The antiparasitic isoxazoline A1443 is a potent blocker of insect ligand-gated chloride channels

Article abstract of DOI:10.1016/j.bbrc.2009.11.131

A structurally unique isoxazoline class compound, A1443, exhibits antiparasitic activity against cat fleas and dog ticks comparable to that of the commercial ectoparasiticide fipronil. This isoxazoline compound inhibits specific binding of the γ-aminobutyric acid (GABA) receptor channel blocker [³H]4′-ethynyl-4-n-propylbicycloorthobenzoate (EBOB) to housefly-head membranes, with an IC₅₀ value of 455 pM. In contrast, the IC₅₀ value in rat-brain membranes is >10 μM. To study the mode of action of this isoxazoline, we utilized MdGBCl and MdGluCl cDNAs, which encode the subunits of housefly GABA- and glutamate-gated chloride channels, respectively. Two-electrode voltage clamp electrophysiology was used to confirm that A1443 blocks GABA- and glutamate-induced chloride currents in Xenopus oocytes expressing MdGBCl or MdGluCl channels, with IC₅₀ values of 5.32 and 79.9 nM, respectively. Blockade by A1443 was observed in A2′S-MdGBCl and S2′A-MdGluCl mutant channels at levels similar to those of the respective wild-types, and houseflies expressing A2′S-MdGBCl channels were as susceptible to A1443 as standard houseflies. These findings indicate that A1443 is a novel and specific blocker of insect ligand-gated chloride channels.

Full text of DOI:10.1016/j.bbrc.2009.11.131

Biochemical and Biophysical Research Communications 391 (2010) 744–749
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications
journal homepage: www.elsevier.com/locate/ybbrc
The antiparasitic isoxazoline A1443 is a potent blocker of insect
ligand-gated chloride channels
b
a
b
c
Yoshihisa Ozoe a, , Miho Asahi , Fumiyo Ozoe , Kunimitsu Nakahira , Takeshi Mita
*
a Department of Life Science and Biotechnology, Shimane University, Matsue, Shimane 690-8504, Japan
b Biological Research Laboratories, Nissan Chemical Industries, Ltd., Saitama 349-0294, Japan
c Chemical Research Laboratories, Nissan Chemical Industries, Ltd., Chiba 274-8507, Japan
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 12 November 2009
Available online 26 November 2009
A structurally unique isoxazoline class compound, A1443, exhibits antiparasitic activity against cat fleas
and dog ticks comparable to that of the commercial ectoparasiticide fipronil. This isoxazoline compound
inhibits specific binding of the
propylbicycloorthobenzoate (EBOB) to housefly-head membranes, with an IC50 value of 455 pM. In con-
trast, the IC50 value in rat-brain membranes is >10 M. To study the mode of action of this isoxazoline, we
c
-aminobutyric acid (GABA) receptor channel blocker [3H]40-ethynyl-4-n-
Keywords:
GABA
Glutamate
Ligand-gated ion channel
Parasiticide
Receptor
l
utilized MdGBCl and MdGluCl cDNAs, which encode the subunits of housefly GABA- and glutamate-gated
chloride channels, respectively. Two-electrode voltage clamp electrophysiology was used to confirm that
A1443 blocks GABA- and glutamate-induced chloride currents in Xenopus oocytes expressing MdGBCl or
MdGluCl channels, with IC50 values of 5.32 and 79.9 nM, respectively. Blockade by A1443 was observed in
A20S-MdGBCl and S20A-MdGluCl mutant channels at levels similar to those of the respective wild-types,
and houseflies expressing A20S-MdGBCl channels were as susceptible to A1443 as standard houseflies.
These findings indicate that A1443 is a novel and specific blocker of insect ligand-gated chloride
channels.
Ó 2009 Elsevier Inc. All rights reserved.
Introduction
neurons or muscle cells, whereas ligand-gated chloride channels
(LGCCs) mediate fast inhibitory synaptic transmission by enhancing
Neurotransmitter receptors are membrane proteins that are di-
rectly involved in transmembrane signaling in both neurons and
muscle cells. They are important not only in the function and reg-
ulation of the nervous system but also as common targets of drugs,
insecticides, and parasiticides [1]. Neonicotinoid insecticides act as
agonists of nicotinic acetylcholine receptors (nAChRs) [2]. Phen-
ylpyrazoles such as fipronil and ethiprole, and macrolides such as
avermectins and milbemycins, are commercially available insecti-
chloride ion permeability through the postsynaptic membrane.
Glutamate receptors exist as both excitatory cation channels
and inhibitory anion channels. However, inhibitory glutamate
receptors are found only in invertebrates. It is interesting that
invertebrates uniquely express not only glutamate- but also bio-
genic amine-gated chloride channels, whereas most of the verte-
brate biogenic amine receptors are G protein-coupled receptors
[1,4–6]. The specific expression of these LGCCs in invertebrates
encouraged us to explore whether they might serve as insecticide
and parasiticide targets.
GABA receptors were first shown to be a target of the organo-
chlorine insecticides lindane and dieldrin [7,8], both of which were
banned because of its environmental persistence on account of
their chemical structures. In the past three decades, structurally di-
verse insecticidal compounds have been reported to act as non-
competitive antagonists or blockers for GABA and inhibitory
glutamate receptors [3]. However, no further development of prac-
tical insecticides or parasiticides has been reported since the dis-
covery of the phenylpyrazole insecticide two decades ago. We
have recently found that a novel isoxazoline class compound,
A1443 (Fig 1A), which is under investigation as an ectoparasiticide,
acts as a potent blocker of housefly GABA- and glutamate-gated
chloride channels (named MdGBCls and MdGluCls, respectively).
cides and parasiticides that target
c-aminobutyric acid (GABA)
receptors and inhibitory glutamate receptors in invertebrates [3].
The ionotropic GABA receptors comprise a family of ‘‘Cys-loop
receptors”, together with nAChRs, glycine receptors, and 5-hydroxy-
tryptamine type 3 receptors (5-HT3Rs). The receptors that belong to
this family are composed of five subunits that form integral ion
channels. nAChRs and 5-HT3Rs form cation channels at the center
of the pentamers, and the other receptors similarly form anion (chlo-
ride) channels. Because each neurotransmitter gates its specific ion
channels, these receptors are termed ligand (neurotransmitter)-
gated ion channels. Ligand-gated cation channels mediate fast excit-
atory synaptic transmission by allowing the influx of cations into
* Corresponding author. Fax: +81 852 32 6092.
E-mail address: ozoe-y@life.shimane-u.ac.jp (Y. Ozoe).
0006-291X/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved.
doi:10.1016/j.bbrc.2009.11.131

Y. Ozoe et al. / Biochemical and Biophysical Research Communications 391 (2010) 744–749
745
We provide here evidence for the unique blocking actions of A1443
on invertebrate LGCCs.
the mean 4-d mortality in three (D. variabilis) or five (C. felis)
replications.
Insecticidal assays. Acetone solutions (1 ll) of compounds were
topically applied on the notum of adult 3- to 5-day-old female
OCR and SRS houseflies, using an Arnold hand microapplicator
(Burkard Scientific, Rickmansworth, England). Thirty flies were
used for each dosage. Treated flies were kept at 25 °C with sugar
and water. LD50 values were calculated from the mean 24-h mor-
tality data across three replications using standard probit analysis.
[3H]EBOB binding assays. Binding assays were performed using
housefly (SRS)-head membranes and rat-brain membranes as pre-
viously described [11]. Nonspecific binding was determined in the
Materials and methods
Chemicals. GABA and fipronil were purchased from Wako Pure
Chemicals Industries (Osaka, Japan). Sodium
L-(+)-glutamate
monohydrate was obtained from Sigma–Aldrich (St. Louis, MO).
[3H]EBOB (47.5 Ci/mmol) was purchased from PerkinElmer (Wal-
tham, MA). Isoxazoline A1443 was synthesized according to the
procedure described in a patent [9]. As A1443 is a racemate, the
enantiomers, (S)-A1443 (A664) and (R)-A1443 (A663), were sepa-
rated using HPLC equipped with a CHIRALPAKÒ AD-H column
(2.0 ꢀ 25 cm, 1/1 hexane/EtOH) (Daicel Chemical Industries, Osaka,
presence of 1
lM a-endosulfan (Wako). Experiments were repli-
cated three times.
cDNAs encoding the wild type and the 20 mutant of MdGBCl and
MdGluCl subunits. In previous studies [12,13], we have described
how the expression vector pcDNA3 can be inserted with cDNAs
that encode wild-type MdGBCl (MdRdl) and MdGluCl subunits
and a 20 (S278A) mutant MdGluCl subunit. The cDNA that encodes
a 20 (A299S) mutant MdGBCl subunit was prepared from the cDNA
of the wild type, using a QuikChange site-directed mutagenesis kit
(Stratagene, La Jolla, CA, USA). Oligonucleotide primers used for the
mutagenesis were MdGBCl-A299S-f (CCAGCCCGTGTATCTTTAGGT
GTCAC) and MdGBCl-A299S-r (GTGACACCTAAAGATACACGGGCT
GG).
Japan). (S)-A1443 (A664): mp 173.0–175.0 °C, [
1.10, ethanol), 99% ee. (R)-A1443 (A663): amorphous, [a]
ꢁ58.95 (c 1.15, ethanol), 99% ee. The enantiomer excess was deter-
mined using CHIRALPAKÒ AD-H (4.6 ꢀ 250 mm, 1/1 hexane/EtOH).
The absolute configuration of A664 was determined by single crys-
tal X-ray analysis (data not shown).
a
]
D
23.1 +61.96 (c
23.1
D
Specimens. The dieldrin-resistant (OCR) and susceptible (SRS)
strains of houseflies (Musca domestica) were kindly supplied by
Professor Jeffrey G. Scott (Cornell University, Ithaca, NY). OCR
houseflies exhibit a homozygous A299S mutation [10]. Mature fe-
male African clawed frogs (Xenopus laevis) were purchased from Ja-
pan SLC (Shizuoka, Japan). Rats (male Wister, 5 weeks old) were
purchased from Shimizu Laboratory Supplies (Kyoto, Japan). Cat
fleas (Ctenocephalides felis) and American dog ticks (Dermacentor
variabilis) were obtained from Stillmeadow (Sugar Land, TX).
Antiparasitic assays. Acetone solutions of several relevant com-
pounds were uniformly coated onto the inner surface of 5.3-cm
TPX petri dishes (Nalgene Nunc International, Tokyo, Japan) at
Preparation of cRNA. Templates for in vitro transcription were
obtained by amplifying the inserts of pcDNA3-MdGluCl and
pcDNA3-MdGBCl plasmids by PCR using KOD-Plus polymerase
(Toyobo, Osaka, Japan) and the primers pcDNA3-F (CTCTCTGGCTA
ACTAGAGAACC) and pcDNA3-R (CTAGAAGGCACAGTCGAGGCTG).
The capped RNA transcripts were synthesized using T7 polymerase
(mMESSAGE mMACHINEÒ T7 Ultra Kit, Ambion, Austin, TX). cRNA
samples were stored at ꢁ80 °C until use.
10 l
l/cm2 and then dried to produce a film of the test compounds.
Twelve flea adults or tick nymphs were released in each petri dish
and kept at 25 °C without food. LD95 values were determined from
Expression of channels in Xenopus laevis oocytes. Xenopus laevis
was anesthetized by immersion in 0.1% tricaine (Sigma–Aldrich)
Fig. 1. Inhibition of [3H]EBOB binding to housefly-head and rat-brain membranes by the isoxazolines A1443, A663, and A664, and fipronil. (A) Structures of the compounds
tested. (B) Concentration-inhibition curves. Each point represents the mean SE of at least three experiments.

746
Y. Ozoe et al. / Biochemical and Biophysical Research Communications 391 (2010) 744–749
for 30 min. Ovary lobes were treated with collagenase type 1A (Sig-
ma–Aldrich; 2 mg/ml) in Ca2+-free standard oocyte saline (SOS)
(100 mM NaCl, 2 mM KCl, 1 mM MgCl2, and 5 mM HEPES, pH
7.6) for 90 min at 25 °C. Each oocyte (stage V-VI) was injected with
2–10 ng of either MdGBCl or MdGluCl cRNA dissolved in nuclease-
free water, and then the oocytes were incubated at 16 °C in a sterile
SOS medium (100 mM NaCl, 2 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2,
and 5 mM HEPES, pH 7.6) containing gentamycin (Sigma–Aldrich;
(Fig. 1A)] were separated and examined for their antiparasitic
activity. The LD95 values of A664 for cat fleas and dog ticks were
not significantly different from those of A1443, whereas A663
was inactive at the tested highest dose for both ectoparasites. This
finding indicates that the S-enantiomer is the active component of
A1443.
Effects of isoxazolines against dieldrin-resistant houseflies
50
lg/ml), penicillin–streptomycin (Sigma–Aldrich; 100 U/ml,
100
l
g/ml), 2.5 mM sodium pyruvate (Wako), and 4% horse serum
The insecticidal activity of A1443 against the OCR and SRS strains
of houseflies was determined in order to investigate the cross-resis-
tance of OCR houseflies to A1443. The OCR strain is resistant to diel-
drin, a GABA receptor channel blocker and a classical chlorinated
insecticide [10]. The LD50 value of A1443 in OCR houseflies
(1.01 0.11 (SE) ng/mg) was not significantly different from that
in dieldrin-susceptible SRS houseflies (0.853 0.056 ng/mg).
(Life Technologies, Carlsbad, CA). Oocytes incubated at 16 °C for 2–
6 days after cRNA injection were used for electrophysiological
recordings.
Electrophysiology. Electrophysiological experiments were per-
formed at a holding potential of ꢁ80 mV, using a two-electrode
voltage-clamp setup (TEV 200A, Dagan Corporation, Minneapolis,
MN). Micropipettes were prepared from glass capillaries
(1.2 mm ꢀ 90 mm, A-M Systems, Sequim, WA), using a pipette
puller (PE-2, Narishige, Tokyo, Japan), and filled with 2 M KCl to
Effects of isoxazolines on [3H]EBOB binding to housefly-head and rat-
brain membranes
give a resistance of 0.2–5 MX in the medium. The current signals
were digitized by a PowerLab 4/26 unit (ADInstruments, Colorado
Springs, CO). Experiments were carried out at 25 °C. Oocytes were
placed in a recording chamber perfused with a SOS solution by
gravity flow at 8–10 ml/min. GABA and glutamate dissolved in a
SOS medium were applied to oocytes for 20 and 10 s, respectively,
at intervals of 2–3 min. Dose–response curves were obtained by
sequential applications of increasing concentrations of GABA and
glutamate to MdGBCl and MdGluCl channels expressed in oocytes,
respectively. Test compounds were first dissolved in dimethyl sulf-
oxide (DMSO), and diluted with a SOS medium to a final DMSO
concentration of 0.1%, which failed to produce any response in oo-
cytes. The test compound solution was added to the perfusate after
three successive control applications of GABA or glutamate, and
then applied consecutively for the remainder of the experiments.
A binding assay using the radiolabeled GABA receptor channel
blocker [3H]40-ethynyl-n-propylbicycloorthobenzoate (EBOB) as a
ligand has been established as an excellent means by which to de-
tect inhibition and allosteric modulation of GABA receptors caused
by various chemicals [14,15]. The binding of [3H]EBOB to GABA
receptors is affected by the binding of not only noncompetitive
antagonists (channel blockers), but also agonists, competitive
antagonists, and activators such as ivermectin. Thus, we first uti-
lized this ligand to examine whether A1443 acts directly on GABA
receptors. Fig. 1B shows the effects of isoxazolines and fipronil on
specific [3H]EBOB binding to membranes prepared from housefly
heads and rat brains. A1443 inhibited [3H]EBOB binding to house-
fly-head membranes in a concentration-dependent fashion. In con-
trast to fipronil, which fully inhibited radioligand binding, the
inhibition by A1443 was partial, reaching a maximum at ꢂ80%.
The IC50 value of A1443 was estimated to be 455 pM, which is
ꢂ7-fold smaller than that of fipronil (Table 1). We then examined
the inhibitory potency of the enantiomers. Fig. 1B shows that the
S-enantiomer A664 has ꢂ1300-fold higher potency than the
antipode A663. The inhibitory activity of A1443 in rat-brain mem-
GABA (100 lM) or glutamate (100 lM) was repeatedly applied
with a test compound for 20 or 10 s at 2-min intervals during
the perfusion of the test compound. The minimum response was
regarded as the extent of inhibition (ꢂ5 min after the first applica-
tion of a test compound). IC50 values were determined from the
mean of three replications using standard probit analysis.
branes was also examined (Fig. 1B). A1443 at a 10 lM concentra-
tion inhibited specific [3H]EBOB binding to rat-brain membranes
by only 43%, indicating that housefly receptors are >2000-fold
more sensitive to A1443 than rat receptors.
Results
Effects of isoxazolines on cat fleas and dog ticks
Effects of isoxazolines on agonist-induced currents in housefly GABA
and inhibitory glutamate receptors
The antiparasitic activity of isoxazolines against cat fleas and
dog ticks was investigated using a dry film method. The LD95 val-
ues of A1443 against cat fleas and dog ticks were slightly greater
than those of fipronil (Table 1). As A1443 is a racemic compound,
the R- and S-enantiomers [designated A663 and A664, respectively
While EBOB is an excellent probe for GABA receptors, it has
been reported not to be highly specific to GABA receptors [16].
Table 1
Antiparasitic activity and potency of isoxazolines and fipronil in the inhibition of [3H]EBOB binding and the blockade of GABA- and glutamate-induced currents.
a
Compound
Antiparasitic activity (LC95
)
[3H]EBOB binding inhibitionb
Housefly
Current blockadeb
MdGBCl
Flea
Tick
Rat
MdGluCl
IC50
IC50
95% CI
IC50
IC50
95% CI
95% CI
A1443
A663
21 15
>10000
1.3 0.7
>10000
1.0 0.3
1.0 0.6
0.455
0.320
–0.680
70
–174
0.0636
–0.129
2.64
>10,000
5.32
3.10
79.9
52.7
–8.78
3750
–13160
3.78
–10.94
16.2
–121.2
9200
–29800
40.7
–94.2
112
110
—
—
—
6600
6.54
24.5
15300
61.2
A664
16
9
0.0831
3.40
Fipronil
4.3 1.6
165
–4.42
–36.9
–245
a
Units (mean SE) are ng/cm2.
Units are nM.
b

Y. Ozoe et al. / Biochemical and Biophysical Research Communications 391 (2010) 744–749
747
Fig. 2. Blockade of GABA- and glutamate-induced currents by A1443 and fipronil.
(A) Blockade of the response to 100 M GABA by 100 nM A1443 or fipronil in
MdGBCl channels. (B) Blockade of the response to 100 M glutamate by 10
l
l
lM
A1443 or fipronil in MdGluCl channels. GABA and glutamate were added for 20 s
and 10 s, respectively, at intervals of 2 min. A1443 or fipronil was bath-applied
continuously after three successive control applications of GABA or glutamate.
Thus, we examined the potency of isoxazolines on both GABA and
inhibitory glutamate receptors cloned from houseflies, i.e., homo-
oligomeric MdGBCl and MdGluCl channels transiently expressed
in Xenopus oocytes. As previously reported [12], respective robust
chloride-permeable channels were formed in oocytes after micro-
injections of cRNAs that encode the MdGBCl and MdGluCl sub-
units. The EC50 values of GABA and glutamate were estimated in
Fig. 3. Dose–response curves of the blockade of MdGBCl and MdGluCl channels by
(A) A1443, (B) fipronil, (C) A664, and (D) A663. The percentage agonist response
based on the peak inward current is plotted against the logarithm of the
concentration of each chemical. Each point represents the mean SE of responses
in at least three oocytes.
this study to be 160
(n = 5) for MdGBCl and MdGluCl channels, respectively.
Fig. 2A shows that 100 nM A1443 and fipronil blocked GABA
(100 M)-induced currents MdGBCl channels; Fig. 2B shows that
these compounds applied at 10 also blocked glutamate
(100 M)-induced currents in MdGluCl channels. Fig. 3A shows
2 lM (mean SE, n = 5) and 94.0 24.0 lM
and the mutant channels, respectively (95% confidence intervals
in parentheses). Not only did the mutant channels exhibit in-
creased sensitivity to fipronil, but the currents in the presence of
fipronil decayed more slowly than those in the wild-type equiva-
lents (Fig. 4C). In contrast, the potency of A1443 was unchanged
by the 20 mutation [79.9 (52.7–121.2) nM (wild-type) vs. 77.9
(52.0–116.8) nM (mutant)] (Fig. 4D), and no change in the time
course of current decay was observed in its presence (Fig. 4C).
We also investigated the blocking actions of A1443 on the 20
(A299S) mutant of MdGBCl channels. The EC50 value of GABA
l
lM
l
that the blockade of MdGBCl and MdGluCl channels by A1443 is
dose-dependent, with IC50 values of 5.32 nM and 79.9 nM, respec-
tively, as determined on the basis of the amplitudes of peak cur-
rents (Table 1). The MdGBCl channel is ꢂ15-fold more sensitive
to A1443 than the MdGluCl channel. For comparison, the blocking
activity of fipronil on both channels was also tested (Fig. 3B). Fipro-
nil was ꢂ7-fold more selective to the MdGBCl channel than to the
MdGluCl channel, with IC50 values of 24.5 nM and 165 nM, respec-
tively. The potency of A664 was not significantly different from
that of A1443 in either MdGBCl or MdGluCl channels, whereas
A663 was a ꢂ1200-fold and ꢂ190-fold weaker blocker than
A1443 in MdGBCl and MdGluCl channels, respectively (Fig. 3C
and D). This finding indicates that the S-enantiomer is the active
component of A1443.
was also increased in this mutant (269 75 (SE) lM, n = 4). How-
ever, the potencies of A1443 and fipronil were unaffected by this
mutation, with IC50 values of 2.81 (1.91–4.10) nM and 11.0 (6.5–
17.6) nM, respectively (95% confidence intervals in parentheses).
Discussion
In the present study, we provided two lines of evidence that the
antiparasitic isoxazoline A1443 is a potent blocker of insect LGCCs.
First, A1443 inhibited the binding of [3H]EBOB to housefly-head
membranes at subnanomolar concentrations; second, it blocked
agonist-induced currents of cloned housefly GABA and inhibitory
glutamate receptor channels at nanomolar concentrations. In con-
trast, A1443 inhibited [3H]EBOB binding to rat-brain membranes
Effects of isoxazolines on the 20 mutants of housefly GABA and
inhibitory glutamate receptors
The amino acid residue at the so-called 20 position of LGCC sub-
units (Fig. 4A) greatly affects the sensitivity of the channels to
blockers [13,17]. Therefore, we examined the effects of A1443 on
glutamate-induced currents in both the wild type and the 20
(S278A) mutant of MdGluCl channels. In agreement with our pre-
vious report [13], the EC50 value of glutamate on the mutant chan-
by only 43% at 10 lM, indicating that A1443 has only an extremely
weak blocking action on rat GABA receptors. In addition to its out-
standing potency and selectivity for insect LGCCs, A1443 is struc-
turally unique compared with the other blockers of GABA
receptor channels reported to date. Although A1443 belongs to
the phenylheterocycle class of compounds, which includes the
phenylpyrazole insecticides fipronil and ethiprole, the heterocyclic
nel was increased to 270 55 (SE)
lM (n = 3). Fig. 4B shows that
the blocking potency of fipronil on glutamate (100
l
M)-induced
currents was enhanced ꢂ9-fold by the mutation, with IC50 values
of 165 (112–245) nM and 18.1 (11.2–28.9) nM for the wild-type

748
Y. Ozoe et al. / Biochemical and Biophysical Research Communications 391 (2010) 744–749
Fig. 4. Effects of A1443 and fipronil on the S278A mutant of MdGluCl channels. (A) Amino acid sequences of transmembrane domain 2 in wild-type MdGBCl and wild-type
and mutant MdGluCl subunits. (B) Dose–response relationships of the blockade of glutamate (100 M)-induced currents by fipronil in wild-type and S278A mutant MdGluCl
channels. (C) Typical blockade of glutamate (100 M)-induced currents by 100 nM A1443 and fipronil in S278A mutant MdGluCl channels. (D) Dose–response relationships of
the blockade of glutamate (100 M)-induced currents by A1443 in wild-type and A278A mutant MdGluCl channels. Each point in (B) and (D) represents the mean SE of
responses in at least three oocytes.
l
l
l
ring of A1443 differs from that of the phenylpyrazoles in that it is
not aromatic. Additionally, A1443 has a longer side chain than the
phenylpyrazoles (Fig. 1A). The 2,6-dichloro-4-trifluoromethyl sub-
stitution on the phenyl group of the phenylpyrazole class of block-
ers is essential for their high potency [18], but A1443 has two
chlorines at the 3 and 5 positions. Thus, A1443 displays a fairly no-
vel chemistry among the LGCC blockers.
In this study, we compared the effects of A1443 on the 20 mu-
tants with those of fipronil to examine whether the two com-
pounds share a site of action. If the two compounds bind to a
common site, the responses of the mutants to these compounds
are assumed to be similar. Consistent with our previous results
[13], the blocking potency of fipronil toward 100 lM glutamate-in-
duced currents was enhanced by the S278A mutation (Fig. 4B). By
contrast, the potency of A1443 was not significantly changed by
the S278A mutation (Fig. 4C). Fipronil also affected the decay rate
of glutamate-induced currents in the mutant, whereas A1443 did
not. These findings with the MdGluCl mutant suggest that fipronil
might interact with the 20 amino acid in MdGluCl channels
whereas this residue might not be involved in the interaction with
A1443. The effects of the reverse mutation (A ? S) were also tested
in MdGBCl channels; the results confirmed that both A1443 and
The unique structural features of A1443 prompted us to exam-
ine whether A1443 shares a binding site with the classical channel
blockers. To this end, we constructed two mutant channels with an
amino acid replacement at the so-called 20 position of each sub-
unit. Insect GABA receptor subunits feature an alanine at this posi-
tion (Fig. 4A), and replacing this amino acid with a serine or a
glycine (the so-called Rdl mutation) confers reduced sensitivity
to blockers and resistance to insecticides [17]. This amino acid re-
sides in the second transmembrane domain (M2) of the subunits,
which assemble to form a pentameric channel complex (Fig. 4A).
The position is on the cytoplasmic side of the channel lumen [3].
It is interesting that inhibitory glutamate receptors have a serine
at the equivalent position (Fig. 4A). The fact that wild-type gluta-
mate receptors have the same 20 amino acid as the GABA receptor
Rdl mutants may explain why most blockers have a lower affinity
for glutamate receptors than for GABA receptors [12,16]. We re-
cently tested this possibility by replacing the 20 (278) serine resi-
due of MdGluCl with an alanine [13]. The GABA receptor channel
blockers, such as fipronil, lindane, and picrotoxinin, showed higher
potencies toward the S278A mutant of MdGluCl channels than to-
ward the wild-type channels when the channels were activated by
fipronil were as effective at blocking currents induced by 100 lM
GABA in the A299S mutant MdGBCl channel as they were in the
wild type. This was a somewhat unexpected finding because the
homologous Drosophila Rdl mutant channels expressed in Xenopus
oocytes were less sensitive to fipronil than the wild type [19].
However, [3H]EBOB binding assays have shown that head mem-
branes prepared from houseflies with the A299S mutation will
bind to fipronil with high affinity, as did membranes from wild-
type houseflies [10]. Accordingly, there may be certain functional
or structural differences between the Drosophila and Musca chan-
nels. Taken together with the finding that OCR houseflies, which
are resistant to known LGCC blockers [10,20], are susceptible to
A1443, these results suggest that A1443 might bind to a site at
least partly different from the one bound by known blockers in
MdGBCl channels. Together, the results of this study demonstrate
that the isoxazoline A1443 is a novel and potent LGCC blocker that
has considerable potential for antiparasitic use.
30 lM glutamate. Taken together with the findings regarding the
GABA receptor mutants [17], these results can be interpreted as
indicating that hydrophobic amino acids at the 20 position are
favorable to interactions with classical blockers.

Y. Ozoe et al. / Biochemical and Biophysical Research Communications 391 (2010) 744–749
749
triazoles as selective insect GABA receptor antagonists, J. Agric. Food Chem. 54
(2006) 1361–1372.
References
[12] Y. Eguchi, M. Ihara, E. Ochi, Y. Shibata, K. Matsuda, S. Fushiki, H. Sugama, Y.
Hamasaki, H. Niwa, M. Wada, F. Ozoe, Y. Ozoe, Functional characterization
of Musca glutamate- and GABA-gated chloride channels expressed
independently and coexpressed in Xenopus oocytes, Insect Mol. Biol. 15
(2006) 773–783.
[1] V. Raymond, D.B. Sattelle, Novel animal-health drug targets from ligand-gated
chloride channels, Nat. Rev. Drug Discov. 1 (2002) 427–436.
[2] K. Matsuda, S. Kanaoka, M. Akamatsu, D.B. Sattelle, Diverse actions and target-
site selectivity of neonicotinoids: structural insights, Mol. Pharmacol. 76
(2009) 1–10.
[13] K. Hirata, C. Ishida, Y. Eguchi, K. Sakai, F. Ozoe, Y. Ozoe, K. Matsuda, Role of a
[3] Y. Ozoe, M. Takeda, K. Matsuda, c-Aminobutyric acid receptors: a rationale for
serine residue (S278) in the pore-facing region of the housefly
L-glutamate-
gated chloride channel in determining sensitivity to noncompetitive
antagonists, Insect Mol. Biol. 17 (2008) 341–350.
developing selective insect pest control chemicals, in: I. Ishaaya, A.R. Horowitz
(Eds.), Biorational Control of Arthropod Pests: Application and Resistance
Management, Springer, Heidelberg, 2009, pp. 131–162.
[14] Y. Deng, C.J. Palmer, J.E. Casida, House fly brain
c-aminobutyric acid-gated
[4] V.T.S. Rao, S.Z. Siddiqui, R.K. Prichard, S.C. Forrester, A dopamine-gated ion
channel (HcGGR3) from Haemonchus contortus is expressed in the cervical
papillae and is associated with macrocyclic lactone resistance, Mol. Biochem.
Parasitol. 166 (2009) 54–61.
chloride channel: target for multiple classes of insecticides, Pestic. Biochem.
Physiol. 41 (1991) 60–65.
[15] Y. Deng, J.E. Casida, House fly head GABA-gated chloride channel:
toxicologically relevant binding site for avermectins coupled to site for
ethynylbicycloorthobenzoate, Pestic. Biochem. Physiol. 43 (1992) 116–122.
[16] M. Ihara, C. Ishida, H. Okuda, Y. Ozoe, K. Matsuda, Differential blocking
[5] J.K. Pirri, A.D. McPherson, J.L. Donnelly, M.M. Francis, M.J. Alkema, A tyramine-
gated chloride channel coordinates distinct motor programs of
a
Caenorhabditis elegans escape response, Neuron 62 (2009) 526–538.
actions of 40-ethynyl-4-n-propylbicycloorthobenzoate (EBOB) and
c-
[6] N. Ringstad, N. Abe, H.R. Horvitz, Ligand-gated chloride channels are receptors
for biogenic amines in C. elegans, Science 325 (2009) 96–100.
[7] S.M. Ghiasuddin, F. Matsumura, Inhibition of gamma-aminobutyric acid
(GABA)-induced chloride uptake by gamma-BHC and heptachlor epoxide,
Comp. Biochem. Physiol. 73C (1982) 141–144.
[8] L.J. Lawrence, J.E. Casida, Interactions of lindane, toxaphane and cyclodienes
with brain-specific t-butylbicyclophosphorothionate receptor, Life. Sci. 35
(1984) 171–178.
[9] T. Mita, T. Kikuchi, T. Mizukoshi, M. Yaosaka, M. Komoda (Nissan Chemical
Industries, Ltd.), Isoxazoline-substituted benzamide compound and noxious
organism control agent, WO 2005-085126, JP 2007-308471.
[10] Y. Ozoe, S. Ishikawa, S. Tomiyama, F. Ozoe, T. Kozaki, J.G. Scott, Antagonism of the
GABA receptor of dieldrin-resistant houseflies by fipronil and its analogues, in:
J.W. Lyga, G. Theodoridis (Eds.), Synthesis and Chemistry of Agrochemicals VII,
American Chemical Society, Washington, DC, 2007, pp. 39–50.
[11] M.S. Alam, R. Kajiki, H. Hanatani, X. Kong, F. Ozoe, Y. Matsui, F. Matsumura, Y.
Ozoe, Synthesis and structure-activity relationships of 1-phenyl-1H-1,2,3-
hexachlorocyclohexane (c-HCH) on c-aminobutyric acid- and glutamate-
induced responses of American cockroach neurons, Invert. Neurosci. 5 (2005)
157–164.
[17] R.H. ffrench-Constant, T.A. Rocheleau, J.C. Steichen, A.E. Chalmers, A point
mutation in a Drosophila GABA receptor confers insecticide resistance, Nature
363 (1993) 449–551.
[18] Y. Ozoe, K. Yagi, M. Nakamura, M. Akamatsu, T. Miyake, F. Matsumura,
Fipronil-related heterocyclic compounds: structure–activity relationships for
interaction with
c-aminobutyric acid- and voltage-gated ion channels and
insecticidal action, Pestic. Biochem. Physiol. 66 (2000) 92–104.
[19] A.M. Hosie, H.A. Baylis, S.D. Buckingham, D.B. Sattelle, Actions of the
insecticide fipronil, on dieldrin-sensitive and -resistant GABA receptors of
Drosophila melanogaster, Br. J. Pharmacol. 115 (1995) 909–912.
[20] J.G. Scott, Z. Wen, Toxicity of fipronil to susceptible and resistant strains of
German cockroaches (Dictyoptera: Blattellidae) and house flies (Diptera:
Muscidae), J. Econ. Entomol. 90 (1997) 1152–1156.