HHQ-4, a quinoline derivate, preferentially inhibits proliferation of glucose-deprived breast cancer cells as a GRP78 down-regulator

Article abstract of DOI:10.1016/j.taap.2019.04.017

As a central regulator for endoplasmic reticulum (ER)stress, glucose-regulated protein 78 (GRP78), controls the activation of ER-transmembrane signaling mechanisms by inducing unfolded protein response (UPR)in response to ER stress. Although limited glucose availability often occurs in poorly vascularized solid cancers, cancer cells often initiate the UPR to support cellular homeostasis and survival under stress conditions. Therefore, targeting GRP78 expression and UPR pathway activation may provide a new strategy for anticancer therapy. Based on this premise, we investigated the molecular mechanisms of a synthetic quinolone derivative, 2-hexyl-3-methyl-4(1H)-quinolinone (HHQ-4), in regulating the GRP78 expression and UPR transcriptional program under glucose deprivation or 2-deoxy-D-glucose (2-DG)-stressed conditions. We found that HHQ-4 suppressed the transcriptional and translational expression of GRP78 gene in glucose-deprived breast cancer cells. HHQ-4 also showed selective antiproliferative activity against glucose-deprived breast cancer cells. Constitutive expression of GRP78 completely prevented breast cancer cells from HHQ-4-mediated proliferation inhibition during glucose starvation, stressing the important role of suppression of the GRP78 in HHQ-4-mediated cell proliferation inhibition. HHQ-4 was also found to exert inhibitory activity against breast cancer cell proliferation by suppressing three survival arms of the UPR, including PERK/eIF2α/ATF4, IRE1/XBP1, and ATF6, which orchestrate an intricate signaling network to modulate GRP78 gene transcription under glucose-deprived stress. Furthermore, HHQ-4 combined with 2-DG synergistically inhibited breast cancer cell proliferation. Our findings show HHQ-4 could be a promising candidate, alone or in combination with 2-DG, for selectively inhibiting breast cancer cell proliferation by down-regulating the transcription and expression of GRP78 under stressful microenvironments.

Full text of DOI:10.1016/j.taap.2019.04.017

Accepted Manuscript
HHQ-4, a quinoline derivate, preferentially inhibits proliferation
of glucose-deprived breast cancer cells as a GRP78 down-
regulator
Xiao Xiao, Shuo Li, Xiaoxun Zhang, Jinjian Lu, Weiguang Wang,
Shijia Zhou, Jingyao Zhang, Rui Wang, Ao Li
PII:
S0041-008X(19)30149-8
https://doi.org/10.1016/j.taap.2019.04.017
YTAAP 14573
DOI:
Reference:
To appear in:
Toxicology and Applied Pharmacology
Received date:
Revised date:
Accepted date:
16 October 2018
18 April 2019
19 April 2019
Please cite this article as: X. Xiao, S. Li, X. Zhang, et al., HHQ-4, a quinoline derivate,
preferentially inhibits proliferation of glucose-deprived breast cancer cells as a GRP78
down-regulator, Toxicology and Applied Pharmacology, https://doi.org/10.1016/
j.taap.2019.04.017
This is a PDF file of an unedited manuscript that has been accepted for publication. As
a service to our customers we are providing this early version of the manuscript. The
manuscript will undergo copyediting, typesetting, and review of the resulting proof before
it is published in its final form. Please note that during the production process errors may
be discovered which could affect the content, and all legal disclaimers that apply to the
journal pertain.

ACCEPTED MANUSCRIPT
HHQ-4, a quinoline derivate, preferentially inhibits proliferation of
glucose-deprived breast cancer cells as a GRP78 down-regulator
a,1
b,1
a
c
d
Xiao Xiao , Shuo Li , Xiaoxun Zhang , Jinjian Lu , Weiguang Wang , Shijia
a
a
a,⁎
e,a,⁎
Zhou , Jingyao Zhang , Rui Wang , Ao Li
a
College of Pharmacy and Bioengineering, Chongqing University of Technology,
Chongqing 400054, China
b
School of Chemistry and Chemical Engineering, Chongqing University of
Technology, Chongqing 400054, China
c
State Key Laboratory of Quality Research in Chinese Medicine, Institute of Chinese
Medical Sciences, University of Macau, Macau 999078, China
d
Key Laboratory of Chemistry in Ethnic Medicinal Resources, State Ethnic Affairs
Commission and Ministry of Education, Yunnan Minzu University, Kunming, Yunnan
6
50031, China
e
Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Xuzhou
Medical University, Xuzhou, Jiangsu 221004, China
1
These authors contributed equally to this work
*
Corresponding authors.
Ao Li, Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy,
Xuzhou Medical University, Xuzhou Medical University, 209 Tongshan Road,
Xuzhou, Jiangsu 221004, China; College of Pharmacy and Bioengineering,
Chongqing University of Technology, 69 Hong Guang Avenue, Chongqing 400054,
China. Fax: +86 23 62563190; E-mail address: ao_livip@sina.com

ACCEPTED MANUSCRIPT
Rui Wang, College of Pharmacy and Bioengineering, Chongqing University of
Technology, 69 Hong Guang Avenue, Chongqing 400054, China. Fax: +86 23
6
2563182; E-mail address: wangrx1022@163.com

ACCEPTED MANUSCRIPT
ABSTRACT
As a central regulator for endoplasmic reticulum (ER) stress, glucose-regulated
protein 78 (GRP78), controls the activation of ER-transmembrane signaling
mechanisms by inducing unfolded protein response (UPR) in response to ER stress.
Although limited glucose availability often occurs in poorly vascularized solid
cancers, cancer cells often initiate the UPR to support cellular homeostasis and
survival under stress conditions. Therefore, targeting GRP78 expression and UPR
pathway activation may provide a new strategy for anticancer therapy. Based on this
premise, we investigated the molecular mechanisms of a synthetic quinolone
derivative, 2-hexyl-3-methyl-4(1H)-quinolinone (HHQ-4), in regulating the GRP78
expression and UPR transcriptional program under glucose deprivation or
2
-deoxy-D-glucose (2-DG)-stressed conditions. We found that HHQ-4 suppressed
transcriptional and translational expression of GRP78 gene in glucose-deprived breast
cancer cells. HHQ-4 also showed selective antiproliferative activity against
glucose-deprived breast cancer cells. Constitutive expression of GRP78 completely
prevented breast cancer cells from HHQ-4-mediated proliferation inhibition during
glucose starvation, stressing the important role of suppression of the GRP78 in
HHQ-4-mediated cell proliferation inhibition. HHQ-4 was also found to exert
inhibitory activity against breast cancer cell proliferation by suppressing three
survival arms of the UPR, including PERK/eIF2α/ATF4, IRE1/XBP1, and ATF6,
which orchestrate an intricate signaling network to modulate GRP78 gene
transcription under glucose-deprived stress. Furthermore, HHQ-4 combined with

ACCEPTED MANUSCRIPT
2
-DG synergistically inhibited breast cancer cell proliferation. Our findings show
HHQ-4 could be a promising candidate, alone or in combination with 2-DG, for
selectively inhibiting breast cancer cell proliferation by down-regulating the
transcription and expression of GRP78 under stressful microenvironments.
Keywords: Glucose deprivation; Glucose-regulated protein 78; Unfolded protein
response; Breast cancer cells; HHQ-4
Abbreviations: Annexin V-FITC, fluoresceinisothiocyanate-labeled annexin V; ATF4,
activating transcription factor-4; ATF6, activating transcription factor-6; BCA,
bicinchoninic acid; CFDA-SE, carboxyfluorescein diacetate succinimidyl ester; 2-DG,
2
-deoxy-D-glucose; DMEM, Dulbecco's modified Eagle's medium; DMSO, dimethyl
sulfoxide; ECL, enhanced chemiluminescence; EdU, 5-ethynyl-2'-deoxyuridine;
eIF2α, eukaryotic translation initiation factor 2 subunit α; ER, endoplasmic reticulum;
ER+, estrogen receptor α positive ; FBS, fetal bovine serum; GRP78,
glucose-regulated protein 78; GRP94, glucose-regulated protein 94; HHQ-4,
2
5
-hexyl-3-methyl-4(1H)-quinolinone; IRE1, inositol-requiring enzyme-1; MTT, 3-(4,
-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide; poly
(ADP-ribose)-polymerase, PARP; PBS, phosphate-buffered saline; PCR, polymerase
chain reaction; PERK, PKR-like ER kinase; PVDF, polyvinylidene difluoride;
SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel; TM, Tunicamycin; UPR,
unfolded protein response; XBP-1, X-box binding protein-1

ACCEPTED MANUSCRIPT
1
. Introduction
Breast cancer is the most common malignant tumor in women with an increasing
incidence rate in recent years (Gangopadhyay et al., 2013). It is the second highest
cancer-related morbidity after lung cancer among women worldwide (Hortobagyi et
-
-
-
al., 2005). Triple-negative (ER , PR , HER2 ) breast cancer and hormone
+
receptor-negative HER2 breast cancer are aggressive subtypes associated with
increased prevalence of visceral or central nervous system metastases and poor
prognosis compared with other breast cancer subtypes (Clayton et al., 2004; Yau et al.,
2
010). Mastectomy and chemotherapy are the most likely treatment choices to deal
with these subtypes of breast cancer, but unfortunately, approximately 70% of patients
are inoperable because of either locally advanced tumor growth or distant metastases
(Dent et al., 2007; Gucalp et al., 2013). Therefore, it is urgent to develop novel
compounds as anticancer agents offering promising therapeutic options for patients
with breast cancer.
Solid cancers, including breast cancer, are continuously exposed to glucose
deficiency as well as to hypoxia due to inadequate vascular supply (Brown and
Giaccia, 1998). The hypoglycemic state of them is usually further exacerbated by the
higher glucose utilization rate through elevated glucose metabolism or the Warburg
effect (Warburg, 1956; Ferreira, 2010). This creates a cellular microenvironment in
solid cancers, characterized by glucose and other nutrient deprivations, hypoxia, and
acidosis (Vaupel, 2004). Many types of tumor cells distant from blood vessels in solid
cancers can adapt to the aberrant microenvironments and survive under metabolic

ACCEPTED MANUSCRIPT
stress, which induces the overexpression of specific stress genes that may be a cause
of tumor development and drug resistance in solid cancers (Lee, 2001).
Glucose starvation, a common form of metabolic stress in the tumor
microenvironment, can disrupt protein folding in the endoplasmic reticulum (ER),
induce the accumulation of unfolded and misfolded proteins in the ER, and activate
the unfolded protein response (UPR; Kim et al., 2008). A pivotal feature of the UPR is
its transcriptional activation, which is initiated through signaling of the ER-localized
transmembrane proteins PKR-like ER kinase (PERK), activating transcription
factor-6 (ATF6) and inositol-requiring enzyme-1 (IRE1). These ER stress sensor
proteins produce several different active transcription factors, which coordinately
activate the transcription of a panel of ER-resident stress proteins that are generally
referred to as glucose-regulated proteins (GRPs).
As a major ER chaperone, the glucose-regulated protein 78 (GRP78) plays an
important role in protecting tumor cells from the stressful conditions of glucose
deprivation and hypoxia as well as from immune surveillance for cell survival
(Jamora et al., 1996; Fu and Lee, 2006). Suppression of GRP78 offers a strategy with
which to explore potential hypoglycemia-targeted therapies directed against residual
resistant tumor. A recent study identified CHM-1, a quinolone derivative, induced
apoptotic cell death in human nasopharyngeal carcinoma cells by suppressing
cell-surface localization of GRP78 (Lin et al., 2015). In addition, another quinolone
derivative, D3ClP, induced an apoptotic cell death in HeLa cervical carcinoma cells
accompanied with the up-regulation of UPR-associated markers (including GRP78;

ACCEPTED MANUSCRIPT
Páez-Franco et al., 2017). These previous studies mainly focused on the effects of
quinolone derivative on cancer cells in the glucose-replete state, however, substances
that directly down-regulate GRP78 induction under glucose-deprived conditions
might provide new agents targeting the inhibition of cancer cells' tolerance to nutrient
starvation.
In the present study, we developed a screening system to identify inhibitors of
GRP78 under glucose starvation conditions by analyzing reporter gene expression in
breast cancer cells transiently transfected with a GRP78 promoter-reporter gene.
Using this system, we identified a candidate quinoline derivative, designated
2
-hexyl-3-methyl-4(1H)-quinolinone (HHQ-4; Supplementary Fig. S1A), that has a
hydrophobic side chain substitution at C position and a methyl substitution at the C
2
3
position of the quinolinone scaffold, exhibited a more potent inhibitory effect toward
glucose deprivation-induced GRP78 promoter activity than the other quinolone
derivatives (Supplementary Fig. S1B and C). We also examined the expression of
GRP78 and GRP94 under the same glucose-deprived conditions. Specifically, we
further investigated the transcriptional regulatory mechanisms by which HHQ-4
preferentially suppressed the expression of GRP78 in glucose-starved breast cancer
cells. Furthermore, we combined HHQ-4 with the glucose analog 2-deoxy-D-glucose
(2-DG) and investigated the synergistic anticancer effects of this combination in vitro.
2
. Materials and Methods
2
.1. Chemicals

ACCEPTED MANUSCRIPT
HHQ-4 (chemical formula: C H NO, MW: 243.16), white powder as shown in
16
21
Fig. 1A, was synthesized by a classic three-step procedure which includes the addition
of Grignard reagent to ortho-aminobenzonitrile, acylation reaction of
ortho-aminopropiophenone, and intramolecular Aldol condensation promoted by the
inorganic strong base. Its structure was identified by HNMR and CNMR
(
Supplementary Fig. S2 and 3). The purity was 99.44% determined with HPLC
Supplementary Fig. S4). HHQ-4 was dissolved in dimethyl sulfoxide (DMSO) at a
(
stock concentration of 100 mM. Salubrinal was obtained from Cayman Chemical
Company (Ann Arbor, MI, USA) and then prepared in DMSO at a stock concentration
of 3 mM. 2-DG was purchased from Sigma-Aldrich (St. Louis, MO, USA) and
dissolved with sterilized distilled water at a concentration of 2 M. All the stock
solutions were stored at -20℃ and diluted with culture medium before each
experiment. The final solvent (DMSO) did not exceed 0.1% of the volume of the
culture medium. Primary antibodies against the following antigens were as follows:
phospho-(ser713)-PERK and XBP1s (BioLegend, San Diego, CA, USA); eIF2α,
GRP78, and β-actin (Bioworld Technology, Minneapolis, MN, USA); GRP94
(GeneTex Inc, Irvine, CA, USA); ATF4 (Proteintech, Chicago, IL, USA); ATF6 (1–
3
73; Novus Biologicals, Littleton, CO, USA); phospho-(ser51)-eIF2α and
phospho-(ser724)-IRE1α (Abcam, Cambridge, MA, UK); IRE1α (Biosynthesis
Biotechnology Co., Ltd, Beijing, China); PERK (Wanlei Biotechnology Co., Ltd,
Shenyang, China); poly (ADP-ribose)-polymerase (PARP; Beyotime Institute of
Biotechnology, Jiangsu, China); Bax and caspase-3 (Cell Signaling Technology,

ACCEPTED MANUSCRIPT
Beverly, MA, USA); Bcl-2 and lamin B1 (Santa Cruz Biotechnology, Santa Cruz, CA,
USA). The rest of the reagents were purchased from Sigma unless stated otherwise.
2
.2. Cell culture and treatment
Human breast epithelial cell (MCF-10) and human breast carcinoma cells
(MCF-7 and MDA-MB-231) were provided from the American Type Culture
Collection (ATCC; Manassas, VA, USA). All the cell lines were cultured in
Dulbecco's modified Eagle's medium (DMEM) without phenol red (containing 4.5
g/L glucose; Hyclone, Pittsburgh, PA, USA) complemented with 10% (v/v)
heat-inactivated fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) and
antibiotics (100 units/mL of penicillin and 100 μg/mL of streptomycin) and
maintained at 37 °C in a humidified atmosphere of 95% O and 5% CO . For
2
2
induction of glucose deprivation stress, all cells were washed three times with
phosphate-buffered saline (PBS), placed in glucose-free DMEM medium (without
sodium pyruvate; Gibco, Waltham, MA, USA) and cultured in standard conditions as
mentioned above. HHQ-4 or salubrinal (an eIF2α dephosphorylation inhibitor) was
added to the culture medium immediately after they were placed in glucose
deprivation conditions. Each experiment was carried out using exponentially growing
cells and was repeated at least three times independently.
2
.3. Cell viability assay

ACCEPTED MANUSCRIPT
The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)
colorimetric assay was performed to examine the effect of HHQ-4 on cell viability.
3
Briefly, cells were seeded into 96-well plates at a density of 1.0 to 5.0 × 10 cells/well
overnight and treated with vehicle (DMSO) or various final concentrations (0.3–100
μM) of HHQ-4 in presence or absence of glucose or 2-DG (10 mM) for another 48 h.
At the end of incubation, the morphologic alterations of cells were observed with an
IX51 inverted phase-contrast microscope equipped with a DP70 digital camera
(Olympus Optical, Tokyo, Japan). To each well, 20 μL of MTT (dissolved in PBS to 5
g/L) was added. After 4 h of incubation, the culture medium was removed and 150 μL
of DMSO was added to each well to dissolve the formazan crystals formed by viable
cells. The absorbance at 570 nm was measured in a microplate reader (Tecan Infinite
2
00 Pro, Hombrechtikon, Switzerland). Relative cell survival was calculated by
setting each absorbance from control cells with vehicle treatment as 100%.
In other experimental settings, cells were seeded in 96-well plates (1.0 to 5.0 ×
3
1
0 cells/well) and cultured for 48 h with vehicle (DMSO) or HHQ-4 (1, 3, or 10 μM)
in presence or absence of glucose or 2-DG (10 mM). Cell viability was determined by
measuring cellular ATP levels using the CellTiter-Lumi™ Luminescent Cell Viability
Assay Kit (Beyotime). The luminescent signal was recorded on a Thermo Varioskan
Flash microplate reader (Thermo Fisher Scientific Inc., Rockford, IL, USA).
2
.4. 5-Ethynyl-2'-deoxyuridine (EdU) incorporation assay

ACCEPTED MANUSCRIPT
For EdU incorporation, exponentially growing MCF-7 and MDA-MB-231 cells
were cultured overnight and treated with vehicle (DMSO) or HHQ-4 (1, 3, or 10 μM)
for another 48 h, followed by incubation with 50 μM EdU (RiboBio, Guangdong,
China) for 2 h. Then the cells were fixed with 4% paraformaldehyde at room
temperature for 30 min followed by cell permeabilization with 0.5% (v/v) Triton
X-100 for 30 min. After washing with PBS for 5 min, the cells were incubated with 1
®
×
Apollo reaction cocktail for 30 min. Subsequently, the cell nuclei were
counterstained with Hoechst 33342 (5 μg/mL) for 30 min. Finally, an IN Cell
Analyzer 2500 (GE Healthcare, Little Chalfont, UK) was used to visualize
EdU-stained (with red fluorescence) and Hoechst-stained cells (with blue
fluorescence).
2
.5. Carboxyfluorescein diacetate succinimidyl ester (CFDA-SE) distribution assay
To determine the division history of cell populations undergoing proliferation,
exponentially growing MCF-7 and MDA-MB-231 cells were stained for 10 min at
7 °C with CFDA-SE (Beyotime) at a final concentration of 5 μM. Then, 10 mL of
3
DMEM containing 10% (v/v) FBS was added, and the cells were washed once.
Subsequently, staining was fixed by adding 10 mL of DMEM containing 10% (v/v)
FBS, and the cells were incubated at 37 °C for 5 min. Thereafter, the cells were
4
seeded into 6-well plates at about 5.0 × 10 cells/well overnight and treated with
vehicle (DMSO) or HHQ-4 (1, 3, or 10 μM) for another 48 h in glucose-free medium
or medium containing 2-DG (10 mM). Cell-permeable CFDA-SE is cleaved by

ACCEPTED MANUSCRIPT
intracellular esterase to yield fluorescent CFSE, which covalently binds to
intracellular amino groups on proteins. The proliferation of CFSE-labeled cells is
estimated by the progressive halving of fluorescence intensity of CFSE after each
division. Hence, dividing cells display a shift in carboxyfluorescein fluorescence in
parallel with an increased cell count indicating cell proliferation. The fluorescence
intensity of CFSE in individual cells was measured on a FACSCalibur flow cytometer
(Becton Dickinson, San Jose, CA, USA). Proliferation index was calculated using the
Proliferation Wizard module of the ModFit LT version 5.0 software (Verity Software
House, Topsham, ME, USA).
2
.6. Colony formation assay
Exponentially growing MCF-7 and MDA-MB-231 cells were plated in 6-well
plates at a density of 500 cells/well overnight and then treated with vehicle (DMSO)
or HHQ-4 (1, 3, or 10 μM) for 48 h in glucose-free medium or medium containing
2
-DG (10 mM). Then the cells were diluted in fresh normal medium and further
incubated under normal growth conditions for about 10 days until individual cells
formed distinctly visible colonies. Subsequently, colonies were fixed with 4%
paraformaldehyde for 15 min and stained with 0.1% (w/v) crystal violet staining
solution for 20 min. Images of colonies were photographed with a Canon EOS 650D
digital camera fitted with a Canon EF-S 18-55 mm f/3.5-5.6 IS II lens (Canon, Tokyo,
Japan).

ACCEPTED MANUSCRIPT
2
.7. Western blotting analysis
For Western blotting analysis, cells were lysed in a RIPA buffer (50 mM Tris pH
.0, 150 mM NaCl, 1% Triton X-100, 0.5 mM EDTA, 1% sodium deoxycholate, 0.1%
8
sodium dodecyl sulphate, 1 M 1, 4-dithiothreitol, 1 mM phenylmethylsulfonyl
fluoride, 10 mg/mL aprotinin and leupeptin, and 1 mM sodium orthovanadate;
Beyotime) containing a protease inhibitor cocktail (Roche Applied Science,
Indianapolis, IN, USA). After 30 min of gentle stirring at 4 °C, the sample was
centrifuged at 12,000 × g for 5 min and the supernatants were collected (total cell
lysate). In addition, nuclear fractions of cells were prepared using the NE-PER
Nuclear and Cytoplasmic Extraction kit (Pierce Biotechnology, Rockford, IL, USA)
in accordance with the manufacturer's instructions. After the protein concentration
was determined by BCA protein assay (Beyotime) according to the manufacturer's
instructions, equal amounts (30 μg) of protein samples were separated by 8–12% (w/v)
sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) electrophoresis, and
transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford,
MA, USA). After blocking the membranes in Tris-buffered saline (25 mM Tris-HCl,
pH 7.4, 137 mM NaCl, and 0.1% (v/v) Tween-20; TBS-T) containing 5% (w/v)
non-fat milk for 1 h at room temperature, immunoblots were probed with primary
antibodies at 4 °C overnight. After washing four times (10 min each) in TBS-T, the
membranes were incubated with
a
1:5000 dilution of horseradish
peroxidase-conjugated secondary antibody (Bioworld Technology, Minneapolis, MN,
USA) for 1 h at room temperature. Protein bands were visualized with an enhanced

ACCEPTED MANUSCRIPT
chemiluminescence (ECL) kit (Millipore). Images were captured with an Amersham
Imager 600 (GE Healthcare Biosciences, Little Chalfont, UK). Finally, densitometry
of bands was quantified with Quantity One software (Bio-Rad, Hercules, CA, USA).
The variation in the densitometry of bands is expressed as a ratio of the mean
densitometry for phosphorylated/activated protein to total/housekeeping protein
compared to that of the control sample in the blot.
2
.8. Detection of apoptotic cell death
For apoptotic cell death assays, cells were seeded into 6-well plates at a density
4
of about 5.0 × 10 cells/well overnight and then treated with vehicle (DMSO) or
various concentrations (1, 3, or 10 μM) of HHQ-4 in glucose-free medium or medium
containing 2-DG (10 mM) for another 48 h. At the end of treatment, cells were stained
with fluoresceinisothiocyanate-labeled annexin V (Annexin V-FITC; beyotime) and
propidium iodide (PI; beyotime) according to the manufacturer's instructions. After
staining with Annexin V-FITC and PI, samples were analyzed on a FACSCalibur flow
cytometer using the CellQuest software (Becton Dickinson). In the same experimental
settings, total cell lysates were subjected to Western blotting for two key regulators of
apoptosis (Bax and Bcl-2), and the cleaved forms of caspase-3 and PARP.
2
.9. XBP-1 splicing measurement
Exponentially growing MCF-7 and MDA-MB-231 cells were treated with
vehicle (DMSO) or HHQ-4 (1, 3 or 10 μM) in medium with or without glucose for 12

ACCEPTED MANUSCRIPT
h and were then washed with PBS. Total RNA was extracted from cells by using an
RNApure high-purity total RNA rapid extraction kit (Bioteke, Beijing, China) and
reverse transcribed to first-strand complementary DNA (cDNA) with RevertAid™
Reverse Transcriptase and oligo(dT)18 primer (Thermo Scientific, Waltham, MA,
USA). cDNA from cells was subjected to standard polymerase chain reaction (PCR)
TM
with Taq
DNA polymerase (TaKaRa Bio Inc., Otsu, Japan) and the following
primer pairs: XBP1 sense 5'-AAACAGAGTAGCAGCTCAGACTGC-3' and
antisense
5'-TCCTTCTGGGTAGACCTCTGGGAG-3';
β-actin
sense
5
5
'-GTCCACCGCAAATGCTTCTA-3' and
antisense
'-TGCTGTCACCTTCACCGTTC-3' (GENEWIZ, Inc., Suzhou, China). The
housekeeping gene β-actin was used as an internal control. The typical reaction
cycling conditions were as follows: (1) an initial denaturing step at 94 °C for 5 min;
(2) 40 cycles of 94 °C for 45 sec, 60 °C for 30 sec, and 72 °C for 30 sec; (3) a final
extension step at 72°C for 10 min. The PCR products were separated in a 5%
polyacrylamide gel to resolve the unspliced (XBP1u; 473 bp) and spliced (XBP1s;
4
47bp) forms of XBP1, stained with a silver staining Kit (Solarbio, Beijing, China),
TM
and visualized with a Gel Doc XR imaging system (Bio-Rad Laboratories, Hercules,
CA, USA). Tunicamycin (TM, Sigma-Aldrich), an inhibitor of protein
N-glycosylation, was used as a positive control to induce XBP1 splicing (5 mg/L for
1
2 h).
2
.10. RNA reverse transcription and quantitative real-time PCR (RT-qPCR)

ACCEPTED MANUSCRIPT
Exponentially growing MCF-7 and MDA-MB-231 cells were treated with
vehicle (DMSO) or HHQ-4 (1, 3 or 10 μM) for 24 h under normal glucose or
glucose-deprived conditions. The total RNA was isolated from each sample and
reversed to cDNA as described above. To assess mRNA expression, a quantitive
real-time PCR assay was performed as described in our previous report (Li et al.,
2
015). Primer sequences for target amplification are synthesized as follows: GRP78
sense
5'-GAAACCGCTGAGGCTTATT-3'
'-CATCTTTGCCCGTCTTCTT-3';
'-GTCCACCGCAAATGCTTCTA-3'
and
antisense
sense
5'-
5
5
β-actin
and
antisense
TGCTGTCACCTTCACCGTTC-3'.
2
.11. Construction and transfection of expression plasmids
The human GRP78 cDNA was cloned into the pCMV6-XL5 vector at the EcoRI
and SalI sites (SC108086, OriGene Technologies, Rockville, MD, USA); the human
spliced XBP1 expression vector was a gift from Qingbo Xu & Lingfang Zeng
(Addgene plasmid # 63680), which was cloned into pCMV5-Flag vector via KpnI and
HindIII sites; pCGN-ATF6 (1–373) expression vector encoding the N-terminal active
region of ATF6 was a gift from Ron Prywes (Addgene plasmid # 27173). MCF-7 and
4
MDA-MB-231 cells were seeded into 24-well plates at a density of 5 × 10 cells/well.
When cells reached approximately 50% confluence, transfection was conducted by
using the Lipofectamine™ 2000 reagent (Invitrogen Life Technologies Inc.,
Gaithersburg, MD, USA) according to the manufacturer's instructions. After 24 h of

ACCEPTED MANUSCRIPT
transfection, cells were treated with HHQ-4 (10 μM) for different periods under
glucose deprivation conditions. Protein expression for each transfection was detected
by Western blotting analysis. Meanwhile, a fraction of transfected cells was treated
with HHQ-4 (10 μM) for 48 h under glucose deprivation conditions, and then cells
were disaggregated into single cell suspensions in fresh normal medium and diluted to
a final density of 500 cells/well in triplicate wells of 6-well plates for colony
formation.
2
.12. Luciferase reporter assay
Reporter plasmid pGRP78pro160-Luc contains promoter region of the gene for
human GRP78 spanning nucleotides -160 to +7 (with flanking KpnI and HindIII sites),
which was amplified by PCR using the primer pair (5' to 3')
CATCCCAAGCTTTCGACCTCACCGTCGCCTACTC
and
CGGGGTACCGGAGCAGTGACGTTTATTGC, and genomic DNA from 293T cells
as a template. The resultant fragment was digested with KpnI and HindIII, and then
cloned into the pGL3-Basic vector (Promega, Madison, WI, USA). For GRP78
4
promoter assay, MCF-7 and MDA-MB-231 cells at a density of 1 × 10 were seeded
into each well of 96-well plates and cultured for 24 h. Then the cells were transiently
transfected with 375 ng of pGRP78pro160-Luc plasmid (firefly luciferase-containing
plasmid) together with 125 ng of pRL-TK reference plasmid (renilla
luciferase-containing plasmid; Promega) per well using the Lipofectamine™ 2000
transfection reagent (Invitrogen). After 6 h of transfection, the cells were treated with

ACCEPTED MANUSCRIPT
vehicle (DMSO) or various concentrations (1, 3, or 10 μM) of quinoline derivatives
for 18 h in the presence or absence of glucose. Cell lysates were assayed for relative
firefly-to-renilla luciferase activity using a dual luciferase reporter assay kit (Promega)
on a Thermo Varioskan Flash microplate reader.
2
.13. Statistical analysis
Data from 3 biological replicates were averaged for the analysis. All data are
expressed as mean ± standard deviation (SD). The significance of differences
between groups was evaluated by one-way analysis of variance (ANOVA), followed
by a Fisher's least significant difference (LSD) post hoc test. All Statistical analyses
were carried out using the SPSS version 19.0 software (IBM, Chicago, IL, USA). A
P value < 0.05 was considered as statistically significant.
3
. Results
3
.1. HHQ-4 showed preferential antiproliferative activity against glucose-deprived
breast cancer cells
To assess the effect of HHQ-4 on cell viability, human breast cancer cells lines
MCF-7 and MDA-MB-231, and human breast epithelial cell MCF-10 were exposed to
different concentrations (0–100 μM) of HHQ-4 in the presence or absence of glucose
or 2-DG (10 mM). Data from the MTT assay show that viability of MCF-7 cells
decreased by 45% (Fig. 1B), and that of MDA-MB-231 cells by 43% (Fig. 1C) at an
HHQ-4 concentration of 1 μM within 48 h of glucose deprivation when compared to

ACCEPTED MANUSCRIPT
that of control cells cultured in glucose-free medium with vehicle treatment. This
sensitivity to glucose deprivation was even more pronounced when HHQ-4 was added
at a concentration of 100 μM, at which almost 90% cell viability reduction was
observed, whereas there was no apparent loss of viability in cells cultured under
normal glucose conditions. When MCF-7 and MDA-MB-231 cells were treated with
HHQ-4 under 2-DG stress conditions, a similar sensitization to HHQ-4 occurred as
shown by the MTT assay. Notably, HHQ-4 did not exhibit any significant cytotoxicity
to MCF-10 cells even at a concentration of up to 100 μM (Fig. 1D), no matter under
normal growth conditions or stress conditions induced by either glucose withdrawal
or 2-DG.
We further evaluated the cell viability by measuring intracellular ATP levels in
HHQ-4-treated cells and its control cells with vehicle treatment. HHQ-4 specifically
decreased the intracellular levels of ATP in breast cancer cells in a
concentration-dependent manner under glucose-deprived (Fig. 1E and H) or
2
-DG-stressed (Fig. 1F and I) conditions, but it had no effects on the production of
ATP in the breast cancer cells under normal growth conditions even at a high
concentration (10 μM; Fig. 1G and J), which are consistent with observations from
the MTT assay. In addition, after 48 h of incubation with HHQ-4 under
glucose-deprived and 2DG-stressed conditions, many of the breast cancer cells
exhibited marked morphological alterations characterized by cytoplasmic shrinkage
and either plasma membrane blebbing or disintegration (Fig. 2A–D).

ACCEPTED MANUSCRIPT
Next, EdU incorporation and CFDA-SE distribution assays were performed to
examine the effects of HHQ-4 on breast cancer cell proliferation. Under
glucose-deprived and 2DG-stressed conditions, the percentage of EdU-positive cells
corresponding to the S phase was lower with HHQ-4 treatment than with vehicle (Fig.
2
E–H). HHQ-4 treatment also caused a strong inhibition of cell division during
growth (Fig. 3G–J), which was paralleled by a decrease in the cell proliferation index
Fig. 3K). Furthermore, we investigated the effects of HHQ-4 on the long-term cell
(
survival and proliferation by colony formation assay. HHQ-4 treatment effectively
inhibited the clonogenic ability of breast cancer cells in a concentration-dependent
manner following 48-h incubation under glucose deprivation conditions (Fig. 3A, B,
E, and F). When combined with 2-DG, HHQ-4 showed more potent inhibitory
activity against clonogenicity of breast cancer cells than it did under glucose
deprivation conditions (Fig. 3C, D, E and F). However, breast cancer cells did not
undergo apoptosis and necrosis to any significant extent following HHQ-4 treatment
under glucose-deprived and 2DG-stressed conditions, as evidenced by Annexin
V-FITC and PI staining (Supplementary Fig. S5A–D). After treating the breast cancer
cells with HHQ-4, we also measured levels of apoptotic-related proteins by western
blotting. Our results showed that the expression of Bcl-2 and Bax, as well as the
cleavage of caspase-3 and PARP, was unaffected by HHQ-4 under stressful
microenvironments (Supplementary Fig. S5E and F).
Taken together, these data demonstrate HHQ-4 exerts potent antiproliferative
effect on breast cancer cells under 2DG- or hypoglycemic-stressed conditions.

ACCEPTED MANUSCRIPT
3
.2. HHQ-4 inhibited proliferation of human breast cancer cells by down-regulating
expression of GRP78 under glucose deprivation conditions
As part of the UPR induced by ER stress, two ER chaperones GRP78 and
GRP94 are transcriptionally induced, which confers survival signals to stressed cells
and resistance to anti-cancer agents (Luo and Lee, 2013). To investigate the
underlying mechanism of differential inhibition of cell survival and proliferation by
HHQ-4, the GRP78 and GRP94 proteins were detected both in MCF-7 and
MDA-MB-231 cells treated with HHQ-4 (3 μM) for 6, 12, and 24 h under normal
growth or glucose-free conditions. The results showed that both mRNA and protein
levels of GRP78 were increased under glucose deprivation conditions, and HHQ-4
abolished the increases in a time- and concentration-dependent manner (Fig. 4A and
C–F; Supplementary Fig. S6A, C, E and F). However, HHQ-4 did not show any
inhibitory effect on GRP78 protein expression under normal growth conditions, and it
had little effect on the GRP94 protein expression at any time point or concentration
tested in cells cultured normally or deprived of glucose. On the other hand, HHQ-4
had a similar inhibitory effect on 2-DG-induced GRP78 protein expression both in
MCF-7 and MDA-MB-231 cells in a time-dependent manner (Fig. 4B;
Supplementary Fig. S6B and D). It is worth noting that treatment with HHQ-4
significantly suppressed the induction of GRP94 protein in response to 2-DG stress.
To further identify the role of GRP78 in the selective antiproliferative effect of
HHQ-4 against glucose-deprived breast cancer cells, MCF-7 and MDA-MB-231 cells

ACCEPTED MANUSCRIPT
were transfected with a pCMV6-XL5-GRP78 overexpression plasmid or
pCMV6-XL5 vector control plasmid before treatment with HHQ-4 (10 μM) for 24 h
under glucose deprivation conditions. We then analyzed the effect of GRP78
transfection on cell proliferation by colony formation assay. Regardless of whether
they were treated with HHQ-4 or not, cells transfected with the pCMV6-XL5-GRP78
overexpression plasmid showed more robust ability to form colonies than cells
transfected with empty vector (Fig. 4G and H; Supplementary Fig. S6G and H). By
transfecting the cells with pCMV6-XL5-GRP78, we were able to restore
clonogenicity in cells pretreated with HHQ-4 to nearly the same levels as in cells
transfected with empty vector and incubated only with the glucose-free medium.
These results suggest that the inhibitory effects of HHQ-4 on breast cancer cell
proliferation during glucose deprivation may be mediated through down-regulation of
GRP78 expression.
3
.3. HHQ-4 suppressed glucose deprivation-induced GRP78 expression and cell
proliferation partially by inhibition of the PERK/eIF2α/ATF4-dependent arm of the
UPR in MCF-7 cells, but not in MDA-MB-231 cells
Upon UPR activation, selective translation of ATF4 initiated by PERK/eIF2α
signaling transcriptionally regulates GRP78 expression, which is crucial for tumor
proliferation (Dong et al., 2008). We, therefore, focused on whether the
PERK/eIF2α/ATF4 branch of the UPR is involved in the HHQ-4-mediated
suppression of GRP78 expression and proliferative responses under glucose

ACCEPTED MANUSCRIPT
deprivation conditions. By Western blotting analysis, we found the phosphorylated
levels of PERK at ser713 and eIF2α at ser51 peaked 0.25 h after glucose withdrawal
and then gradually declined to the control level both in MCF-7 (Fig. 5A) and
MDA-MB-231 cells (Fig. 5B). The level of ATF4 protein was also strongly induced
after 3 h of glucose-free treatment and maintained at a high level until 24 h.
Significantly, pretreatment with various concentrations (1, 3, or 10 μM) of HHQ-4
inhibited the increase in the phosphorylation state of PERK and eIF2α and level of
ATF4 protein induced by glucose-free medium treatment in MCF-7 cells (Fig. 5C;
Supplementary Fig. S7A–C). However, HHQ-4 failed to change the phosphorylation
of PERK and eIF2α as well as the level of ATF4 protein in MDA-MB-231 cells under
the same conditions (Fig. 5D; Supplementary Fig. S7E–G). Meanwhile, treatment
with HHQ-4 (10 μM) alone did not detectably affect the expression of ATF4 or
phosphorylated PERK and eIF2α proteins compared with vehicle control both in
MCF-7 and MDA-MB-231 cells.
To provide more direct evidence that HHQ-4 inhibited glucose
deprivation-induced GRP78 expression and cell proliferation by suppressing the
PERK/eIF2α/ATF4 pathway under glucose deprivation conditions, we tested the
phosphorylation level of eIF2α and protein level of ATF4 after pretreating MCF-7 and
MDA-MB-231 cells with salubrinal. As a compound selectively inhibiting the activity
of specific protein phosphatase complex, salubrinal prevented dephosphorylation of
eIF2α, a downstream target of PERK, and up-regulated ATF4 expression in MCF-7
cells under glucose deprivation conditions (Fig. 5E). Meanwhile, salubrinal also

ACCEPTED MANUSCRIPT
significantly enhanced GRP78 expression and promoted cell proliferation under the
same conditions (Fig. 5E; Supplementary Fig. S7D). Notably, an increase in the
protein levels of phosphorylated eIF2α and ATF4 was highly correlated with
up-regulation of GRP78 expression, suggesting that the intactness of
PERK/eIF2α/ATF4 pathway is necessary for GRP78 expression and subsequent cell
proliferation in glucose-deprived MCF-7 cells. We also observed that pretreating cells
with salubrinal (3 μM) partially blocked the suppression of phosphorylated eIF2α,
ATF4 and GRP78 expression by HHQ-4 (10 μM), thereby promoting the
clonogenicity of MCF-7 cells. In contrast, the maintenance of eIF2α in a
hyper-phosphorylated state and induction of ATF4 expression by salubrinal did not
substantially affect the level of GRP78 protein and formation of colonies in
MDA-MB-231 cells under glucose-free conditions (Fig. 5F; Supplementary Fig. S7H),
irrespective of whether the cells were treated with salubrinal alone or in combination
with HHQ-4. Overall, these data suggested that deactivation of PERK/eIF2α/ATF4
signaling pathway mediates, at least in part, the effects of HHQ-4 on the inhibition of
GRP78 expression and cell proliferation during glucose deprivation in MCF-7 cells,
whereas not in MDA-MB-231 cells.
3
.4. HHQ-4 suppressed glucose deprivation-induced GRP78 expression and cell
proliferation partially by inhibition of the ATF6 branch of the UPR in MDA-MB-231
cells, but not in MCF-7 cells

ACCEPTED MANUSCRIPT
Although contribution of the PERK/eIF2α/ATF4 pathway in the induction of
GRP78 gene expression has been suggested as described above, the stressed ER also
initiates the degradation of the other UPR transducer, ATF6, by serine protease site-1
(S1P) and site-2 protease (S2P) (Zhang and Kaufman, 2004). ATF6 is processed to its
active form (p50 ATF6) which then translocates to the nucleus, where it activates
transcription of various UPR-responsive genes, such as GRP78 (Zhang and Kaufman,
2
004). Thus, we first examined the impact of glucose-free treatment on the expression
of this nuclear form of ATF6 as a marker of its activation. As shown in Fig. 6A, the
protein level of p50 ATF6 was up-regulated from 0.25 to 24 h of glucose deprivation
in MCF-7 cells and peaked at 3 h. In MDA-MB-231 cells, intracellular cleavage and
nuclear localization of ATF6 occurred as early as 0.25 h of glucose deprivation.
However, longer periods of incubation (0.5–24 h) did not further increase nuclear
accumulation of p50 ATF6 (Fig. 6B). Although treatment with HHQ-4 (10 μM) alone
had no apparent effect on the basal expression of p50 ATF6, pretreatment with HHQ-4
markedly inhibited the increase in the level of p50 ATF6 protein triggered by glucose
deprivation both in MCF-7 (Fig. 6C; Supplementary Fig. S8A) and MDA-MB-231
cells (Fig. 6D; Supplementary Fig. S8B).
To determine whether the ATF6 pathway of the UPR was involved in the
inhibition of GRP78-dependent proliferation of breast cancer cells by HHQ-4 under
glucose deprivation conditions, we transfected a pCGN-ATF6 (1–373) expression
plasmid into MCF-7 cells and found that transfection with pCGN-ATF6 (1–373)
caused up-regulation of p50 ATF6 protein but had no effect on that of GRP78 protein

ACCEPTED MANUSCRIPT
and clonogenic ability of cells in absence or presence of HHQ-4 (10 μM; Fig. 6E;
Supplementary Fig. S8C). In contrast, ectopically expressed p50 ATF6 in
MDA-MB-231 cells increased the protein level of GRP78 as well as the formative
colony numbers under the same conditions (Fig. 6F). More importantly, we observed
that the down-regulation of GRP78 expression and loss of clonogenicity of cells by
HHQ-4 were partially reversed when MDA-MB-231 cells were transfected with the
pCGN-ATF6 (1–373) plasmid (Supplementary Fig. S8D). Together, these results
suggested that HHQ-4 suppressed the up-regulation of GRP78 and subsequent cell
proliferation during glucose deprivation at least in part by blocking the ATF6 arm of
the UPR in MDA-MB-231cells, but not in MCF-7 cells.
3
.5. HHQ-4 inhibited glucose deprivation-induced GRP78 expression and cell
proliferation via interfering with the IRE1/XBP1 branch of the UPR in both MCF-7
and MDA-MB-231 cells
Upon induction of the UPR, the RNase of IRE1 is trans-autophosphorylated and
activated, allowing it to remove a 26-base pair intron from the full-length unspliced
XBP1 mRNA (XBP1u) (Lin et al., 2007). The resulting spliced XBP1 mRNA (XBP1s)
encodes a protein that serves as a potent transcriptional activator of many
UPR-inducible genes, including GRP78 (Zhang and Kaufman, 2004). To assess
whether glucose deprivation triggered the activation of the IRE1-XBP1 pathway, we
analyzed the levels of phosphorylated IRE1α protein and spliced XBP1 mRNA during
glucose deprivation. Time course studies showed a rapid and robust phosphorylation

ACCEPTED MANUSCRIPT
of IRE1α was detected as early as 0.5 and 1 h after incubation with the glucose-free
medium in MCF-7 (Fig. 7A) and MDA-MB-231 cells (Fig. 7B), respectively. We also
noticed that at the later stage of depletion of glucose in the medium (6 or 12 h), a
large fraction of XBP-1 mRNA is spliced by the activated IRE1 in MCF-7 (Fig. 7E)
and MDA-MB-231 cells (Fig. 7F). In addition, an identical 447-bp fragment
amplified from XBP1s was also observed in TM-treated breast cancer cells as positive
control. Notably, pretreatment with HHQ-4 significantly suppressed IRE1α
phosphorylation and activation stimulated by glucose deprivation in MCF-7 (Fig. 7C;
Supplementary Fig. S9A) and MDA-MB-231 cells (Fig. 7D; Supplementary Fig.
S9C). Moreover, HHQ-4 was also found to inhibit the activation of XBP-1 splicing in
a concentration-dependent manner under the same conditions (Fig. 7G and H).
To further investigate the role of the IRE1/XBP1 pathway in the inhibition of
GRP78-dependent proliferation of breast cancer cells by HHQ-4 under glucose
deprivation conditions, MCF-7 and MDA-MB-231 cells were transfected with
pCMV5-Flag-XBP1s overexpression or pCMV5-Flag empty vector plasmid for 48 h
prior to addition of HHQ-4 (10 μM). Transfection with the XBP1s overexpression
plasmid further increased glucose deprivation-induced XBP1s and GRP78 protein
expression (Fig. 7I and J). Colony formation assay also showed that transfection with
the XBP1s overexpression plasmid induced more cells to form colonies than the
empty vector during glucose deprivation (Supplementary Fig. S9B and D). The
consistent induction of XBP1s and GRP78 expression implied that spliced form of
XBP1 (XBP1s) trans-activated the transcription of GRP78 target gene during glucose

ACCEPTED MANUSCRIPT
deprivation, thereby facilitating the proliferation of both MCF-7 and MDA-MB-231
cells. Strikingly, after transfection of XBP1s gene, the inhibitory effects of HHQ-4 on
the GRP78 expression and colony-forming ability were remarkably attenuated. Hence,
these results suggested that HHQ-4 induced down-regulation of GRP78 expression
and subsequent proliferation inhibition during glucose deprivation, at least in part, by
blunting activation of IRE1/XBP1 pathway both in MCF-7 and MDA-MB-231 cells.
4
. Discussion
In the course of searching for inhibitors of GRP78 gene transcription, we found
HHQ-4, a quinoline derivate, could inhibit activation of a GRP78 promoter reporter in
glucose-deprived breast cancer cells. Previous research has revealed that ER
stress-induced increase in GRP78 expression is a key pro-survival component of the
evolutionarily conserved UPR (Dong et al., 2008). GRP78 has been found highly
expressed in a panel of biopsy specimens and cell lines from human breast cancer,
promoting cellular resistance to various stresses, including hypoxia, glucose
deprivation, and anticancer agent treatment (Fernandez et al., 2000; Li and Lee, 2006).
Thus, GRP78 has been seen as a promising therapeutic target in solid cancers (Lee,
2
007). Substances that selectively inhibit GRP78 expression might be potential
chemotherapeutical agents (Chang et al., 2015). In the present study, we have
presented evidence that HHQ-4 exhibited highly selective anti-proliferative activity
against glucose-deprived breast cancer cells by down-regulating the expression of
GRP78. Particularly, we also found the down-regulation of GRP78 expression by

ACCEPTED MANUSCRIPT
HHQ-4 was mediated, at least to some extent, by differentially suppressing the
activation of ATF4, XBP1, and ATF6 in breast cancer cells exposed to glucose
deprivation. In addition, the hypoglycemic or 2-DG-stressed conditions under which
HHQ-4 was toxic to breast cancer cells but not normal breast epithelial cells.
Upon UPR activation, PERK-dependent eIF2α phosphorylation signaling
regulates about one-third of UPR-responsive gene transcription (Shen et al., 2004).
Although global protein synthesis repression could be imposed by eIF2α
phosphorylation, ATF4 was reported to be induced by eIF2α phosphorylation on
serine 51. As a result, ATF4 regulates the GRP78 expression at the transcriptional
level, which is vital for the survival of tumor cells in the glucose-restricted
microenvironment. Here, we found salubrinal increased proliferative activity of
glucose-deprived MCF-7 cells by inhibiting eIF2α dephosphorylation and
subsequently up-regulating the expression of ATF4 and GRP78. More importantly,
salubrinal could reverse the inhibitory effects of HHQ-4 on GRP78 expression and
cell proliferation during glucose deprivation. These results suggest that in MCF-7
cells, HHQ-4 suppressed the GRP78 expression with consequent cell proliferation at
least in part by blocking PERK/eIF2α/ATF4 branch of the UPR. In MDA-MB-231
cells, however, the same concentration of salubrinal did not significantly affect the
GRP-78 protein expression and the capacity of the cells to form viable colonies after
HHQ-4 treatment. Similarly, a discrepant response pattern of the two cell types to the
cytotoxicity of curcumin was also observed in a previous study (Jia, et al., 2014).
These results suggested that the differential molecular signaling that underlies distinct