An unexpected vestigial protein complex reveals the evolutionary origins of an s-triazine catabolic enzyme

Article abstract of DOI:10.1074/jbc.RA118.001996

Cyanuric acid is a metabolic intermediate of s-triazines, such as atrazine (a common herbicide) and melamine (used in resins and plastics). Cyanuric acid is mineralized to ammonia and carbon dioxide by the soil bacterium Pseudomonas sp. strain ADP via three hydrolytic enzymes (AtzD, AtzE, and AtzF). Here, we report the purification and biochemical and structural characterization of AtzE. Contrary to previous reports, we found that AtzE is not a biuret amidohydrolase, but instead it catalyzes the hydrolytic deamination of 1-carboxybiuret. X-ray crystal structures of apo AtzE and AtzE bound with the suicide inhibitor phenyl phosphorodiamidate revealed that the AtzE enzyme complex consists of two independent molecules in the asymmetric unit. We also show that AtzE forms an 22 heterotetramer with a previously unidentified 68-amino acid-long protein (AtzG) encoded in the cyanuric acid mineralization operon from Pseudomonas sp. strain ADP. Moreover, we observed that AtzG is essential for the production of soluble, active AtzE and that this obligate interaction is a vestige of their shared evolutionary origin. We propose that AtzEG was likely recruited into the cyanuric acid–mineralizing pathway from an ancestral glutamine transamidosome that required protein–protein interactions to enforce the exclusion of solvent from the transamidation reaction.

Full text of DOI:10.1074/jbc.RA118.001996

JBC Papers in Press. Published on March 9, 2018 as Manuscript RA118.001996
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.RA118.001996
An unexpected vestigial protein complex reveals the evolutionary origins of an s-triazine
catabolic enzyme
Lygie Esquirol*1,2, Thomas S. Peat*3, Matthew Wilding2,3, Jian-Wei Liu1, Nigel G. French1,
Carol J. Hartley1, Hideki Onagi2, Thomas Nebl3, Christopher J. Easton2, Janet Newman3,
Colin Scott1,4
From: 1 Biocatalysis and Synthetic Biology Team, CSIRO Land & Water, Canberra, ACT,
Australia; 2 Research School of Chemistry, Australian National University, Canberra, ACT,
Australia; 3 CSIRO Biomedical Manufacturing, Parkville, Melbourne, VIC, Australia;
4Synthetic Biology Future Science Platform, CSIRO Land & Water, Canberra, ACT,
Australia
*Authors contributed equally
To whom correspondence should be addressed: Dr. Colin Scott, CSIRO Land & Water,
Foundation Building, Black Mountain Science and Innovation Park, Canberra, ACT 2601,
Australia. colin.scott@csiro.au
Running Title: Evolution of AtzE, a 1-carboxybiuret hydrolase
Key words: AtzE; biuret hydrolase; atrazine; cyanuric acid
1

strain ADP. This soil bacterium was isolated in
the mid-1990s by Wackett and co-workers (6).
ABSTRACT
Cyanuric acid is a metabolic intermediate of s-
triazines, such as atrazine (a common herbicide)
and melamine (used in resins and plastics).
Cyanuric acid is mineralized to ammonia and
carbon dioxide by the soil bacterium
Pseudomonas sp. strain ADP via three hydrolytic
enzymes (AtzD, AtzE, and AtzF). Here, we report
the purification and biochemical and structural
characterization of AtzE. Contrary to previous
reports, we found that AtzE is not a biuret
amidohydrolase, but instead catalyzes the
hydrolytic deamination of 1-carboxybiuret. X-ray
crystal structures of apo AtzE and AtzE bound
The
atrazine
catabolism
pathway
of
Pseudomonas sp. strain ADP is comprised of six
hydrolases encoded by genes on a self-
transmissible plasmid (pADP1) (5). The upper
pathway (Fig. 1A) is comprised of three
hydrolytic steps: dechlorination, followed by two
sequential N-alkyl chain hydrolyses. The upper
pathway is catalyzed by AtzA (4,7), AtzB (8) and
AtzC (9), respectively; all three enzymes are
metalloenzymes
of
the
amidohydrolase
superfamily (9,10).
The lower pathway from Pseudomonas
sp. strain ADP (Fig. 1B) is also comprised of
three hydrolases: AtzD, AtzE and AtzF. Unlike
the upper pathway, these three enzymes are serine
hydrolases; AtzD is an unusual Ser-Lys hydrolase
and is the archetype of a recently discovered
protein fold (the Toblerone fold; (11,12)), while
AtzE and AtzF are Ser-cisSer-Lys hydrolases
(1,13). The lower pathway progresses via the
AtzD-mediated ring opening of cyanuric acid to
form an unstable product, 1-carboxybiuret, which
is known to spontaneously decarboxylate to
biuret in an aqueous environment (1). It was
therefore thought that the proceeding catabolic
steps consisted of the deamination of biuret by
AtzE to form allophanate, and allophanate
deamination by AtzF to form carbamic acid.
Interestingly, these enzymatic products are
unstable in an aqueous environment and can
undergo spontaneous reactions; allophanate
decarboxylates to urea (14), whilst carbamic acid
decomposes to ammonia and carbon dioxide in
water (13,15). AtzD and AtzF have been
overproduced in heterologous expression
systems, which has allowed them to be studied
biochemically (14-17) and structurally (11-
13,18). However, expression and purification of
AtzE in a heterologous system has been
challenging (1) and structural and biochemical
data had not been obtained previously.
with
the
suicide
inhibitor
phenyl
phosphorodiamidate revealed that the AtzE
enzyme complex consists of two independent
molecules in the asymmetric unit. We also show
that AtzE forms an α2β2 heterotetramer with a
hitherto unidentified 68-amino-acid-long protein
(AtzG) encoded in the cyanuric acid
mineralization operon from Pseudomonas sp.
strain ADP. Moreover, we observed that AtzG is
essential for the production of soluble, active
AtzE and that this obligate interaction is a vestige
of their shared evolutionary origin. We propose
that AtzEG was likely recruited into the cyanuric
acid–mineralizing pathway from an ancestral
glutamine transamidosome that required protein–
protein interactions to enforce the exclusion of
solvent from the transamidation reaction.
INTRODUCTION
The
presence
of
anthropogenic
compounds in the environment provides selection
pressures that can lead to the evolution of new
metabolic pathways (1). One of the most well
studied examples of an evolutionary response by
bacterial to the presence of synthetic xenobiotics
is that of the s-triazines (2). This family of
compounds includes fertilizers (e.g., atrazine and
ametryn), resins and plastics (e.g., melamine),
explosives (e.g., RDX) and disinfectants (e.g.
cyanuric acid). Interestingly, many of the s-
triazine catabolic pathways that have evolved
share a common structure, in which specific
‘upper pathways’ convert different s-triazines to
cyanuric acid (1,3,5-triazine-2,4,6-triol) by
hydrolosis of the three substituents that decorate
the heterocyclic ring (3-5). A common ‘lower
pathway’ then mineralizes cyanuric acid to
carbon dioxide and ammonia.
The lower pathway has a degree of
plasticity in its composition. AtzD can be
replaced by homologs, such as TrzD from
Pseudomonas sp. strain NRRLB-12227 (56 %
identity to AtzD; (16,17)). AtzF is sometimes
substituted by the homologous TrzF found in
Enterobacter cloacae strain 99 (70 % identity to
AtzF; (14)) and AtzE has been replaced with the
non-homologous biuret amidohydrolase (BiuH, a
(/)8 TIM barrel cysteine hydrolase) in
Rhizobium leguminasorum bv. viciae 3841 (Table
1) (1,19).
The best characterized of the bacterial
catabolic pathways that have evolved in response
to s-triazines in the environment is the atrazine
mineralization pathway of Pseudomonas sp.
2

Herein, we describe the purification and
biochemical and structural characterization of
AtzE directly from the model organism
Pseudomonas sp. strain ADP. We show that AtzE
forms a stable α2β2 heterotetramer with a hitherto
unknown small protein, AtzG, which is required
for soluble expression of AtzE. Co-expression of
AtzE and AtzG in E. coli allows, for the first time,
the heterologous over-production of AtzE.
AtzE suggested that the poor expression of AtzE
in E. coli was not due to protein instability.
Purified AtzE had no detectable biuret
aminohydrolase activity under any condition
tested. However, AtzE-mediated ammonia
production was observed when incubated with
cyanuric acid and pure AtzD. This suggested that
the product of cyanuric acid hydrolysis by AtzD,
1-carboxybiuret, was in fact the natural substrate
for AtzE. LCMS was subsequently used to follow
the reactions directly. There was no detectable
biuret amidohydrolase activity with AtzE (Fig.
2A), but it was detected using the biuret
amidohydrolase from a Rhizobium species, BiuH
(19) (Fig. 2B). Moreover, biuret accumulates in
reactions in which cyanuric acid is treated with
AtzD (Fig. 2C), but does not when AtzE is also
included (Fig. 2D), suggesting that AtzE prevents
biuret’s formation via the hydrolytic deamination
of 1-carboxybiuret.
RESULTS
AtzE is a 1-carboxybiuret hydrolase - We
attempted to produce active AtzE recombinantly
in E. coli, but were unsuccessful (consistent with
previous attempts; 1, 18). As heterologous
expression was unsuccessful, we purified native
AtzE from Pseudomonas sp. strain ADP. The
expression of the atzDEF operon is induced under
low nitrogen conditions in the presence of
cyanuric acid (5), and so we cultured
Pseudomonas sp. strain ADP on a minimal
medium and supplied cyanuric acid as the sole
nitrogen source. We were able to detect cyanuric
Steady-state kinetic data for AtzD, AtzE
and the biuret hydrolase were obtained (Table 1).
The product inhibition of AtzD reported
previously (11) was alleviated by the addition of
AtzE, allowing the determination of rates at
concentrations above 0.2 mM cyanuric acid for
the first time. The kinetic parameters determined
for AtzD were found to be: a kcat of 17 s-1, a KM of
350 µM, and a kcat/KM of 4.8 x 104 s-1.M-1. The
steady state kinetic parameters for AtzE were
found to be similar to those of the Rhizobium
biuret amidohydrolase for its physiological
substrate, with a kcat of 16 s-1, a KM of 63 µM, and
a kcat/KM of 2.5 x 105 s-1.M-1 for AtzE, and a kcat of
12 s-1, a KM of 80 µM, and a kcat/KM of 1.5 x 105 s-
1.M-1 for BiuH (Table 1).
acid
amidohydrolase
and
allophanate
amidohydrolase activities in the cell free extracts
(CFE) of these cultures. Cyanuric acid added to
the CFE was mineralized (i.e., 3 molecules of
ammonia were formed for each molecule of
cyanuric acid added). However, we were unable
to detect any biuret hydrolysis.
We were able to detect and follow AtzE
during CFE fractionation and purification by
measuring
ammonia
production
when
supplementing fractions with purified AtzD and
cyanuric acid. Although the cruder samples
during fractionation had high background levels
of ammonia, additional ammonia produced from
cyanuric acid by AtzD and AtzE was
distinguishable from this background. Using
ammonia production as a proxy for enzyme
activity, we were able to isolate 0.125 mg of pure
AtzE per liter of Pseudomonas sp. strain ADP
culture via ammonium sulfate precipitation and
four chromatography steps (Fig. S1A, Suppl.
Table 1).
We also tested AtzE with a number of
potential additional substrates, including the
product of barbituric acid hydrolase (1-
carboxymalonamide), analogs of AtzE’s natural
substrate (1-nitrobiuret and succinamic acid),
structurally related α-amino acids (citrulline,
lysine, glutamine, asparagine and 2-amino-3-
propionic acid) and the biuret analog malonamide
(Table 1, Suppl. Table 2). None of the α-amino
acids were substrates for AtzE, nor was the biuret
analog malonamide (Suppl. Table 2). However,
The mass of the isolated protein was
48,119 Da by mass spectrometry, consistent with
the predicted mass of AtzE, and the fragmentation
pattern obtained by tryptic digest confirmed that
the isolated protein was AtzE. Differential
Scanning Fluorimetry revealed that the melting
temperature (Tm) for AtzE isolated from
Pseudomonas sp. strain ADP was greater than 60
°C. Previous reports had suggested that AtzE
could not be produced in E. coli because of low
stability (1); however, the high Tm of purified
1-carboxymalonamide,
1-nitrobiuret,
and
succinamic acid were all substrates for AtzE with
kcat/KM values of 4.2 x 104, 1.2 x 104 and 3.6 x 104
s-1.M-1, respectively (Table 1; Fig. 3).
LCMS was used to identify that the
product of AtzE-mediated hydrolysis of 1-
carboxymalonamide is 1-carboxymalonamic acid
through hydrolysis of the terminal amine.
Succinamic acid has a terminal amide rather than
3

an ureido group, suggesting that AtzE hydrolyzes
the amide from this substrate in an equivalent
reaction to that of the hydrolysis of 1-
carboxymalonamide. We therefore propose an
update to the cyanuric acid catabolic pathway, in
‘ammonia tunnel’, to a phosphate-activated,
aspartate-charged tRNA in the second active site
(in GatB). Channelling prevents loss of ammonia
and excludes water from the active site of GatB
(22).
which AtzE acts as
a
1-carboxybiuret
AtzG is homologous to the GatC protein
amidohydrolase, producing 1,3-dicaboxyurea and
ammonia (Fig. 1B, Fig. 2D).
in the GatCAB complex and binds AtzE in the
same position as GatC binds GatA in the GatCAB
complex. The function of GatC is to coordinate
the complex by forming appropriate interactions
with both GatA and GatB. AtzG appears to fulfil
a similar role, gluing together the AtzE dimer
resulting in a tightly associated heterotetramer.
According to the program PISA (23), the AtzEG
heterotetramer sequesters over 12,500 Å2 of
buried surface area, giving a ΔG of interaction of
-108 kcal/mol. AtzG has extensive interactions
with both AtzE and the AtzG of the dimerization
partner (Fig. 4). Notably, AtzG is 28 amino acids
shorter than GatC (68 vs. 96 amino acids), with
the additional 28 amino acids of GatC forming the
majority of its interactions with GatB (21) (Fig.
5). GatC also participates in the formation of the
ammonia tunnel in the GatCAB complex.
Interestingly, the ammonia tunnel is retained in
AtzEG (Fig. 6). The retention of the ammonia
tunnel may facilitate a high reaction rate by
provide rapid egress of the ammonia product.
When AtzE and AtzG were co-expressed
The structure of AtzE reveals the presence of an
unexpected, but essential ancillary protein – X-
ray crystal structures were obtained for purified
AtzE (PDB ID: 6C62; Table 2) and purified AtzE
treated with the suicide inhibitor phenyl
phosphorodiamidate (PPDI; PDB ID: 6C6G;
Table 2). The crystals of AtzE had two
independent molecules of AtzE in the asymmetric
unit, and the entire chain could be traced for both
molecules (Fig. 4). Surprisingly, after positioning
the AtzE chains in the structure, additional
protein density (Fig. 4). The density was of high
enough quality to allow for initial estimation of
the unknown sequence, which was identical to the
predicted translation product of a short (204 base
pairs) unannotated intergenic region between
atzD and atzE in the atzDEF operon on the
pADP1 plasmid (Fig. 1B).
Examination of purified AtzE by SDS-
PAGE indicated a small co-purified protein of
approximately the same size as the protein that
co-crystallized with AtzE (Fig. S1B). Mass
spectrometry of the AtzE purified from
Pseudomonas confirmed the presence of an
unidentified protein having a mass of 7422 Da
(Fig. S1C), and analysis of tryptic fragments of
the 7.4 kDa protein confirmed that it was encoded
by the small unannotated open reading frame
located between the atzD and atzE genes (Fig.
S2), which we have termed atzG (Fig S1). Along
with the two molecules of AtzE, there are two
molecules of AtzG in the asymmetric unit (Fig
4B).
in E. coli, a soluble (Fig. S1B), active enzyme that
was catalytically indistinguishable from AtzEG
purified from Pseudomonas sp. strain ADP was
obtained (Table 1). This confirmed that AtzG
promotes the production of soluble, active AtzE.
Notably, GatA cannot be over-produced in the
absence of GatC (24,25).
Substrate specificity and reaction mechanism-
Molecular dynamics were used to understand the
behaviour of 1-carboxybiuret in the active site. 1-
Carboxybiuret binds via a series of hydrogen
bonding interactions: the terminal carboxylate of
the substrate binds to Tyr125, Asn172 and
Gln402, the main chain carbonyl of Gly126 binds
the terminal adjacent amines and the main chain
NH of Gln402 binds the carbonyl between those
amines (Fig. 7A). The interactions with the
terminal carboxylate substantially strengthen the
binding of 1-carboxybiuret relative to biuret, and
would explain the lack of activity with biuret.
From a 500 ns MD simulation, we found that the
ΔG total as a function of time (Fig. 7C) for 1-
carboxybiuret reached significantly lower values
than biuret (-33 kcal/mole and -12 kcal/mole,
respectively). Carboxybiuret was retained by the
AtzE active site for the duration of the simulation,
Of the protein structures available in the
Protein Data Bank (PDB)(20), AtzE is most
similar to the glutamine deaminase component
(chain A; 35% sequence identity) of 4WJ3, an
glutamine transamidosome from Pseudomonas
(21): 428 residues aligned (out of 457) with a 1.5
Å rmsd over the aligned backbone atoms (Fig. 5).
The transamidosome is a three protein complex
(GatCAB) that is essential for the production of
correctly charged tRNA in bacteria via the
transfer of an ammonia from gutamine to acidic
amino acid-charged tRNA (21). Deamination
occurs in the active site of an amidase (GatA).
The ammonia is then channelled, via an
4

whereas biuret was observed to leave the active
site after 400 ns.
Lys74 then acts as a general base, activating water
and leading to the hydrolysis of the acyl enzyme,
releasing 1,3-dicarboxyurea and restoring the
active site to its original state.
The catalytic mechanism of AtzE is
likely to resemble that of other enzymes with Ser-
cisSer-Lys catalytic triads (e.g., malonamidase,
allophanate amidohydrolase, DNA polymerase V
accessory protein, and signal peptidase) (13,26-
28). The catalytic triad of AtzE, inferred from
crystallographic data and homology with other
amidases, comprises of Lys74, cisSer150 and
Ser174. In the substrate-docked structure, Ser174
is positioned for attack at the carbonyl of the
terminal amide of 1-carboxybiuret (Fig. 7B).
Moreover, in the crystal structure of AtzE with
the suicide inhibitor PPDI, extra density,
consistent with a phosphate group was seen
associated with Ser174. This suggests that the
phosphodiamidate moiety had been transferred to
the catalytic serine (Ser174) during the
crystallization process, and that Ser174 is the
nucleophilic residue in the catalytic triad. Mass
spectrometry of proteolyzed, PPDI-treated AtzE
showed that 70% of the enzyme was labelled with
monoaminophosphate at Ser174, and 30% with
It is interesting that AtzE has no
detectable activity with GatA substrates (e.g., -
amino acids), given their high degree of structural
similarity. We compared the structures of AtzE
with docked 1-carboxybiuret and GatA with
glutamine bound in its active site (Fig. 9). The
AtzE active site is highly conserved when
compared with that of GatA, albeit with some
differences (Fig. 9). The catalytic triad is
conserved (Lys79, Ser154 and Ser178 in GatA),
as are Gly126 (GatA Gly130), Ser169 (GatA
Ser173), Thr171 (GatA Thr175), and Gly173
(GatA Gly177). Among the key differences
between the two enzymes are Phe127 and Tyr125
(Gly131 and Met129 in GatA), which appear to
stabilize 1-carboxybiuret in the AtzE active site
via π-stacking interactions to the conjugated
carbonyl system in the substrate. Phe127 would
also sterically prevent the binding of glutamine
and other -amino acids which cannot adopt a
planar orientation like 1-carboxybiuret, and
therefore likely has a prominent role in substrate
specificity. Additionally, Asp425 in GatA, which
is required for hydrogen bonding to the backbone
nitrogen of the substrates, is Gly398 in AtzE.
diaminophosphate.
This suggests that the
diaminophosphate is labile, releasing an ammonia
in an aqueous solution (consistent with previous
reports)(1).
There are three sets of potential reaction
products from the deamination of 1-
carboxybiuret: allophanate and carbamate,
diacarboxyammonia and urea or 1,3-
dicarboxyurea and ammonia. These products are
difficult to resolve using the GDH-coupled assay
that we employed, as carbamate and
diacarboxyammonia readily decompose in water
to produce ammonia. As GatA produces
ammonia, we might expect that AtzE does too;
furthermore, the substrate range of AtzE includes
succinamic acid from which carbamate cannot be
produced. We therefore propose that AtzE
deaminates 1-carboxybiuret, producing 1,3-
DISCUSSION
Previously, AtzE had been reported to be
a biuret hydrolase (1,5,14,19), largely through
comparison with the non-homologous biuret
hydrolase of Rhizobium sp. (Table 1). However,
our findings demonstrate that AtzE is a 1-
carboxybiuret hydrolase and that the terminal
carboxylate is essential for correct substrate
binding. Sequence and structural homology
suggest that AtzEG may have been ‘repurposed’
from the bacterial glutamine transamidosome, in
which a similar complex, GatAC, is essential in
channelling a solvent-labile intermediate between
the complex’s two active sites (22). AtzG does
not appear to fulfil the same complex co-
ordinating function as GatC, instead it may be
that the obligate AtzEG complex is simply a
vestige of their shared evolutionary past.
Interestingly, Pseudomonas sp. strain ADP
possesses genes that encode a predicated GatCAB
complex (gatA, GenBank KSW28066.1; gatB,
GenBank KSW26274.1; gatC, KSW26275.1).
However, as atzEG are encoded by a gene cluster
on a transposable element, carried on a self-
transmissible plasmid (29,30), it seems unlikely
dicarboxyurea
(Fig.
1B),
which
then
monodecarboxylates to form allophanate (the
substrate for AtzF) (13,15). Currently, it is
unclear if the formation of allophanate is
spontaneous or enzyme-mediated.
The suggested mechanism for AtzE is
described in Fig 8. In the first step, Lys74, Ser150
and Ser174 all form a hydrogen bonding network,
where Lys74 acts as a general base to activate the
catalytic Ser174 through the cis-Ser150 bridging
ligand. The activated Ser174 performs a
nucleophilic attack on the terminal amide end of
1-carboxybiuret, leading to the formation of a
covalent acyl-enzyme intermediate and ammonia.
5

that atzEG was recruited from this specific gene
cluster.
Na2HPO4, 22 mM KH2PO4, 8.5 mM NaCl, 200
M MgSO4, 2.9 mM sucrose, 3.4 mM trisodium
citrate, 44 µM CaCl2, 20 mL/L of vitamin stock
and 1 mL/L of trace elements, adapted from
Balotra et al., 2015 (13). The cells were harvested
by centrifugation (8000 x g for 15 minutes), lysed
as described in the reference above and the
soluble supernatant was used for further
purification.
Despite the structural and mechanistic
similarities between AtzEG and its likely ancestor
(a GatAC-like protein), the substrate range for
AtzEG excludes the GatAC substrates asparagine
and glutamine. GatCAB fulfils an essential role in
the production of asparagine and glutamine
charged tRNA at the expense of glutamine (31),
and it is plausible that AtzEG rapidly evolved
away from these substrates under selective
pressure to eliminate perturbations in core
cellular functions (i.e., amino acyl tRNA
production and amino acid pools).
AtzE was purified by a four-step
purification process: ammonium sulfate (AS)
precipitation,
followed
by
hydrophobic
interaction, anion exchange and size exclusion
chromatography. A solution of concentrated AS
was added to the supernatant to give a final
concentration of 0.6 M and stirred for 4 hours at
4 °C. After centrifugation (18000 x g for 30
minutes), the soluble fraction was syringe filtered
through a 0.22 µm filter.
Although not itself catalytic, AtzG is
essential for correct AtzE function and previous
attempts to express AtzE in heterologous hosts
were unsuccessful because the gene encoding
AtzG had been overlooked by automated
annotation. There is an increasing body of
evidence that small, overlooked open-reading
frames often encode functional low-molecular
weight proteins (32,33). It may be that a subset of
these have structural roles, like that of AtzG, and
are required to promote or enhance soluble
protein expression or stability of their partner
proteins.
The supernatant from the AS cut was
purified
by
hydrophobic
interaction
chromatography using a 65 mL column packed
with Phenyl Sepharose preparation grade resin
(GE Healthcare Life Sciences), equilibrated with
25 mM potassium phosphate and 0.6 M
ammonium sulfate, pH 7.5. After running 4
column volumes (CV) of 0.4 M AS, a reverse
gradient from 0.4 M to 0.09 M AS over 10 CV
was used to elute the protein. Fractions containing
a 48 kDa band (SDS-PAGE) eluted between
0.27-0.14 M AS. These fractions were pooled,
and concentrated to 10 mL volume (Amicon
Ultra-15 centrifugal filter unit, Ultracel-30
membrane).
Surprisingly,
the
cyanuric
acid
mineralizing operon contains
a
second
unannotated open-reading frame between the
genes encoding AtzE and AtzF (Fig. 1B) that is
predicted to encode a 129 amino acid protein
(GenBank WP_064987550.1), tentatively named
AtzH that belongs to the DUF3225 family of
uncharacterized proteins. Preliminary proteomics
with Pseudomonas sp. strain ADP indicate that
AtzH is expressed under the same conditions as
AtzD, E, F and G. Investigations are underway to
determine the role of AtzH.
A desalting step was performed using a
53 mL HiPrep C26/10 desalting column (GE
Healthcare Life Sciences), equilibrated with 25
mM potassium phosphate, pH 8.5 for 1.5 CV.
The crude protein fraction was purified
by anion exchange chromatography using a 77
mL column packed with Q Sepharose preparation
grade resin (GE Healthcare Life Sciences),
equilibrated with 25 mM potassium phosphate,
pH 8.5. The protein was eluted with a gradient of
0 to 0.25 M NaCl over 11 CV. Fractions eluted
between 0.16-0.23 M NaCl were found to contain
a 48 kDa band (SDS-PAGE). After pooling, these
fractions were concentrated to 12 mL using an
Amicon Ultra-15 centrifugal filter unit.
EXPERIMENTAL PROCEDURES
Purification of AtzE from Pseudomonas
sp. strain ADP - Pseudomonas sp. strain ADP’s
growth conditions were optimized to induce
expression of the cyanuric acid catabolism
operon. 40 L of Pseudomonas sp. strain ADP was
grown in 500 mL cultures in 2 L flasks. Cultures
were grown in minimal medium at 28 °C and
shaken at 200 rpm until an OD600 of 0.4 was
reached. The minimal medium contained 10 mM
cyanuric acid as a sole nitrogen source, 26 mM
This combined sample was applied to a
130 mL size exclusion column packed with
Superdex 200 preparation grade resin (GE
Healthcare Life Sciences), equilibrated with
6

25mM potassium phosphate and 200 mM NaCl,
pH 7.5, and eluted over 1.5 CV with the same
buffer.
grown with shaking at 200 rpm at 28 °C. Protein
expression was induced at an OD600 of 0.8 by
addition
of
isopropyl-β–D-1-
thiogalactopyranoside (IPTG; 1 mM final
concentration).
All
chromatography
steps
were
performed using an ÄKTA purifier UPC 10 (GE
Healthcare Life Sciences).
Cells were harvested 24 hours after
induction by centrifugation at 5000 x g for 15
minutes using an Aventi J-E centrifuge (Beckman
Coulter, Indianapolis, USA), resuspended in lysis
buffer (25 mM potassium phosphate, 5 mM
imidazole, pH 7.5) and lysed by passage through
Cloning - A synthetic version of the atzE gene,
coding
for
the
protein
NP_862538
(NP_862538.1) was obtained from GenScript
Corporation (Piscataway, NJ, USA), inserted into
pUC57, flanked by the restriction sites NdeI and
BamHI. The genes were subcloned into the NdeI
and BamHI sites of pETcc2, described in Peat et
al., 2013 (11). Following the lack of soluble AtzE
expression, we reamplified atzE flanked with
NcoI and AvrII with the primers (5’ to 3’:
GTACACCCATGGGAATGAAGACAGTAGA
a
Microfluidics
homogenizer
M-110P
(Massachusetts, USA) five times at 15000 PSI.
The lysis was followed by centrifugation at 18
000 x g for 45 minutes to pellet the cellular debris,
and the soluble fraction was used for further
purification.
The soluble fraction was syringe filtered
throughout a 0.22 µm filter. The filtrate was
purified using a 5 mL Ni-NTA Superflow
cartridge (Qiagen, Maryland, USA) with a
gradient from 5 mM imidazole to 500 mM over
10 CV. SDS-PAGE gel analysis was performed
to assess the purity of the fractions.
AATTATTGAAGG
and
TTTTTTGAGCTCCCACATTTCAGTCGGGC
GATAC). atzE was subcloned into the first
multiple cloning site of the pACYCDuet-1 vector
(Novagen), a low copy number expression vector
for co-expression of two genes, with an in-frame
N-terminal thrombin cleavable hexahis-tag. AtzG
coding for the protein WP_082996223
(WP_082996223.1) was cloned directly from
Pseudomonas sp. ADP genomic DNA with the
primers
CGACGACATATGCTCGAGATGACGGAAA
CTG and
TGCTGCGAGCTCCCTAGGTCAGATATCTT
CTGC), before being subcloned into the second
cloning site of the pACYCDuet-1 vector using
the enzymes NdeI and XhoI.
The atzD coding for the protein NP_862537
(NP_862537.1) had been cloned into pETcc2
previously (11,13,18). Ligations were performed
using T4 ligase. Restriction enzymes and T4 ligase
were obtained from Thermofisher Scientific.
The biuret hydrolase from Rhizobium
leguminasorum bv. viciae 3841 (BiuH)
(AM236084.1) and barbituric acid hydrolase
from Nocardioides sp. JS614 coding for the
protein ABL81019 (ABL81019.1) were
expressed in E. coli as described elsewhere
(12,19).
Enzyme assays- Cyanuric acid hydrolysis by
AtzD was followed by UV spectrophotometry at
214 nm (13) using 0-0.6 mM of cyanuric acid in
25 mM phosphate buffer pH 9.
(5’
to
3’:
A glutamate dehydrogenase (GDH,
Sigma Aldrich) coupled reaction was used to
measure ammonia release and determine the
activity rate in the biuret hydrolase (BH) and
AtzE-dependent reactions. GDH catalyzes the
NADH-dependent amination of -ketoglutarate.
Ammonia production by BH and AtzE was
followed using the decrease of absorbance by UV
spectrophotometry at 340 nm that was due to the
oxidation of NADH by GDH. 1.25 U of GDH was
used in a 250 µL reaction volume, the final
concentrations of -ketoglutarate and NADH
were 3.5 mM and 0.2 mM, respectively (13) (Fig.
S3).
Monitoring the AtzE activity during
purification steps from Pseudomonas sp. strain
ADP was initially done with its reported
substrate, biuret (1,5,13). However, as no
ammonia could be detected, the fractions were
supplemented with 5.1 nM of AtzD and 0.2 mM
of cyanuric acid, in 25 mM phosphate buffer pH
9, in order to generate the substrate in situ. There
was a significant background of ammonia in the
early steps/cruder fractions; however, AtzE-
dependent ammonia production was detectable
Heterologous protein expression
–
The
expression vectors were used to transform
Escherichia coli BL21 (λDE3) cells (Invitrogen).
Bacteria were grown on Luria-Bertani (LB)
medium containing 100 µg/mL ampicillin for the
pETcc2 constructs or 34 µg/mL chloramphenicol
for the pACYCDuet-1 construct. Cells were
7

after the background rate (measured in the
absence of cyanuric acid) had been subtracted.
5 U/µL of GDH in presence of various amount of
biuret ranging from 0-0.7 mM.
Steady state kinetics for AtzD were
obtained by using 41 nM of AtzD, in the presence
of various amounts of cyanuric acid substrate
ranging from 0-0.6 mM. Cyanuric acid
degradation was measured by following the
decrease in absorbance at 214 nm, but above 0.2
mM AtzD activity was inhibited. To determine
whether the substrate or the product was
inhibiting AtzD activity, we pooled 41 nM of
AtzD, 24 nM of AtzE and 5 U/µL of GDH in the
presence of 0 - 0.6 mM cyanuric acid. This
removed the inhibition previously observed at
cyanuric acid concentrations above 0.2 mM, and
allowed the determination of steady state kinetics
for AtzD. Steady state kinetics for AtzD were
determined using 41 nM of AtzD, 24 nM of AtzE
and 5 U/µL of GDH, after ensuring that in these
proportions, the AtzD-mediated reaction was the
rate limiting reaction and with the assumption
that the rate of ammonia production recorded was
proportional to the AtzD activity rate.
All the kinetics constants were calculated
with
Hyper32
software
(http://homepage.ntlworld.com/john.easterby/hy
per32.html), fitting the rate data to Michaelis-
Menten equation:
푑[푃]
푑푡
푉
푚푎푥[푆]
=
퐾푚 + [푆]
The steady-state kinetic values for AtzE
with 1-nitro-biuret were estimated using
Lineweaver-Burk equation:
1
퐾푚 1
1
=
+
푉표
푉푚푎푥 [푆]
푉
푚푎푥
LC-MS/MS multiple reaction monitoring
(MRM)-based enzyme assay was used to follow
the fate of cyanuric acid and biuret when in
presence of either BiuH, AtzD and/or AtzE.
Reaction samples were run in triplicates. Four
reactions were composed of: 10 mM biuret with
580 nM BiuH, 10 mM biuret with 374 nM AtzE,
10 mM cyanuric acid with 420 nM AtzD and 10
mM cyanuric acid with 420 nM AtzD and 374 nM
AtzE. 5 uL of reaction mix was injected every 2
minutes for 30-60 minutes. Analysis was
performed using a Waters Alliance 2695
separation module coupled to a Waters TQD
detector but injections were made using a manual
injector with a 5 µL injection loop. The HPLC
Column used was a Phenomenex Develosil
RPAQEOUS-AR 5u C30 (dimension: 250 × 4.6
mm), which was heated to 35 ˚C. A flow rate of
0.7 mL/min was used (15:1 flow splitter was used
after separation). The eluent used was 15% (v/v)
acetonitrile and 0.1% formic acid in water. Two
simultaneous but independent MRM analyses
were performed as follows: MRM parameters for
biuret (Parent m/z = 103.9424): Channel 1 (ES+):
Daughter (m/z): 17.9654, Dwell (s): 0.025, Cone
(V): 20, Collision (V): 10; Channel 2 (ES+):
Daughter (m/z): 43.8956, Dwell (s): 0.025, Cone
(V): 20, Collision (V): 20. MRM Parameters for
cyanuric acid (Parent m/z = 127.8577): Channel
1 (ES-): Daughter (m/z): 41.9357, Dwell (s):
0.025, Cone (V): 28, Collision (V): 14. MRM
peaks were integrated using Waters MassLynx
v4.1 software.
Steady state kinetics for AtzE with the
product of AtzD or barbituric acid hydrolase
(BAH) were obtained under conditions where the
AtzE-mediated reaction was the rate limiting
reaction (i.e. 3.5 times slower than either the
GDH, AtzD, or barbituric acid hydrolase
mediated reactions). AtzE steady state kinetics
were obtained by using 41 nM of AtzD/ 48 nM
barbituric acid hydrolase, 12 nM of AtzE and 5
U/µL of GDH. Substrate (cyanuric acid or
barbituric acid) was added over the range of 0-0.6
mM. As AtzE was rate-limiting, it was assumed
to be a good estimate of the rate of AtzE.
Other potential AtzE substrates tested
were: 1-nitrobiuret, 1-carboxymalonamide,
succinamic acid, 2-amino-3-ureidopropionic
(Albizziin), citrulline, lysine, glutamine,
asparagine, biuret and malonamide. Specific
activities were obtained with 12-400 nM of AtzE
and 5 U/µL of GDH and 1.5 mM substrates in 25
mM phosphate buffer pH 9. Steady state kinetics
were obtained with 1-nitrobiuret using 12 nM of
AtzE and 5 U/µL of GDH. Substrate,1-
nitrobiuret, was added over the range of 0-2.5
mM. Steady state kinetics were obtained with 1-
carboxy-malonamide using 12 nM of AtzE, 48
nM BAH and 5 U/µL of GDH. Substrate
(barbituric acid) was added over the range of 0-4
mM.
Biuret hydrolase kinetic data were
obtained by using 11 nM of biuret hydrolase and
Proteomics- In-gel digestion was performed by
resuspending pieces of bis-acrylamide gel
8

containing 50-100 µg protein in 100 µL of 25 mM
ammonium bicarbonate. After addition of 5 µL of
15% DTT, the mix was incubated at room
temperature for 30 min, followed by addition of
3.5 µL of 40% Acrylamide and another 30 min
incubation at room temperature. The sample was
digested with 0.5 µg of trypsin at 37 °C overnight.
To stop the digestion, formic acid was added to a
final concentration of 0.1-1%, then the trypsin
digested peptides were eluted from gel pieces by
sonication for 15 min and further incubated at
room temperature for 30 min. Typically, 1-5 µL
of sample was used for LC-MS analysis.
PPDI-treated AtzE samples were
digested with trypsin using the SP3 digestion
protocol (34). Peptides were separated using an
UltiMate nanoUPLC system, utilizing a 60min
gradient on an Acclaim Pepmap 100 column (25
cm × 75µm id with 3 µm particles). High-
resolution MS/MS data was obtained on an
Orbitrap Fusion Lumos Mass Spectrometer and
top-twenty multiply charged species selected for
fragmentation in high-high mode with the
Orbitrap resolution set at 75,000.
Orbitrap MS/MS data was searched
against a focused decoy database containing
AtzE, E. coli and common contaminant protein
sequences using the Byonic search engine
(Protein Metrics) with tolerance of 5 ppm for
precursor ions and 10 ppm for product ions.
Enzyme specificity was tryptic and allowed for
up to 2 missed cleavages per peptide. Variable
modifications were set for NH2-terminal
acetylation or protein N-termini, oxidation of
methionine or tryptophan, deamidation of
asparagine or glutamine and dehydration of
cysteine. A Wildcard search with a range of +75
to +80Da facilitated confident peptide
identification (< 1% FDR) and spectrum counting
of monoamidophphate or diaminophosphate
modified serine residues.
The trypsin-digested peptides were
separated by reversed-phase HPLC using an
Agilent NanoFlow LC system (1260 Infinity).
The peptides were loaded onto a NanoLC trap
column (3 µm, ChromXP C18CL, 120Å 0.5 mm
x 350 µm from Eksignet Technologies) by
autosampler at a flowrate of 5 uL/min and
continuously desalted for 5 min. The desalted
peptides were eluted from the trap column and
separated on a NanoLC column (3 µm, ChromXP
C18CL, 120Å, 15 cm x 75 µm from Eksigent)
with a 0-40% gradient in 100 min consisting of
buffer A (0.1% FA in water) and Buffer B (0.1%
FA in acetonitrile). The flowrate of Nano pump
was set to 300 nL/min.
Peptides were analyzed using positive
and high sensitive mode on an AB Sciex Tripletof
5500 mass spectrometer. The voltage of Nano
spray II was set to 2300 kV. In Data Dependent
Acquisition (DDA) mode, the mass window for
precursor ions of the quadrupole mass analyzer
was set to +/- 1 m/z. The precursor irons were
fragmented by nitrogen collision gas. The MS1
survey scan (250 msec; mass 350-1500) was
carried out. 50 of the most abundant precursors
were selected for MS/MS Scan (50 msec; mass
100-1800). MS/MS spectra were obtained for
product ions which had charge state of 2 to 5 and
were above 10 counts per second. Rolling
collision energy was used, and automatic
calibration was carried out after every 5 sample
runs.
Crystallization and structural determination -The
stability of purified AtzE in the phosphate buffer
used in the size exclusion chromatography was
assessed using Differential Scanning Fluorimetry
as
implemented
in
the
Collaborative
Crystallisation Centre (35). Protein was used at
2.3 mg/mL, and showed a Tm of 64.6 +/- 1.4 C
in the phosphate buffer, but also showed that the
protein was equally stable in all buffers tested
with pH between 6.5 and 8.5, and the stability was
essentially independent of salt concentration. An
initial bank of 384 crystallization trials (PACT,
shotgun and PS gradient at 20 C, shotgun at 8
C; see c6.csiro.au for details of the screens)
showed the formation of crystals overnight in
many PEG-containing conditions. All of the
crystals were small and rod-shaped, and all
diffracted poorly and had a pathological packing
problem which made them unsuitable for
diffraction analyses. Over the course of a year,
over 10,000 droplets were set up, trying various
combinations of seeding, in-situ proteolysis,
concentrations, differing formulations, vapor
diffusion, microbatch and temperatures. All
Mass spectrum data was analyzed using
the Paragon algorithm of ProteinPilot (AB Sciex).
The detected protein threshold was set to
>0.05(10%). The matching peptide sequences
were identified against the Pseudomonas sp. ADP
proteome found in Uniprot. The false discovery
rate (FDR) analysis tool algorithm of ProteinPilot
provided a global FDR of 1% and a local FDR at
1% in all cases.
9

crystals showed the same pathological form as the
original crystals that grew overnight. Finally, it
was found that the addition of 0.05 % agarose to
the protein solution before setup, coupled with
seeding from the poor form crystals gave a new
crystal form that showed diffraction to 2 Å, and
which did not have the same packing problems.
The well-behaved crystal form appeared
overnight and grew to full size in 5 days, and grew
at both 8 C and 20 C. The crystals used in the
structure determination were grown from sitting
drop trials with 250 nL of 1.1 mg/mL protein in
25 mM Hepes pH 7.5, 100 mM NaCl, with 0.05%
agarose, 250 nL crystallant (0.1 M bis-tris pH
6.04, 0.276 M MgCl2, 17.6 % w/v PEG 8000),
incubated at 8 C. Crystals of the protein treated
with an inhibitor, phenyl phosphorodiamidate
(PPDI), grew under similar conditions to the
native protein (reservoir 0.1 M bis-tris pH 5.46,
0.128 M MgCl2, 21 %w/v PEG 8000) at 20 C. A
crystal of the protein/PPDI complex was
processed using Xia2/DIALS and the AtzE/PPDI
model was used to phase the data with Phaser.
Computational methods- Models of AtzEG
containing biuret and 1-carboxybiuret were
prepared in Accelrys Discovery Studio v4.1 using
the experimentally derived structure as a starting
point. Models for the substrates were relaxed
using the Full Minimization tool in Discovery
Studio v4.1 using the default settings (CHARMm
force field) and positioned in the receptor cavity
(active site) using CDOCKER with the default
parameters.
Ligands were prepared for MD using the
Antechamber module in AMBER16 (44) using
the GAFF2 force field. The protein models were
prepared for MD simulations using xLeap
applying the ff14SB force field and charge-
neutralized by the addition of Na+ ions. The
proteins were solvated in a TIP3P truncated
octahedral solvent box with a minimum 12 Å
periodic boundary distance from the solute.
cryoprotected
with
reservoir
solution
supplemented with glycerol to 20% final
concentration and flash cooled in liquid nitrogen.
This crystal was used to collect 360 degrees of
data to 2.1 Å at beamline MX1 of the Australian
Synchrotron. The data were initially processed
with XDS (36), and the structure was solved by
molecular replacement using MoRDa (37), which
output two copies each of the A domains from
3ip4 and 3dha in the asymmetric unit. After some
rebuilding, the new model was used in Phaser
with reprocessed data (using Xia2 and DIALS)
(38-42) and this was followed by manual building
(COOT) and refinement with Refmac (43). Two
complete chains of AtzE (residues 1-457) were
located in the asymmetric unit. Additional protein
density was clearly visible in the maps and
another protein chain was modelled into the
density. The sequence was confirmed by
searching the Pseudomonas database and finding
that the AtzG sequence matched the sequence of
the density (with 66 of 68 residues visible).
Subunit interactions were analysed using PISA
(23).
Initial minimization of both systems was
performed using AMBER 16 over 10,000 steps
under a constant pressure of 1 bar (Berendsen
barostat). Bonds lengths on bonds involving
hydrogen were constrained using SHAKE, and
force evaluation on these bonds was not
performed. MD simulations of 500 ns with a step-
size of 0.002 ps were performed at 310 K and 1
bar pressure with a 1 ps relaxation time. Long
range electrostatic interactions were treated with
the particle mesh Ewald method beyond 12ꢀÅ.
Simulations were analysed using VMD (v. 1.9.2)
(45).
Molecular
Boltzmann Surface
Mechanics
Area
Poisson–
(MM-PBSA)
continuum solvation models were calculated
using the MM-PBSA module in AMBER 16 over
the course of the entire simulation. Entropy
approximations were calculated with ptraj.
The ammonia tunnel in the GatCAB
complex (PDB: 2G5H) and the equivalent tunnel
in AtzEG were visualized using CAVER 3 (46)
using the default parameters (Clustering
threshold of 3.5, probe radius of 0.9.
Approximation of 12).
A crystal of the native AtzE without
inhibitor was harvested and data collected that
extended to just beyond 2 Å at the MX2 beamline
of the Australian Synchrotron. These data were
ACKNOWLEDGEMENTS
We would like to thank the beamline scientists at the Australian Synchrotron for their help in data
collection. Crystals were grown in the CSIRO Collaborative Crystallisation Centre (http://www.
10

csiro.au/C3) at CSIRO Manufacturing. We would also like to thank Drs Andrew Warden and Thomas
Walsh (CSIRO Land & Water) for their constructive comments while preparing this manuscript.
CONFLICT OF INTEREST
The authors declare that they have no conflicts of interest with the contents of this article.
AUTHOR CONTRIBUTIONS
CS conceived and coordinated the study. LE, CS, TSP and JN wrote the paper. LE, CJH, CJE
and MW designed and interpreted the biochemical characterization experiments. TSP and JN did the
crystallization and structural biology. LE, HO and JWL designed and interpreted the mass spectrometry
experiments. TN designed and performed the mass spec experiments on the inhibited protein complex.
NGF provided technical assistance. LE and MW did the substrate docking. MW did the molecular
dynamics. All authors reviewed the results and approved the final version of the manuscript.
REFERENCES
1.
Cameron, S. M., Durchschein, K., Richman, J. E., Sadowsky, M. J., and Wackett, L. P.
(2011) A new family of biuret hydrolases involved in s-triazine ring metabolism. ACS
Catal 2011, 1075-1082
2.
3.
4.
Udikovic-Kolic, N., Scott, C., and Martin-Laurent, F. (2012) Evolution of atrazine-
degrading capabilities in the environment. Appl Microbiol Biotechnol 96, 1175-1189
Jutzi, K., Cook, A. M., and Hutter, R. (1981) The degradative pathway of the s-triazine
melamine. Experientia 37, 1231-1232
Mandelbaum, R. T., Allan, D. L., and Wackett, L. P. (1995) Isolation and
characterization of a Pseudomonas sp that mineralizes the s-triazine herbicide atrazine.
Applied and Environmental Microbiology 61, 1451-1457
5.
6.
Martinez, B., Tomkins, J., Wackett, L. P., Wing, R., and Sadowsky, M. J. (2001)
Complete nucleotide sequence and organization of the atrazine catabolic plasmid
pADP-1 from Pseudomonas sp. strain ADP. J Bacteriol 183, 5684-5697
de Souza, M. L., Wackett, L. P., Boundy-Mills, K. L., Mandelbaum, R. T., and
Sadowsky, M. J. (1995) Cloning, characterization, and expression of a gene region from
Pseudomonas sp. strain ADP involved in the dechlorination of atrazine. Appl Environ
Microbiol 61, 3373-3378
7.
8.
Peat, T. S., Newman, J., Balotra, S., Lucent, D., Warden, A. C., and Scott, C. (2015)
The structure of the hexameric atrazine chlorohydrolase AtzA. Acta Crystallogr D Biol
Crystallogr 71, 710-720
Seffernick, J. L., Aleem, A., Osborne, J. P., Johnson, G., Sadowsky, M. J., and Wackett,
L. P. (2007) Hydroxyatrazine N-ethylaminohydrolase (AtzB): an amidohydrolase
superfamily enzyme catalyzing deamination and dechlorination. J Bacteriol 189, 6989-
6997
9.
Balotra, S., Warden, A. C., Newman, J., Briggs, L. J., Scott, C., and Peat, T. S. (2015)
X-Ray structure and mutagenesis studies of the N-isopropylammelide
isopropylaminohydrolase, AtzC. PLoS One 10, e0137700
10.
Sadowsky, M. J., Tong, Z. K., de Souza, M., and Wackett, L. P. (1998) AtzC is a new
member of the amidohydrolase protein superfamily and is homologous to other
atrazine-metabolizing enzymes. J. Bacteriol. 180, 152-158
11

11.
12.
13.
Peat, T. S., Balotra, S., Wilding, M., French, N. G., Briggs, L. J., Panjikar, S.,
Cowieson, N., Newman, J., and Scott, C. (2013) Cyanuric acid hydrolase: evolutionary
innovation by structural concatenation. Mol Microbiol 88, 1149-1163
Peat, T. S., Balotra, S., Wilding, M., Hartley, C. J., Newman, J., and Scott, C. (2017)
High-resolution X-ray structures of two functionally distinct members of the cyclic
amide hydrolase family of Toblerone fold enzymes. Appl Environ Microbiol 83, 16
Balotra, S., Newman, J., Cowieson, N. P., French, N. G., Campbell, P. M., Briggs, L.
J., Warden, A. C., Easton, C. J., Peat, T. S., and Scott, C. (2015) X-ray structure of the
amidase domain of AtzF, the allophanate hydrolase from the cyanuric acid-
mineralizing multienzyme complex. Appl Environ Microbiol 81, 470-480
Cheng, G., Shapir, N., Sadowsky, M. J., and Wackett, L. P. (2005) Allophanate
hydrolase, not urease, functions in bacterial cyanuric acid metabolism. Appl Environ
Microbiol 71, 4437-4445
Shapir, N., Sadowsky, M. J., and Wackett, L. P. (2005) Purification and
characterization of allophanate hydrolase (AtzF) from Pseudomonas sp. strain ADP. J
Bacteriol 187, 3731-3738
Eaton, R. W., and Karns, J. S. (1991) Cloning and comparison of the DNA encoding
ammelide aminohydrolase and cyanuric acid amidohydrolase from three s-triazine-
degrading bacterial strains. J Bacteriol 173, 1363-1366
14.
15.
16.
17.
Seffernick, J. L., Erickson, J. S., Cameron, S. M., Cho, S., Dodge, A. G., Richman, J.
E., Sadowsky, M. J., and Wackett, L. P. (2012) Defining sequence space and reaction
products within the cyanuric acid hydrolase (AtzD)/barbiturase protein family. J
Bacteriol 194, 4579-4588
18.
19.
Balotra, S., Newman, J., French, N. G., Briggs, L. J., Peat, T. S., and Scott, C. (2014)
Crystallization and preliminary X-ray diffraction analysis of the amidase domain of
allophanate hydrolase from Pseudomonas sp. strain ADP. Acta Crystallogr F Struct
Biol Commun 70, 310-315
Esquirol, L., Peat, T. S., Wilding, M., Lucent, D., French, N. G., Hartley, C. J.,
Newman, J., and Scott, C. (2018) Structural and biochemical characterization of the
biuret hydrolase (BiuH) from the cyanuric acid catabolism pathway of Rhizobium
leguminasorum bv. viciae 3841. PLoS ONE 13, e0192736
20.
21.
Berman, H. M. (2000) The protein data bank. Nucleic Acids Res. 28, 235-242
Suzuki, T., Nakamura, A., Kato, K., Soll, D., Tanaka, I., Sheppard, K., and Yao, M.
(2015) Structure of the Pseudomonas aeruginosa transamidosome reveals unique
aspects of bacterial tRNA-dependent asparagine biosynthesis. Proc Natl Acad Sci U S
A 112, 382-387
22.
Nakamura, A., Yao, M., Chimnaronk, S., Sakai, N., and Tanaka, I. (2006) Ammonia
channel couples glutaminase with transamidase reactions in GatCAB. Science 312,
1954-1958
23.
24.
Krissinel, E., and Henrick, K. (2007) Inference of macromolecular assemblies from
crystalline state. J Mol Biol 372, 774-797
Curnow, A. W., Hong, K. W., Yuan, R., Kim, S. I., Martins, O., Winkler, W., Henkin,
T. M., and Soll, D. (1997) Glu-tRNA(Gln) amidotransferase: A novel heterotrimeric
enzyme required for correct decoding of glutamine codons during translation.
Proceedings of the National Academy of Sciences of the United States of America 94,
11819-11826
25.
Skouloubris, S., de Pouplana, L. R., de Reuse, H., and Hendrickson, T. L. (2003) A
noncognate aminoacyl-tRNA synthetase that may resolve a missing link in protein
evolution. Proceedings of the National Academy of Sciences of the United States of
America 100, 11297-11302
12

26.
Shin, S., Lee, T. H., Ha, N. C., Koo, H. M., Kim, S. Y., Lee, H. S., Kim, Y. S., and Oh,
B. H. (2002) Structure of malonamidase E2 reveals a novel Ser-cisSer-Lys catalytic
triad in a new serine hydrolase fold that is prevalent in nature. EMBO J 21, 2509-2516
Paetzel, M., Dalbey, R. E., and Strynadka, N. C. (1998) Crystal structure of a bacterial
signal peptidase in complex with a beta-lactam inhibitor. Nature 396, 186-190
Peat, T. S., Frank, E. G., McDonald, J. P., Levine, A. S., Woodgate, R., and
Hendrickson, W. A. (1996) Structure of the UmuD' protein and its regulation in
response to DNA damage. Nature 380, 727-730
27.
28.
29.
30.
31.
de Souza, M. L., Wackett, L. P., and Sadowsky, M. J. (1998) The atzABC genes
encoding atrazine catabolism are located on a self-transmissible plasmid in
Pseudomonas sp. strain ADP. Applied and Environmental Microbiology 64, 2323-2326
Martinez, B., Tomkins, J., Wackett, L. P., Wing, R., and Sadowsky, M. J. (2001)
Complete nucleotide sequence and organization of the atrazine catabolic plasmid
pADP-1 from Pseudomonas sp. strain ADP. J. Bacteriol. 183, 5684-5697
Min, B., Pelaschier, J. T., Graham, D. E., Tumbula-Hansen, D., and Soll, D. (2002)
Transfer RNA-dependent amino acid biosynthesis: an essential route to asparagine
formation. Proc Natl Acad Sci U S A 99, 2678-2683
32.
33.
Baek, J., Lee, J., Yoon, K., and Lee, H. (2017) Identification of unannotated small genes
in Salmonella. G3 (Bethesda) 7, 983-989
Hucker, S. M., Ardern, Z., Goldberg, T., Schafferhans, A., Bernhofer, M., Vestergaard,
G., Nelson, C. W., Schloter, M., Rost, B., Scherer, S., and Neuhaus, K. (2017)
Discovery of numerous novel small genes in the intergenic regions of the Escherichia
coli O157:H7 Sakai genome. PLoS One 12, e0184119
34.
35.
Hughes, C. S., Foehr, S., Garfield, D. A., Furlong, E. E., Steinmetz, L. M., and
Krijgsveld, J. (2014) Ultrasensitive proteome analysis using paramagnetic bead
technology. Molecular Systems Biology 10
Rosa, N., Ristic, M., Seabrook, S. A., Lovell, D., Lucent, D., and Newman, J. (2015)
Meltdown: A tool to help in the interpretation of thermal melt curves acquired by
differential scanning fluorimetry. J Biomol Screen 20, 898-905
36.
37.
Kabsch, W. (2010) Xds. Acta Crystallogr D Biol Crystallogr 66, 125-132
Winn, M. D., Ballard, C. C., Cowtan, K. D., Dodson, E. J., Emsley, P., Evans, P. R.,
Keegan, R. M., Krissinel, E. B., Leslie, A. G., McCoy, A., McNicholas, S. J.,
Murshudov, G. N., Pannu, N. S., Potterton, E. A., Powell, H. R., Read, R. J., Vagin, A.,
and Wilson, K. S. (2011) Overview of the CCP4 suite and current developments. Acta
Crystallogr D Biol Crystallogr 67, 235-242
38.
McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn, M. D., Storoni, L. C.,
and Read, R. J. (2007) Phaser crystallographic software. J Appl Crystallogr 40, 658-
674
39.
40.
McCoy, A. J. (2007) Solving structures of protein complexes by molecular replacement
with Phaser. Acta Crystallogr D Biol Crystallogr 63, 32-41
Parkhurst, J. M., Winter, G., Waterman, D. G., Fuentes-Montero, L., Gildea, R. J.,
Murshudov, G. N., and Evans, G. (2016) Robust background modelling in DIALS. J
Appl Crystallogr 49, 1912-1921
41.
Waterman, D. G., Winter, G., Gildea, R. J., Parkhurst, J. M., Brewster, A. S., Sauter,
N. K., and Evans, G. (2016) Diffraction-geometry refinement in the DIALS framework.
Acta Crystallogr D Struct Biol 72, 558-575
42.
43.
Winter, G. (2010) xia2: an expert system for macromolecular crystallography data
reduction. Journal of Applied Crystallography 43, 186-190
Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997) Refinement of
macromolecular structures by the maximum-likelihood method. Acta Crystallogr D
Biol Crystallogr 53, 240-255
13

44.
Case, D. A., Cerutti, D. S., Cheatham, I., Darden, T., A.R.E., D., Giese, T. J., Gohlke,
H., Goetz, A. W., Greene, D., Homeyer, N., Izadi, S., Kovalenko, A., Lee, T. S.,
LeGrand, S., Li, P., Lin, C., Liu, J., Luchko, T., Luo, R., Mermelstein, D., M. Merz, K.
M., Monard, G., Nguyen, H., Omelyan, I., Onufriev, A., Pan, F., Qi, R., Roe, D. R.,
Roitberg, A., Sagui, C., Simmerling, C. L., Botello-Smith, W. M., Swails, J., Walker,
R. C., Wang, J., Wolf, R. M., Wu, X., Xiao, L., York, D. M., and Kollman, P. A. (2017)
AMBER16. University of California, San Francisco
45.
46.
Humphrey, W., Dalke, A., and Schulten, K. (1996) VMD: visual molecular dynamics.
J Mol Graph 14, 33-38, 27-38
Pavelka, A., Sebestova, E., Kozlikova, B., Brezovsky, J., Sochor, J., and Damborsky,
J. (2016) CAVER: Algorithms for analyzing dynamics of tunnels in macromolecules.
IEEE-ACM Trans. Comput. Biol. Bioinform. 13, 505-517
14

Table 1: Steady-state kinetic parameters for AtzE. The structures of the substrates and
non-substrates tested (biuret, malonamide, asparagine, glutamine, lysine, citrulline and 2-
amino-3-ureidopropionic acid) are shown in Supplementary Table 2. The standard errors for
the KM and kcat values are given.
Enzyme
Substrate
kcat
KM
(µM)
kcat/KM
(s-1)
(s-1.M-1)
cyanuric acid
biuret
17.0 ± 1.7
11.5 ± 0.2
15.5 ± 0.1
350 ± 42
4.8 x 104
1.5 x 105
2.5 105
AtzD
BiuH
80 ± 7
1-carboxybiuret
63 ± 3
AtzE (Pseudomonas
sp. ADP)
AtzE (E. coli)
1-carboxybiuret
1-nitrobiuret
14.1 ± 0.2
9.4 ± 3.3
7.0 ± 0.1
19.0 ± 0.4
61 ± 3
2.3 x 105
785 ± 217 1.2 x 104
1-carboxymalonamide
succinamic acid
167 ± 17
523 ± 30
4.2 x 104
3.6 x 104
15

Table 2: Crystal structure parameters.
6C62 (Native)
6C6G (PPDI)
I2
Data collection
Space group
I2
Cell dimensions
a, b, c (Å)
78.6, 88.9,
141.9
79.5, 89.0, 141.7
 () 
Resolution (Å)
90, 101.9, 90
1.95 (1.99 -
1.95)
90, 101.3 , 90
2.10 (2.16 -
2.10)
Rmerge
Rpim
0.233 (1.545)
0.095 (0.622)
6.9 (2.1)
0.326 (1.282)
0.126 (0.496)
6.7 (2.0)
I / I
CC1/2
0.991 (0.804)
100 (100)
0.982 (0.656)
100 (100)
Completeness (%)
Redundancy
6.9 (7.1)
7.6 (7.6)
Refinement
Resolution (Å)
Unique reflections
Rwork / Rfree
No. atoms
2 dimers
69.3 - 1.95
66,810
15.3 / 19.1
8659
2 dimers
69.6 - 2.10
53,225
16.7 / 21.0
8523
7882
8
Protein
7930
Inhibitor
n/a
Water
B-factors (Å2)
726
639
16.8
16.9
12.4
21.1
17.5
Protein
17.4
Inhibitor
n/a
Water
24.6
R.m.s deviations
Bond lengths (Å)
Bond angles ()
0.017
1.726
0.014
1.643
Note: Values in parentheses are for the highest resolution shell.
16

Figure Legends
Figure 1. Catabolism of the s-triazine herbicide atrazine by Pseudomonas sp. strain ADP.
The atrazine catabolic pathway is comprised of an ‘upper pathway’ (A), which transforms
atrazine to cyanuric acid, and a lower pathway (B), which catabolizes cyanuric acid to ammonia
and carbon dioxide. The entire Pseudomonas sp. strain ADP atrazine catabolic pathway is
encoded on a single conjugative plasmid (pADP1; GeneBank NZ_CM003636.1), and the co-
ordinates of each gene are shown. The genes of the upper pathway (atzA, atzB, and atzC)
encode three hydrolases (AtzA, AtzB, and AtzC). The genes of the lower pathway (atzD, atzG,
atzE, atzH and atzF) are found as a single operon: atzG and atzH (shown in red) were identified
in the work reported here. AtzE had previously been reported as a biuret amidohydrolase (1);
however in the work presented here we have demonstrated that it is a 1,3-dicaboxyurea forming
1-carboxybiuret amidohydrolase (as shown in the updated lower pathway).
17

Figure 2. LC-MS analysis of AtzE activity with biuret and 1-carboxybiuret. The
concentrations of cyanuric acid (triangles) and biuret (circles) present in each reaction is
shown. Four reaction conditions were tested: A) biuret in presence of AtzE; B) biuret in
presence of the biuret hydrolase BiuH; C) cyanuric acid in presence of AtzD; and, D) cyanuric
acid in presence of AtzD and AtzE. Reactions were done in triplicate and the standard
deviations are shown.
18

Figure 3. AtzE-dependent deamination reactions. The schemes for AtzE-dependent
deamination of: 1) 1-carboxybiuret, 2) 1-carboxymalonamide, 3) 1-nitrobiuret and 4)
succinamic acid are shown. 1-Carboxybiuret and 1-carboxymalonamide were produced in situ
by cyanuric acid amidohydrolase (AtzD) and barbituric acid amidohydrolase (BAH),
respectively. Square brackets indicate compounds that spontaneously decarboxylate under the
reaction conditions used.
19

Figure 4. X-ray crystal structure of the unexpected AtzE complex. A) The AtzE monomer
(green) has a typical amidase fold. Surprisingly, it is associated with a small (68 amino acid)
protein (yellow); B) The 22 heterotetramer, containing two molecules of AtzE (green and
cyan) and two molecules of the 68 amino acid protein (yellow and magenta).
20

Figure 5. Superposition of the AtzEG heterodimer and the GatA:GatC complex. AtzE and
AtzG are shown in green and magenta, respectively. GatA and GatC are shown in cyan and
yellow, respectively. The phosphoserine from the AtzE x-ray crystal structure (Ser174) is
shown in stick representation.
21

Figure 6. Conservation of the transamidosome ammonia tunnel in AtzEG. The ammonia
tunnel is shown in the GatCAB complex and a comparable tunnel is seen in AtzEG.
Superposition of the two protein complexes show that the tunnels overlap for the whole length
of the AtzEG tunnel. CAVER (46) was used to generate this figure.
22

Figure 7. Docking and molecular dynamics of substrate in the AtzE active site. A) 1-
carboxybiuret docked into the AtzE active site in its most stable configuration (ΔG minimal).
1-carboxybiuret is shown in magenta, AtzE is shown in green and AtzG is shown in yellow.
Hydrogen bonds between the protein and substrate are shown as dashed lines; B) A 90°
rotation of panel A showing the position of the catalytic amino acids Ser174, Ser150 and
Lys74, for clarity the stick representation of amino acids Gly126, Phe127 have been
removed; C) Variation in ΔG (kcal/mole) as a function of time (ns) during a molecular
dynamics simulation of biuret and 1-carboxybiuret docked into the active site of AtzEG. The
lowest ΔG total reached during the 1-carboxybiuret MMPBSA is -59.0 at 388 ns of
simulation, whereas the lowest ΔG total for biuret is only of -16.7 at 425 ns of simulation.
While 1-carboxybiuret adopts a stable conformation over time, biuret does not and escapes
the active site at t=400 ns.
23

Figure 8. The AtzE reaction mechanism. The catalytic triad (Lys74, Ser150 and Ser174;
shown in green) form a hydrogen bonding network with the substrate, Lys74 activates the
catalytic (Ser174) via the cis-Ser150 bridging ligand. Ser174 performs a nucleophilic attack on
the terminal amide of the substrate, forming the covalent acyl-enzyme intermediate and
releasing ammonia. Lys74 then acts as a general base, activating water (blue) and leading to
the hydrolysis of the acyl enzyme, releasing 1,3-dicarboxyurea and regenerating the active site.
24

Figure 9. Comparison of the active sites of AtzE and GatA bound to 1-carboxybiuret and
glutamine, respectively. The AtzE active site (green) is shown superposed on the GatA active
site (cyan). The GatA substrate (glutamine; yellow) is also shown. Hydrogen bonds between
GatA and glutamine are shown as dotted lines. Panels A and B are rotated 180° relative to each
other to highlight the positions of the alpha amine of glutamine and Phe127 in AtzE.
25

An unexpected vestigial protein complex reveals the evolutionary origins of an
s-triazine catabolic enzyme
Lygie Esquirol, Thomas S. Peat, Matthew Wilding, Jian-Wei Liu, Nigel G. French,
Carol J. Hartley, Hideki Onagi, Thomas Nebl, Christopher J. Easton, Janet Newman and
Colin Scott
J. Biol. Chem. published online March 9, 2018
Access the most updated version of this article at doi: 10.1074/jbc.RA118.001996
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts