Mechanistically elucidating the in vitro safety and efficacy of a novel doxorubicin derivative

Article abstract of DOI:10.1007/s13346-017-0379-2

Doxorubicin is an effective anticancer drug; however, it is cardiotoxic and has poor oral bioavazilability. Quercetin is a plant-based flavonoid with inhibitory effects on P-glycoprotein (P-gp) and CYP3A4 and also antioxidant properties. To mitigate these therapeutic barriers, DoxQ, a novel derivative of doxorubicin, was synthesized by conjugating quercetin to doxorubicin. The purpose of this study is to mechanistically elucidate the in vitro safety and efficacy of DoxQ. Drug release in vitro and cellular uptake by multidrug-resistant canine kidney (MDCK-MDR) cells were quantified by HPLC. Antioxidant activity, CYP3A4 inhibition, and P-gp inhibitory effects were examined using commercial assay kits. Drug potency was assessed utilizing triple-negative murine breast cancer cells, and cardiotoxicity was assessed utilizing adult rat and human cardiomyocytes (RL-14). Levels of reactive oxygen species and gene expression of cardiotoxicity markers, oxidative stress markers, and CYP1B1 were determined in RL-14. DoxQ was less cytotoxic to both rat and human cardiomyocytes and retained anticancer activity. Levels of ROS and markers of oxidative stress demonstrate lower oxidative damage induced by DoxQ compared to doxorubicin. DoxQ also inhibited the expression and catalytic activity of CYP1B1. Additionally, DoxQ inhibited CYP3A4 and demonstrated higher cellular uptake by MDCK-MDR cells than doxorubicin. DoxQ provides a novel therapeutic approach to mitigate the cardiotoxicity and poor oral bioavailability of doxorubicin. The cardioprotective mechanism of DoxQ likely involves scavenging ROS and CYP1B1 inhibition, while the mechanism of improving the poor oral bioavailability of doxorubicin is likely related to inhibiting CYP3A4 and P-gp.

Full text of DOI:10.1007/s13346-017-0379-2

Drug Deliv. and Transl. Res.
DOI 10.1007/s13346-017-0379-2
ORIGINAL ARTICLE
Mechanistically elucidating the in vitro safety
and efficacy of a novel doxorubicin derivative
Samaa Alrushaid1 & Yunqi Zhao 2 & Casey L. Sayre1,3 & Zaid H. Maayah4
&
M. Laird Forrest5 & Sanjeewa N. Senadheera5 & Kevin Chaboyer1,6
Hope D. Anderson1,6 & Ayman O. S. El-Kadi4 & Neal M. Davies4
&
#
Controlled Release Society 2017
Abstract Doxorubicin is an effective anticancer drug; how-
ever, it is cardiotoxic and has poor oral bioavazilability.
Quercetin is a plant-based flavonoid with inhibitory effects
on P-glycoprotein (P-gp) and CYP3A4 and also antioxidant
properties. To mitigate these therapeutic barriers, DoxQ, a
novel derivative of doxorubicin, was synthesized by conjugat-
ing quercetin to doxorubicin. The purpose of this study is to
mechanistically elucidate the in vitro safety and efficacy of
DoxQ. Drug release in vitro and cellular uptake by
multidrug-resistant canine kidney (MDCK-MDR) cells were
quantified by HPLC. Antioxidant activity, CYP3A4 inhibi-
tion, and P-gp inhibitory effects were examined using com-
mercial assay kits. Drug potency was assessed utilizing triple-
negative murine breast cancer cells, and cardiotoxicity was
assessed utilizing adult rat and human cardiomyocytes (RL-
14). Levels of reactive oxygen species and gene expression of
cardiotoxicity markers, oxidative stress markers, and
CYP1B1 were determined in RL-14. DoxQ was less cytotoxic
to both rat and human cardiomyocytes and retained anticancer
activity. Levels of ROS and markers of oxidative stress dem-
onstrate lower oxidative damage induced by DoxQ compared
to doxorubicin. DoxQ also inhibited the expression and cata-
lytic activity of CYP1B1. Additionally, DoxQ inhibited
CYP3A4 and demonstrated higher cellular uptake by
MDCK-MDR cells than doxorubicin. DoxQ provides a novel
therapeutic approach to mitigate the cardiotoxicity and poor
oral bioavailability of doxorubicin. The cardioprotective
mechanism of DoxQ likely involves scavenging ROS and
CYP1B1 inhibition, while the mechanism of improving the
poor oral bioavailability of doxorubicin is likely related to
inhibiting CYP3A4 and P-gp.
Dr. Yunqi Zhao was instrumental in developing the chemical synthesis of
the drug (DoxQ), and this contribution is equal to the first author Samaa
Alrushaid.
.
.
.
Keywords Doxorubicin Quercetin Cardiotoxicity
* Neal M. Davies
Bioavailability
ndavies@ualberta.ca
1
College of Pharmacy, Rady Faculty of Health Sciences, University of
Introduction
Manitoba, Winnipeg, MB R3E 0T5, Canada
2
School of Pharmaceutical Sciences and Yunnan Provincial Key
Doxorubicin, also called adriamycin, is an anticancer drug
used to treat lymphomas and breast and ovarian cancers [1].
The anticancer activity of doxorubicin is due to its intercala-
tion between the two strands of DNA, inhibiting the activity of
topoisomerase and DNA synthesis [2, 3]. Despite the clinical
effectiveness of doxorubicin, its use is limited by off-target
adverse effects particularly dose-related cardiotoxicity, which
can be life threatening [4]. Additionally, doxorubicin is a sub-
strate of the P-glycoprotein (P-gp) efflux pump [5] and cyto-
chrome P450 metabolic enzymes [6], both of which contribute
to its poor oral absorption and low oral bioavailability. For this
Laboratory of Pharmacology for Natural Products, Kunming Medical
University, Kunming 650500, Yunnan, People’s Republic of China
3
College of Pharmacy, Roseman University of Health Sciences, South
Jordan, UT 84096, USA
4
Faculty of Pharmacy and Pharmaceutical Sciences, University of
Alberta, Edmonton, AB T6G 2R3, Canada
5
Department of Pharmaceutical Chemistry, School of Pharmacy,
University of Kansas, Lawrence, KS 66047, USA
6
Canadian Centre for Agri-Food Research in Health and Medicine, St.
Boniface Hospital Research Centre, Winnipeg, MB R2H 2A6,
Canada

Drug Deliv. and Transl. Res.
reason, doxorubicin is only available as a parenteral treatment,
which is administered intravenously as a hydrochloride salt
formulation.
Over the years, several attempts were undertaken to over-
come these limitations including drug delivery systems such
as micelles [7], synthetic polymer conjugates [8], and
antibody-targeted carriers [9] with varied success. The cur-
rently available formulation of doxorubicin (Doxil™) is a
pegylated liposomal formulation [10] that is administered in-
travenously and retains the risk of cardiotoxicity.
comparison to doxorubicin to assess its cardiotoxicity and
suggest possible mechanisms involved in cardioprotection or
cardiotoxicity. The effects of the novel derivative were also
examined in murine breast cancer cells to assess anticancer
activity.
Materials and methods
Materials
The potential therapeutic utility of polyphenols, including
flavonoids, is being studied extensively [11]. One flavonoid
found in plant-based food with potential health benefits is
quercetin. Quercetin has been reported to have a role in pre-
vention of diseases such as liver disease [12], pulmonary hy-
pertension [13], and other cardiovascular diseases [14].
Furthermore, quercetin exhibits anti-inflammatory [15], anti-
cancer [16], and antioxidant [17, 18] effects.
Doxorubicin and quercetin were obtained from Sigma-
Aldrich (Oakville, ON). Chemical solvents were from Fisher
(Ottawa, ON). H-Gly-OtBu-HCl was from Bachem Americas,
Inc. (Torrance, CA). Bis(4-nitrophenyl) carbamate was from
Alfa Aesar (Tewksbury, MA).
Cayman antioxidant assay kit catalogue# 709001 was pur-
chased from Cayman Chemical (Ann Arbor, MI), cytochrome
P450 kit catalogue# P2857 was from Life Technologies
(Burlington, ON), and P-glycoprotein assay kit catalogue#
V3601 was from Promega (Madison, WI). High-Capacity
cDNA Reverse Transcription Kit for 200 or 1000 reactions
was obtained from Applied Biosystems (AB).
Preliminary studies suggest that combining quercetin with
doxorubicin may have beneficial effects. Quercetin enhanced
the antitumor effect of doxorubicin in HT29 colorectal cancer
cell line [19], MCF-7 breast cancer cell line [20], liver cancer
cells [21], and K562 human leukemia cell line [22]. Quercetin
also showed cardioprotection against cardiotoxicity induced by
doxorubicin [23, 24]. Additionally, quercetin could potentially
minimize doxorubicin’s loss during first-pass metabolism and
P-gp efflux by inhibiting CYP3A4 and P-gp and thus enhance
its oral bioavailability [25]. Furthermore, quercetin has a natural
tendency to be transported to the lymphatics after intraduodenal
administration in rat studies as its concentrations in the lymph
were higher than those in plasma [26]. This observation suggests
that quercetin may be preferentially absorbed from the intestine
into the lymphatics over the hepatic portal vein, resulting in lower
first-pass effect and improved bioavailability. As bioavailability
(F) = 1 − extraction ratio (E), utilizing quercetin as a novel
lymphatically targeted carrier for doxorubicin could increase its
systemic delivery (F) by increasing its localization and delivery
in the lymphatics through a reduction in its first-pass liver me-
tabolism and extraction (E). Here, quercetin was conjugated to
doxorubicin via a glycine linker to give DoxQ as a novel deriv-
ative and delivery system of doxorubicin. The doxorubicin-
quercetin conjugate (DoxQ) may provide a natural lymphatically
targeted delivery approach to improve lymphatic metastasis and
may also serve as a novel therapeutic delivery approach to im-
prove the safety and tolerability of doxorubicin in patients both
parenterally and orally.
Chemical synthesis
The chemical synthesis of the doxorubicin-quercetin conjugate
(DoxQ) is shown in Fig. 1. All glassware was oven-dried at
140 °C prior to use. Dry organic solvents (tetrahydrofuran
(THF) and dimethylformamide (DMF)) were used. Reactions
were performed at ambient temperature under dry argon.
Compound 1 (quercetin-Gly-tBu)
Quercetin-Gly-tBu was synthesized according to Kim et al.
[27], with some modifications. In a 100-ml round-bottom
flask (RBF), H-Gly-OtBu-HCl (1 g, 6 mmol) and bis(4-nitro-
phenyl) carbonate (2 g, 6.6 mmol) were dissolved in 30 ml of
dry THF and 15 ml of DMF with stirring. Two milliliters of
diisopropylethylamine (DIPEA) was then added to the RBF to
initiate the reaction. The reaction was maintained at ambient
temperature for 24 h. The following day, quercetin (1.82 g,
1.82 mmol) was added gradually over 10 min with stirring.
The reaction was maintained for an additional 24 h. The prod-
uct was transferred to a clean 250-ml RBF and concentrated
under reduced pressure. The crude product was further dried
overnight under high vacuum. The dried yellowish crude
product was purified over the silica gel using a dichlorometh-
ane (DCM)/acetone solvent system (gradient solvent system:
initially 10:90, then 15:85, and finally 20:80). The fractions
were analyzed by TLC (1:10, acetone/DCM). The fractions of
interest were combined and concentrated under reduced pres-
In this study, the in vitro safety and efficacy of DoxQ are
mechanistically characterized. The efficacy, metabolism, and
safety of DoxQ in comparison to doxorubicin are examined
for the first time with a potential to enhance the bioavailability,
safety, and efficacy of the parent compound utilizing several
in vitro assays. Additionally, the effects of DoxQ on adult rat
cardiomyocytes and human cardiomyocytes were tested in
1
sure to afford compound 1 as yellow solid (2 g). H-NMR

Drug Deliv. and Transl. Res.
Fig. 1 A schematic diagram of
DoxQ synthesis
HATU/DIPEA/DMF
(acetone-d6, 400 MHz): δ = 12.06 (s, 1H), 9.23 (bs, 1H), 7.99
(d, J = 2.2 Hz, 1H), 7.96 (dd, J = 8.6, 2.1 Hz, 1H), 7.06 (d,
J = 8.7 Hz, 1H), 6.99 (t, J = 6.6 Hz, 1H), 6.46 (t, J = 2.1 Hz,
1H), 6.21 (t, J = 2.1 Hz, 1H), 3.86 (d, J = 6.0 Hz, 2H), 1.43 (s,
9H); ESI (m/z); calculated for C22H20NO10 (M-H)−:
458.1087; found: 458.0047.
(HATU) (655 mg, 1.72 mol) were dissolved in 100 ml of
dry DMF with stirring. DIPEA (1.3 ml, 6.9 mmol) was added
last. The reaction was maintained at ambient temperature with
stirring over 48 h in the dark.
The reaction mixture was concentrated under reduced pres-
sure in the dark. The crude product was purified by recrystal-
lization using MeCN and MeOH as follows: the crude product
was dissolved in a minimum amount of MeCN/MeOH (4:1,
10 ml) with the help of sonication and heating (~50–60 °C).
The resulting solution was allowed to cool down to facilitate
the crystallization, and the RBF was stored overnight at 4 °C
in a refrigerator to facilitate crystallization/precipitation of the
product. The dark red product with the solution was trans-
ferred into a 50-ml centrifugation tube and centrifuged at
4000g for 20 min. The supernatant was decanted. The centri-
fugation was repeated four times with ice-cold MeCN/MeOH
(4:1, 5 ml × 4). The supernatant was carefully pipetted/
decanted. After the final round of centrifugation, a clear solu-
tion of supernatant was observed. The resulting dark red solid
residue was collected and dried to afford the final compound 3
(DoxQ, ~500 mg; 1H-NMR (DMSO-d6, 400 MHz): δ = 8.32
(s, 1H), 7.94 (t, J = 6.4 Hz, 1H), 7.90 (d, J = 1.2 Hz, 1H), 7.88
(s, 1H), 7.79 (s, 1H), 7.71 (s, 1H), 7.15 (d, J = 8.4 Hz, 1H),
7.06 (d, J = 8.4 Hz, 1H), 6.46 (s, 1H), 6.19 (s, 1H), 5.50 (s,
1H), 5.23 (s, 1H), 4.97 (s, 1H), 4.87 (s, 2H), 4.57 (s, 1H), 4.16
(s, 1H), 4.00–3.89 (m, 3H), 3.07 (s, 3H), 3.00 (s, 1H), 2.92 (s,
3H), 2.78 (d, J = 9.6 Hz, 1H), 2.68 (d, J = 6.4 Hz, 1H), 2.21–
2.11 (m, 2H), 3.32 (s, 3H), 2.99–2.89 (m, 2H), 2.84–2.56 (m,
1H), 2.37–2.21 (m, 3H), 1.51–1.41 (m, 1H), 1.24 (s, 1H), 1.13
(d, J = 7.6 Hz, 3H); ESI (m/z); calculated for C45H40N2O20
(M+Na)+ calculated value 951.81; found: 951.2089.
Compound 2 (quercetin-Gly-COOH)
Compound 1 (2 g) was dissolved in 10 ml of DCM and cooled
on ice, and then 40 ml of trifluoroacetic acid (TFA) was added
gradually with stirring. An additional 10 ml of DCM was
added to rinse the walls of the RBF, and the reaction mixture
was stirred for 4 h. The resulting yellow precipitate was fil-
tered under vacuum using a ceramic Buchner funnel fitted
with a filter paper. The precipitate was washed with DCM
and ice-cold acetone and then oven-dried to afford compound
2 as a yellow solid (~1 g), which was used for the next step
without further purification. 1H-NMR (DMSO-d6, 400 MHz):
δ = 12.69 (bs, 1H), 12.44 (s, 1H), 10.81 (bs, 1H), 10.38 (bs,
1H), 9.56 (s, 1H), 8.02 (t, J = 6.8 Hz, 1H), 7.91 (dd, J = 8.6,
2.3 Hz, 1H), 7.88 (d, J = 2.2 Hz, 1H), 7.06 (d, J = 8.6 Hz, 1H),
6.47 (d, J = 2.0 Hz, 1H), 6.21 (d, J = 2.0 Hz, 1H), 3.77 (d,
J = 6.1 Hz, 2H); ESI (m/z); calculated for C18H12NO10 (M-
H)−: 402.0461; found: 402.0419.
Compound 3 (quercetin-Gly-Dox)
Doxorubicin HCl (500 mg, 0.86 mol), compound 2 (900 mg,
2.15 mol), and 1-[bis(dimethylamino)methylene]-1H-1,2,3-
triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate

Drug Deliv. and Transl. Res.
In vitro drug release and cellular uptake by MDCK-MDR
cells
plates at the concentration of 5000 cells/well in 90 μl of
growth medium. After 12 h, the parent compound doxorubi-
cin, quercetin, and a mixture of doxorubicin and quercetin
solution were added at different concentrations. Hanks’ solu-
tion and 10% trichloroacetic acid (TCA) were used as nega-
tive and positive control, respectively. The medium was
refreshed 8 h after treatment. At 72 h post-treatment, resazurin
blue (5 μM) was added and the resorufin product was mea-
sured with a fluorophotometer using an excitation wavelength
of 550 nm and an emission wavelength of 590 nm.
In vitro drug release studies
DoxQ release was examined in phosphate-buffered saline
(PBS) supplemented with 10% fetal bovine serum (FBS) at
37 °C. Aliquots (100 μl) from the sample were collected at
predetermined time intervals and analyzed by HPLC coupled
with a fluorescent detector (excitation/emission 480/590).
Cell culture and treatments
Effects on antioxidant activity
MDCK-MDR cells were maintained in high-glucose
Dulbecco’s modified Eagle’s medium (DMEM) with 1× L-
glutamine and sodium pyruvate that was supplemented with
10% FBS, 1× non-essential amino acid, and 1× penicillin-
streptomycin. The cells were seeded onto poly-L-lysine pre-
coated glass coverslips (BD, Franklin Lakes, NJ) in a 12-well
culture plate at a density of 5000 cells/well.
The antioxidant activity of DoxQ, doxorubicin, quercetin, or a
mixture of doxorubicin and quercetin was examined using the
antioxidant kit from Cayman Chemical. The assay is based on
the ability of the antioxidant in the sample to inhibit the oxi-
dation of ABTS® (2,2′-azino-di-[3-ethylbenzthiazoline sulfo-
nate]) to ABTS®·+ by metmyoglobin. The amount of ABTS
produced is measured by absorbance at 750 nm. Antioxidants
will suppress absorbance at 750 nm, and the suppression is
proportional to the concentration. The antioxidant capacity is
compared to a water-soluble tocopherol analog called Trolox.
The result of the assay was expressed as molar Trolox equiv-
alents. More information about the assay can be found in the
technical bulletin of the assay kit.
Cell imaging
After 12 h, the cells were treated with 50 nM free doxorubicin,
a mixture of doxorubicin and quercetin, or DoxQ alone with
3 μg/ml DAPI at 15 min prior to cell imaging. After treatment,
the cells were washed three times with PBS. Live cells were
rapidly imaged on a Nikon Eclipse 80i epifluorescence micro-
scope (Melville, NY) with a 20 × 0.75 NA objective and a
Hamamatsu ORCA ER digital camera (Houston, TX). The
GFP filter set (Nikon, NY) was used to image the fluorescence
signal from doxorubicin. All images were taken with identical
instrument settings and scaled equally so that fluorescence
intensity could be compared between independent images
and quantified accurately.
Effects on CYP3A4 activity
The inhibitory effects of CYP3A4 by DoxQ, doxorubicin,
quercetin, or a mixture of doxorubicin and quercetin were
examined using CYP Vivid kits from Life Technologies fol-
lowing the manufacturer’s instructions. The inhibitory effects
of the investigational compounds were compared to ketoco-
nazole as a positive inhibitor of CYP3A4, and the result was
expressed as percentage of inhibition. More information about
the assay can be found in the technical bulletin of the assay kit.
Quantification of cellular uptake
Cellular uptake and accumulation of doxorubicin in MDCK-
MDR cells was quantified using HPLC. Cells were seeded in
12-well plates at a density of 10,000 cells/well. After the cells
attached to the surface, 1 μM of doxorubicin, a mixture of
doxorubicin and quercetin, or DoxQ was added. After 6 h of
treatment, the supernatant was collected and analyzed.
Fluorescence signals were analyzed by ImageJ. Cellular up-
take was by quantified by HPLC.
Effects on P-glycoprotein activity
The Pgp-Glo kit from Promega was utilized to determine if
DoxQ exhibits inhibitory effects on P-gp or not. The assay
detects the effects of compounds on recombinant human P-
gp in a cell membrane fraction by measuring ATPase activity.
More information about the assay can be found in the techni-
cal bulletin of the assay kit.
Effects on murine breast cancer cells
Effects on adult rat cardiomyocytes
A triple-negative murine breast cancer cell line was main-
tained in Dulbecco’s modified Eagle’s medium supplemented
with 10% fetal bovine serum (HyClone Laboratory, Inc.,
Logan, UT). Cells were plated in white 96-well flat-bottomed
Care of the animals was in full compliance with the Canadian
Council on Animal Care, and animal ethics approval was
granted by the University of Manitoba Animal Care
Committee. Ventricular cardiomyocytes were isolated from

Drug Deliv. and Transl. Res.
adult rats and maintained. The effect of the novel derivative on
cell viability was examined in comparison to doxorubicin by
trypan blue assay.
Effect of doxorubicin and DoxQ on cell viability (MTT assay)
The effects of DoxQ on the RL-14 viability were determined
utilizing MTT assay. The assay measures the capacity of cells
to convert MTT to colored formazan crystals as described
previously [28, 29].
Cell isolation
Adult cardiac myocytes were isolated from 6- to 7-week-old
rats transferred to 24-well plates containing 500 μl of media.
The cells were incubated for 2 h in media.
Determination of reactive oxygen species levels by DCF assay
RL-14 cells grown to 90% confluence in 96-well cell culture
plates were treated for 24 h with the tested compounds.
Thereafter, the cells were washed with PBS before incubation
for 30 min in fresh media containing 10 μM
dichlorofluorescein (DCF). Fluorescence measurements at
excitation/emission (545/575 nm) of the wells were recorded
using the BioTek Synergy H1 Hybrid Multi-Mode Microplate
Reader (BioTek Instruments, Winooski, VT, USA).
Cell treatments
The cells were exposed to 1, 5, or 10 μM treatments of doxo-
rubicin, DoxQ, or control, 3% PEG in DMSO. Stock solutions
of the appropriate concentration were directly added to the
wells with a micropipette. Treatments were preformed in du-
plicate with each experiment. Three sets of experimental rep-
licates were preformed. All treatments proceeded under sterile
conditions in a biosafety cabinet. Following the treatments,
the cells were then incubated at 37 °C for 18 h.
RNA extraction and cDNA synthesis
Total RNA from the treated cells was isolated using TRIzol
reagent (Invitrogen®) according to the manufacturer’s instruc-
tions and quantified by measuring the absorbance at 260 nm.
RNA purity was determined by measuring the 260:280 ratio
(>1.8). Thereafter, first-strand complementary DNA (cDNA)
synthesis was performed using the High-Capacity cDNA
Reverse Transcription Kit (Applied Biosystems), according
to the manufacturer’s instructions as described previously
[30]. Briefly, 1.5 μg of total RNA from each sample was
added to a mixture of 2.0 μl of 10× reverse transcriptase buff-
er, 0.8 μl of 25× dNTP mix (100 mM), 2.0 μl of 10× reverse
transcriptase random primers, 1.0 μl of MultiScribe reverse
transcriptase, and 4.2 μl of nuclease-free water. The final
reaction mixture was kept at 25 °C for 10 min, heated to
37 °C for 120 min, heated to 85 °C for 5 min, and finally
cooled to 4 °C.
Cell staining and microscopy
After 18 h of incubation, 250 μl of media was removed from
each well and replaced with 250 μl of trypan blue dye, which
selectively dyes dead cells. The wells were then visualized
under a bright-field microscope, and six sets of pictures were
taken at random for each treatment.
Cell counting
Live and dead cells were manually counted. Dead cells were
identified to be of a rounded morphology and visibly darker
due to the staining with trypan blue. The ratio of dead to total
cell count was then calculated.
Quantification of mRNA expression by quantitative real-time
PCR
Effects on human cardiomyocytes (RL-14)
Cell culture and treatments
Quantitative analysis of specific mRNA expression was per-
formed by real-time polymerase chain reaction (PCR) by sub-
jecting the resulting 1.5 μg cDNA to PCR amplification using
96-well optical reaction plates in the ABI PRISM 7500
System (Applied Biosystems) [31]. The 25 μl reaction mix-
ture contained 0.1 μl of 10 μM forward primer and 0.1 μl of
10 μM reverse primer (40 nM final concentration of each
primer), 12.5 μl of SYBR Green Universal Master Mix,
11.05 μl of nuclease-free water, and 1.25 μl of cDNA sample.
Human and rat primer sequences for BNP, α-myocin heavy
chain (α-MHC), β-myocin heavy chain (β-MHC), GST-A1,
HO-1, CYP1B1, and β-actin are illustrated in Table 1. These
primers were purchased from Integrated DNA Technologies
Human cardiomyocytes (RL-14, American Type Cell Culture
Patent Deposit Designation PTA-1499, Manassas, VA) were
grown in DMEM/F-12 with phenol red supplemented with
12.5% fetal bovine serum, 20 μM L-glutamate, 100 IU peni-
cillin G, and 100 μg/ml streptomycin. The cells were grown in
75-cm2 tissue culture flasks at 37 °C in a humidified incubator
with 5% CO2.
The cells were seeded in 12-well culture plates with
DMEM/F-12 and then washed with PBS. The cells were then
replenished with serum-free media and treated with the com-
pounds of interest for 24 h.

Drug Deliv. and Transl. Res.
(IDT, Coralville, IA). The ratio of β-MHC to α-MHC expres-
sion was quantitated by assessing relative cDNA levels of the
genes compared with β-actin expression from the same sam-
ple. The real-time PCR data was analyzed using the
relative gene expression (i.e., ΔΔCT) method, as de-
scribed and explained previously [32]. Briefly, the fold
change in the level of target genes between the treated
and untreated cells, corrected for the level of β-actin,
was determined using the following equation: fold
change = 2−Δ(ΔCt), where ΔCt = Ct(target) − Ct(β-actin)
Results
In vitro drug release and cellular uptake by MDCK-MDR
cells
In vitro DoxQ release
To assess the post-administration fate of DoxQ, the in vitro
release of the conjugate was examined. The in vitro drug re-
lease scheme is shown in Fig. 2. The release of doxorubicin
was due to the enzyme digestion of the amide bond. The
release of doxorubicin from the conjugate showed a first-
order kinetic profile, and the release half-life (t1/2) was approx-
imately 60 h (Fig. 3). Quercetin was released from the conju-
gate by hydrolyzing the carbamate bond. The release of quer-
cetin exhibited second-order kinetics in aqueous medium with
and Δ(ΔCt) = ΔCt(treated) − ΔCt(untreated)
.
Determination of CYP1B1 enzymatic activity
CYP1B1-dependent methoxyresorufin O-deethylase
(MROD) and ethoxyresorufin O-deethylase (EROD) activity
was performed on intact living RL-14 cells [33, 34]. After
incubation of the cells with the test compounds, 100 μl of
2 μM MROD or EROD in assay buffer (0.05 M Tris, 0.1 M
NaCl, pH 7.8) was then added to each well. Immediately, an
initial fluorescence measurement (t = 0) at excitation/emission
(545/575 nm) was recorded followed by an additional set of
fluorescence measurements of the samples that were recorded
every 5 min for 40 min using the BioTek Synergy H1 Hybrid
Multi-Mode Microplate Reader (BioTek Instruments,
Winooski, VT, USA).
t1/2 of approximately 100 h.
Drug uptake by MDCK-MDR cells
To assess the efficacy of DoxQ, the uptake of the novel con-
jugate was examined in MDCK-MDR cells, a P-gp-positive
cell line. Confocal microscopy was used to examine if the
novel derivative can improve doxorubicin’s uptake by P-gp-
positive cells. The fluorescence signal detected in the cells
treated with a mixture of doxorubicin and quercetin or
DoxQ was higher than that in the group treated with free
doxorubicin (Fig. 4). The images were analyzed by ImageJ
(Fig. 5a). After 5-min treatment, there was no significant im-
provement of drug uptake by the cells treated with the doxo-
rubicin plus quercetin mixture compared to that of free doxo-
rubicin. However, the fluorescence signal was significantly
enhanced in the cells treated with DoxQ (P < 0.05).
Statistical analysis
Compiled data were presented as mean and standard error of
the mean (mean SEM). Where possible, data were statisti-
cally analyzed by SigmaPlot® for Windows (Systat Software,
Inc, CA) or GraphPrism, with a P value <0.05 being consid-
ered statistically significant. One-way analysis of variance
(ANOVA) followed by the Tukey-Kramer multiple compari-
son test was employed to assess which treatment group(s)
showed a significant difference from the control group.
Drug uptake by the cells was quantified by HPLC as shown
in Fig. 5b. The novel formulation significantly improved drug
uptake compared to both free doxorubicin and a mixture of
doxorubicin and quercetin. This is consistent with the fluores-
cence imaging study (Figs. 4 and 5a).
Table 1 Primer sequences and efficiency used for RT-PCR
Gene
Forward primer
Reverse primer
Slope
Amplification
Efficiency
α-MHC
β-MHC
BNP
CCAAACGAGTTCCGGCCT
TGCCCAAACCAAAGAGAATGA
TCATCTTCTCACTAAGGGCT
TGTAGGGCCTTGGTCCTTTG
TGTAGGGCCTTGGTCCTTTG
CACCAGCTTCATCCCATCAAT
TGTTGCGCTCAATCTCCTCCT
GTGGTACGACCAGAGGCATACA
−2.999
−3.009
−3.33
−3.35
−3.25
−3.01
−3.00
2.15
2.14
1.99
1.98
2.03
2.14
2.15
1.15
1.14
0.995
0.985
1.03
1.14
1.15
GAATGGCTTCTAGTCCCA
CAGAAGCTGCTGGAGCTGATAAG
CAGAAGCTGGAGCTGATAAG
TTGATGTTCCAGCAAGTGCC
ATGGCCTCCCTGTACCACATC
CCAGATCATGTTTGAGACCTTCAA
CYP1B1
GST-A1
HO-1
β-actin
The Ct slope method was used to measure the efficiency of the RT-PCR. This method involves generating a dilution series of the target template and
determining the Ct value for each dilution. A plot of Ct versus log cDNA concentration range (with four concentration points at 60, 6, 0.6, and 0.06 ng/μl)
was made. Exponential amplification was calculated using the equation A = 10(−1/slope) . Efficiency was calculated using the equation Ex = 10(−1/slope) − 1

Drug Deliv. and Transl. Res.
Fig. 2 A schematic
representation of the release of
doxorubicin and quercetin from
DoxQ
Enzyme
Doxorubicin
+
DoxQ
Querceꢀn-Gly-COOH
Hydrolysis
+
+
CO2
Glycine
Querceꢀn
Effect of DoxQ on murine breast cancer cells
Antioxidant activity
The cytotoxicity of doxorubicin was evaluated in a triple-
negative murine breast cancer cell line by resazurin blue assay
in comparison to DoxQ or a mixture of doxorubicin and querce-
tin to assess its anticancer activity. DoxQ was substantially less
toxic than doxorubicin or a mixture of doxorubicin and quercetin
mixture. IC50 of DoxQ was more than twofold higher than that of
doxorubicin alone or a mixture of doxorubicin and quercetin
(Fig. 6). The decreased cytotoxicity of DoxQ could be partially
due to the very poor water solubility and the relatively slow
release of doxorubicin from the conjugate.
To understand the possible mechanism involved in attenuating
doxorubicin-induced cardiotoxicity by DoxQ, the antioxidant
capacity of DoxQ was investigated. The antioxidant effect
was studied utilizing an assay that compares the antioxidant
capacity of the investigational compound to that of a positive
control (Trolox). The antioxidant capacity of doxorubicin,
DoxQ, quercetin, and a mixture of doxorubicin and quercetin
was evaluated at 1, 10, 50, and 100 mM and showed a dose-
response effect in all study groups (Fig. 7). DoxQ showed a
significantly higher antioxidant effect compared to doxorubi-
cin at all concentrations studied. Similarly, the antioxidant
capacity of DoxQ at 10 and 50 mM DoxQ was significantly
higher than that of a mixture of doxorubicin and quercetin,
while at 1 and 10 mM DoxQ, it was significantly higher than
that of quercetin alone.
Effect on CYP3A4 inhibition
To elucidate the possible mechanisms involved in improv-
ing the bioavailability of doxorubicin, the effect of DoxQ
on CYP3A4 inhibition was investigated. CYP3A4 is the
major metabolic enzyme involved in first-pass effect.
Inhibitory effects of CYP3A4 by the test compounds were
Fig. 3 In vitro release of doxorubicin and quercetin from DoxQ
quantified by HPLC. N = 3; mean SEM

Drug Deliv. and Transl. Res.
Fig. 4 Fluorescence imaging study of cell uptake of doxorubicin by MDCK-MDR cells (P-gp positive). Cells were treated with a 50 nM free
doxorubicin, b 50 nM doxorubicin and 50 nM quercetin, and c 50 nM DoxQ
compared to those of ketoconazole at 0.01, 0.1, 1, 10, 50,
and 100 μM, and the result was expressed as percentage
of inhibition relative to ketoconazole. The results show
that DoxQ inhibited CYP3A4 at all the concentrations
tested, with the highest inhibition at 0.01 μM (Fig. 8). A
mixture of doxorubicin and quercetin did not inhibit
CYP3A4 except at 100 μM, which could be due to insta-
bility of quercetin, dimerization, or its precipitation [35].
Effect of DoxQ on rat cardiomyocyte cell viability
To assess the safety of DoxQ, the effects of DoxQ on rat
cardiomyocytes were examined at 1, 5, and 10 μM in com-
parison to doxorubicin by trypan blue assay. A dose-response
effect was observed with both doxorubicin and DoxQ
(Fig. 10a). At 10 μM, doxorubicin treatment resulted in
~22% cell death, while DoxQ treatment resulted in ~17% cell
death; both were statistically significant from the baseline.
Additionally, the lower percentage of cell death in the cells
treated with DoxQ at 10 μM was statistically significant from
the cells treated with doxorubicin alone at the same concen-
tration (Fig. 10b).
Effect on P-gp ATPase activity
The effects of DoxQ on P-gp were examined in comparison to
doxorubicin, quercetin, or a mixture of doxorubicin and quer-
cetin to elucidate the possible role of P-gp inhibition in im-
proving the bioavailability of doxorubicin. At the concentra-
tion range of 1–100 μM, there was no statistically different
ATPase activity between DoxQ and doxorubicin. At 200 μM,
P-gp ATPase activity of DoxQ was lower than that of doxo-
rubicin by 0.6 fold, suggesting slight P-gp inhibition effects.
However, a mixture of doxorubicin and quercetin significantly
reduced P-gp ATPase activity by 0.8–1.2 folds at 50–200 μM
concentration compared to free doxorubicin (Fig. 9).
Quercetin alone reduced P-gp ATPase activity at all concen-
trations, supporting its P-gp inhibitory effects documented in
the literature.
Effects on human cardiomyocytes (RL-14 cells)
Effect of DoxQ on RL-14 cell viability
To further confirm the safety of DoxQ, the effects of DoxQ or
doxorubicin on human cardiomyocytes was investigated after
treatment at 10 μM for 24 h by MTT assay. The results show
that cell viability was higher in the group of cells treated with
DoxQ (77%) than in the group of cells treated with free doxo-
rubicin (52%), indicating that DoxQ prevented the cytotoxic-
ity mediated by doxorubicin by ~25% (Fig. 11).
Fig. 5 a The fluorescence signals
analyzed by ImageJ of the images
of MDCK-MDR cells after
treatment. N = 3; mean SD. b
HPLC quantification of
percentage of drug uptake by
MDCK-MDR cells (P-gp
positive) after treatment. N = 3;
mean SD. *P < 0.05

Drug Deliv. and Transl. Res.
Effect of DoxQ on the induction of cellular oxidative stress
markers
To further confirm the cardioprotective effects of DoxQ and
the role of oxidative stress in promoting cardiotoxicity by
doxorubicin, the expression of oxidative stress markers
GST-A1 and HO-1 was investigated in RL-14 cells. DoxQ
significantly lowered the mRNA expression of GST-A1 by
1.5 folds in comparison to doxorubicin (Fig. 14a). The expres-
sion of HO-1 was lower by 1 fold in the cells treated with
doxorubicin compared to the cells treated with DoxQ
(Fig. 14b).
Fig. 6 The cytotoxic effects of doxorubicin, a mixture of doxorubicin
and quercetin, or DoxQ determined by resazurin blue assay expressed as
IC50 after 5 μM treatment for 72 h. N = 4; mean SD
Effect of DoxQ on reactive oxygen species
Effect of DoxQ on gene expression and catalytic activity
of CYP1B1
To elucidate whether DoxQ may protect cardiomyocytes from
the damage caused by doxorubicin via generating ROS, the
levels of ROS generated after treatment of RL-14 cells with
doxorubicin, DoxQ, or quercetin were measured by DCF as-
say. The level of ROS in the cells treated with DoxQ (556%)
was higher than that in the cells treated with free doxorubicin
(322%) by ~234% (Fig. 12).
To further elucidate the cardioprotective effects of DoxQ, the
capacity of DoxQ to alter the induction of the CYP1B1 gene
by doxorubicin as well as its catalytic activity was investigated
in RL-14 cells. Figure 14a demonstrates that DoxQ inhibited
the mRNA expression of CYP1B1 by more than 4 folds com-
pared to doxorubicin (Fig. 15a). The catalytic activity of
CYP1B1 was also significantly inhibited by DoxQ compared
to doxorubicin alone (Fig. 15b, c).
Effect of DoxQ on induction of cellular cardiotoxicity markers
To further confirm the protective effects of DoxQ against
doxorubicin-induced cardiotoxicity, the expression of three
cardiac hypertrophy markers (α-MHC, β-MHC, and BNP)
was examined in RL-14 cells after treatment at 10 μM for
24 h of test compounds.
DoxQ significantly inhibited the induction of mRNA ex-
pression of α-MHC by 1.5 folds, β-MHC by 2.5 folds, and
BNP by 6 folds compared to doxorubicin (Fig. 13). The ex-
pression of all three hypertrophic markers in the group of cells
treated with quercetin was similar to that of the control un-
treated cells, supporting the protective role of quercetin in
cardiomyocytes.
Discussion
Doxorubicin is an effective chemotherapeutic anticancer
agent used in a variety of cancers. However, its use is often
limited by dose-related cardiotoxicity as the cumulative dose
of doxorubicin concentrates in the heart and may progress to
severe cardiomyopathy and even death. The cardiotoxicity of
doxorubicin is related to the generation of reactive oxygen
species such as superoxides and subsequently hydrogen per-
oxide. In addition, the expression of certain cardiotoxicity
Fig. 7 Antioxidant activity of
DoxQ in comparison to
doxorubicin, a mixture of
doxorubicin and quercetin, or
quercetin alone expressed as
Trolox equivalents (N = 4;
mean SEM). +P < 0.05
compared to control, *P < 0.05
compared to doxorubicin,
^P < 0.05 compared to quercetin,
#P < 0.05 compared to Dox +
quercetin mixture

Drug Deliv. and Transl. Res.
Fig. 8 CYP3A4 enzyme
inhibition expressed as
percentage of the positive
inhibitor (ketoconazole). N = 4;
mean SEM. *P < 0.05
compared to doxorubicin
markers and metabolic enzymes is altered with doxorubicin
therapy and is involved in doxorubicin-induced cardiotoxicity.
The currently available pegylated liposomal formulation of
doxorubicin Doxil™ preferentially concentrates in the skin,
resulting in palmar-plantar erythrodysesthesia (PPE) syn-
drome [10, 36]. There is another liposomal non-pegylated
formulation of doxorubicin called Myocet™ that significantly
reduces hand-foot syndrome. Both liposomal formulations
provide sustained release of doxorubicin, thus minimizing
the acute cardiotoxicity caused by high maximum plasma
concentration (Cmax) to some extent compared to the doxo-
rubicin hydrochloric salt when administered intravenously.
A doxorubicin-hyaluronic acid conjugate (Dox-HA)
has previously shown promise in the treatment of breast
cancer and metastatic lymph nodes [37]. The Dox-HA
was encapsulated in a nanocarrier and administered sub-
cutaneously into the mammary tumors of nude mice.
The Dox-HA provided localization in the breast tissue
and also provided a sustained release of doxorubicin,
both contributing to lower systemic toxicities caused
by doxorubicin while retaining efficacy.
Consistent with the promising results of a Dox-HA [37],
we designed a novel derivative of doxorubicin utilizing a fla-
vonoid that is naturally consumed in fruits and vegetables and
reported to have health benefits, P-gp and CYP3A4 inhibitory
activities [25], and a preferential tendency to intestinal lym-
phatic absorption [26, 38, 39]. The novel compound (DoxQ)
was chemically synthesized by conjugating doxorubicin to a
naturally occurring flavonoid, quercetin, via a peptide linker,
Bglycine^ (Fig. 1), and can be administered orally or intrave-
nously. The release of doxorubicin is accomplished by a sim-
ple cleavage of the peptide bond of glycine by proteases
followed by the cleavage of the carbamate bond to release
quercetin (Fig. 2).
The purpose of this study is to elucidate the in vitro efficacy
and safety of DoxQ with a potential to mitigate the poor oral
bioavailability and dose-related cardiotoxicity of doxorubicin.
The possible mechanisms by which DoxQ mitigates these
therapeutic limitations are also described. In terms of efficacy,
we have shown that both doxorubicin and quercetin are re-
leased from the conjugate in vitro. The slow in vitro release of
doxorubicin from the conjugate over more than 4 days (Fig. 3)
Fig. 9 Fold change in P-gp
ATPase activity of doxorubicin,
DoxQ, a mixture of doxorubicin
and quercetin, or quercetin at 1,
10, 50, 100, and 200 μM relative
to basal activity. N = 4;
mean SEM. *P < 0.05 com-
pared to doxorubicin

Drug Deliv. and Transl. Res.
Fig. 10 Effect of doxorubicin
and DoxQ on adult rat
cardiomyocyte viability. a Dox
versus DoxQ dose response.
N = 3; mean SEM. *P < 0.05
Dox compared to control;
#P < 0.05 DoxQ compared to
control. b Dox versus DoxQ
(10 μM). N = 3; mean SEM.
*P < 0.05 DoxQ compared to
doxorubicin
may translate into a lower peak plasma concentration, thus
limiting acute cardiotoxicity. Additionally, DoxQ retained its
anticancer activity in triple-negative murine breast cancer cells
with IC50 in the micromolar range.
To assess the safety of DoxQ, the effects of the novel con-
jugate were initially investigated in isolated adult rat
cardiomyocytes. DoxQ showed a lower cytotoxicity profile in
rat cardiomyocytes at the concentration range tested in compar-
ison to doxorubicin alone (Fig. 10). The effects of DoxQ were
then examined in RL-14 cells, a commercially available cell
line isolated from human ventricular tissues, which is common-
ly used to investigate molecular mechanisms and toxic effects
induced by chemotherapeutic agents like doxorubicin [43, 44].
Before conducting experiments in RL-14 cells, 10 μM concen-
tration was selected based on the reported therapeutic plasma
concentration of doxorubicin in humans [45, 46] as well as
other in vitro studies that examined the cardiotoxic effects of
doxorubicin [47, 48]. Our study shows that DoxQ was less
toxic to RL-14 (Fig. 11) as evident by MTT assay and consis-
tent with the observation from the trypan blue assay in rat
cardiomyocytes. The expression of cardiac hypertrophy
markers α-MHC, β-MHC, and BNP was examined in RL-14
cells to further confirm the protective effects of DoxQ on
cardiomyocytes. Chronic treatment with doxorubicin causes
cardiotoxicity that may progress to cardiac myopathy and heart
failure via multiple cellular pathways [49]. Maayah et al. report-
ed that treatment of RL-14 cells with doxorubicin caused
cardiotoxicity manifested by induction in the expression of
The low oral bioavailability of doxorubicin is due to its lim-
ited uptake by intestinal cells expressing P-gp as it is a substrate
of the P-gp efflux pump and also its extensive first-pass metab-
olism by CYP3A4 [40–42]. The cellular uptake of DoxQ as well
as a mixture of doxorubicin and quercetin by P-gp-positive cells
(Figs. 4 and 5) and the inhibitory effects on P-gp ATPase by a
mixture of doxorubicin and quercetin (Fig. 9) suggest that the
release of quercetin from DoxQ plays a role in minimizing the P-
gp efflux effect of doxorubicin and enhances its uptake by P-gp-
positive cells. We then investigated the effect of DoxQ on
CYP3A4 inhibition, as it is the major metabolic enzyme contrib-
uting to first-pass effect and also many compounds that inhibit P-
gp are inhibitors of CYP3A4. Figure 8 shows that DoxQ acts as
an inhibitor of CYP3A4, which could limit the loss of doxorubi-
cin by first-pass metabolism and potentially improve its bioavail-
ability. The overall improvement in the bioavailability of doxo-
rubicin by DoxQ sheds light on the therapeutic utility of DoxQ as
a novel delivery approach for oral administration of doxorubicin
and may also lower the required dose of doxorubicin to achieve
effective concentrations when administered intravenously.
Fig. 11 Cell viability of human
cardiac myocytes (RL-14)
measured by MTT assay after
drug treatment at 10 μM for 24 h.
N = 4; mean SEM. *P < 0.05
compared to doxorubicin,
+P < 0.05 compared to control

Drug Deliv. and Transl. Res.
Fig. 12 Reactive oxygen species
levels quantified fluorometrically
by dichlorofluorescein (DCF)
assay after drug treatment of RL-
14 cells at 10 μM for 24 h. N = 4;
mean SEM. *P < 0.05
compared to doxorubicin,
+P < 0.05 compared to control
β-MHC/α-MHC genes [50]. Furthermore, Chen et al. showed
that doxorubicin enhanced the protein expression of BNP and
β-MHC while reducing the expression of α-MHC in a rat
model [49]. These observations are supported by our findings
in this study as doxorubicin induced the expression of β-MHC
more than α-MHC (Fig. 13) and also induced the expression of
BNP. Interestingly, the expression of α-MHC, β-MHC, and
BNP was inhibited by DoxQ, confirming the protective effects
of DoxQ on cardiomyocytes.
To elucidate the cardioprotective mechanisms of DoxQ
against doxorubicin-induced cardiotoxicity, several in vitro
assays were utilized. Given the role of reactive oxygen species
in doxorubicin-induced cardiotoxicity and the antioxidant ef-
fects of quercetin, the antioxidant capacity of DoxQ was ini-
tially examined using a commercial kit in comparison to doxo-
rubicin alone and a mixture of doxorubicin and quercetin. Our
results show that the antioxidant capacity of DoxQ was higher
than that of doxorubicin in a non-cell environment (Fig. 7).
a
b
c
Fig. 13 Fold expression of cardiac hypertrophy markers in RL-14 cells
after treatment at 10 μM for 24 h of doxorubicin, DoxQ, or quercetin. The
mRNA expression of a BNP, b α-MHC, and c β-MHC in RL-14 cells.
The mRNA expression was quantified by RT-PCR and normalized to β-
actin as a housekeeping gene. N = 6; mean SEM. *P < 0.05 compared to
doxorubicin, +P < 0.05 compared to control

Drug Deliv. and Transl. Res.
a
b
Fig. 14 Fold expression of oxidative stress markers in RL-14 cells after
treatment at 10 μM for 24 h of doxorubicin, DoxQ, or quercetin. The
mRNA expression of a GST-A1 and b HO-1 in RL-14 cells. The mRNA
expression was quantified by RT-PCR and normalized to β-actin as a
housekeeping gene. N = 6; mean SEM. *P < 0.05 compared to
doxorubicin, +P < 0.05 compared to control
Based on this observation, DCF assay was undertaken to mea-
sure the levels of reactive oxygen species in RL-14 cells. The
levels of reactive oxygen species generated by DoxQ were
lower than those by doxorubicin alone (Fig. 13), suggesting
that the presence of quercetin likely scavenges the reactive
oxygen species generated by doxorubicin and limits its toxic
effects on cardiomyocytes. This observation is also supported
by the effects of DoxQ on the expression of oxidative stress
markers GST-A1 and HO-1. The inhibitory effects of DoxQ
on the expression of GST-A1 (Fig. 14a), which is
overexpressed when cells are under oxidative stress, imply
the lower ROS generated by DoxQ than doxorubicin alone.
a
b
c
Fig. 15 a The mRNA expression of CYP1B1 quantified by RT-PCR and
normalized to β-actin as a housekeeping gene. N = 6; mean SEM. b
CYP1B1 catalytic activity determined by MROD assay. N = 3;
mean SEM. c CYP1B1 catalytic activity determined by EROD assay.
N = 3; mean SEM. *P < 0.05 compared to doxorubicin, +P < 0.05
compared to control

Drug Deliv. and Transl. Res.
Acknowledgments The authors would like to acknowledge the
College of Pharmacy, Faculty of Health Sciences, Kuwait University,
for the graduate scholarship awarded to S.A.
Z.H.M. is a recipient of the Izaak Walton Killam Memorial
Scholarship and Alberta Innovates Health Solution Graduate Student
Scholarship.
Additionally, the inhibitory effects on mRNA expression of
HO-1 by doxorubicin and not DoxQ further support the
cardioprotective effects of DoxQ as elevated HO-1 levels have
protective effects on cardiomyocytes [50]. To further investi-
gate the mechanisms involved in cardioprotection by DoxQ,
the effects of DoxQ on the gene expression and catalytic ac-
tivity of CYP1B1 were explored in RL-14 cells. CYP1B1 is a
member of CYP450 metabolic enzymes and catalyzes the
formation of mid-chain HETE metabolites of arachidonic ac-
id, which are cardiotoxic [51]. CYP1B1 also has a role in
modulating cellular oxidative stress [52]. A recent study
showed that doxorubicin-induced cytotoxicity is mediated
by the CYP1B1 pathway [53]. Our results demonstrate that
doxorubicin induced the expression of CYP1B1 and its cata-
lytic activity in RL-14 cell, while DoxQ reversed these effects
(Fig. 15), suggesting that DoxQ attenuates doxorubicin-
induced cardiotoxicity at least partially by CYP1B1 inhibitory
activities.
Compliance with ethical standards Adult rat ventricular
cardiomyocytes isolation procedure was approved by the University of
Manitoba Office of Research Ethics and Compliance and Animal Care
Committee, and were conducted in accordance with guidelines by the
Canadian Council for Animal Care.
Conflict of interest The authors declare that they have no conflict of
interest.
References
1. Thorn CF, Oshiro C, Marsh S, Hernandez-Boussard T, McLeod H,
Klein TE, Altman RB. Doxorubicin pathways: pharmacodynamics
and adverse effects. Pharmacogenet Genomics. 2011;21(7):440–6.
2. Swift LP, Rephaeli A, Nudelman A, Phillips DR, Cutts SM.
Doxorubicin-DNA adducts induce a non-topoisomerase II-mediat-
ed form of cell death. Cancer Res. 2006;66(9):4863–71.
Conclusions
3. Agudelo D, Bourassa P, Bérubé G, Tajmir-Riahi HA. Intercalation
of antitumor drug doxorubicin and its analogue by DNA duplex:
structural features and biological implications. Int J Biol Macromol.
2014;66:144–50.
4. Carvalho FS, Burgeiro A, Garcia R, Moreno AJ, Carvalho RA,
Oliveira PJ. Doxorubicin-induced cardiotoxicity: from bioenergetic
failure and cell death to cardiomyopathy. Med Res Rev. 2014;34(1):
106–35.
5. Gustafson DL, Merz AL, Long ME. Pharmacokinetics of combined
doxorubicin and paclitaxel in mice. Cancer Lett. 2005;220:161–9.
6. Lee HJ, Lee MG. Effects of dexamethasone on the pharmacokinet-
ics of adriamycin after intravenous administration to rats. Res
Commun Mol Pathol Pharmacol. 1999;105:87–96.
7. Matsumura Y, Hamaguchi T, Ura T, Muro K, Yamada Y, Shimada
Y, Shirao K, Okusaka T, Ueno H, Ikeda M, Watanabe N. Phase I
clinical trial and pharmacokinetic evaluation of NK911, a micelle-
encapsulated doxorubicin. Br J Cancer. 2004;91(10):1775–81.
8. Ríhová B, Strohalm J, Prausová J, Kubácková K, Jelínková M,
Rozprimová L, Sírová M, Plocová D, Etrych T, Subr V, Mrkvan
T, Kovár M, Ulbrich K. Cytostatic and immunomobilizing activi-
ties of polymer-bound drugs: experimental and first clinical data. J
Control Release. 2003;91(1–2):1–16.
9. Tolcher AW, Sugarman S, Gelmon KA, Cohen R, Saleh M, Isaacs
C, Young L, Healey D, Onetto N, Slichenmyer W. Randomized
phase II study of BR96-doxorubicin conjugate in patients with met-
astatic breast cancer. J Clin Oncol. 1999;17(2):478–84.
10. Soloman R, Gabizon AA. Clinical pharmacology of liposomal
anthracyclines: focus on pegylated liposomal doxorubicin. Clin
Lymphoma Myeloma. 2008;8(1):21–32.
11. Davies NM, Yanez JA. Flavonoid pharmacokinetics: methods of
analysis, preclinical and clinical pharmacokinetics, safety, and tox-
icology. 1st ed. John Wiley and Sons; 2013.
12. Liu L, Gao C, Yao P, Gong Z. Quercetin alleviates high-fat diet-induced
oxidized low-density lipoprotein accumulation in the liver: implication
for autophagy regulation. Biomed Res Int. 2015;2015:607531.
13. He Y, Cao X, Liu X, Li X, Xu Y, Liu J, Shi J. Quercetin reverses
experimental pulmonary arterial hypertension by modulating the
TrkA pathway. Exp Cell Res. 2015;339(1):122–34.
In conclusion, we developed a novel derivative of doxorubicin
with improved in vitro safety while retaining activity. DoxQ
was less toxic than doxorubicin in both rat and human
cardiomyocytes and retained anticancer activity in triple-
negative murine breast cancer cells. The lower level of reac-
tive oxygen species generated by DoxQ compared to doxoru-
bicin as well as the results of the oxidative stress markers
examined also suggests cardioprotection in vitro. DoxQ
inhibited both the expression of CYP1B1 and also its catalytic
activity, proposing an additional mechanism by which DoxQ
attenuates cardiotoxicity induced by doxorubicin and im-
proves its tolerability.
In terms of mitigating the drug delivery barriers of poor oral
bioavailability, the initial in vitro results of DoxQ are promising.
The cellular uptake of DoxQ by MDCK-MDR cells was higher
than that of doxorubicin alone or a doxorubicin plus quercetin
mixture. The CYP450 inhibitory activities of DoxQ were higher
than those of doxorubicin. DoxQ inhibited CYP3A4 while a
mixture of doxorubicin and quercetin demonstrated higher inhi-
bition of P-gp ATPase activity compared to DoxQ and free doxo-
rubicin. If DoxQ is less susceptible to first-pass effect (F = 1 − E)
and the release of quercetin from DoxQ lowers the P-gp efflux
effect, then oral absorption of doxorubicin and the possibility that
DoxQ is shunted to intestinal lymphatics could potentially in-
crease when E is lowered. To the best of our knowledge, this is
the first study that utilizes quercetin as a lymphatically targeted
carrier for doxorubicin to improve its bioavailability and safety
and mechanistically elucidate the efficacy and safety of the novel
conjugate DoxQ. Future in vivo experiments in light of the
in vitro observations using this novel drug delivery approach
are warranted and are in progress by our laboratory.

Drug Deliv. and Transl. Res.
14. Gormaz JG, Quintremil S, Rodrigo R. Cardiovascular disease: a
target for the pharmacological effects of quercetin. Curr Top Med
Chem. 2015;15(17):1735–42.
15. Chirumbolo S. The role of quercetin, flavonols and flavones in
modulating inflammatory cell function. Inflamm Allergy Drug
Targets. 2010;9(4):263–85.
16. Wang G, Wang J, Luo J, Wang L, Chen X, Zhang L, Jiang S.
PEG2000-DPSE-coated quercetin nanoparticles remarkably en-
hanced anticancer effects through induced programed cell death
on C6 glioma cells. J Biomed Mater Res A. 2013;101(11):3076–85.
17. Jiang P, Burczynski F, Campbell C, Pierce G, Austria JA, Briggs
CJ. Rutin and flavonoid contents in three buckwheat species
Fagopyrum esculentum, F. tataricum, and F. homotropicum and
their protective effects against lipid peroxidation. Food Res Int.
2007;40:356–64.
18. Kang JT, Moon JH, Choi JY, Park SJ, Kim SJ, Saadeldin IM, Lee
BC. Effect of antioxidant flavonoids (quercetin and taxifolin) on
in vitro maturation of porcine oocytes. Asian-Australas J Anim
Sci. 2016;29(3):352–8.
19. Atashpour S, Fouladdel S, Movahhed TK, Barzegar E, Ghahremani
MH, Ostad SN, Azizi E. Quercetin induces cell cycle arrest and
apoptosis in CD133(+) cancer stem cells of human colorectal
HT29 cancer cell line and enhances anticancer effects of doxorubi-
cin. Iran J Basic Med Sci. 2015;18(7):635–43.
20. Minaei A, Sabzichi M, Ramezani F, Hamishehkar H, Samadi N. Co-
delivery with nano-quercetin enhances doxorubicin-mediated cytotox-
icity against MCF-7 cells. Mol Biol Rep. 2016;43(2):99–105.
21. Wang G, Zhang J, Liu L, Sharma S, Dong Q. Quercetin potentiates
doxorubicin mediated antitumor effects against liver cancer through
p53/Bcl-xl. PLoS One. 2012;7(12):e51764.
22. Chen FY, Cao LF, Wan HX, Zhang MY, Cai JY, Shen LJ, Zhong
JH, Zhong H. Quercetin enhances adriamycin cytotoxicity through
induction of apoptosis and regulation of mitogen-activated protein
kinase/extracellular signal-regulated kinase/c-Jun N-terminal ki-
nase signaling in multidrug-resistant leukemia K562 cells. Mol
Med Rep. 2015;11(1):341–8.
23. Chen JY, Hu RY, Chou HC. Quercetin-induced cardioprotection
against doxorubicin cytotoxicity. J Biomed Sci. 2013;20:95.
24. Kaiserová H, Simůnek T, Van der Vijgh WJ, Bast A, Kvasnicková
E. Flavonoids as protectors against doxorubicin cardiotoxicity: role
of iron chelation, antioxidant activity and inhibition of carbonyl
reductase. Biochim Biophys Acta. 2007;1772(9):1065–74.
25. Choi JS, Piao YJ, Kang KW. Effects of quercetin on the bioavail-
ability of doxorubicin in rats: role of CYP3A4 and P-gp inhibition
by quercetin. Arch Pharm Res. 2011;34(4):607–13.
in vitro rat cardiomyocytes is influenced by the aryl hydrocarbon
receptor signaling pathway. Arch Toxicol. 2014;88(3):725–38.
32. Livak KJ, Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T))
method. Methods. 2001;25(4):402–8.
33. Kennedy SW, Lorenzen A, James CA, Collins BT.
Ethoxyresorufin-O-deethylase and porphyrin analysis in chicken
embryo hepatocyte cultures with a fluorescence multiwell plate
reader. Anal Biochem. 1993;211(1):102–12.
34. Lo SN, Chang YP, Tsai KC, Chang CY, Wu TS, Ueng YF.
Inhibition of CYP1 by berberine, palmatine, and jatrorrhizine: se-
lectivity, kinetic characterization, and molecular modeling. Toxicol
Appl Pharmacol. 2013;272(3):671–80.
35. Pham A, Bortolazzo A, White JB. Rapid dimerization of quercetin
through an oxidative mechanism in the presence of serum albumin
decreases its ability to induce cytotoxicity in MDA-MB-231 cells.
Biochem Biophys Res Commun. 2012;427(2):415–20.
36. Lorusso D, Stefano AD, Carone V, Fagotti A, Pisconti S, Scambia
G. Pegylated liposomal doxorubicin-related palmar-plantar
erythrodysesthesia (‘hand-foot’ syndrome). Ann Oncol.
2007;18(7):1159–64.
37. Cai S, Thati S, Bagby TR, Diab HM, Davies NM, Cohen MS,
Forrest ML. Localized doxorubicin chemotherapy with a
biopolymeric nanocarrier improves survival and reduces toxicity
in xenografts of human breast cancer. J Control Release.
2010;146(2):212–8.
38. Murota K, Terao J. Quercetin appears in the lymph of unanesthe-
tized rats as its phase II metabolites after administered into the
stomach. FEBS Lett. 2005;579(24):5343–6.
39. Murota K, Cermak R, Terao J, Wolffram S. Influence of fatty acid
patterns on the intestinal absorption pathway of quercetin in thorac-
ic lymph duct-cannulated rats. Br J Nutr. 2013;109(12):2147–53.
40. Chan LM, Lowes S, Hirst BH. The ABCs of drug transport in
intestine and liver: efflux proteins limiting drug absorption and
bioavailability. Eur J Pharm Sci. 2004;21(1):25–51.
41. Qian F, Wei D, Liu J, Yang S. Molecular model and ATPase activity of
carboxyl-terminal nucleotide binding domain from human P-glycopro-
tein. Biochem Mosc. 2016;71(Suppl 1):S18–24. 11-12 (2006)
42. Kim JE, Cho HJ, Kim JS, Shim CK, Chung SJ, Oak MH, Yoon IS,
Kim DD. The limited intestinal absorption via paracellular pathway
is responsible for the low oral bioavailability of doxorubicin.
Xenobiotica; the fate of foreign compounds in biological systems.
2013;43:579–91.
43. Maayah ZH, Elshenawy OH, Althurwi HN, Abdelhamid G, El-
Kadi AO. Human fetal ventricular cardiomyocyte, RL-14 cell line,
is a promising model to study drug metabolizing enzymes and their
associated arachidonic acid metabolites. J Pharmacol Toxicol
Methods. 2015;71:33–41.
44. Kobashigawa LC, Xu YC, Padbury JF, Tseng YT, Yano N.
Metformin protects cardiomyocyte from doxorubicin induced cy-
totoxicity through an AMP-activated protein kinase dependent sig-
naling pathway: an in vitro study. PLoS One. 2014;9(8):e104888.
45. Mross K, Maessen P, van der Vijgh WJ, Gall H, Boven E, Pinedo
HM. Pharmacokinetics and metabolism of epidoxorubicin and
doxorubicin in humans. J Clin Oncol. 1988;6(3):517–26.
46. Robert J, Vrignaud P, Nguyen-Ngoc T, Iliadis A, Mauriac L,
Hurteloup P. Comparative pharmacokinetics and metabolism of
doxorubicin and epirubicin in patients with metastatic breast cancer.
Cancer Treat Rep. 1985;69(6):633–40.
26. Chen IL, Tsai YJ, Huang CM, Tsai TH. Lymphatic absorption of
quercetin and rutin in rat and their pharmacokinetics in systemic
plasma. J Agric Food Chem. 2010;58(1):546–51.
27. Kim MK, Park KS, Yeo WS, Choo H, Chong Y. In vitro solubility,
stability and permeability of novel quercetin-amino acid conju-
gates. Bioorg Med Chem. 2009;17:1164–71.
28. Liu Y, Schubert D. Cytotoxic amyloid peptides inhibit cellular 3-(4,
5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)
reduction by enhancing MTT formazan exocytosis. J Neurochem.
1997;69(6):2285–93.
29. Maayah ZH, El Gendy MA, El-Kadi AO, Korashy HM. Sunitinib, a
tyrosine kinase inhibitor, induces cytochrome P450 1A1 gene in
human breast cancer MCF7 cells through ligand-independent aryl
hydrocarbon receptor activation. Arch Toxicol. 2013;87(5):847–56.
30. Zordoky BN, Aboutabl ME, El-Kadi AO. Modulation of cyto-
chrome P450 gene expression and arachidonic acid metabolism
during isoproterenol-induced cardiac hypertrophy in rats. Drug
Metab Dispos. 2008;36(11):2277–86.
47. McHowat J, Swift LM, Arutunyan A, Sarvazyan N. Clinical con-
centrations of doxorubicin inhibit activity of myocardial mem-
brane-associated, calcium-independent phospholipase A(2).
Cancer Res. 2001;61(10):4024–9.
48. Doroshow JH, Akman S, Chu FF, Esworthy S. Role of the
glutathione-glutathione peroxidase cycle in the cytotoxicity of the
anticancer quinones. Pharmacol Ther. 1990;47(3):359–70.
31. Maayah ZH, Ansari MA, El Gendy MA, Al-Arifi MN, Korashy
HM. Development of cardiac hypertrophy by sunitinib in vivo and

Drug Deliv. and Transl. Res.
49. Chen YL, Chung SY, Chai HT, Chen CH, Liu CF, Chen YL, Huang
TH, Zhen YY, Sung PH, Sun CK, Chua S, Lu HI, Lee FY, Sheu JJ,
Yip HK. Early administration of carvedilol protected against
doxorubicin-induced cardiomyopathy. J Pharmacol Exp Ther.
2015;355(3):516–27.
50. Issan Y, Kornowski R, Aravot D, Shainberg A, Laniado-
Schwartzman M, Sodhi K, Abraham NG, Hochhauser E. Heme
oxygenase-1 induction improves cardiac function following myo-
cardial ischemia by reducing oxidative stress. PLoS One.
2014;9(3):e92246.
and cardiac hypertrophy. Arch Toxicol. 2016 Jan;90(1):119–
36.
52. Tang Y, Scheef EA, Wang S, Sorenson CM, Marcus CB, Jefcoate
CR, Sheibani N. CYP1B1 expression promotes the proangiogenic
phenotype of endothelium through decreased intracellular oxidative
stress and thrombospondin-2 expression. Blood. 2009;113(3):744–
54.
53. Maayah ZH, Althurwi HN, Abdelhamid G, Lesyk G, Jurasz P, El-
Kadi AO. CYP1B1 inhibition attenuates doxorubicin-induced
cardiotoxicity through a mid-chain HETEs-dependent mechanism.
Pharmacol Res. 2016;105:28–43.
51. Maayah ZH, El-Kadi AO. The role of mid-chain
hydroxyeicosatetraenoic acids in the pathogenesis of hypertension