et al, 1997; Wawrousek et al, 1990).
Three transgenic lines designated ODO4-11, 16, and
21 were established using the plasmid construct de-
picted in Figure 1.
Expression and Functional Integrity of Transgene
Protein Product
Expression of C3-exoenzyme mRNA was confirmed
by RT-PCR analysis of total lens RNA extracted from
3-week-old mice for line ODO4-11; and for line ODO4-
21, single lenses obtained from 4-day and 6-week-old
Figure 2.
Expression of C3 transgene product. A, Total RNA extracted from a single pair
or from pooled lenses from wild-type littermate controls and from OD04-11,
ODO4-16, and ODO4-21 transgene-positive mice was used for RT-PCR
analysis using C3-specific primers. Lanes 1 to 7 represent the following: 1,
wild-type littermate lens; 2, ODO4-11 mouse lens; 3, ϪRT control to ODO4-11
lens sample; 4, ODO4-21 mouse lens; 5, ODO4-16 mouse lens; 6, nonlenticular
ocular tissues of line ODO4-11; and 7, GADPH expression in nonlenticular
ocular tissues of line ODO4-11 mouse. The expected 316-bp fragment was
observed in line ODO4-11 and ODO4-21 lenses (lanes 2 and 4, respectively)
but not in line ODO4-16 (lane 5) or in wild-type littermate lenses (lane 1). C3
transgene expression was found to be lens specific and showed no expression
in nonlenticular ocular tissues (lane 6). Lane M indicates base pair marker. B,
Expression of RhoA and RhoB in lenses of wild-type (lanes 1 and 2,
respectively), transgenic line ODO4-11 (lanes 3 and 4), and line ODO4-21 mice
(lanes 5 and 6). Lane 7 indicates ϪRT control. Lane M is base pair marker.
These data indicate that RhoA and RhoB expression were not affected by the
C3 transgene in line ODO4-11 and ODO4-21 mice.
Figure 1.
A, Structure of the ␣A/C3 transgene. Bacterial C3 cDNA (coding region)
containing a eukaryotic translation initiation sequence was subcloned into the
polylinker region of the CPV2 plasmid between the ␣A-crystallin promoter and
the SV40 small t antigen intron and polyadenylation sequences. The locations
of primers used for screening genomic tail DNA and for RT-PCR analysis are
shown in hatched and solid arrows, respectively. B, Sequence of the
oligonucleotide representing the eukaryotic translation initiation site (large
caps) inserted upstream of the C3 coding sequence (small caps). ␣Ap ϭ
␣A-crystallin promoter; ETIS ϭ Eukaryotic translation initiation sequence; pA
ϭ Polyadenylation.
232 Laboratory Investigation • February 2002 • Volume 82 • Number 2

Rho GTPase and Lens Growth
positive RT reaction. Both C3 transgenic and wild-
type lenses showed normal expression of RhoA and
RhoB as confirmed by RT-PCR analysis (Fig. 2B).
To demonstrate the presence of the transgene
protein product, lenses from neonatal mice (lines
ODO4-11 and ODO4-21) were isolated and homoge-
nized, and the homogenates were subjected to SDS-
PAGE analysis and Western blotting using a monoclo-
eny of line ODO4-16 revealed no obvious phenotype
and eyes appeared normal. This is consistent with the
failure to detect expression of C3 in RT-PCR analysis
in ODO4-16 mice. Line ODO4-21 mice that had severe
ocular phenotype (both males and females) including
cataract and ocular hemorrhage, failed to breed after a
couple of progeny and could not be maintained. On
the other hand, all line ODO4-11 C3-positive mice
were males, bilaterally microphthalmic, and catarac-
tous with ocular hemorrhage. Notably, the percentage
of male progeny in line ODO4-11 was consistently low
(only around 20%) as compared with wild-type mice
(50%). Although C3 transgenic mice have a normal
growth rate and no other phenotype, the inability to
breed line ODO4- 21 and the consistently lower per-
centage of males that are always C3 positive in line
ODO4-11 suggest some systemic stress in these
mice. Weights (mg) of whole eye obtained from 6- to
10-month-old mice (22.83 Ϯ 1.11, n ϭ 14 wild type
versus 12.35 Ϯ 0.448, n ϭ 13, C3 mice) and lens
weights obtained from 6-week-old mice (5.08 Ϯ 0.405
wild type n ϭ 8 vs 2.76 Ϯ 0.44 n ϭ 7, C3) were
reduced by 50% in C3 mice (ODO4-11) as compared
with littermate controls. For line ODO4-21 mice, there
was not enough sample number available for these
measurements.
nal
antibody
raised
against
C3-exoenzyme
(Yamamoto et al, 1993) kindly provided by Shunji
Kozaki, Department of Veterinary Science, University
of Osaki Prefecture, Japan. The antibody recognized a
single protein of Ϸ25 kd in the transgenic samples
(mostly in the insoluble fractions) but not in the normal
littermate controls (Fig. 3A). In older lenses it migrated
as a doublet of approximately 50 kd (data not shown).
To confirm the functional integrity of the C3-
exoenzyme expressed in the transgenic lenses, in vitro
ADP-ribosylation assays were performed using
[
32P]NAD. A 26-kd ADP-ribosylated protein corre-
sponding to Rho was detected in wild-type control
samples and was markedly reduced in transgenic
samples, indicating that most of the Rho GTPase
protein was already endogenously ADP ribosylated by
transgenically produced C3-exoenzyme (Fig. 3B).
Ocular Phenotypes of C3 Transgenic Mice
Histologic Changes in C3 Transgenic Mice
The ODO4-11 and ODO4-21 founder mice and their
progeny exhibited severe ocular abnormalities includ-
ing cataract, microphthalmia, and ocular hemorrhage
evident as early as embryonic day 15. These effects
are shown in 6-week-old mice (ODO4-21) by slitlamp
photography in Figure 4. The cataracts appear to be
cortical in nature. There was variability in the severity
of these effects, for example, microphthalmia was not
present in all affected animals and was not always
bilateral in line ODO4-21, whereas line ODO4-11 mice
consistently show bilaterally smaller eyes. In many
instances dilation of the pupils of the transgenic mice
was very limited when compared with littermate wild-
type mice (Fig. 5a, panels C and D). Compared with
lines ODO4-11 and ODO4-21, the founder and prog-
To evaluate early changes in developing C3 lenses,
histologic analysis was performed using eyes from
embryonic, neonatal, and postnatal mice (Fig. 5, a and
b). Embryonic lens sections (E15.5) exhibited abnor-
mal primary fiber cell organization and shorter fiber
lengths, with accumulation of vacuoles and gaps
between the cells (Fig. 5a, panel E, and Fig. 5b, panel
D); lens size was also much smaller than controls.
Neonatal (4 day old) C3 lenses showed abnormal fiber
cell organization and frequently a ruptured posterior
capsule (Fig. 5a, panel F). Although the secondary
fibers close to the equatorial region appeared to be
quite normal, the organization of the primary fibers
was very different from the littermate controls. Fiber
Figure 3.
A, Detection of C3 protein by Western blot analysis. Although homogenates obtained from wild-type lens (lane 1) showed no immunoreactivity to C3 monoclonal
antibody, lens homogenates obtained from line ODO4-11 (lane 2) and line ODO4-21 (lane 3) C3 mice showed a immunopositive band (Ϸ25 kDa). B, To test the
functional integrity of the C3 protein, lens homogenates from transgenic and wild-type littermates were subjected to in vitro ADP-ribosylation of Rho GTPase by
exogenous C3-exoenzyme. Lane 1 is a control in which the C3-exoenzyme was absent. As compared with a wild-type sample (lane 2), transgenic lens homogenate
obtained from line ODO4-21 mice showed a very weak in vitro ADP-ribosylated band (lane 3), indicating that most of the Rho GTPase had already been ribosylated
by the endogenous C3 produced transgenically, suggesting its in vivo inactivation. The lower dark band is derived from the unbound radiolabeled compound.
Laboratory Investigation • February 2002 • Volume 82 • Number 2 233

Rao et al
Figure 4.
Ocular phenotypes of C3 transgenic mice. The eyes of 6-week-old mice were dilated with 1% tropicamide and 2.5% phenylephrine hydrochloride, and pictures were
recorded with a slitlamp biomicroscope. As compared with wild-type control (A), the transgenic animals developed severe lenticular opacity or cataract (B–D),
microphthalmia (C), and intraocular hemorrhage (D). Animals from both lines OD04-11 and OD04-21 exhibited these phenotypes, whereas line OD04-16 animals
showed no cataract, microphalmia, or ocular hemorrhage (data not shown). Photographs shown here are from line ODO4-21 mice.
cells in C3 lenses were swollen and shorter than the
wild type (Fig. 5b, panel E). C3 mice at postnatal day
12 (Fig. 5a, panel G) exhibited a severe degeneration
of lens structure, with accumulation of large vacuoles
and abnormal fiber cell organization at the equatorial
and posterior regions close to the capsule. Frequently
there was rupture of the posterior capsule with exten-
sive leakage of lens material into the vitreous as seen
in Figure 5a, panels G and H. In most of the C3 lenses
in both lines ODO4-11 and ODO4-21, the effect of C3
was greatest at the equatorial and posterior subcap-
sular region with severe vacuolization and abnormal
fiber cell organization. The epithelium in general was
found to be quite normal even in adult lenses. In
12-day-old lenses, fiber cell disorganization was as-
sociated with accumulation of nuclei in the posterior
and center of the lens (Fig. 5b, panel F). Six-week-old
lenses were grossly degenerated with ruptured cap-
sule and severe vacuolization throughout the lens.
Figure 5b illustrates the histologic changes in C3
transgenic mice at higher magnification. Interestingly,
the anterior capsule of C3 mice (ODO4-11) was no-
ticeably much thicker (13.1 Ϯ 0.807 ␮m, n ϭ 16) than
in the wild type (5.5 Ϯ 0.208 ␮m, n ϭ 16), and this
abnormality is especially prominent in older lenses
(Fig. 6). Although samples for line ODO4-21 were
limited, three independent samples obtained from
mice older than 6 months consistently showed thicker
capsules than corresponding littermate controls simi-
lar to line ODO4-11 mice.
In both lines 0D04-11 and 0D04-21 mice, histologic
abnormalities were also observed in ocular tissues
other than the lens. In many specimens, there ap-
peared to be synechiae, in which the iris was fused to
either the cornea or lens. This may explain the failure
of the iris to dilate well in response to chemical agents.
Similarly, in many C3-positive mice (both lines), the
retina was attached to the posterior of the lens and
found to be swollen and undifferentiated as compared
with controls as shown in Figure 5a, panel H. Further-
more, some of the eyes from C3 mice (both lines)
showed severe hemorrhage with accumulation of
erythrocytes in the vitreous and/or the aqueous cham-
bers of the eye (Fig. 5a, panel F, indicated with
arrows). Electron microscopic analysis was under-
taken to determine the source of the bleeding. Several
obvious changes in the vessel walls within the poste-
rior hyaloid membrane were found (Figs. 7 and 8). In
vessels of eyes in which hemorrhage was less severe
and only moderate numbers of erythrocytes and mac-
rophages were present in the vitreous body, the
vascular wall adjacent to the lens capsule was mark-
edly thinned (Fig. 7). These vessels often contained
thrombocytes. In eyes with severe hemorrhage, the
whole vitreous cavity was filled with erythrocytes (Fig.
8). Between the erythrocytes, many macrophages
were observed that often contained phagocytosed
erythrocytes (Fig. 8, A and B). By electron microscopy,
separation of endothelial cells and larger openings of
the vascular wall were frequently observed in the
234 Laboratory Investigation • February 2002 • Volume 82 • Number 2

Rho GTPase and Lens Growth
Figure 5b.
Discussion
Data presented in this study demonstrate that the
selective inhibition of Rho GTPase in the developing
lens impairs lens growth and integrity, suggesting the
importance of Rho GTPase signaling in maintaining
lens transparency and growth.
Figure 5a.
a, Histologic changes in C3 transgenic mouse eyes. Whole eyes from wild-type
littermates (A to D) and age-matched transgenic mice, embryonic (E15.5) (E),
4 day (F), 12 day (G), and 6 week (H) were fixed in glutaraldehyde as described
in “Materials and Methods.” Sections were stained with hematoxylin and eosin.
As the figure demonstrates, progressive degenerative histologic changes were
observed in the C3 eyes beginning during embryogenesis. In eyes from
neonatal and juvenile transgenic animals, such changes included ruptured lens
capsule, severe vacuole accumulation, impaired fiber elongation and differen-
tiation, and presence of nuclei in differentiated lens fibers. Arrows in panel F
indicate hemorrhage in C3 transgenic eye. b, Histologic changes in C3 mouse
lenses at higher magnification. Sections from the regions indicated with stars in
Figure 5a were viewed at higher magnification to depict the abnormal changes in
fiber cell organization, elongation, and differentiation. A to C and D to F are from
control and transgenic samples, respectively, from E15.5, day 4, and day 12 mice.
Arrows in panel F depict the presence of nuclei in fiber cells, indicating abnormal
terminal differentiation. Data shown here are from line ODO4-21 mice, and similar
changes were observed in line ODO4-11 mice (data not shown).
Lens fiber cell differentiation and elongation appear
grossly impaired in C3 transgenic mice (Fig. 5, a and
b). The Rho family of small GTPases (Rho, Rac, and
CDC42) has been implicated in regulating various
aspects of cytoskeletal reorganization. The three iso-
forms of Rho (RhoA, RhoB, and RhoC) regulate orga-
nization of the actin cytoskeleton through multiple
mechanisms, including modulation of activities of
phosphatidyl inositol phospholipid kinases, myosin
light chain phosphatase, LIM kinase, CP1-17, and
cofilin phosphorylation (Hall, 1998; Kaibuchi et al,
1999; Uehata et al, 1997). Rho GTPases mediate their
effects through serine/threonine kinases such as the
Rho kinases (Aelst and D’Souza-Schorey, 1997; Hall,
1998; Kaibuchi et al, 1999; Uehata et al, 1997). We
have demonstrated endogenous expression of both
Rho GTPase (Maddala et al, 2001a; Rao et al, 1997a)
and regulatory factors for Rho GTPase, including the
Rho GAPs, Rho GEFs, Rho GDI, and Rho kinases in
lens (our unpublished data). The activity of Rho GTP-
vessels of the posterior hyaloid membrane (Fig. 8, C
and D). These openings were not plugged by throm-
bocytes but contained fine fibrillar material. Erythro-
cytes that appeared to leak through the openings were
phagocytosed by macrophages that were regularly
observed in the immediate vicinity (Fig. 8, C and D).
Laboratory Investigation • February 2002 • Volume 82 • Number 2 235

Rao et al
Figure 6.
Changes in lens capsule thickness in C3 transgenic mice. Anterior capsule of line
ODO4-11 C3 transgenic lenses (B) was thickened dramatically in the older animals
(6 months and older) as compared with littermate controls (A). Older ODO4-21
mice were not available to examine these changes. LC ϭ Lens capsule.
Figure 7.
ases in the transgenic mice lenses seemed to be
decreased by 50% or more based on the in vitro
ADP-ribosylation of lens homogenates mediated by
C3-exoenzyme (Fig. 3B). Most of this inactivation was
likely associated with lens fiber Rho GTPases because
the ␣A-crystallin promoter used to drive the C3 ex-
pression is specific to lens fibers (Overbeek et al,
1985; Wawrousek et al, 1990). The generally normal
appearance of the lens epithelium in the C3 mice
suggest lack of expression of the transgene in these
cells. The ␣A-crystallin promoter used in this study is
known to be expressed no earlier than E11.5 (Over-
beek et al, 1985), and therefore, in early developmen-
tal stages lens fiber cell elongation would not be
expected to affect C3 transgenic mice.
In contrast to the inherent limitations of cell culture
systems, the C3 transgenic mouse developed in this
study represents a tractable in vivo model for studying
the contribution of Rho GTPase signaling pathways
participating in lens development and growth. Further-
more, the lens system itself provides distinct advan-
tages in terms of the simplicity of cellular composition
and its avascular nature. C3-exoenzyme has previ-
ously been expressed in the thymus using a tissue-
specific promoter demonstrating the critical role of
Rho GTPase function in the development of thymus
(Henning et al, 1997). Expression of C3 in the lens
suggests a definite role for Rho GTPase in the regu-
lation of growth, differentiation, and functional integ-
rity of this organ. Disorganization and vacuolization of
fiber cells and the presence of nuclei in differentiated
fibers suggests impaired fiber cell differentiation. Con-
sistent with our hypothesis, lens-specific expression
of the dbl oncogene product, which can function as an
exchange factor for Rho GTPases in vitro, has been
previously shown to induce cataract formation and im-
pair lens fiber cell elongation and differentiation (Eva et
al, 1991). Furthermore, another Rho GTPase regulatory
protein, Rho GAP6, has been localized to a chromo-
somal region linked to microphthalmia (Schaefer et al,
1997). The preceding observations, together with the
Electron microscopy of a posterior hyaloid vessel in a C3 transgenic (ODO4-
21) embryo (E17.5) with moderate intraocular hemorrhage (bar is 1.26 ␮m).
The vascular wall adjacent to the lens capsule (Ca) is markedly thinned in a
distinctly localized area (large arrow). Le ϭ Lens; Er ϭ Erythrocyte.
data presented in this study, suggest an important role
for Rho GTPases in regulation of developmental pro-
cesses in the lens. The possibility that perturbation of the
actin cytoskeleton is a factor in these C3-exoenzyme–
mediated effects is under investigation.
Although the posterior lens capsule is ruptured in
many of the C3 mice (Fig. 5a, G and H), the anterior
capsule is markedly thickened, particularly in older
animals (Fig. 6); whether this is caused by changes in
basal lamina proteins of the capsule is not known.
Interestingly, transgenic mice expressing diphtheria
toxin in the lens have also been reported to exhibit
ruptured capsules (Breitman et al, 1990; Harrington et
al, 1991) as do mice deficient in SPARC/osteonectin.
In the latter situation, there were no changes in the
major basal lamina proteins laminin, collagen, perle-
can, or entactin (Gilmour et al, 1998).
Microphthalmia is commonly manifested in trans-
genic mouse models harboring defects of growth
factor biology or cell cycle regulation (Fromm et al,
1994; Lovicu and Overbeek, 1998). The C3 mice
frequently had unilateral or bilateral microphthalmia;
the reasons for this heterogeneity are not clear at
present. A similar heterogeneity was observed in
transgenic mice expressing diphtheria toxin in the
lens, and the microphthalmia was attributed to defec-
tive lens development, suggesting that normal lens
development is critical for normal development of the
entire eye (Beebe and Coats, 2000; Breitman et al,
1990; Harrington et al, 1991). It is unclear whether the
extralenticular defects seen in C3 mice, including
synechiae and hemorrhage, are direct effects of Rho
GTPase inactivation in these tissues because of C3
leakage from the lens or are secondary to other effects
on the lens. Because C3 expression was not detected
in ocular tissues except for the lens, leakage from the
236 Laboratory Investigation • February 2002 • Volume 82 • Number 2

Rho GTPase and Lens Growth
Figure 8.
Light (A and B) and electron microscopy (C and D) of posterior hyaloid vessels in a C3 transgenic (ODO4-21) embryo (E15.5) with severe ocular hemorrhage. A and
B, bar is 8.4 ␮m. In eyes with severe hemorrhage, the whole vitreous cavity is filled with erythrocytes. Between the erythrocytes, many macrophages are observed
that contain phagocytosed erythrocytes (arrows). C and D, The endothelial cells of the vessels are separated from each other and form large openings towards both
lens capsule and the vitreous cavity (arrows) (bar is 1.4 ␮m). Le ϭ Lens; Ca ϭ Capsule; Er ϭ Erythrocytes; Ma ϭ Macrophage. Asterisk indicates phagocytosed
erythrocytes.
lens is probably responsible for these changes. Alter-
natively, defective lens development by itself could be
responsible for abnormalities elsewhere in the eye
(Beebe and Coats, 2000; Thut et al, 2001). Secretion
of C3-exoenzyme from the lens is unlikely because the
C3 transgene used in this study does not contain
the signal peptide required for secretion. Intriguingly,
the hemorrhagic phenotype found in C3 mice seems
to be unique and has not been reported in other
animal models of cataract (Fig. 5a, panel F, and Fig. 8).
Rho GTPase has been implicated in endothelial cell
migration and contraction and thereby may regulate
gap formation between cell junctions (Aepfelbacher et
al, 1997; Essler et al, 1998; Vouret-Craviari et al, 1998).
Furthermore, Rho GTPase signaling has also been
shown to interact with G␣12 and G␣13 signaling,
thereby regulating vascular endothelial cell integrity
and wound repair (Offermanns et al, 1997). It is pos-
sible that the cell-cell junctions and the actin-myosin
system that maintain the integrity of the endothelial
barrier of hyaloid vessels are impaired by C3-
mediated reactions, resulting in movement of erythro-
cytes into extracellular spaces (Figs. 7 and 8).
In conclusion, the present study demonstrates that
Rho GTPase is important in regulating lens growth and
development and in maintaining lens transparency.
We speculate that the histologic changes associated
with lens fiber and capsule integrity might be directly
related to Rho GTPase-regulated actin cytoskeletal
organization and focal adhesions. Furthermore, this
C3 transgenic mouse should serve as an important
model for investigating the effects of Rho GTPase
Laboratory Investigation • February 2002 • Volume 82 • Number 2 237

Rao et al
signaling in vivo on lens fiber cell cytoskeletal reorga-
nization and terminal differentiation. Such studies are
currently in progress.
lulose and immunoblotted for C3-exoenzyme using a
monoclonal antibody and ECL peroxidase system
(Amersham, Arlington Heights, Illinois).
Materials and Methods
In Vitro ADP-Ribosylation
Generation of C3-Exoenzyme Transgenic Mice
C3-exoenzyme–catalyzed ADP-ribosylation of Rho
GTPase was performed as described by Rao et al
(1997b). Lens samples were homogenized in ice-cold
5 mM Tris buffer, pH 7.4, containing 5 mM MgCl2, 1 mM
EDTA, 1 mM dithiothreitol, 0.5 mM PMSF, 1 ␮g/ml
aprotinin, and 1 ␮g/ml leupeptin. The 700 ϫg super-
natants were subjected to the ADP-ribosylation assay.
Briefly, the assay was performed in a final volume of
0.1 ml containing 100 mM Tris, pH 8.0, 2.5 mM MgCl2,
1.0 mM EDTA, 10 mM thymidine, 10 mM dithiothreitol, 1
mm ATP, 0.1 mM GTP, 1 ␮Ci [32P]NAD (1000 Ci/
mmolϪ1; DuPont-New England Nuclear, Boston,
Massachusetts), and 50 ␮g of lens protein. The assay
was initiated by addition of 1 ␮g of C3-exoenzyme
(Calbiochem, San Diego, California); after a 60-minute
incubation at 37° C, it was stopped by addition of 11
␮l of ice-cold TCA (70% v/v). TCA precipitates were
dissolved in Laemmli sample buffer and then sub-
jected to SDS-PAGE (12.5%). ADP-ribosylated pro-
teins were detected by autoradiography.
A C3-exoenzyme (Botulinum C3 ADP-ribosyltransferase)
expression vector (pGEX T2-C3) was kindly provided by
Dr. Larry Feig from Tufts University Medical School
(Dillon and Feig, 1995). The cDNA insert (truncated 616
bp) encoding C3-exoenzyme was released from this
parental expression plasmid using Sau3AI and NlaIII
restriction enzymes. A synthetic oligonucleotide contain-
ing the remainder of the missing coding sequence of
mature C3 (36 bp), plus a eukaryotic translation initiation
sequence CCACCATG, was added (Fig. 1B). This se-
quence, encoding mature C3 (652 bp without the signal
peptide sequence), was ligated into the polylinker (ClaI
and HindIII sites) of CpV2, a plasmid vector carrying a
modified version of the murine ␣A-crystallin promoter
separated by a polylinker from the SV40 small t antigen
intron and polyadenylation sequence. After confirming
the orientation and sequence of the C3 cDNA insert by
dideoxy sequencing, the transgene DNA fragment was
released by NotI digestion and purified by agarose gel
electrophoresis. Microinjection of the transgene into
single-celled FVB/N mouse embryos and subsequent
generation of transgenic mice was performed as
described earlier (Wawrousek et al, 1990). Trans-
genic mice were identified by PCR analysis of
genomic DNA isolated from tail biopsy specimens
using the following primers: CCGAGCTGAGCATA-
GACATT and TAACTCCTTATTTTTGTCTTAGC.
Histologic Analysis
Tissues for histologic analysis, which included heads
of embryos (E15.5) or whole eyes of postnatal animals,
were immersed in 2.5% glutaraldehyde in 50 mM
cacodylate buffer (pH 7.2) containing 4% sucrose and
2 mM CaCl2 for 2 hours, then transferred to 10%
buffered formalin for another 48 hours or more. They
were then embedded in methacrylate, cut into 1- to
2-␮m sections, and stained with hematoxylin and
eosin using conventional methods.
RT-PCR
Total RNA was extracted from a single pair or from
four to six pooled lenses using the Qiagen RNeasy
mini kit (QIAGEN, Valencia, California). DNase-1–
treated total RNA was reverse transcribed using an
RT-PCR kit (Clontech, Palo Alto, California). cDNA
generated from the RT reaction was used as template
to amplify C3 transgene, RhoA, and RhoB mRNAs using
the following 5'-specific and 3'-specific primers of C3,
RhoA, RhoB, and GAPDH, respectively: C3.1 (AAGCAA-
AAGCTTGGGGTAATGC) and C3.2 (TTTAGCCTTTTCA-
AAAGCCGTTTTAT); RhoA (TGAAAACTATGTGGCG-
GATATCG and TCTGCTTCTTCAGGTTTAACCGG);
RhoB (AGGACTACGATCGTTTACGGCC and CAGC-
CATTCTGGGATCCGTAG); GAPDH (ACCACAGTCCAT-
GCCATCAC and TCCACCACCCTGTTGCTGTA).
Electron Microscopy
Heads from E15.5 and E17.5 transgenic embryos with
obvious ocular hemorrhage and from wild-type litter-
mates were immersed overnight in 2.5% glutaralde-
hyde in 50 mM cacodylate buffer (pH 7.2) containing
4% sucrose and 2 mM CaCl2. After fixation, the eyes
were washed for at least 24 hours in cacodylate buffer,
postfixed with 2% osmium tetroxide, and embedded
in Epon (Roth, Karlsruhe, Germany). Ultrathin sections
were cut on a microtome, contrasted with lead citrate
and uranyl acetate, and viewed with a Zeiss EM 902
electron microscope (Zeiss, Oberkochen, Germany).
Acknowledgements
SDS-PAGE and Western Blot Analysis
The authors are very thankful to Drs. Larry Feig for
providing pGEX2T-C3 plasmid, Shunji Kozaki for anti–
C3-exoenzyme monoclonal antibody, and A. Cvekl
and Joram Piatigorsky for the ␣A-crystallin promoter.
We thank Dr. Gordon Klintworth for his suggestions
and Dr. Rupalatha Maddala for technical help. We are
also grateful to Ms. Anke Fischer and Mr. Marco
GoBwein for technical help with electron microscopy.
For SDS-PAGE analysis and immunoblotting, suitable
aliquots of lens homogenates were dissolved in 65 mM
Tris buffer, pH 7.4, containing 2% SDS and 2%
␤-mercaptoethanol and separated on 12.5% acryl-
amide gels according to the method of Laemmli
(1970), using a Hoefer Mighty Small apparatus. Pro-
teins were electrophoretically transferred to nitrocel-
238 Laboratory Investigation • February 2002 • Volume 82 • Number 2

Rho GTPase and Lens Growth
McAvoy JW (1978). Cell division, cell elongation, and the
coordination of crystallin gene expression during lens mor-
phogenesis in the rat. J Embryol Exp Morphol 45:271–281.
References
Aelst IV and D’Souza-Schorey CD (1997). Rho GTPases and
signaling network. Genes Dev 11:2295–2322.
Offermanns S, Mancino V, Revel JP, and Simon MI (1997).
Vascular system defects and impaired cell chemokinesis as a
result of Galpha13 deficiency. Science 275:533–536.
Aepfelbacher M, Essler M, Huber E, Sugai M, and Weber PC
(1997). Bacterial toxins block endothelial wound repair: Evi-
dence that Rho GTPases control cytoskeletal rearrange-
ments in migrating endothelial cells. Arterioscler Thromb
Vasc Biol 17:1623–1629.
Overbeek PA, Chepelinsky AB, Khillan JS, Piatigorsky J, and
Westphal H (1985). Lens-specific expression and develop-
mental regulation of the bacterial chloramphenicol acetyl-
transferase gene driven by the murine ␣A-crystallin promoter
in transgenic mice. Proc Natl Acad Sci USA 82:7815–7819.
Beebe DC and Coats J M (2000). The lens organizes the
anterior segment: Specification of neural crest cell differen-
tiation in the avian eye. Dev Biol 220:424–431.
Piatigorsky J (1981). Lens differentiation in vertebrates: A
review of cellular and molecular features. Differentiation
19:134–153.
Breitman ML, Rombola H, Maxwell IH, Klintworth GK, and
Berntein A (1990). Genetic ablation in transgenic mice with an
attenuated diphtheria toxin a gene. Mol Cell Biol 10:474–
479.
Rao PV, Robison WG, Bettelheim F, Lin LR, Reddy VN, and
Zigler JS (1997a). Role of small GTP-binding proteins in
lovastatin-induced cataract. Invest Ophthalmol Vis Sci 38:
2313–2321.
Dillon ST and Feig LA (1995). Purification and assay of recom-
binant C3 transferase. Methods Enzymol 256:174–183.
Essler M, Amano M, Kruse HJ, Kaibuchi K, Weber PC, and
Aepfelbacher M (1998). Thrombin inactivates myosin light
chain phosphatase via Rho and its target Rho kinase in
human endothelial cells. J Biol Chem 273:21867–21874.
Rao PV, Zigler JS, and Garland D (1997b). Analysis of small
GTP-binding proteins of the lens by GTP overlay assay
reveals the presence of unique GTP-binding proteins asso-
ciated with fiber cells. Exp Eye Res 64:219–227.
Eva A, Graziani G, Zannini M, Merin LM, Khillan JS, and
Overbeek PA (1991). Dominant dysplasia of the lens in
transgenic mice expressing the dbl oncogene. New Biol
3:158–168.
Robinson ML, Overbeek PA, Verran DJ, Grizzle WE, Stockard
CR, Friesel R, Maciag T, and Thompson JA (1995). Extracel-
lular FGF-1 acts as a lens differentiation factor in transgenic
mice. Development 121:505–514.
Fromm L, Shawlot W, Gunning K, Butel JS, and Overbeek PA
(1994). The retinoblastoma protein-binding region of simian
virus 40 large T antigen alters cell cycle regulation in lenses of
transgenic mice. Mol Cell Biol 14:6743–6754.
Rubin EJ, Gill DM, Boquet P, Popoff MR (1988). Functional
modification of a 21-kilodalton G protein when ADP-
ribosylated by exoenzyme C3 of Clostridium botulinum. Mol
Cell Biol 8:418–426.
Hall A (1998). Rho GTPases and the actin cytoskeleton.
Science 279:509–514.
Schaefer L, Prakash S, and Zoghbi HY (1997). Cloning and
characterization of a novel rho-type GTPase-activating pro-
tein gene (ARHGAP6) from the critical region for microphthal-
mia with linear skin defects. Genomics 46:268–277.
Harrington L, Klintworth GK, Sector TE, and Breitman ML
(1991). Developmental analysis of ocular morphogenesis in
alphaA-crystallin/diphtheria toxin transgenic mice undergo-
ing ablation of the lens. Dev Biol 148:508–516.
Stolen CM, Jackson MW, and Griep AE (1997). Overexpres-
sion of FGF-2 modulates fiber cell differentiation and survival
in the mouse lens. Development 124:4009–4017.
Henning W, Galandrini R, Hall A, and Cantrell DA (1997). The
GTPase Rho has a critical regulatory role in thymus develop-
ment. EMBO J 16:2397–2407.
Thut CT, Rountree RB, Hwa M, and Kingsley DM (2001). A
large-scale in situ screen provides molecular evidence for the
induction of eye anterior segment structures by the develop-
ing lens. Dev Biol 231:63–76.
Gilmour DT, Lyon GJ, Carlton MBL, Sanes JR, Cunningham
JM, Anderson JR, Hogan BL, Evans MJ, and Colledge WH
(1998). Mice deficient for the secreted glycoprotein SPARC/
osteonectin/BM40 develop normally but show severe age-
onset cataract formation and disruption of the lens. EMBO J
17:1860–1870.
Uehata M, Ishizaki T, Satoh H, Ono T, Kawahara T, Morishita
T, Tamakawa H, Yamagami K, Inui J, Maekawa M, and
Narumiya S (1997). Calcium sensitization of smooth muscle
mediated by a Rho-associated protein kinase in hyperten-
sion. Nature 389:990–994.
Kaibuchi K, Kuroda S, and Amano M (1999). Regulation of
the cytoskeleton and cell adhesion by the Rho family GT-
Pases in mammalian cells. Ann Rev Biochem 68:459–486.
Vouret-Craviari V, Boquet P, Pouyssegur J, and Van
Obberghen-Schilling E (1998). Regulation of the actin cy-
toskeleton by thrombin in human endothelial cells: Role of
Rho proteins in endothelial barrier function. Mol Biol Cell
9:2639–2653.
Laemmli UK (1970). Cleavage of structural proteins during
the assembly of the head of bacteriophage T4. Nature
227:680–685.
Wawrousek EF, Chepelinsky AB, McDermott JB, Piatigorsky
J (1990). Regulation of the murine alphaA-crystallin promoter
in transgenic mice. Dev Biol 137:68–76.
Lovicu FJ and Overbeek PA (1998). Overlapping effects of
different members of the FGF family on lens fiber differenti-
ation in transgenic mice. Development 125:3365–3377.
Yamamoto M, Marui N, Sakai T, Morii N, Kozaki S, Ikai K,
Imamura S, and Narumiya S (1993). ADP-ribosylation of the
rhoA gene product by botulinum C3 exoenzyme causes
Swiss 3T3 cells to accumulate in the G1 phase of the cell
cycle. Oncogene 8:1449–1455.
Maddala RL, Peng YW, and Rao PV (2001a). Selective
expression of the small GTPase RhoB in the early developing
mouse lens. Dev Dynamics 222:534–537.
Maddala RL, Reddy VN, and Rao PV (2001b). Lovastatin-
induced cytoskeletal reorganization in lens epithelial cells: Role
of Rho GTPases. Invest Ophthalmol Vis Sci 42:2610–2615.
Laboratory Investigation • February 2002 • Volume 82 • Number 2 239