Design, Synthesis, and Evaluation of WD-Repeat-Containing Protein 5 (WDR5) Degraders

Article abstract of DOI:10.1021/acs.jmedchem.1c00146

Histone H3K4 methylation serves as a post-translational hallmark of actively transcribed genes and is introduced by histone methyltransferase (HMT) and its regulatory scaffolding proteins. One of these is the WD-repeat-containing protein 5 (WDR5) that has also been associated with controlling long noncoding RNAs and transcription factors including MYC. The wide influence of dysfunctional HMT complexes and the typically upregulated MYC levels in diverse tumor types suggested WDR5 as an attractive drug target. Indeed, protein-protein interface inhibitors for two protein interaction interfaces on WDR5 have been developed. While such compounds only inhibit a subset of WDR5 interactions, chemically induced proteasomal degradation of WDR5 might represent an elegant way to target all oncogenic functions. This study presents the design, synthesis, and evaluation of two diverse WDR5 degrader series based on two WIN site binding scaffolds and shows that linker nature and length strongly influence degradation efficacy.

Full text of DOI:10.1021/acs.jmedchem.1c00146

pubs.acs.org/jmc
Featured Article
Design, Synthesis, and Evaluation of WD-Repeat-Containing Protein
5 (WDR5) Degraders
Anja Dölle,∥∥ Bikash Adhikari,∥∥ Andreas Krämer, Janik Weckesser, Nicola Berner, Lena-Marie Berger,
Mathias Diebold, Magdalena M. Szewczyk, Dalia Barsyte-Lovejoy, Cheryl H. Arrowsmith, Jakob Gebel,
Frank Löhr, Volker Dötsch, Martin Eilers, Stephanie Heinzlmeir, Bernhard Kuster, Christoph Sotriffer,
Elmar Wolf,* and Stefan Knapp*
Cite This: https://doi.org/10.1021/acs.jmedchem.1c00146
Read Online
sı
*
Metrics & More
Article Recommendations
Supporting Information
ACCESS
ABSTRACT: Histone H3K4 methylation serves as a post-translational hallmark of actively
transcribed genes and is introduced by histone methyltransferase (HMT) and its regulatory
scaffolding proteins. One of these is the WD-repeat-containing protein 5 (WDR5) that has
also been associated with controlling long noncoding RNAs and transcription factors
including MYC. The wide influence of dysfunctional HMT complexes and the typically
upregulated MYC levels in diverse tumor types suggested WDR5 as an attractive drug target.
Indeed, protein−protein interface inhibitors for two protein interaction interfaces on WDR5
have been developed. While such compounds only inhibit a subset of WDR5 interactions,
chemically induced proteasomal degradation of WDR5 might represent an elegant way to target all oncogenic functions. This study
presents the design, synthesis, and evaluation of two diverse WDR5 degrader series based on two WIN site binding scaffolds and
shows that linker nature and length strongly influence degradation efficacy.
activity of KMT2s is dependent on the assembly of further
adaptor proteins. The so-called WRAD complex consists of
WD-repeat-containing protein 5 (WDR5), DPY30, absent,
small, or homeotic-2 like (ASH2L), and retinoblastoma
binding protein 5 (RBBP5).14,15
INTRODUCTION
■
Eukaryotic transcription by all three nuclear RNA polymerases
is controlled by chromatin organization. The accessibility of
chromatin is influenced by the distribution of nucleosomes in
the genome, the composition of histone variants within
nucleosomes, and post-transcriptional modifications of histone
proteins. Histone modifications present a crucial layer of
epigenetic transcription control and have become a wide
research field as their influence on disease development and
progression is outstanding.1 Tight control of target gene
transcription is specifically important for multicellular organ-
isms as deregulated transcription is often associated with
aberrant cellular growth and proliferation and might ultimately
induce the development of cancer.2−7
Among all possible histone modifications, mono-(me1), di-
(me2), or tri-(me3) methylation of lysine residues in histone
tails is considered as the key hallmark of epigenetic regulation.
One important example is the methylation of histone H3 lysine
4 residues (H3K4), which defines regulatory elements such as
promoters of RNA polymerase II and enhancer elements, and
therefore plays a critical role in transcriptional regulation of
most protein coding genes.8−10 Cellular H3K4 methylation
levels are determined by the balance between H3K4
demethylases and methyltransferases.11,12 The highly con-
served class 2 lysine methyltransferase (KTM2) comprises the
mixed-lineage leukemia family (MLL1, MLL2, MLL3, MLL4,
MLL5) and SET1A/SET1B enzymes and are responsible for
deposition of most of the H3K4 methylation marks associated
with transcription.13 With the exception of MLL5, the catalytic
WDR5 is of particular importance: its propeller-shaped WD
interaction domain interacts with a large diversity of proteins
as well as some long noncoding RNAs. Both surfaces of the
doughnut-shaped WD domain protein present docking sites,
which are called WIN (WDR5-interacting site) and WBM
(WDR5-binding motif) sites, and both protein interaction sites
have been targeted successfully by small molecules.16−21
Interestingly, WDR5 is not only an integral part of the
WRAD complex but also directly binds to the MYC
oncoprotein family (c-, L-, and N-Myc).22,23 MYC proteins
are essential transcription factors, and their expression is
frequently enhanced and deregulated in human tumors.24
Partial genetic inhibition of MYC is well tolerated in adult
mice, and it induces tumor regression and long-term survival in
several tumor models such as lung adenocarcinoma,25 but no
clinical inhibitor of MYC function is available, so far.26 MYC
Received: January 25, 2021
https://doi.org/10.1021/acs.jmedchem.1c00146
© XXXX American Chemical Society
J. Med. Chem. XXXX, XXX, XXX−XXX
A

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
Figure 1. Synthesis design of WDR5 degraders based on available crystal structures. (a) Crystal structures of WDR5 in complex with the small-
molecule antagonist OICR-9429 (pink; the chemical structure of OICR-9429 is displayed above) and (b) a small molecule published by Wang and
co-workers (blue; chemical structure of the chemical probe is displayed above). The red-colored spheres indicate the solvent-exposed site and
represent the attachment point for linkers. pdb entry: 4QL1, 6DAK. (c) (Upper panel) Schematic illustration of a heterobifunctional degrader
molecule (also called PROTAC) consisting of a ligand for the target protein (WDR5, herein colored in pink/blue) and a ligand binding an E3
ligase (orange). (Lower panel) Chemical structures of two developed degrader series targeting WDR5. The molecules contain either the OICR-
9429 derivate (pink) or the pyrroloimidazole derivate (blue) and are connected via different linkers (red) to different E3 ligase ligands (orange).
binds to the WBM site of WDR5 with an evolutionary
conserved N-terminal region, which is called Myc-box IIIb.27
Interestingly, the interaction of MYC with WDR5 supports
chromatin association of MYC and is required for the MYC-
mediated induction of components of the ribosome and
protein production.28 Recently, first MYC/WDR5 protein−
protein interface inhibitors have been developed.15,29
The WDR5 WIN site, located opposite the MYC binding
site, is required for WDR5 chromatin recruitment and
interaction with KMT2 enzymes, and MLL1 is particularly
dependent on this interaction. The small-molecule antagonist
OICR-9429 for instance binds to the WIN site of WDR5 and
efficiently disrupts its interaction with MLL1.16,17 Its potential
as an anticancer agent has been demonstrated in leukemia and
some solid tumors.17,30,31 Interestingly, targeting the WIN site
with small molecules evicts WDR5 as well as its interaction
partners from the chromatin, resulting in changes in MLL1-
dependent histone methylation.27,30 Besides WDR5s’ well-
established scaffolding function for KMT2 enzymes, long
noncoding RNAs are also able to bind to WDR5, adding a
further key role in MLL regulation of gene transcription and
tumorigenesis.32,33
Both main binding sites of WDR5 are important for key
oncogenic functions. We hypothesized therefore that a WDR5
degrader molecule may be an efficient therapeutic agent for
cancer treatment and designed a series of PROTACs
(PROteolysis TArgeting Chimeras) based on two known
WIN ligands at two diverse attachment points for linkers and
E3 binding moieties. Herein, we present the development of
WDR5 degraders that are based on the scaffold of the
antagonist OICR-9429 as well as a modified pyrroloimidazole
scaffold published by Wang and co-workers.16−18 The most
optimal degraders of both series result in rapid, selective, and
robust degradation of WDR5, providing chemical tools for
further studies on this interesting cancer target.
RESULTS AND DISCUSSION
■
Synthesis Design of WDR5 Degraders. In this study,
two established WDR5 antagonists were used as basic
anchoring scaffolds for the PROTAC design: the (trifluor-
omethyl)-pyridine-2-one OICR-9429 as well as the pyrroloi-
midazole-based inhibitor that was published by Wang and co-
workers.16−18 An overlay of the available crystal structures of
the inhibitor complexes revealed (see Figure 1) that the two
ligands enter the WDR5-binding pocket at different angles.
B
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
a
Scheme 1. Synthesis Route of WDR5 Degraders 7a−e Addressing the E3 Ligase Cereblon (CRBN)
a
(a) N,N-Diisopropylethylamine (DIEA), EtOH, 80 °C, 16 h; (b) Zn, NH4Cl, dioxane/water (3/1), rt, 30 min; (c) (4-(tert-
butoxycarbonyl)phenyl)boronic acid, XPhos PdG3, NaHCO3, dioxane/water (3/1), 85 °C, 16 h; (d) 1. carboxylic acid, SOCl2, CH2Cl2/ACN
(1/1), 50 °C, 3 h; 2. pyridine, CH2Cl2/ACN (1/1), 50 °C, 16 h; (e) 1. Trifluoroacetic acid (TFA)/CH2Cl2 (1/1), rt, 1 h; 2. HATU, DIEA, N,N-
dimethylformamide (DMF), CRBN ligase ligand linker L1−L5, rt, 3−5 h. The type and nature of the linker are indicated in red.
The attachment points to the E3 ligase binding moiety were
chosen at carbonyl groups that were solvent-accessible and
allowed the exit of linker moieties at different positions of the
WIN pocket. We hypothesized that the diversity of linker
attachment points might increase the possibility of efficient
ternary complex formation and thus successful degradation of
WDR5 by the developed degraders.
Synthesis of OICR-9429-Based Degraders 7a−e, 8a−j,
and 9a−c. In the first series, the WDR5 antagonist OICR-
9429 scaffold was used.16,17 Educts 1 and 2 formed
intermediate 3 in a nucleophilic aromatic substitution. The
reduction reaction of the aromatic nitro group led to
intermediate 4, which was coupled via a Suzuki−Miyaura
cross-coupling to obtain biaryl 5. To maintain affinity for
WDR5, an amide coupling of the primary amine 5 with the
nicotinic acid was carried out to form amide 6. The in situ
deprotection of the carboxylic acid on the attached biaryl
system pointed toward the solvent and served as an elongation
point of several E3 ligase linkers L1−L15 (synthesis described
in the Supporting Information). The E3 ligase linker molecules
were synthesized either by attaching the Boc-protected linker
to the VHL ligand in an amide formation reaction or by
attaching the Boc-protected linker to pomalidomide in a
nucleophilic aromatic substitution. Deprotection of intermedi-
ate 6 and amide coupling reactions to the corresponding E3
ligase linker resulted in degrader molecules 7a−e and 8a−j.
The synthetic steps carried out for the synthesis of the OICR-
9429-based degrader molecules are shown in Schemes 1 and 2.
C
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
a
Scheme 2. Chemical Structures of WDR5 Degraders 8a−j Addressing the E3 Ligase Von−Hippel−Lindau (VHL)
a
The synthesis steps starting from intermediate 6 are shown: (a) 1. TFA/CH2Cl2 (1/1), rt, 1 h; 2. HATU, DIEA, DMF, linker L6−L14, rt, 3−5 h.
The type and nature of the linker are indicated in red.
For the synthesis of the E3 ligase MDM2 targeting
degraders, the linker was directly attached to the modified
OICR-9429 scaffold 6 to form intermediates 6a−c, and this
molecule was subsequently coupled using an amide formation
reaction to the MDM2 inhibitor idasanutlin, yielding degrader
molecules 9a−c, as shown in Scheme 3.
Synthesis of Pyrroloimidazole-Based Degraders
17a−g. The modified scaffold of the second degrader series
was derived from the antagonist published by Wang and co-
workers.18 The synthetic scheme for the pyrroloimidazole-
based molecules is shown in Scheme 4. Educt 10 underwent an
intramolecular cyclization to form aryl bromide 11. Inter-
mediate 11 reacted by a Suzuki−Miyaura cross-coupling with
(3-cyano-4-methoxyphenyl)boronic acid to form the biaryl
system 12. Reduction of the nitrile group led to amine 13,
which was then coupled with 2-(3,4-dichlorophenyl)acetic acid
to yield amide 14. Ether deprotection of intermediate 14 led to
the free phenol 15. Phenol 15 was reacted by a nucleophilic
substitution reaction with the tosylated linker derivatives to
yield intermediates 16a−g. Deprotection of 16a−g followed by
amide-bond formation with the VHL E3 ligase ligand34
resulted in the degrader molecules 17a−g.
Evaluation of Degrader Binding to WDR5. To gain a
first indication of the binding affinity of the degraders to
WDR5, differential scanning fluorimetry (DSF)/temperature-
shift measurements were carried out with recombinantly
expressed WDR5, using the WDR5 antagonist OICR-9429 as
a reference compound. The obtained temperature shifts ΔTm
D
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
a
Scheme 3. Synthesis Route of WDR5 Degraders 9a−c Addressing the E3 Ligase MDM2
a
The synthesis steps starting from intermediate 6 are shown: (a) 1. TFA/CH2Cl2 (1/1), rt, 1 h; 2. HATU, DIEA, DMF, linker, rt, 3−5 h; (b) 1.
TFA/CH2Cl2 (1/1), rt, 1 h; 2. HATU, DIEA, DMF, idasanutlin, rt, 12 h. The type and nature of the linker are indicated in red.
are listed in Table 1. Unexpectedly, the inhibitor modification
6 increased the thermal stability significantly when compared
to the reference OICR-9429, suggesting improved potency.
Regarding the degrader molecules, temperature-shift data
correlated with the nature of the introduced linker: mostly
aliphatic linker 8e−i showed weaker thermal stabilization
compared to more polar linkers in 8a and 8c. However, this
might be due to the limiting solubility of compounds
containing an aliphatic linker. The heterobifunctional mole-
cules 7a, 8a, and 9a contained the shortest [PEG]-linker
([PEG]1), and they showed higher melting temperature shifts
than degraders containing longer [PEG]-linkers, regardless of
the E3 ligase ligand used. Besides the heterobifunctional
molecules, the inhibitors idasanutlin, VHL ligand 1, and a
modified thalidomide were included in the experiments to
investigate their binding affinity toward WDR5 (see the
Supporting Information). All E3 ligase ligands alone used did
not result in significant temperature shifts of WDR5. The
MDM2 ligand-containing degraders 9a−c lost their affinity
toward WDR5 possibly due to their size and associated less
favorable physiochemical properties or steric constraints.
Performing DSF measurements of MDM2 targeting degrader
intermediates 6a−c, a decrease in temperature shifts was
observed.
To determine the binding affinity for WDR5 in solution,
isothermal titration calorimetry (ITC) measurements for
selected degrader molecules 7a, 8a, and 8e−j were performed
(see Table 1; for binding curves, see the Supporting
Information). We chose CRBN-based degrader 7a and VHL-
based degrader 8a for ITC measurements due to their
E
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
a
Scheme 4. Synthesis of WDR5 degraders 17a−g addressing the E3 ligase VHL
a
(a) POBr3, MeCN, MW, 70 °C, 2 h; (b) (3-cyano-4-methoxyphenyl)boronic acid, XPhos PdG3, NaOH, THF/H2O, 80 °C, 21 h; (c) LiAlH4,
THF, 60 °C−rt, 21 h; (d) 2-(3,4-dichlorophenyl)acetic acid, EDC, HOBt, DIEA, DMF, rt, 16 h; (e) 1. BBr3, CH2Cl2, −78 °C to rt, 21 h; 2.
NaOH/H2O; (f) linker-OTs, K2CO3, DMF, 70 °C, 16−22.5 h; (g) 1. TFA/CH2Cl2 (1/1), rt, 1.5 h; 2. HATU, DIEA, DMF, VHL hydrochloride
linker, rt, 3−18 h. The type and nature of the linker are indicated in red.
comparably small molecular weight, their identical linker
structure, and the high ΔTm value. Their comparison showed
that the binding affinity did not correlate well with ΔTm shifts;
7a, which showed less thermal stabilizing, had a three times
higher affinity for WDR5 than 8a, which showed a higher ΔTm
value. Also, DSF measurements revealed that 8e−i showed a
surprising diversity of thermal stabilization (ranging from 3.5
to 13 K shift), and these ligands were therefore chosen for
further characterization by ITC. Interestingly, only a small
difference in binding affinity was observed for degraders 8e−i,
which decrease with increasing linker length (ethyl- to hexyl-
linker). Similar to 7a and 8a, we concluded that high thermal
stabilization did not always correlate well with the binding
affinity for these large ligands. For instance, 8g and 8j
displayed the highest ΔTm shifts, but in ITC measurements,
they showed the lowest binding affinities in this series.
Furthermore, a decrease in solubility was observed for
degraders with a long aliphatic linker (especially 8h and 8i),
which made data acquisition using ITC challenging. The
limited solubility of some degraders also made comparison of
thermodynamic parameters problematic, and particularly
thermodynamic data measured on degraders harboring
aliphatic and aromatic linkers such as 8h, 8i, and 8j need to
be treated with caution. Despite all of these technical
F
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
Table 1. In Vitro and In Cellulo Data of the WDR5 Antagonist OICR-9429, the Modified Inhibitor 6, and Degraders 7a−e, 8a−
j, and 9a−c
a
Thermal shift ΔTm values given are the mean of triplicate measurements. DSF assays were performed at 2 μM protein concentration and a final
b
compound concentration of 10 μM. Kd values were derived from ITC measurements (carried out as duplicate, except for 8i, which was measured
in a single measurement) and calculated by assuming a sigmoidal dose−response relationship (four parameters). The errors of the fits were
c
calculated using standard deviation and a confidence interval of 68%. IC50 values were derived from bioluminescence resonance energy transfer
(BRET) duplicate measurements and calculated by assuming a normalized 3-parameter curve fit. n.d., not determined.
challenges, we concluded that all heterobifunctional degrader
molecules showed excellent affinity to WDR5 in the one- or
two-digit nanomolar KD range.
compensation mechanisms could be due to water displacement
as the polar [PEG]1 linker in 8a showed an unfavorable
binding entropy change, while degraders with aliphatic linkers
feature an increased binding entropy term.
Overall, the ITC experiments highlighted the value of
determining binding affinity in an orthogonal assay system as
similar ΔTm shifts resulted in some cases in very different
binding affinities and degraders with high ΔTm shift were not
necessarily more affine than a degrader with a moderate ΔTm
shift.
In analogy to degrader molecules based on the modified
OICR-9429 scaffold, the highest ΔTm shift of the pyrroloimi-
dazole-based degraders 17a−g was observed with the shortest
linker moieties 17a (see Table 2). The subsequent decrease in
For all PROTACs that we selected for ITC studies, large
negative binding enthalpies were observed ranging from −10
to −4.9 kcal/mol (Table S3). Entropy changes (TΔS) were
also favorable, except for 8a (−0.2 kcal/mol), ranging from
+0.7 to +4.5 kcal/mol, but enthalpy−entropy compensation
was observed for degraders with large favorable ΔH values. For
instance, compounds 8a, 8f, and 8i all showed large negative
binding enthalpies of −10 kcal/mol with close-to-zero entropy
changes (−0.2 to 1.1 kcal/mol), whereas compounds with
large positive entropy changes showed small binding enthalpies
(e.g., 8e: ΔH = −6.3 kcal/mol, TΔS = +4.5 kcal/mol). These
G
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
Table 2. In Vitro and In Cellulo Data of the WDR5 Antagonist OICR-9429, the Modified Molecule 14, and Degraders 17a−g
a
Thermal shift ΔTm values given are the mean of triplicate measurements. DSF assays were performed at 2 μM protein concentration and a final
b
compound concentration of 10 μM. Kd values were derived from ITC measurements as duplicate measurements and calculated by assuming a
sigmoidal dose−response relationship (four parameters). The errors of the fits were calculated using standard deviation and a confidence interval of
c
68%. IC50 values were derived from BRET duplicate measurements and calculated by assuming a normalized 3-parameter curve fit. n.d., not
determined.
temperature-shift values correlated also for this scaffold with
the linker length. The ΔTm shift did increase slightly for
degraders with longer linker moieties, namely, 17e−g; thus,
solubility, solvatization in the large Win pocket, and interaction
with the hydrophobic surface of WDR5 might be possible
explanations for the observed effect. The affinity of 17b for
WDR5 was examined by ITC, showing that 17b and the parent
compound 14 had comparable dissociation constants (Kds) of
97 and 125 nM, respectively. In accordance with the OICR-
9429-derived degraders, the binding event was found to be
enthalpically favored and also a gain in entropy was observed
in the binding measurements. Once more, we assume that this
observable effect might be related to the characteristic
properties of the WDR5 system that have already been
discussed in the context of the OICR-9429-derived degraders.
Cellular Permeability and Target Engagement of
Degrader Molecules. Due to the rather large molecular
weight inherent of heterobifunctional molecules, cellular
permeability can be a limiting factor. In this study, bio-
luminescence resonance energy transfer (BRET) experiments
were used to determine cell permeability and potency in the
cellular context and for comparison also in lysed cells. To
establish this assay, three tracer molecules 19a−c based on
molecule 6 were synthesized using BODIPY fluorescent
conjugates. The synthetic procedures of the tracer molecules
19a−c via their intermediates 6a, S18a, and S18b are
summarized in the Supporting Information. The obtained
tracer molecules were titrated into cells transfected with N-
terminally and C-terminally tagged WDR5 NanoLuc-fusion
constructs to determine the assay performance (see Figure 2a).
These experiments revealed 19c (see Figure 2b) and the C-
terminally tagged WDR5 construct as the most suitable Tracer-
NanoLuc combination for cellular BRET assays.
BRET assays were performed in lysed (permeabilized) and
living cells (see Figure 2c,d), and both assay formats were used
to assess cell penetration as well as cellular affinity for full-
length WDR5 (see Tables 1 and 2). The parent compound of
the degrader series 7a−e, 8a−j, and 9a−c showed a cellular
potency of 139 nM. We observed a significant drop in affinity
when parent compound 6 was elongated to the final degrader
molecules. Comparing the attached E3 ligase ligands as well as
the nature of the linker, central changes could be observed.
Most cereblon (CRBN) targeting degraders 7a−e had similar
cellular potencies. Furthermore, both formats of the assay
system (intact and lysed modes) indicated a low micromolar
affinity for WDR5. Interestingly, VHL targeting degraders
H
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
Figure 2. Cellular permeability and target engagement studies were performed with the BRET assay. (a) Tracer titration of all three synthesized
tracer molecules and either C-terminal or N-terminal Nanoluc-tagged WDR5 (WDR5-C or WDR5-N). (b) Chemical structure of the most suitable
tracer molecule 19c. (c) and (d) NanoBRET dose−response curves of the degrader 8g, ligand 6, and WDR5 antagonist OICR-9429 in live cells (c)
as well as in lysed cells (d).
showed a weaker cellular activity potentially due to the
peptidelike nature of this ligand. While we were able to
determine affinity values in lysed cells for all VHL degraders,
no matter the linker nature, the only aliphatic linker containing
degrader 8g showed a two-digit micromolar affinity in the
intact cellular experiment. Comparing 8e−i to the PEG
containing degraders 8a−c, the directly linked degrader 8d,
and the aromatic linked molecule 8j, weak solubility might be
the limiting factor for this observation (as already shown in the
ITC experiments of 8e−i). As MDM2 targeting degraders 9a−
c already showed weak in vitro affinity, the BRET measure-
ments confirmed the weak in cellulo activity of these molecules
to WDR5. Taken together with the DSF results, the MDM2
targeting degraders were excluded from further experiments.
The generated tracer 19c could not be displaced by the
pyrroloimidazole-based degraders 17a−g. A possible hypoth-
esis for this observation might be the different binding modes
of the used inhibitor. All in all, the herein-established BRET
assay for WDR5 indicates that several degrader molecules are
cell-permeable and bind to WDR5 in cells and lysates,
demonstrating their potential as putative degraders in vivo.
PROTAC-Mediated Degradation of Cellular WDR5.
Targeted degradation of cellular proteins requires productive
complex formation of the PROTAC-bound protein with the
respective E3 ligase and proteasomal degradation of the
ubiquitylated target protein. We therefore analyzed PROTAC-
mediated degradation of WDR5 in cells. The open reading
frame of WDR5 was fused with a luciferase peptide (called
HiBiT) and stably transduced into the AML cell line MV4-11
(MV4-11WDR5‑HiBiT). Immunoblots demonstrated that expres-
sion levels of WDR5-HiBiT are comparable to endogenously
expressed WDR5 (see Figure 3a). We treated MV4-
11WDR5‑HiBiT cells with various concentrations of the two
different degrader series for 24 h and estimated depletion of
WDR5-HiBiT by measuring the luciferase activity.
Intriguingly, depletion of WDR5-HiBiT varied substantially
between the different degrader classes (see Tables 3 and 4;
additional data can be found in Figure S3). While none of the
cereblon-based PROTACs showed significant depletion, many
VHL ligand-containing degraders demonstrated cellular
degrader efficacy. The most effective degrader of the OICR-
9429-derived series 8g, which linked both functional binding
moieties by a butyl chain, showed a maximum depletion of 58
3% and DC50 values of 53
10 nM (see Figure 3b and
Table 3). A shortening of the linker by implementing ethyl
(8e) and propyl (8f) chains as well as an elongation with
pentyl (8h) and hexyl (8i) chains significantly reduced the
degradation efficiency (see Figure 3c,d). Strikingly, degrader
8a, a degrader resembling 8h, but containing a [PEG]1 moiety
instead of an aliphatic chain, did not induce degradation of
WDR5 (see Figure 3c). The most efficient pyrroloimidazole-
based degrader was 17b, which contained a [PEG]2 linker (see
Figure 3e). Both 8g and 17b did not induce maximal depletion
of WDR5 at high concentrations, a phenomenon called the
Hook effect, resulting from less efficient ternary complex
formation at excess degrader levels due to binding site
competition (see Figure 3b,e).35 Two negative controls20,
resembling molecule 8g, and 21, resembling molecule 17b
with the inactive variant of the VHL ligand were synthesized to
verify the effect of targeted protein degradation. Their
biophysical properties can be found in the Supporting
Information. Notably, neither negative controls 20 and 21
nor the ligands 6 and 14 alone induced degradation of WDR5
in cells (see Figure 3e,f). The increase in WDR5 levels by 6 is
most likely a direct effect on WDR5 stability induced by ligand
binding.
Next, we analyzed if the degrader molecules 8g and 17b also
induced degradation of untagged and endogenously expressed
WDR5. MV4-11WDR5‑HiBiT cells were treated for 24 h with 8g
or 17b and were analyzed by immunoblots stained with an
anti-WDR5 antibody. Both degraders induced efficient
I
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
Figure 3. Cellular degradation studies on WDR5. (a) Immunoblot of WDR5. WDR5 was fused to the fragment of luciferase (HiBiT) and stably
expressed in MV4-11 cells. Naive (-) MV4-11 cells and HiBiT-WDR5 (+) MV4-11 cells. Vinculin was used as a loading control. (b) WDR5 levels
based on luciferase measurements. MV4-11WDR5‑HiBiT cells were treated with different concentrations of 8g for 24 h, lysed, complemented with the
second luciferase fragment (largeBiT), and measured for luciferase activity. (c) WDR5 levels based on luciferase measurements. MV4-11WDR5‑HiBiT
cells were treated with different concentrations of degraders 8a, 8e, 8f, 8h, and 8i for 24 h, lysed, complemented with the second luciferase
fragment (largeBiT), and measured for luciferase activity. (d) Quantification of WDR5 Dmax (maximal degradation) from the HiBiT assay for
degraders with different aliphatic linkers. MV4-11WDR5‑HiBiT cells were treated with different concentrations of degraders for 6 h or 24 h, lysed,
complemented with the second luciferase fragment (largeBiT), and measured for luciferase activity of linkers comprising ethyl: 8e, propyl: 8f, butyl:
8g, pentyl: 8h, and hexyl: 8i. (e) and (f) WDR5 levels based on luciferase measurements. MV4-11WDR5‑HiBiT cells were treated with different
concentrations of 14, 21, and 17b (e) and 6, 20, and 8g (f) for 24 h. Cells were then lysed, complemented with the second luciferase fragment
(largeBiT), and measured for luciferase activity.
depletion of endogenous WDR5, and the dose-dependency
and gratifyingly degradation efficacy of the endogenous protein
resembled the depletion of the HiBiT-tagged protein (see
Figures 4a and S4). Degraders 8g and 17b showed a similar
level of WDR5 depletion in naive MV4-11 cells even 72 h post
treatment (see Figures 4b and S5a). Immunoblotting also
confirmed the depletion efficiency of various other degraders
of WDR5 in naive MV4-11 cells as seen in HiBiT data (see
Figure S5b−f). Degraders induce degradation of their targets
by inducing ubiquitylation and subsequently proteasomal
degradation. We therefore tested if 8g and 17b decreased
the protein stability of WDR5. We blocked protein translation
by incubating cells with cycloheximide in addition to the
degraders (or vehicle-treated cells) and estimated WDR5 levels
by immunoblotting at several time points. Both degraders
reduced the stability of the WDR5 protein substantially in
comparison to the vehicle-treated cells (Figures 4c and S5g).
To exclude effects of our compounds on WDR5 tran-
scription, we treated MV4-11 cells with the most effective
degraders 8g and 17b and their corresponding WDR5 ligands
6 and 14 and quantified mRNA by quantitative PCR (qPCR).
As expected, even though both degraders reduced the WDR5
protein level, WDR5 mRNA levels were not decreased (see
Figures 4d and S5h). Similarly, 8g-mediated WDR5 degrada-
tion was completely abolished by coincubation of MV4-11
cells with WDR5 ligand 6, showing that WDR5 depletion
requires binding of 8g to WDR5 (see Figure 4e). We also
rescued WDR5 depletion by 17b through proteasomal
inhibition with MG132 and neddylation inhibition with
MLN4924 (see Figure 4f). Finally, we also tested if the
degradation of WDR5 was limited to MV4-11 cells or if the
degrader compounds were also functional in other cell lines.
We thus treated the human leukemia cell line HL-60 with 8g
and observed WDR5 depletion as seen in MV4-11 cells (see
Figure 4g). We concluded that 8g and 17b mediate depletion
of endogenous WDR5 in various cancer cell lines by inducing
protein ubiquitylation and degradation.
To determine whether 8g- and 17b-mediated degradation
was specific to WDR5, we analyzed cellular protein levels by
quantitative proteomics. To this end, we treated MV4-11 cells
with 8g and 17b or with their corresponding ligands and
compared their protein content to untreated cells by mass
spectrometry. Remarkably, among 5805 proteins detected,
only WDR5 was significantly and substantially depleted
(−log10 p > 3, log2 FC < −0.5) after 9 h of treatment (see
J
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
Table 3. HiBiT Data of WDR5 Ligand 6 and Degraders 7a−e and 8a−j
a
b
DC50, half-maximal degradation concentration, calculated with the dose−response (four parameters) equation. DCmax, maximal degradation
c
d
concentration. Dmax, maximal degradation. no, no degradation. N/A, not applicable.
Figure 4h−i). WDR5 levels were not significantly altered by
treatment with the ligands 6 and 14 (see Figure S6).
MV4-11WDR5‑HiBiT/VHL cells when compared to control cells
(see Figures 5b and S3). For 17b, the Dmax increased from 52.5
to 77.8%, whereas DC50 decreased from 1.01 to 0.155 μM.
Immunoblotting confirmed the enhanced degradation of
endogenous WDR5 after 17b treatment in MV4-
11WDR5‑HiBiT/VHL cells (see Figure S5j). To test if enhanced
degradation of WDR5 in VHL-overexpressing cells induced a
more pronounced cell-cycle phenotype, we also generated
naive MV4-11 cells with ectopic VHL expression (MV4-
11VHL) (see Figure S5i). We verified the degradation of
endogenous WDR5 in these cells in comparison to control
cells (see Figure 5c). Finally, we repeated the cumulative
growth analysis in MV4-11VHL cells by incubating the cells with
different concentrations of 17b, 21, and 14 for 15 days. In line
with the stronger WDR5 depletion, a high concentration (10
μM) of 17b showed a stronger growth inhibition than that in
the control cells (see Figure 5a,d). Importantly, MV4-11VHL
cells also showed growth defects even at lower concentrations
of 17b (5 μM), whereas none of the controls (21 and 14)
showed notable effects (see Figure 5d). We concluded that
degrader-induced partial depletion of WDR5 shows moderate
but statistically significant cell growth defects in MV4-11 cells.
To determine the cellular consequences of WDR5 depletion,
we analyzed MV4-11 cell proliferation. We treated MV4-11
cells with different concentrations of 17b, its negative control
(21), and its ligand (14) for 15 days. Only a higher
concentration (∼10 μM) of 17b induced a proliferation defect
over the course of time, whereas neither a lower concentration
of 17b nor any incubation with 21 and 14 showed significant
growth defect (see Figure 5a). We hypothesized that only high
concentrations mediate a long-standing and sufficient
depletion of WDR5, which is required to affect cell growth.
In fact, all degraders studied here induce only partial
degradation of WDR5 and we speculate that more efficient
depletion is required to see stronger attenuation of cancer cell
growth. As effective degradation via degraders requires a
stoichiometric relation among the target protein, the degrader,
and the E3 ligase, we wondered whether the expression of
VHL might be the limiting factor for degrader efficacy. To test
this hypothesis, we stably expressed exogenous VHL in MV4-
11WDR5‑HiBiT cells (MV4-11WDR5‑HiBiT/VHL) (see Figure S5i).
Strikingly, the HiBiT assay demonstrated the superior
degradation of the WDR5 protein by both 8g and 17b in
K
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
Table 4. HiBiT Data of WDR5 Ligand 14 and Degraders 17a−g
a
b
DC50, half-maximal degradation concentration, calculated with the dose−response (four parameters) equation. DCmax, maximal degradation
c
concentration. Dmax, maximal degradation. no, no degradation.
Computational Studies on WDR5 Degraders. Compu-
tational docking studies were performed to obtain a structural
model that was able to explain the binding of the active
degraders 8e−j to WDR5 and VHL. Therefore, crystal
structures of WDR5 in complex with the WDR5 antagonist
OICR-9429 (PDB: 4QL1)17 and VHL in complex with the
ligand VH032 (PDB: 4W9H)36 were prepared for protein/
protein docking, as described in the Methods section and the
Supporting Information. In the second step, protein/protein
docking was performed in the Molecular Operating Environ-
ment (MOE) to obtain 405 possible protein/protein
complexes. For evaluation of the generated protein complexes,
the distance between the two linkage sites served as the
primary selection criterion. Since the shortest linker used in 8e
showed effective degradation, docking solutions capable of
binding both OICR-9429 and VH032 in their known binding
modes while maintaining a linkable distance for the short ethyl
moiety were examined. Ten of the obtained protein/protein
complexes showed a distance of less than 4 Å between the two
critical carbon atoms, with five of these being ranked in the top
20% of the protein/protein docking solutions. None of the
complexes stood out as clearly preferred, suggesting rather an
ensemble of possible configurations.
VH032 and the WDR5 antagonist OICR-9429. The docking
results show that all active degraders can be placed in these
complexes while still occupying their native binding sites in the
individual proteins with RMSD values around or below 1 Å.
Only degrader 8j required rearrangements of the scaffolds in
most top-ranked docking solutions (see the Supporting
Information). The structural models obtained by a successive
protein/protein- and small-molecule-docking suggest that
WDR5 and VHL do not form a dominant ternary complex.
Rather, it appears likely that an ensemble of multiple different
configurations of the ternary complex may exist in solution,
similar (but probably even more diverse) to that as illustrated
in Figure 6.
CONCLUSIONS AND OUTLOOK
■
The MLL/SET HMT complexes as well as the transcription
factor family MYC are attractive drug targets. In the strategy
presented here, we aimed to modulate both oncogenic
functions by degrading the scaffolding protein WDR5 using a
PROTAC approach. We used two diverse inhibitor scaffolds
allowing for diverse exit vectors from the WDR5 WIN binding
site comprising OICR-9429 and a modified pyrroloimidazole-
based inhibitor in combination with E3 ligase ligands targeting
cereblon, VHL, and MDM2. Thus, the study provides
interesting SAR developing degraders for this attractive cancer
target. In BRET studies, VHL and cereblon-based degraders
showed good cell permeability and on-target activity in cells.
Surprisingly, degraders based on both inhibitor scaffolds led to
In the next step, degraders 8e−j were docked with GOLD to
the five best-ranked of the compatible protein/protein
complexes (ranks 52, 53, 59, 78, and 79) and evaluated
based on a rescoring with DrugscoreX and RMSD values with
respect to the crystalized binding modes of the VHL ligand
L
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
Figure 4. Degrader-induced depletion of WDR5 depends on the ubiquitin system. (a) Immunoblot of WDR5. MV4-11WDR5‑HiBiT cells were treated
with different concentrations of 8g for 24 h and compared with dimethyl sulfoxide (DMSO)-treated or naive MV4-11 cells. Vinculin was used as a
loading control (as in all further immunoblot experiments). Quantification is based on both protein bands (endogenous/HiBiT-tagged WDR5).
(b) Immunoblot of WDR5. Naive MV4-11 cells were treated with different concentrations of 8g for 72 h and compared with DMSO-treated cells.
(c) Immunoblot and quantification of WDR5 levels. WDR5 protein stability was evaluated by treating 1 μM 8g or DMSO-incubated MV4-11 cells
for 0, 1, 2, 6, and 12 h with cycloheximide (CHX). The data is mean s.d from n = 2 biological replicates. (d) Quantitative reverse transcriptase
polymerase chain reaction (RT-PCR) analysis of WDR5 mRNA levels. RNA was extracted from MV4-11 cells incubated with 1 μM 8g, 1 μM 6, 3
μM 17b, and 3 μM 14 for 24 h. WDR5 expression levels were normalized with a reference gene (B2M). Bars represent mean s.d. of n = 3
technical replicates. (e) Immunoblot of WDR5. MV4-11 cells were treated for 6 h with 1 μM 8g, 5 μM 6, 10 μM VHL ligand, or a combination of
them. (f) Immunoblot of WDR5. MV4-11 cells were treated for 6 h with 3 μM 17b, 5 μM MLN4924, 10 μM MG132, or a combination of them.
(g) Immunoblot of WDR5. HL-60 cells were treated with different concentrations of 8g for 24 h. (h) and (i) Volcano plot exhibiting global
proteomics change. MV4-11 cells were treated with 1 μM 8g (h) or 5 μM 17b (i) for 9 h, and lysates were analyzed by quantitative proteomics.
WDR5 (blue) and other SET1/MLL complex core subunits: KMT2A, KTM2B, KTM2C, KTM2D, SETD1A, RBBP5, ASH2L, and DPY30
(orange).
successful degradation of the target protein, indicating good
degradability of WDR5. However, only VHL-based degraders
led to functional degradation, and small changes in linker
length and linker type resulted in significant changes in
degradation efficacy. Large MDM2-based PROTACs did not
show significant binding affinity and were discarded early on in
the study. The best degrader molecules showed low nM
potency degrading WDR5 in a proteasome-and ubiquitin-
dependent way. However, under the cell lines and condition
tested, only partial degradation was observed. This could be a
kinetic effect depending on the speed of resynthesis and
degradation or potentially due to the location of WDR5 on the
chromatin, which might protect a fraction of the protein from
degradation. Nonetheless, the cells could be sensitized for
better degradation of the protein via overexpression of one of
the components of the ternary complex (here, VHL), which
significantly increased the degradation efficiency of the
PROTACs. These data suggest that using the PROTAC in
M
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
Figure 5. VHL overexpression increases PROTACs/degrader efficiency and cellular responses. (a) Cumulative growth curve in MV4-11 cells.
MV4-11 cells were treated with 10, 5, and 3 μM of 17b, 21, and 14 and counted at indicated time points. To prevent the overgrowth, cells were
reseeded to the original density every third day in fresh media with compounds and treatment was continued for 15 days. Data represent mean
s.d. of n = 2 biological replicates. Asterisks indicate P-value calculated from the 15th day cumulative cell number (two-tailed unpaired t-test
assuming equal variance against DMSO treatment). * P ≤ 0.05. (b) WDR5 levels based on luciferase measurements. MV4-11WDR5‑HiBiT cells (Ctr)
and MV4-11WDR5‑HiBiT/VHL cells (VHL OE) were treated with different concentrations of 17b for 24 h, lysed, complemented with the second
luciferase fragment (largeBiT), and measured for luciferase activity. (c) Immunoblot of WDR5 and VHL. MV4-11 cells (Ctr) and MV4-11VHL
(VHL OE) were treated for 24 h with various concentrations of 17b. †, overexpressed VHL; ††, endogenous VHL. (d) Cumulative growth curve in
MV4-11VHL cells. MV4-11VHL cells were treated with 10, 5, and 3 μM of 17b, 21, and 14 and counted at indicated time points. To prevent the
overgrowth, cells were reseeded to the original density every third day in fresh media with compounds and treatment was continued for 15 days.
Data represent mean s.d. of n = 2 biological replicates. Asterisks indicate P-values calculated from the 15th day cumulative cell number (two-tailed
unpaired t-test assuming equal variance against DMSO treatment). * P ≤ 0.05.
shifts δ are reported in parts per million (ppm). Mass spectra were
recorded by the mass spectrometry service team of the Goethe
University using a Thermo Fisher Surveyor MSQ system (including
TLC-MS for reaction control). High-resolution mass spectra were
recorded on a MALDI LTQ ORBITRAP XL device from Thermo
Fisher Scientific. Product purification was performed on a PuriFlash
Flash Column Chromatography System from Interchim using
prepacked silica or RP C18 columns. Product purification was also
performed on an Agilent 1260 Infinity II LC System [Eclipse XDB-
C18 column (7 μM, 21.2 mm × 250 mm)] using a gradient of water/
MeCN + 0.1% TFA (98:2−5:95) over 40 min with a flow rate of 21
mL/min. Compound purity was analyzed on an Agilent 1260 Infinity
II LC System [Eclipse XDB-C18 column (4.6 mm × 250 mm, 5 μm)]
coupled to an Agilent InifinityLab LC/MSD using a gradient of
water/MeCN + 0.1% TFA (98:2−5:95) over 25 min at a flow rate of
1 mL/min (see the SI data for HPLC−MS traces of lead
compounds). Final compounds 7a−e, 8a−j, and 9a−c were
synthesized from 5-bromo-2-fluoronitrobenzole 1 and 4-methylpiper-
azine 2 via intermediates 3−6 and 6a−c as outlined in Scheme 1.
Final compounds 17a−g were synthesized from Piracetam 10 via
intermediates 11−16a−g as outlined in Scheme 2. More information
can be found in the Supporting Information.
cell lines that show higher VHL levels will also increase WDR5
degradation determining sensitivity to the degrader. We
established an array of assay systems such as a BRET-based
target engagement assay and a stable HiBiT cell line, which will
allow further testing of future second-generation WDR5
degrader molecules with improved potency. However, the
molecules presented here are versatile tools that will allow
comprehensive evaluation of WDR5 degraders in diverse
cancer types and the potential of this strategy for drug
discovery.
EXPERIMENTAL SECTION
■
Compound Synthesis. The structures of the synthesized
compounds were verified by 1H NMR, 13C NMR, and mass
spectrometry (ESI/MALDI). Purity of the final compounds (254,
260, and 280 nm >95%) was determined by analytical high-
performance liquid chromatography (HPLC). All commercial
chemicals and solvents were used without further purification. The
commercially available VHL ligand 1 hydrochloride was used for the
degrader molecules 8a−j and 17a−g, while the VHL ligand for the
negative controls 20 and 21 was obtained as described by Buckley and
van Molle.34 1H NMR and 13C NMR spectra were measured in
DMSO-d6, MeOD, CD2Cl2, or CDCl3 on a Bruker DPX250, AV300,
AV400, AV500, DPX600, AV700, or AV800 spectrometer. Chemical
General Procedure A (Amide Coupling). First, 1.0 equiv of the
Boc-protected carboxylic acid was dissolved in 1 mL of CH2Cl2, and 1
mL of TFA was added. The solution was stirred for 1 h at rt. Excess
N
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
Figure 6. Computational docking studies on WDR5 and VHL. (a) Structures of the selected protein/protein docking solutions compatible with a
short linker distance. VHL (blue) and VH032 (orange) form a complex with WDR5 (gray) and a modified OICR-9429 ligand (pink), with the
attachment points for linkers in close proximity (<4 Å). (b−f) DSX top-ranked docking pose of degrader 8g docked to each of the selected
protein/protein complexes. The functional parts of molecule 8g are colored in orange for the interaction with VHL, in pink for the interaction with
WDR5, and in red for the linker that connects both moieties.
solvent was removed under reduced pressure. Then, 1.0 equiv of the
Boc-protected amine was dissolved in 1 mL of CH2Cl2 and 1 mL of
TFA was added. The solution was stirred for 1 h at rt. Excess solvent
was removed under reduced pressure. The crude species was
dissolved in 0.5 mL of DMF, and DIEA was added until the pH of
the solution was basic. Next, 1.2 equiv of HATU was added to the
deprotected carboxylic acid. The reaction mixture was stirred for 20
min at rt. The crude species of the deprotected amine rt for 3−5 h.
The reaction was stopped with 1 mL of water. Saturated NaHCO3
solution and saturated NaCl solution were added, and the reaction
mixture was extracted 4× with EA. The combined organic phases
were washed with saturated NaHCO3 solution, dried over MgSO4,
and filtered. The solvent of the organic phase was evaporated under
reduced pressure. The purification of the crude product was carried
out on a preparative HPLC system.
General Procedure B (Tosylation and Nucleophilic Sub-
stitution). First, 1.4 equiv of tosylchloride was added portionwise
(2×) to 1.0 equiv of commercially available alcohol, 0.3 equiv of 4-
dimethylaminopyridine (DMAP), and 1.3 equiv of triethylamine in 5
mL of dichloromethane at −10 °C. The reaction mixture was stirred
for 20 min, allowed to warm to room temperature, and stirred for
another 22 h. The reaction was quenched by adding 3 mL of a
saturated solution of NH4Cl in water. The organic layer was
separated, and the remaining aqueous layer was extracted with
dichloromethane (3×). The combined organic layers were washed
with brine and dried with Na2SO4, and the solvent was removed
under reduced pressure. Purification was achieved by column
chromatography (10% MeOH/CH2Cl2).
of DMF. The reaction mixture was stirred at 70 °C for 21 h. The
reaction was quenched by adding 6 mL of water and ethyl acetate.
The organic layer was separated, and the remaining aqueous layer was
extracted with ethyl acetate (3×). The combined organic layers were
dried with MgSO4, and the solvent was removed under reduced
pressure. Purification was carried out on a preparative HPLC system.
General Procedure C (Amide Coupling). This reaction was not
performed in an inert atmosphere. A solution of 1.0 equiv of ester in 4
mL of dichloromethane/TFA (1/1) was stirred for 1.5 h. All volatiles
were removed under reduced pressure. Then, 1.2 equiv of HATU was
added to a solution of the carboxylic acid and 10.0 equiv of DIPEA in
2 mL of DMF. The reaction mixture was stirred for 15 min, it turned
orange, and 1.1 equiv of VHL amine hydrochloride was added. The
mixture was stirred for another 3.5 h and quenched with water and
ethyl acetate. The organic layer was separated, and the aqueous layer
was extracted with ethyl acetate (3×). The combined organic layers
were dried with MgSO4, and the solvent was removed under reduced
pressure. Purification was carried out on a preparative HPLC system.
The gained product was then dissolved in ethyl acetate and a solution
of saturated NaHCO3 and saturated NaCl solution and extracted with
ethyl acetate. The combined organic phases were dried over MgSO4,
and the solvent was removed under reduced pressure.
Synthesis of 1-(4-Bromo-2-nitrophenyl)-4-methylpiperazine (3).
First, 5 mL (39.7 mmol, 1.00 equiv) of 5-bromo-2-fluoro-nitro-
benzene was dissolved in 20 mL of EtOH. Thn, 4 mL (39.7 mmol,
1.00 equiv) of N-methylpiperazine and 13.5 mL (79.4 mmol, 2.00
equiv) of DIEA were added and the reaction mixture was stirred for 5
h at 80 °C. The reaction was cooled to rt, and the solvent was
removed under reduced pressure. The reaction mixture was diluted
with water and extracted 8× with dichloromethane (DCM). The
Then, 2.4 equiv of the tosylate linker species in 1.5 mL of DMF was
added to a solution of the alcohol 15 and 3.2 equiv of K2CO3 in 2 mL
O
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
2
combined organic phases were washed with 1 M HCl and saturated
NaCl solution, dried over MgSO4, and filtered. The crude product
was purified via CC (gradient: 0−10% MeOH in DCM) to give 11.1 g
(37 mmol, 95%) of an orange powder. Rf (5% MeOH/CH2Cl2): 0.54.
ESI: (calculated): [M + H+] 300.03 g/mol, (found): [M + H+]
299.98 g/mol. 1H NMR (250 MHz, CDCl3) δ = 7.94 (d, 4J = 2.3 Hz,
139.5 (m), 138.6 (q, J = 32 Hz), 135.0, 134.1, 132.7, 130.1, 129.8,
1
126.4, 124.0, 122.1 (q, J = 273 Hz), 121.0, 118.9 (m), 111.6 (m),
80.7, 52.8, 48.1, 42.3, 27.8 ppm.
Synthesis of tert-Butyl (2-(2-(3′-(6-Hydroxy-4-(trifluoromethyl)-
nicotinamido)-4′-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-4-
carboxamido)ethoxy)ethyl)carbamate (6a). First, 20 mg (36 μmol,
1.0 equiv) of tert-butyl 3′-(6-hydroxy-4-(trifluoromethyl)-
nicotinamido)-4′-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-4-carboxy-
late was dissolved in 0.5 mL of DCM and 0.5 mL of TFA and stirred
at rt for 1 h. The excess solvent was evaporated. The solid was
dissolved in 0.5 mL of DMF; then, 125 μL (720 μmol, 20 equiv) of
DIEA and 16.4 mg (43 μmol, 1.2 equiv) of HATU were added. After
15 min, a solution of 7.7 mg (38 μmol, 1.05 equiv) of tert-butyl (2-(2-
aminoethoxy)ethyl)carbamate in 0.5 mL of DMF was added. The
solution was stirred for 3 h at rt. The reaction mixture was quenched
with 2 mL of water and 2 mL of saturated NaHCO3; then, the
reaction was extracted 3× with EA. The organic phase was dried over
MgSO4 and filtered, and the solvent was removed under reduced
pressure. The crude product was purified using HPLC to obtain 18
mg of a TFA salt with an unknown stoichiometry as a white solid.
ESI: (calculated) [M + H+] 687.31 g/mol, (found) [M + H+] 687.52
3
4
3
1H), 7.65 (dd, J = 8.7 Hz, J = 2.4 Hz, 1H), 7.17 (d, J = 8.7 Hz,
1H), 3.43 (m, 4H), 3.25 (m, 4H), 2.80 (s, 3H) ppm.
Synthesis of 5-Bromo-2-(4-methylpiperazin-1-yl)aniline (4).
First, 2.00 g (7.40 mmol, 1.00 equiv) of 1-(4-bromo-2-nitrophenyl)-
4-methylpiperazine was suspended in a mixture of 1,4-dioxane and
water (3:1). Then, 3.20 g (37 mmol, 7.50 equiv) of ammonium
chloride was added, followed by a slow addition of 2.60 g (37 mmol,
7.50 equiv) of zinc dust. The reaction mixture was stirred until a color
change from orange to light pink was observed. The solvent was
removed under reduced pressure. The reaction mixture was diluted
with saturated NaHCO3 solution and extracted 6× with DCM. The
combined organic phases were washed with saturated NaCl solution,
dried over MgSO4, and filtered, and the solvent was removed under
reduced pressure to give 1.57 mg (5.81 mmol, 79%) of a light-pink
solid. Rf (5% MeOH/CH2Cl2): 0.3. ESI: (calculated): [M + H+]
270.06 g/mol, (found): [M + H+] 270.03 g/mol. HPLC: RT = 10.9
min (254 nm, 99%). 1H NMR (250 MHz, CDCl3) δ = 6.96−6.70 (m,
1
g/mol. HPLC: RT = 11.6 min (254 nm, 96%). H NMR (400 MHz,
DMSO) δ = 9.47 (s, 1H), 8.52 (t, 3J = 5.4 Hz, 1H), 8.13 (d, 3J = 2.1
3
3
3
Hz), 7.97 (s, 1H), 7.93 (d, J = 8.4 Hz, 2H), 7.68 (d, J = 8.5 Hz,
3H), 4.01 (s, 2H), 2.92 (t, J = 4.5 Hz, 4H), 2.60 (s, 4H), 2.39 (s,
3
4
3
2H), 7.52 (dd, J = 8.4 Hz, J = 2.2 Hz), 7.27 (d, J = 8.4 Hz, 1H),
6.82 (s, 1H), 6.76 (s, 1H), 3.55−3.52 (m, 2H), 3.47−3.38 (m, 4H),
3.11−3.06 (m, 2H), 2.99−2.85 (m, 4H), 2.50 (s, 4H) 2.23 (s, 3H),
1.36 (s, 9H) ppm. 13C NMR (101 MHz, DMSO) δ = 168.0, 166.0,
162.8, 161.2, 144.9, 142.2, 140.0, 139.5 (q, 2J = 35 Hz), 134.2, 133.00
132.3, 132.2, 128.3, 127.9, 126.0, 123.9, 122.6 (q, 1J = 240 Hz), 122.3,
121.0, 120.4, 119.1 (m), 110.3 (m), 77.59, 68.99, 68.7, 54.7, 51.0,
45.7, 39.1, 38.9, 28.2 ppm.
Synthesis of tert-Butyl (1-(3′-(6-Hydroxy-4-(trifluoromethyl)-
nicotinamido)-4′-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-4-yl)-1-
oxo-5,8,11,14,17,20,23-heptaoxa-2-azapentacosan-25-yl)-
carbamate (6b). First, 20 mg (36 μmol, 1.0 equiv) of tert-butyl 3′-(6-
hydroxy-4-(trifluoromethyl)nicotinamido)-4′-(4-methylpiperazin-1-
yl)-[1,1′-biphenyl]-4-carboxylate was dissolved in 0.5 mL of DCM
and 0.5 mL of TFA and stirred at rt for 1 h. The excess solvent was
evaporated. The solid was dissolved in 0.5 mL of DMF; then, 125 μL
(720 μmol, 20 equiv) of DIEA and 16.4 mg (43 μmol, 1.2 equiv) of
HATU were added. After 15 min, a solution of 17.7 mg (38 μmol,
1.05 equiv) of tert-butyl (23-amino-3,6,9,12,15,18,21-
heptaoxatricosyl)carbamate in 0.5 mL of DMF was added. The
solution was stirred for 3 h at rt. The reaction mixture was quenched
with 2 mL of water and 2 mL of saturated NaHCO3; then, the
reaction was extracted 3× with EA. The organic phase was dried over
MgSO4 and filtered, and the solvent was removed under reduced
pressure. The crude product was purified using HPLC to obtain 10
mg of a TFA salt with an unknown stoichiometry as a white oil. ESI:
(calculated) [M + H+] 951.47 g/mol, (found) [M + H+] 951.95 g/
3H) ppm.
Synthesis of tert-Butyl 3′-Amino-4′-(4-methylpiperazin-1-yl)-
[1,1′-biphenyl]-4-carboxylate (5). First, 395 mg (1.78 mmol, 1.2
equiv) of (4-(tert-butoxycarbonyl)phenyl)boronic acid was dissolved
in an argon-purged solvent solution (1,4-dioxane/water (3:1)) and
288 mg (7.40 mmol, 5.0 equiv) of sodium hydroxide was added. The
reaction mixture was stirred for 5 min at rt under an argon
atmosphere; then, 400 mg (1.48 mmol, 1.0 equiv) of 5-bromo-2-(4-
methylpiperazin-1-yl)aniline and 171 mg (148 μmol, 0.1 equiv) of
Pd(PPh3)4 were added. The reaction was stirred at 90 °C for 18 h
under an argon atmosphere. The reaction mixture was cooled to rt,
filtered over celite, and washed with MeOH. The solvent was
removed under reduced pressure. The reaction mixture was diluted
with water and extracted 3× with DCM. The crude product was
purified via FC (0−10% MeOH/DCM) to give 395 mg (1.08 mmol,
73%) of a white solid. Rf (5% MeOH/CH2Cl2): 0.28. ESI:
(calculated): [M + H+] 368.23 g/mol, (found): [M + H+] 368.13
1
g/mol. HPLC: RT = 11.9 min (254 nm, 94%). H NMR (500 MHz,
CD2Cl2) δ = 7.98 (d, 3J = 8.5 Hz, 2H), 7.59 (d, 3J = 8.5 Hz, 2H), 7.06
(d, 3J = 8.7 Hz, 1H), 6.99 (m, 2H), 3.97 (s, 1H), 2.97 (s, 4H), 2.61 (s,
4H), 2.35 (s, 3H), 1.58 (s, 9H) ppm. 13C NMR (126 MHz, CD2Cl2)
δ = 165.9, 145.5, 142.3, 139.8, 136.5, 130.8, 130.1, 126.8, 120.4,
117.6, 113.8, 81.1, 55.0, 51.0, 46.1, 28.3 ppm.
Synthesis of tert-Butyl 3′-(6-Hydroxy-4-(trifluoromethyl)-
nicotinamido)-4′-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-4-car-
boxylate (6). First, 56 mg (272 μmol, 1.00 equiv) of 6-hydroxy-4-
(trifluoromethyl)nicotinic acid was dissolved in 1 mL of DCM and
228 μL (2.72 mmol, 10 equiv) of thionyl chloride. The reaction
mixture was stirred for 3 h at 50 °C until a color change from clear to
yellow was observed. Excess thionyl chloride was removed under
reduced pressure, and the acyl chloride was evaporated on a high
vacuum line for 5 min. The acyl chloride was diluted with 2 mL of
DCM, and a 3 mL solution containing 100 mg (272 μmol, 1.00
equiv) of 3′-amino-4′-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-4-car-
boxylate and 44 μL (544 μmol, 2.00 equiv) of pyridine was added.
The reaction mixture was stirred at 50 °C for 18 h. The reaction
mixture was cooled to rt, diluted with water, and extracted 3× with
DCM. The crude product was purified via FC (0−10% MeOH/
DCM) to give 109 mg (139 μmol, 51%) of a yellow TFA salt with a
stoichiometry of 1:2 (product: TFA). Rf (5% MeOH/CH2Cl2): 0.21.
ESI: (calculated): [M + H+] 557.23 g/mol, (found): [M + H+]
557.08 g/mol. HPLC: RT = 12.9 min (254 nm, 93%). 1H NMR (500
1
mol. HPLC: RT = 11.8 min (254 nm, 94%). H NMR (400 MHz,
DMSO) δ = 9.46 (s, 1H), 8.53 (t, 3J = 5.7 Hz, 1H), 8.12 (d, 4J = 2.2
Hz, 1H), 7.97 (s, 1H), 7.94 (d, 3J = 8.5 Hz, 2H), 7.68 (d, 3J = 8.5 Hz,
3
4
3
2H), 7.53 (dd, J = 8.4 Hz, J = 2.2 Hz, 1H), 7.27 (d, J = 8.4 Hz,
1H), 6.82 (s, 1H), 6.72 (t, J = 5.3 Hz, 1H), 3.61−3.47 (m, 28H),
3.44 (dd, J = 11.6 Hz, J = 5.8 Hz, 2H), 3.36 (t, J = 6.1 Hz, 4H),
3
2
3
3
3
3.05 (q, J = 6.0 Hz, 2H), 2.96−2.86 (m, 4H), 2.24 (s, 3H), 1.36 (s,
9H) ppm.
Synthesis of tert-Butyl (4-((3′-(6-Hydroxy-4-(trifluoromethyl)-
nicotinamido)-4′-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-4-
carboxamido)methyl)benzyl)carbamate (6c). First, 20 mg (36
μmol, 1.0 equiv) of tert-butyl 3′-(6-hydroxy-4-(trifluoromethyl)-
nicotinamido)-4′-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-4-carboxy-
late was dissolved in 0.5 mL of DCM and 0.5 mL of TFA and stirred
at rt for 1 h. The excess solvent was evaporated. The solid was
dissolved in 0.5 mL of DMF; then, 125 μL (720 μmol, 20 equiv) of
DIEA and 16.4 mg (43 μmol, 1.2 equiv) of HATU were added. After
15 min, a solution of 8.90 mg (38 μmol, 1.05 equiv) of tert-butyl (4-
(aminomethyl)benzyl)carbamate in 0.5 mL of DMF was added. The
3
MHz, CDCl3) δ = 8.97 (s, 1H), 8.69 (s, 1H), 8.04 (d, J = 8.3 Hz,
2H), 7.89 (s, 1H), 7.66 (d, 3J = 8.3 Hz, 2H), 7.48−7.30 (m, 2H), 6.95
(s, 1H), 3.05 (s, 4H), 2.78 (s, 4H), 2.51 (s, 3H), 1.61 (s, 9H) ppm.
13C NMR (75 MHz, DMSO) δ = 164.8, 163.1, 161.1, 143.7, 143.2,
P
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
solution was stirred for 3 h at rt. The reaction mixture was quenched
with 2 mL of water and 2 mL of saturated NaHCO3; then, the
reaction was extracted 3× with EA. The organic phase was dried over
MgSO4 and filtered, and the solvent was removed under reduced
pressure. The crude product was purified using HPLC to obtain 14
mg of a TFA salt with an unknown stoichiometry as a white solid.
ESI: (calculated) [M + H+] 719.32 g/mol, (found) [M + H+] 719.54
NaHCO3 and saturated NaCl solution and extracted with ethyl
acetate. The combined organic phases were dried over MgSO4, and
the solvent was removed under reduced pressure to give 18 mg (14.4
μmol, 41%) of a yellow oil as a TFA salt (1:2/product: TFA.)
MALDI: (calculated) [M + H+] 1019.41 g/mol, (found) [M + H+]
1019.52 g/mol. HPLC: RT = 11.6 min (254 nm, 100%). HRMS:
(calculated) [M + H+] 1019.4121 g/mol, (found) [M + H+]
1
1
g/mol. HPLC: RT = 12.2 min (254 nm, 91%). H NMR (400 MHz,
1019.4117 g/mol. H NMR (500 MHz, DMSO) δ = 11.10 (s, 1H),
4
3
9.20 (s, 1H), 8.59 (d, 3J = 5.2 Hz, 1H), 8.32 (d, 4J = 1.7 Hz, 1H), 8.14
(s, 1H), 7.94 (d, 3J = 8.3 Hz, 6H), 7.68 (d, 3J = 8.4 Hz, 6H), 7.57 (dd,
3J = 8.4 Hz, 3J = 7.3 Hz, 1H), 7.46 (dd, 3J = 8.3 Hz, 4J = 2.0 Hz, 1H),
MeOD) δ 8.29 (d, J = 1.8 Hz, 1H), 7.99 (s, 1H), 7.92 (d, J = 8.4
Hz, 2H), 7.72 (d, 3J = 8.4 Hz, 2H), 7.52 (dd, 3J = 8.3 Hz, 4J = 2.1 Hz,
1H), 7.35−7.33 (m, 3H), 7.25 (d, 3J = 8.1 Hz, 2H), 6.92 (s, 1H), 4.57
(s, 2H), 4.21 (s, 2H), 3.01 (s, 4H), 2.69 (s, 4H), 2.39 (s, 3H), 1.44 (s,
9H).
3
3
7.29 (d, J = 8.4 Hz, 1H), 7.13 (t, J = 8.4 Hz, 1H), 7.06−6.94 (m,
1H), 6.58 (dd, 2J = 12.2 Hz, 3J = 6.4 Hz, 1H), 6.46 (s, 1H), 5.05 (dd,
3J = 12.7 Hz, 4J = 5.4 Hz, 1H), 3.67−3.32 (m, 28H), 2.89 (t, 3J = 4.4
Synthesis of N-(4′-((2-(2-((2-(2,6-Dioxopiperidin-3-yl)-1,3-dioxoi-
soindolin-4-yl)amino)ethoxy)ethyl)carbamoyl)-4-(4-methylpipera-
zin-1-yl)-[1,1′-biphenyl]-3-yl)-6-hydroxy-4-(trifluoromethyl)-
nicotinamide (7a). The reaction was carried out as described in
General Procedure A. The gained product was then dissolved in ethyl
acetate and a solution of saturated NaHCO3 and saturated NaCl
solution and extracted with ethyl acetate. The combined organic
phases were dried over MgSO4, and the solvent was removed under
reduced pressure to give 17.2 mg (20.4 μmol, 71%) of a yellow solid.
MALDI: (calculated) [M + H+] 843.31 g/mol, (found) [M + H+]
843.41 g/mol. HPLC: RT = 11.6 min (254 nm, 100%). HRMS:
(calculated) [M + H+] 843.3072 g/mol, (found) [M + H+] 843.3067
Hz, 4H), 2.60−2.56 (m, 1H), 2.48 (s, 1H), 2.28−2.25 (m, 1H), 2.22
(s, 3H), 2.08−1.95 (m, 1H) ppm. 13C NMR (126 MHz, DMSO) δ =
172.8, 170.1, 168.9, 167.3, 165.9, 163.1, 161.1, 146.4, 142.9, 142.0,
139.5, 138.6 (q, 2J = 32 Hz), 136.2, 135.3, 133.2, 132.6, 132.1, 128.0,
126.1, 123.9, 122.3, 122.1 (q, 1J = 275 Hz), 121.0, 119.0, 117.4, 111.7,
110.7, 109.2, 69.8, 69.8, 69.7, 69.6, 68.9, 68.9, 52.8, 48.6, 48.1, 42.4,
41.7, 38.9, 31.0, 22.1 ppm.
Synthesis of N-(4′-((23-((2-(2,6-Dioxopiperidin-3-yl)-1,3-dioxoi-
soindolin-4-yl)amino)-3,6,9,12,15,18,21-heptaoxatricosyl)-
carbamoyl)-4-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-6-hy-
droxy-4-(trifluoromethyl)nicotinamide (7d). The reaction was
carried out as described in General Procedure A. The gained product
was then dissolved in ethyl acetate and a solution of saturated
NaHCO3 and saturated NaCl solution and extracted with ethyl
acetate. The combined organic phases were dried over MgSO4, and
the solvent was removed under reduced pressure to give 20.5 mg
(18.5 μmol, 69%) of a yellow oil. MALDI: (calculated) [M + H+]
1107.46 g/mol, (found) [M + H+] 1107.52 g/mol. HRMS:
(calculated) [M + H+] 1107.4645 g/mol, (found) [M + H+]
1
g/mol, H NMR (500 MHz, DMSO) δ = 12.54 (s, 1H), 11.08 (s,
1H), 9.52 (s, 1H), 8.53 (t, 3J = 5.6 Hz, 1H), 8.14 (d, 4J = 1.8 Hz, 1H),
3
3
8.00 (s, 1H), 7.91 (d, J = 8.4 Hz, 2H), 7.66 (d, J = 8.4 Hz, 2H),
3
3
7.60−7.48 (m, 2H), 7.28 (d, J = 8.4 Hz, 1H), 7.15 (d, J = 8.6 Hz,
1H), 7.02 (d, 3J = 7.0 Hz, 1H), 6.83 (s, 1H), 6.63 (t, 3J = 5.7 Hz, 1H),
5.03 (dd, J = 12.8 Hz, J = 5.4 Hz, 1H), 3.66 (t, J = 5.4 Hz, 2H),
3
4
3
3
3
4
3.61 (t, J = 6.0 Hz, 2H), 3.48 (dd, J = 13.3 Hz, J = 4.9 Hz, 4H),
2.99 (s, 4H), 2.91−2.80 (m, 1H), 2.75 (s, 4H), 2.58−2.57 (m, 1H),
2.52 (s, 1H), 2.42 (s, 3H), 2.01−1.98 (m, 1H) ppm. 13C NMR (126
MHz, DMSO) δ = 172.7, 170.1, 168.9, 167.3, 166.0, 162.9, 161.1,
146.4, 144.3, 142.1, 139.3, 138.5 (q, 2J = 33 Hz), 136.2, 134.5, 133.0,
132.3, 132.1, 127.9, 126.0, 123.9, 122.3, 122.0 (q, 1J = 275 Hz), 120.6,
119.0, 117.5, 111.7, 110.7, 109.2, 68.8, 68.8, 54.1, 50.1, 48.5, 44.8,
41.7, 31.0, 25.5, 22.1 ppm.
1
1107.4638 g/mol. HPLC: RT = 11.7 min (254 nm, 97%). H NMR
(500 MHz, DMSO) δ = 12.51 (s, 1H), 11.08 (s, 1H), 9.47 (s, 1H),
8.54 (t, 3J = 5.6 Hz, 1H), 8.12 (d, 4J = 2.0 Hz, 1H), 7.98 (s, 1H), 7.94
3
3
(d, J = 8.4 Hz, 2H), 7.68 (d, J = 8.4 Hz, 2H), 7.60−7.55 (m, 1H),
7.52 (dd, 3J = 8.3 Hz, 4J = 2.2 Hz, 1H), 7.26 (d, 3J = 8.4 Hz, 1H), 7.13
(d, 3J = 8.6 Hz, 1H), 7.03 (d, 3J = 7.0 Hz, 1H), 6.82 (s, 1H), 6.59 (t,
3J = 5.7 Hz, 1H), 5.05 (dd, 3J = 12.7 Hz, 4J = 5.4 Hz, 1H), 3.61 (t, 3J =
Synthesis of N-(4′-((2-(2-(2-(2-((2-(2,6-Dioxopiperidin-3-yl)-1,3-
dioxoisoindolin-4-yl)amino)ethoxy)ethoxy)ethoxy)ethyl)-
carbamoyl)-4-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-6-hy-
droxy-4-(trifluoromethyl)nicotinamide (7b). The reaction was
carried out as described in General Procedure A. The gained product
was then dissolved in ethyl acetate and a solution of saturated
NaHCO3 and saturated NaCl solution and extracted with ethyl
acetate. The combined organic phases were dried over MgSO4, and
the solvent was removed under reduced pressure to give 8.58 mg
(8.95 μmol, 33%) of a light-yellow solid. MALDI: (calculated) [M +
H+] 959.39 g/mol, (found) [M + H+] 959.47 g/mol. HPLC: RT =
11.8 min (254 nm, 98%). HRMS: (calculated) [M + H+] 959.3909 g/
mol, (found) [M + H+] 959.3905 g/mol. 1H NMR (500 MHz,
5.4 Hz, 2H), 3.58−3.41 (m, 32H), 3.33−3.25 (m, 2H), 2.95−2.89
(m, 4H), 2.89−2.83 (m, 1H), 2.61−2.51 (m, 2H), 2.23 (s, 3H),
2.06−1.96 (m, 1H) ppm. 13C NMR (126 MHz, DMSO) δ = 172.7,
170.0, 168.9, 167.3, 165.9, 162.8, 161.1, 146.4, 144.9, 142.2, 139.2,
138.5 (q, 2J = 32 Hz), 136.2, 134.2, 132.9, 132.2, 132.1, 127.9, 126.0,
123.9, 122.3, 122.0 (q, 1J = 275 Hz), 120.4, 119.0, 117.4, 111.7,
110.64 109.2, 69.8, 69.8, 69.7, 69.6, 68.9, 68.9, 54.7, 51.0, 48.6, 45.7,
41.7, 31.0, 22.1 ppm.
Synthesis of N-(4′-((4-(((2-(2,6-Dioxopiperidin-3-yl)-1,3-dioxoi-
soindolin-4-yl)amino)methyl)benzyl)carbamoyl)-4-(4-methylpiper-
azin-1-yl)-[1,1′-biphenyl]-3-yl)-6-hydroxy-4-(trifluoromethyl)-
nicotinamide (7e). The reaction was carried out as described in
General Procedure A. The gained product was then dissolved in ethyl
acetate and a solution of saturated NaHCO3 and saturated NaCl
solution and extracted with ethyl acetate. The combined organic
phases were dried over MgSO4, and the solvent was removed under
reduced pressure to give 7.6 mg (6.9 μmol, 30%) of a yellow solid as a
TFA salt (1:2/product: TFA). MALDI: (calculated) [M + Na+]
897.29 g/mol, [M + H+] 875.31 g/mol, (found) [M + Na+] 897.2018
g/mol (100), [M + H+] 875.2220 g/mol (70). HRMS: (calculated)
[M + H+] 875.3123 g/mol, (found) [M + H+] 875.3120 g/mol.
HPLC: RT = 12.1 min (254 nm, 95%). 1H NMR (500 MHz, DMSO)
3
DMSO) δ = 11.08 (s, 1H), 9.45 (s, 1H), 8.44 (t, J = 5.5 Hz, 1H),
8.12 (d, 4J = 1.7 Hz, 1H), 7.98 (s, 1H), 7.91 (d, 3J = 8.4 Hz, 2H), 7.67
3
(d, 3J = 8.4 Hz, 2H), 7.61−7.54 (m, 1H), 7.51 (dd, J = 8.3 Hz, 4J =
2.2 Hz, 1H), 7.26 (d, 3J = 8.4 Hz, 1H), 7.08 (d, 3J = 8.6 Hz, 1H), 7.01
(d, 3J = 7.0 Hz, 1H), 6.81 (s, 1H), 6.65 (t, 3J = 5.9 Hz, 1H), 5.04 (dd,
4
3J = 12.7 Hz, J = 5.4 Hz, 1H), 3.61−3.35 (m, 21H), 2.95−2.89 (m,
3H), 2.91−2.84 (m, 1H), 2.62−2.55 (m, 1H), 2.23 (s, 3H), 2.07−
1.95 (m, 1H), 1.85−1.72 (m, 5H) ppm. 13C NMR (126 MHz,
DMSO) δ = 172.8, 170.1, 168.8, 167.3, 165.8, 162.8, 162.3, 146.4,
144.8, 142.1, 139.0, 138.5 (q, 2J = 32 Hz), 136.2, 134.2, 133.2, 132.2,
132.2, 127.8, 126.0, 123.9, 122.2, 122.0 (q, 1J = 275 Hz), 120.4, 118.8,
117.1, 111.7, 110.3, 109.0, 69.8, 69.7, 69.7, 69.6, 68.3, 68.2, 54.7, 51.0,
48.5, 45.8, 40.4, 36.7, 35.8, 31.0, 29.4, 28.9, 22.1 ppm.
3
δ = 11.09 (s, 1H), 10.11 (s, 1H), 9.61 (s, 1H), 9.08 (t, J = 5.9 Hz,
3
1H), 8.25−8. 22 (m, 1H), 8.04 (s, 1H), 7.95 (d, J = 8.4 Hz, 2H),
3
3
4
7.69 (d, J = 8.4 Hz, 2H), 7.56 (dd, J = 8.3 Hz, J = 2.1 Hz, 1H),
7.450−7.47 (m, 1H), 7.38−7.28 (m, 3H), 7.28−7.15 (m, 3H), 7.00
Synthesis of N-(4′-((17-((2-(2,6-Dioxopiperidin-3-yl)-1,3-dioxoi-
soindolin-4-yl)amino)-3,6,9,12,15-pentaoxaheptadecyl)-
carbamoyl)-4-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-6-hy-
droxy-4-(trifluoromethyl)nicotinamide (7c). The reaction was
carried out as described in General Procedure A. The gained product
was then dissolved in ethyl acetate and a solution of saturated
3
3
(d, J = 7.0 Hz, 1H), 6.95 (d, J = 8.6 Hz, 1H), 6.84 (s, 1H), 5.08−
3
3
5.04 (m, 1H), 4.56 (d, J = 4.4 Hz, 2H), 4.49 (d, J = 4.8 Hz, 2H),
3.55−3.52 (m, 2H), 3.33−3.19 (m, 4H), 3.08−3.04 (m, 2H), 2.92−
2.82 (m, 4H), 2.59−2.54 (m, 2H), 2.04−2.00 (m, 1H) ppm. 13C
Q
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
NMR (126 MHz, DMSO) δ = 173.3, 170.5, 169.2, 167.7, 166.3,
163.6, 161.6, 146.6, 143.4, 142.5, 140.6, 139.5, 139.0, 138.6, 136.6,
135.8, 133.6, 133.1, 132.6, 129.0, 128.5, 126.6, 126.4, 126.1, 125.9,
124.4, 122.9, 122.6 (d, 1J = 275 Hz), 121.5, 119.0, 118.1, 111.3, 111.2,
110.0, 53.3, 49.0, 48.6, 45.9, 43.0, 42.9, 31.4, 22.6 ppm.
5H), 7.31 (d, 3J = 8.4 Hz, 1H), 6.84 (s, 1H), 5.12 (s, 1H), 4.54 (d, 3J
3
= 9.4 Hz, 1H), 4.48−4.39 (m, 2H), 4.35 (s, 1H), 4.21 (dd, J = 15.9
Hz, 4J = 5.5 Hz, 1H), 3.68−3.64 (m, 1H), 3.64−3.57 (m, 4H), 3.56−
3.41 (m, 20H), 3.25−3.15 (m, 2H), 3.05−3.00 (m, 2H), 2.86 (s, 3H),
2.44 (s, 3H), 2.37−2.30 (m, 1H), 2.07−1.99 (m, 1H), 1.95−1.85 (m,
1H), 0.93 (s, 9H) ppm. 13C NMR (126 MHz, DMSO) δ = 171.9,
170.0, 169.5, 165.9, 163.1, 161.1, 151.5, 147.6, 142.9, 142.0, 139.5,
139.1, 138.5 (q, 2J = 33 Hz), 135.4, 133.2, 132.7, 131.2, 129.6, 128.6,
128.0, 127.4, 126.1, 123.9, 122.3, 122.1 (q, 1J = 277 Hz), 121.0, 118.9,
111.7, 69.8, 69.7, 69.7, 69.6, 69.5, 68.9, 68.9, 66.9, 58.7, 56.4, 56.3,
52.8, 48.1, 42.4, 41.7, 38.0, 35.7, 35.4, 26.3, 15.9 ppm.
Synthesis of 6-Hydroxy-N-(4′-((2-(3-(((S)-1-((2S,4R)-4-hydroxy-2-
((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-di-
methyl-1-oxobutan-2-yl)amino)-3-oxopropoxy)ethyl)carbamoyl)-
4-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-4-(trifluoromethyl)-
nicotinamide (8a). The reaction was carried out as described in
General Procedure A. The gained product was then dissolved in ethyl
acetate and a solution of saturated NaHCO3 and saturated NaCl
solution and extracted with ethyl acetate. The combined organic
phases were dried over MgSO4, and the solvent was removed under
reduced pressure to give 27.4 mg, 26.6 μmol, 59% of a white solid.
MALDI: (calculated): [M + Na+] 1050.41 g/mol, (found): [M +
Na+] 1050.20 g/mol. HRMS: (calculated) [M + Na+] 1050.4129 g/
mol, (found) [M + Na+] 1050.4121 g/mol. HPLC: RT = 11.3 min
(254 nm, 97%). 1H NMR (500 MHz, DMSO) δ = 9.47 (s, 1H), 8.97
(s, 1H), 8.56 (t, 3J = 6.1 Hz, 1H), 8.50 (t, 3J = 5.5 Hz, 1H), 8.12 (d, 3J
Synthesis of 6-Hydroxy-N-(4′-(((S)-1-((2S,4R)-4-hydroxy-2-((4-(4-
methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-
1-oxobutan-2-yl)carbamoyl)-4-(4-methylpiperazin-1-yl)-[1,1′-bi-
phenyl]-3-yl)-4-(trifluoromethyl)nicotinamide (8d). The reaction
was carried out as described in General Procedure A to give 22.2
mg, 24.3 μmol, 67% of a white solid. ESI: (calculated) [M + H+]
913.37 g/mol, (found) [M + H+] 913.63 g/mol. MALDI: (calculated)
[M + Na+] 935.3496 g/mol, (found) [M + Na+] 935.0969 g/mol.
HRMS: (calculated) [M + Na+] 935.3496 g/mol, (found) [M + Na+]
3
1
= 2.1 Hz, 1H), 8.02−7.91 (m, 4H), 7.68 (d, J = 8.5 Hz, 2H), 7.52
935.3486 g/mol. HPLC: RT = 11.8 min (254 nm, 96%). H NMR
4
3
(dd, 3J = 8.4 Hz, J = 2.2 Hz, 1H), 7.45−7.33 (m, 4H), 7.26 (d, J =
(600 MHz, DMSO) δ = 9.94 (s, 1H), 9.59 (s, 1H), 8.99 (s, 1H), 8.59
(t, 3J = 5.7 Hz, 1H), 8.23 (s, 1H), 8.03 (d, 3J = 10.0 Hz, 2H), 7.98 (d,
3J = 7.8 Hz, 2H), 7.69 (d, 3J = 7.8 Hz, 2H), 7.56 (d, 3J = 8.3 Hz, 1H),
7.41 (q, 3J = 8.1 Hz, 4H), 7.33 (d, 3J = 8.3 Hz, 1H), 6.84 (s, 1H), 4.80
3
8.4 Hz, 1H), 6.82 (s, 1H), 5.13 (s, 1H), 4.56 (d, J = 9.4 Hz, 1H),
4.46−4.38 (m, 2H), 4.35 (s, 1H), 4.24−4.20 (m, 1H), 3.71−3.58 (m,
4H), 3.58−3.48 (m, 2H), 3.44−3.41 (m, 4H), 2.98−2.85 (m, 4H),
2.61−2.52 (m, 1H), 2.44−2.34 (m, 2H), 2.23 (s, 3H), 2.07−1.99 (m,
1H), 1.96−1.84 (m, 1H), 0.92 (s, 9H) ppm. 13C NMR (126 MHz,
DMSO) δ = 171.9, 170.0, 169.6, 165.9, 162.8, 161.2, 151.4, 147.7,
144.9, 142.2, 139.5, 139.2, 138.5 (q, 2J = 32 Hz), 134.2, 132.9, 132.2,
3
3
(d, J = 9.0 Hz, 1H), 4.47 (t, J = 8.1 Hz, 1H), 4.47−4.41 (m, 2H),
3
4
4.39 (s, 1H), 4.25 (dd, J = 15.7 Hz, J = 5.3 Hz, 1H), 3.75 (s, 2H),
3.54−3.52 (m, 2H), 3.29−3.17 (m, 2H), 3.23−3.19 (m, 2H), 3.06−
3.02 (m, 2H), 2.87 (s, 3H), 2.45 (s, 3H), 2.10−2.03 (m, 1H), 1.96−
1.90 (m, 1H), 1.05 (s, 9H) ppm. 13C NMR (151 MHz, DMSO) δ =
171.9, 169.5, 166.2, 162.9, 161.1, 151.5, 147.8, 142.9, 142.4, 139.5,
139.4, 138.8 (q, 2J = 33 Hz), 134.5, 132.7, 132.4, 131.2, 129.7, 128.7,
128.5, 127.5, 126.0, 124.0, 122.3, 121.1 (q, 1J = 275 Hz), 120.6, 119.1,
111.6, 68.9, 58.8, 57.3, 56.5, 52.8, 48.1, 41.7, 40.4, 37.9, 35.6, 26.5,
15.9 ppm.
1
131.2, 129.6, 128.6, 127.9, 127.4, 126.0, 123.9, 122.3, 122.0 (d, J =
275 Hz), 120.4, 119.0, 111.7, 68.9, 68.6, 66.6, 58.7, 56.4, 56.3, 54.7,
51.0, 45.7, 41.7, 39.0, 37.9, 35.6, 35.4, 26.3, 15.9 ppm.
Synthesis of 6-Hydroxy-N-(4′-((2-(2-(3-(((S)-1-((2S,4R)-4-hydroxy-
2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-
dimethyl-1-oxobutan-2-yl)amino)-3-oxopropoxy)ethoxy)ethyl)-
carbamoyl)-4-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-4-
(trifluoromethyl)nicotinamide (8b). The reaction was carried out as
described in General Procedure A to give 14.2 mg (10 μmol, 23%) of
a white solid as a TFA salt (1:3/product: TFA.) MALDI: (calculated)
[M + Na+] 1094.44 g/mol, (found) [M + Na+] 1094.44 g/mol.
HPLC: RT = 11.3 min (254 nm, 100%). HRMS: (calculated) [M +
Synthesis of 6-Hydroxy-N-(4′-((3-(((S)-1-((2S,4R)-4-hydroxy-2-((4-
(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-di-
methyl-1-oxobutan-2-yl)amino)-3-oxopropyl)carbamoyl)-4-(4-
methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-4-(trifluoromethyl)-
nicotinamide (8e). The reaction was carried out as described in
General Procedure A to give 26.8 mg, 18.6 μmol, 43% of a white solid
as a TFA salt (1:4/product: TFA.) MALDI: (calculated) [M + Na+]
1006.39 g/mol, (found) [M + Na+] 1006.42 g/mol. HRMS:
(calculated) [M + Na+] 1006.3867 g/mol, (found): [M + Na+]
1006.3870 g/mol. HPLC: RT = 11.2 min (254 nm, 100%). 1H NMR
(600 MHz, DMSO) δ = 10.24 (s, 1H), 9.92 (s, 1H), 8.97 (s, 1H),
1
Na+] 1094.4392 g/mol, (found) [M + Na+] 1094.4384 g/mol. H
NMR (600 MHz, DMSO) δ = 9.92 (s, 1H), 9.59 (s, 1H), 8.97 (s,
1H), 8.56 (t, 3J = 5.6 Hz, 2H), 8.22 (s, 1H), 8.04 (s, 1H), 7.95−7.90
(m, 3H), 7.69 (d, 3J = 8.2 Hz, 2H), 7.55 (dd, 3J = 8.3 Hz, 4J = 1.4 Hz,
1H), 7.42−7.37 (m, 4H), 7.31 (d, 3J = 8.3 Hz, 1H), 6.83 (s, 1H), 4.55
(d, 3J = 9.4 Hz, 1H), 4.49−4.38 (m, 2H), 4.35 (s, 1H), 4.22 (dd, 3J =
3
8.56 (t, J = 5.5 Hz, 1H), 8.50−8.48 (m, 1H), 8.34 (s, 1H), 8.16 (s,
4
1H), 8.01 (d, 3J = 9.2 Hz, 1H), 7.94 (d, 3J = 8.3 Hz, 2H), 7.67 (d, 3J =
7.8 Hz, 2H), 7.59 (d, 3J = 8.5 Hz, 1H), 7.40 (dd, 2J = 22.6 Hz, 3J = 7.6
Hz, 4H), 7.34 (d, 3J = 8.3 Hz, 1H), 7.31 (s, 1H), 4.57 (d, 3J = 9.2 Hz,
15.8 Hz, J = 5.5 Hz, 2H), 3.68−3.65 (m, 1H), 3.64−3.56 (m, 3H),
3.56−3.47 (m, 8H), 3.46−4.42 (m, 2H), 3.28−3.25 (m, 2H), 3.24−
3.19 (m, 2H), 3.06−3.02 (m, 2H), 2.87 (s, 3H), 2.53 (s, 1H), 2.44 (s,
3H), 2.40−2.29 (m, 1H), 2.08−2.00 (m, 1H), 1.96−1.86 (m, 1H),
0.93 (s, 9H) ppm. 13C NMR (126 MHz, DMSO) δ = 171.9, 170.0,
169.6, 165.9, 163.1, 161.1, 151.5, 147.7, 142.9, 142.0, 139.5, 139.1,
138.5 (q, 2J = 32 Hz), 135.3, 133.2, 132.64, 131.2, 129.6, 128.6, 128.0,
3
4
1H), 4.47−4.39 (m, 2H), 4.36 (s, 1H), 4.22 (dd, J = 15.9 Hz, J =
3
5.3 Hz, 1H), 3.72−3.64 (m, 2H), 3.59−3.52 (m, 2H), 3.49 (dd, J =
4
3
15.9 Hz, J = 7.6 Hz, 2H), 3.31 (d, J = 11.4 Hz, 2H), 3.06 (s, 4H),
2.86 (s, 3H), 2.62−2.54 (m, 2H), 2.44 (s, 3H), 2.09−1.99 (m, 1H),
1.95−1.87 (m, 1H), 0.93 (s, 9H) ppm. 13C NMR (151 MHz, DMSO)
δ = 171.9, 170.4, 169.6, 165.8, 163.1, 161.1, 151.5, 147.6, 142.9,
142.0, 139.5, 139.0, 138.5 (q, 2J = 32 Hz), 135.3, 133.3, 132.6, 131.2,
129.6, 128.6, 127.9, 127.4, 126.1, 124.0, 122.4, 122.1 (q, 1J = 279 Hz),
121.0, 118.9, 111.7, 68.9, 58.7, 56.5, 56.4, 52.9, 48.1, 42.4, 41.7, 38.0,
36.3, 35.3, 34.9, 26.4, 15.9 ppm.
1
127.4, 126.1, 123.9, 122.32, 122.1 (q, J = 275 Hz), 121.0, 119.0,
118.8, 111.6, 69.6, 69.5, 69.0, 68.9, 66.9, 58.7, 56.4, 56.3, 52.85, 48.1,
42.4, 41.7, 38.0, 35.7, 35.4, 26.3, 15.9 ppm.
Synthesis of 6-Hydroxy-N-(4′-(((S)-17-((2S,4R)-4-hydroxy-2-((4-
(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidine-1-carbonyl)-
18,18-dimethyl-15-oxo-3,6,9,12-tetraoxa-16-azanonadecyl)-
carbamoyl)-4-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-4-
(trifluoromethyl)nicotinamide (8c). The reaction was carried out as
described in General Procedure A to give 11.5 mg (7.11 μmol, 16%)
of a white solid as a TFA salt (1:4/product: TFA.) MALDI:
(calculated) [M + H+] 1160.51 g/mol, (found) [M + H+] 1160.58 g/
mol. HPLC: RT = 11.4 min (254 nm, 99%). HRMS: (calculated) [M
Synthesis of 6-Hydroxy-N-(4′-((4-(((S)-1-((2S,4R)-4-hydroxy-2-((4-
(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-di-
methyl-1-oxobutan-2-yl)amino)-4-oxobutyl)carbamoyl)-4-(4-
methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-4-(trifluoromethyl)-
nicotinamide (8f). The reaction was carried out as described in
General Procedure A to give 14.7 mg, 14.7 μmol, 41% of a white solid.
ESI: (calculated) [M + H+] 998.42 g/mol, (found) [M + H+] 998.35
g/mol (70). MALDI: (calculated): [M + Na+] 1020.40 g/mol,
(found) [M + Na+] 1020.34 g/mol. HRMS: (calculated) [M + Na+]
1020.4024 g/mol, (found) [M + Na+] 1020.4010 g/mol. HPLC: RT
= 11.3 min (254 nm, 100%). 1H NMR (600 MHz, DMSO) δ = 9.82
1
+ Na+] 1182.4916 g/mol, (found) [M + Na+] 1182.4913 g/mol. H
NMR (500 MHz, DMSO) δ = 9.76 (s, 1H), 9.57 (s, 1H), 8.97 (s,
1H), 8.56 (t, 3J = 5.4 Hz, 2H), 8.21 (d, 4J = 1.8 Hz, 1H), 8.03 (s, 1H),
7.95 (d, 3J = 8.4 Hz, 2H), 7.90 (d, 3J = 9.4 Hz, 1H), 7.69 (d, 3J = 8.4
Hz, 2H), 7.56 (dd, 3J = 8.3 Hz, 4J = 2.1 Hz, 1H), 7.40 (q, 3J = 8.3 Hz,
R
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
(s, 1H), 9.58 (s, 1H), 8.97 (s, 1H), 8.55 (t, 3J = 6.0 Hz, 1H), 8.52 (t,
3J = 5.5 Hz, 1H), 8.21 (s, 1H), 8.03 (s, 1H), 7.95 (d, 3J = 8.2 Hz, 3H),
7.69 (d, 3J = 8.3 Hz, 2H), 7.56 (dd, 3J = 8.3 Hz, 4J = 1.9 Hz, 1H), 7.40
(dd, 2J = 22.3 Hz, 3J = 8.1 Hz, 4H), 7.32 (d, 3J = 8.4 Hz, 1H), 6.84 (s,
1H), 4.56 (d, J = 9.3 Hz, 1H), 4.43 (dd, J = 14.8 Hz, J = 6.9 Hz,
2H), 4.36 (s, 1H), 4.22 (dd, 3J = 15.8 Hz, 4J = 5.4 Hz, 1H), 3.71−3.63
(m, 2H), 3.52 (d, 3J = 11.2 Hz, 2H), 3.28 (d, 3J = 7.4 Hz, 4H), 3.22−
3.18 (m, 2H), 3.05−3.01 (m, 2H), 2.87 (s, 3H), 2.44 (s, 3H), 2.37−
2.30 (m, 1H), 2.25−2.20 (m, 1H), 2.05−2.00 (m, 1H), 1.95−1.87
(m, 1H), 1.81−1.72 (m, 2H), 0.95 (s, 9H) ppm. 13C NMR (201
MHz, DMSO) δ = 171.9, 171.8, 169.6, 165.8, 162.8, 161.0, 151.4,
147.7, 144.8, 142.0, 139.5, 139.1, 138.7 (q, 2J = 33 Hz), 134.3, 133.2,
132.2, 131.1, 129.6, 128.6, 127.9, 127.4, 126.0, 124.0, 122.4, 122.0 (q,
1J = 276 Hz), 120.4, 119.0, 111.6, 68.9, 58.5, 56.2, 56.1, 52.6, 48.0,
General Procedure A to give 4.67 mg, 4.49 μmol, 14% of a yellow
solid (TFA salt with a stoichiometry of 1:4/product: TFA). MALDI:
(calculated) [M + H+] 1040.21 g/mol, (found) [M + H+] 1040.25 g/
mol. HPLC: RT = 11.6 min (254 nm, 98%). HRMS: (calculated) [M
1
+ Na+] 1062.4494 g/mol, (found) [M + Na+] 1062.4483 g/mol. H
3
3
4
NMR (500 MHz, DMSO) δ = 12.55 (s, 1H), 9.52 (s, 1H), 8.97 (s,
1H), 8.55 (t, 3J = 6.0 Hz, 1H), 8.46 (t, 3J = 5.6 Hz, 1H), 8.17 (s, 1H),
8.01 (s, 1H), 7.93 (d, 3J = 8.4 Hz, 2H), 7.84 (d, 3J = 9.4 Hz, 1H), 7.68
(d, 3J = 8.4 Hz, 2H), 7.54 (dd, 3J = 8.3 Hz, 4J = 2.1 Hz, 1H), 7.40 (q,
3J = 8.3 Hz, 4H), 7.30 (d, 3J = 8.4 Hz, 1H), 6.83 (s, 1H), 5.11 (d, 3J =
3
3.6 Hz, 1H), 4.54 (d, J = 9.4 Hz, 1H), 4.49−4.38 (m, 2H), 4.35 (s,
2
3
1H), 4.21 (dd, J = 16.0 Hz, J = 5.4 Hz, 1H), 3.72−3.58 (m, 2H),
3
4
3.26 (dd, J = 13.3 Hz, J = 6.7 Hz, 4H), 3.05 (s, 4H), 2.44 (s, 3H),
2.32−2.28 (m, 1H), 2.19−2.07 (m, 1H), 2.07−1.98 (m, 1H), 1.93−
1.88 (m, 1H), 1.52−1.47 (m, 4H), 1.31−1.23 (m, 3H), 0.93 (s, 9H)
ppm. 13C NMR (126 MHz, DMSO) δ = 172.1, 171.9, 169.7, 165.7,
163.1, 161.1, 151.4, 147.7, 142.9, 141.8, 139.5, 139.1, 138.5 (q, 2J = 32
Hz), 135.4, 133.5, 132.6, 131.2, 129.6, 128.6, 127.9, 127.4, 126.1,
123.9, 123.1, 122.3, 122.1 (q, 1J = 273 Hz), 121.0, 119.0, 111.6, 68.9,
58.7, 56.3, 56.3, 52.8, 48.1, 42.3, 41.6, 38.4, 38.0, 35.2, 34.8, 29.1,
26.4, 25.4, 15.9 ppm.
42.1, 41.4, 38.7, 37.7, 35.1, 32.4, 26.2, 25.4, 15.6 ppm.
Synthesis of 6-Hydroxy-N-(4′-((5-(((S)-1-((2S,4R)-4-hydroxy-2-((4-
(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-di-
methyl-1-oxobutan-2-yl)amino)-5-oxopentyl)carbamoyl)-4-(4-
methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-4-(trifluoromethyl)-
nicotinamide (8g). The reaction was carried out as described in
General Procedure A to give 7.42 mg (7.33 μmol, 23%) of a white
solid. ESI: (calculated) [M + H+] 1012.43 g/mol, (found) [M + H+]
1012.62 g/mol. HPLC: RT = 11.4 min (254 nm, 100%). HRMS:
(calculated) [M + Na+] 1034.4180 g/mol, (found) [M + Na+]
Synthesis of 6-Hydroxy-N-(4′-((4-(2-(((S)-1-((2S,4R)-4-hydroxy-2-
((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-di-
methyl-1-oxobutan-2-yl)amino)-2-oxoethyl)benzyl)carbamoyl)-4-
(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-4-(trifluoromethyl)-
nicotinamide (8j). The reaction was carried out as described in
General Procedure A. The gained product was then dissolved in ethyl
acetate and a solution of saturated NaHCO3 and saturated NaCl
solution and extracted with ethyl acetate. The combined organic
phases were dried over MgSO4, and the solvent was removed under
reduced pressure to give 14.4 mg, 13.6 μmol, 30% of a white solid.
MALDI: (calculated) [M + H+] 1060.44 g/mol, (found) [M + H+]
1060.17 g/mol. HRMS: (calculated) [M + Na+] 1082.4180 g/mol,
(found) [M + Na+] 1082.4171 g/mol. HPLC: RT = 11.6 min (254
nm, 100%). 1H NMR (500 MHz, DMSO) δ = 9.47 (s, 1H), 9.04 (t, 3J
1
1034.4171 g/mol. H NMR (500 MHz, DMSO) δ = 9.77 (s, 1H),
9.57 (s, 1H), 8.97 (s, 1H), 8.55 (t, 3J = 6.1 Hz, 1H), 8.50 (t, 3J = 5.6
Hz, 1H), 8.21 (d, 4J = 1.8 Hz, 1H), 8.03 (s, 1H), 7.94 (d, 3J = 8.4 Hz,
2H), 7.86 (d, 3J = 9.3 Hz, 1H), 7.68 (d, 3J = 8.4 Hz, 2H), 7.55 (dd, 3J
= 8.3 Hz, 4J = 2.1 Hz, 1H), 7.42−7.39 (m, 4H), 7.32 (d, 3J = 8.4 Hz,
1H), 6.84 (s, 1H), 5.12 (s, 1H), 4.54 (d, 3J = 9.4 Hz, 1H), 4.48−4.38
(m, 2H), 4.35 (s, 1H), 4.21 (dd, 3J = 15.9 Hz, 4J = 5.5 Hz, 1H), 3.70−
3.63 (m, 2H), 3.55−3.46 (m, 2H), 3.29−3.23 (m, 4H), 3.07−3.02
(m, 2H), 2.86 (s, 3H), 2.53−2.50 (m, 2H), 2.44 (s, 3H), 2.35−2.26
(m, 1H), 2.19−2.14 (m, 1H), 2.09−1.99 (m, 1H), 1.93−1.88 (m,
1H), 1.60−1.47 (m, 4H), 0.94 (s, 9H) ppm. 13C NMR (126 MHz,
DMSO) δ = 172.0, 172.0, 169.7, 165.8, 163.2, 151.4, 147.7, 144.6,
142.1, 139.5, 139.1, 138.1 (d, 2J = 32 Hz), 134.4, 133.2, 132.5, 131.2,
129.6, 128.6, 127.9, 127.4, 126.0, 123.7, 121.8, 122.3 (q, 1J = 276 Hz),
120.5, 117.7, 111.7, 68.9, 58.7, 56.3, 56.3, 54.8, 51.1, 45.8, 41.6, 38.7,
37.9, 35.2, 34.7, 28.9, 26.4, 23.1, 15.9 ppm.
3
4
= 6.0 Hz, 1H), 8.98 (s, 1H), 8.56 (t, J = 6.1 Hz, 1H), 8.12 (d, J =
2.1 Hz, 1H), 8.09 (d, 3J = 9.3 Hz, 1H), 8.01−7.93 (m, 3H), 7.69 (d, 3J
3
4
3
= 8.5 Hz, 2H), 7.53 (dd, J = 8.4 Hz, J = 2.2 Hz, 1H), 7.40 (q, J =
3
8.4 Hz, 4H), 7.27 (d, J = 8.4 Hz, 1H), 7.24 (s, 4H), 6.82 (s, 1H),
5.11 (d, 3J = 3.1 Hz, 1H), 4.51 (d, 3J = 9.4 Hz, 1H), 4.47 (d, 3J = 5.8
Hz, 2H), 4.45−4.39 (m, 2H), 4.33 (s, 1H), 4.22 (dd, 3J = 15.9 Hz, 4J
Synthesis of 6-Hydroxy-N-(4′-((6-(((S)-1-((2S,4R)-4-hydroxy-2-((4-
(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-di-
methyl-1-oxobutan-2-yl)amino)-6-oxohexyl)carbamoyl)-4-(4-
methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-4-(trifluoromethyl)-
nicotinamide (8h). The reaction was carried out as described in
General Procedure A to give 15.5 mg (11.3 μmol, 26%) of a white
solid as a TFA salt (1:3/product: TFA.) MALDI: (calculated) [M +
Na+] 1048.43 g/mol, [M + H+] 1026.45 g/mol, (found) [M + Na+]
1048.43 g/mol, [M + H+] 1026.44 g/mol. HPLC: RT = 11.4 min
(254 nm, 100%). HRMS: (calculated) [M + Na+] 1048.4337 g/mol,
(found) [M + Na+] 1048.4338 g/mol. 1H NMR (500 MHz, DMSO)
δ = 9.96 (s, 1H), 9.59 (s, 1H), 8.98 (s, 1H), 8.56 (t, J = 6.0 Hz, 1H),
8.48 (t, J = 5.6 Hz, 1H), 8.22 (d, J = 2.0 Hz, 1H), 8.04 (s, 1H), 7.94
(d, J = 8.5 Hz, 2H), 7.84 (d, J = 9.3 Hz, 1H), 7.68 (d, J = 8.4 Hz, 2H),
7.55 (dd, J = 8.3, 2.2 Hz, 1H), 7.45−7.36 (m, 4H), 7.32 (d, J = 8.4
Hz, 1H), 6.84 (s, 1H), 4.54 (d, J = 9.4 Hz, 1H), 4.47−4.38 (m, 2H),
4.35 (s, 1H), 4.22 (dd, J = 15.9, 5.4 Hz, 1H), 3.68−3.65 (m, 2H),
3.53 (d, J = 11.2 Hz, 2H), 3.28−3.20 (m, 6H), 3.04 (t, J = 11.3 Hz,
2H), 2.87 (s, 3H), 2.44 (s, 3H), 2.31−2.22 (m, 1H), 2.17−2.10 (m,
1H), 2.05−2.01 (m, 1H), 1.93−1.87 (m, 1H), 1.56−1.50 (m, 4H),
1.35−1.25 (m, 2H), 0.93 (s, 9H) ppm. 13C NMR (126 MHz, DMSO)
δ = 172.1, 172.0, 169.7, 165.7, 163.1, 161.1, 151.5, 147.7, 142.9,
141.9, 139.5, 139.0, 138.5 (q, 2J = 33 Hz), 135.4, 133.5, 132.6, 131.2,
129.6, 128.6, 127.9, 127.4, 126.1, 123.9, 122.3, 122.1 (q, 1J = 276 Hz)
121.0, 118.9, 118.8, 111.6, 68.9, 58.7, 56.4, 56.3, 52.8, 48.1, 42.4, 41.7,
38.0, 35.2, 34.9, 29.0, 26.4, 26.2, 25.3, 15.9 ppm.
3
= 5.5 Hz, 1H), 3.71−3.58 (m, 3H), 3.44 (d, J = 13.9 Hz, 2H), 2.91
3
(t, J = 4.3 Hz, 4H), 2.50 (s, 4H), 2.44 (s, 3H), 2.24 (s, 3H), 2.07−
1.97 (m, 1H), 1.92−1.86 (m, 1H), 0.92 (s, 9H) ppm. 13C NMR (126
MHz, DMSO) δ = 171.9, 170.0, 169.5, 165.8, 162.8, 161.1, 151.4,
147.72, 145.0, 142.3, 139.5, 139.2, 138.5 (q, 2J = 32 Hz), 137.6, 135.1,
134.2, 132.9, 132.2, 131.2, 129.6, 129.0, 128.6, 128.0, 127.4, 127.0,
126.1, 124.0, 122.4, 122.0 (d, 1J = 275 Hz), 120.4, 119.0, 111.6, 68.9,
58.7, 56.5, 56.4, 54.7, 51.0, 45.7, 42.4, 41.7, 41.5, 37.9, 35.4, 26.3, 15.9
ppm.
Synthesis of N-(4′-((2-(2-(4-((2R,3S,4R,5S)-3-(3-Chloro-2-fluoro-
phenyl)-4-(4-chloro-2-fluorophenyl)-4-cyano-5-neopentylpyrroli-
dine-2-carboxamido)-3-methoxybenzamido)ethoxy)ethyl)-
carbamoyl)-4-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-6-hy-
droxy-4-(trifluoromethyl)nicotinamide (9a). First, 15.2 mg (21
μmol, 1.05 equiv) of intermediate 6a was dissolved in 2 mL of
TFA/CH2Cl2 and stirred for 1 h at rt. The excess solvent was
removed under reduced pressure. Then, 13 mg (21 μmol, 1.0 equiv)
of idasanutlin, 9.6 mg (25 μmol, 1.2 equiv) of HATU, and 7 μL (42
μmol, 2.0 equiv) of DIEA were dissolved in 1 mL of DMF and stirred
for 15 min at rt. Then, a solution of deprotected 6a and 73 μL (420
μmol, 10 equiv) of DIEA in 1 mL of DMF were added to the solution
and stirred for 12 h at rt. The reaction mixture was quenched with 2
mL of water and 2 mL of saturated NaHCO3; then, the reaction was
extracted 3× with EA. The organic phase was dried over MgSO4 and
filtered, and the solvent was removed under reduced pressure. The
crude product was purified by HPLC. The gained product was then
dissolved in ethyl acetate and a solution of saturated NaHCO3 and
saturated NaCl solution and extracted with ethyl acetate. The
combined organic phases were dried over MgSO4, and the solvent was
removed under reduced pressure to give 3.0 mg, 2.5 μmol, 12% of a
Synthesis of 6-Hydroxy-N-(4′-((7-(((S)-1-((2S,4R)-4-hydroxy-2-((4-
(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-di-
methyl-1-oxobutan-2-yl)amino)-7-oxoheptyl)carbamoyl)-4-(4-
methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-4-(trifluoromethyl)-
nicotinamide (8i). The reaction was carried out as described in
S
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
clear oil. MALDI: (calculated) [M + H+] 1184.49 g/mol, (found) [M
+ H+] 1184.40 g/mol. HRMS: (calculated) [M + Na+] 1206.3805 g/
mol, (found) [M + Na+] 1206.3821 g/mol. HPLC: RT = 14.4 min
+ K+] 1254.32 g/mol. HRMS: (calculated) [M + Na+] 1238.3856 g/
mol, (found) [M + Na+] 1238.3894 g/mol. HPLC: RT = 14.7 min
(254 nm, 98%). 1H NMR (250 MHz, DMSO) δ = 10.40 (s, 1H), 9.13
(s, 1H), 9.04 (s, 1H), 8.96 (s, 1H), 8.49 (s, 3H), 8.44 (s, 1H), 8.31
(d, 3J = 9.1 Hz, 2H), 8.20 (d, 3J = 11.9 Hz, 1H), 7.98 (d, 3J = 7.9 Hz,
1
(254 nm, 98%). H NMR (400 MHz, DMSO) δ = 10.45 (s, 1H),
10.40 (s, 1H), 9.45 (s, 1H), 8.53 (t, 3J = 5.5 Hz, 1H), 8.48 (t, 3J = 5.5
Hz, 1H), 8.35 (s, 1H), 8.32 (d, 3J = 8.5 Hz, 2H), 8.13 (d, 4J = 1.9 Hz,
1H), 7.92 (d, 3J = 8.4 Hz, 2H), 7.73 (t, 3J = 7.3 Hz, 2H), 7.67 (d, 3J =
8.4 Hz, 2H), 7.60−7.56 (m, 4H), 7.53−7.50 (m, 3H), 7.44−7.38 (m,
3
2H), 7.69 (d, J = 7.4 Hz, 2H), 7.61 (s, 2H), 7.57−7.52 (m, 2H),
7.52−7.47 (m, 1H), 7.39 (s, 1H), 7.36 (s, 2H), 7.29 (s, 4H), 6.52 (s,
1H), 6.13 (s, 1H), 4.59−4.58 (m, 2H), 4.51−4.41 (m, 4H), 3.91 (s,
4H), 3.57−3.50 (m, 6H), 3.47 (d, 3J = 4.8 Hz, 2H), 3.11 (d, 3J = 5.1
Hz, 2H), 3.03−2.99 (m, 2H), 2.44−2.37 (m, 1H), 0.97 (s, 9H) ppm.
Contains rotameres.
3
1H), 7.38−7.31 (m, 4H), 7.25 (d, J = 8.4 Hz, 1H), 6.81 (s, 1H),
4.65−4.54 (m, 4H), 4.40−4.33 (m, 2H), 3.99−3.95 (m, 2H), 3.92 (s,
3H), 3.90 (s, 3H), 3.60−3.57 (m, 5H), 3.48−3.43 (m, 8H), 2.92−
2.88 (m, 4H), 1.69−1.60 (m, 2H), 1.39−1.36 (m, 1H), 1.28−1.24
(m, 2H), 0.96 (s, 9H) ppm. Contains rotameres.
Synthesis of 6-Hydroxy-N-(4′-((5-(((S)-1-((2S,4S)-4-hydroxy-2-((4-
(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-di-
methyl-1-oxobutan-2-yl)amino)-5-oxopentyl)carbamoyl)-4-(4-
methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-4-(trifluoromethyl)-
nicotinamide (20). The reaction was carried out as described in
General Procedure A with intermediate 6 and tert-butyl (5-(((S)-1-
((2S,4S)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)-
pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)amino)-5-oxopentyl)-
carbamate (L15). The gained product was then dissolved in ethyl
acetate and a solution of saturated NaHCO3 and saturated NaCl
solution and extracted with ethyl acetate. The combined organic
phases were dried over MgSO4, and the solvent was removed under
reduced pressure to give 9 mg, 8.9 μmol, 18% of a white oil. MALDI:
(calculated) [M-CH3-tBu+2H+] 941.35 g/mol, (found) [M-CH3-tBu
+2H+] 941.45 g/mol. HRMS: (calculated) [M + Na+] 1034.4180 g/
mol, (found) [M + Na+] 1034.4169 g/mol. HPLC: RT = 11.4 min
(254 nm, 100%). 1H NMR (250 MHz, MeOD) δ = 9.03 (s, 1H), 8.26
(d, 4J = 1.9 Hz, 1H), 8.03 (s, 1H), 7.91 (d, 3J = 8.3 Hz, 2H), 7.71 (d,
3J = 8.3 Hz, 2H), 7.56 (dd, 3J = 8.5 Hz, 4J = 2.0 Hz, 1H), 7.44 (dd, 2J
Synthesis of N-(4′-((1-(4-((2R,3S,4R,5S)-3-(3-Chloro-2-fluoro-
phenyl)-4-(4-chloro-2-fluorophenyl)-4-cyano-5-neopentylpyrroli-
dine-2-carboxamido)-3-methoxyphenyl)-1-oxo-5,8,11,14,17,20,23-
heptaoxa-2-azapentacosan-25-yl)carbamoyl)-4-(4-methylpipera-
zin-1-yl)-[1,1′-biphenyl]-3-yl)-6-hydroxy-4-(trifluoromethyl)-
nicotinamide (9b). First, 8.9 mg (9 μmol, 1.0 equiv) of intermediate
6b was dissolved in 2 mL of TFA/CH2Cl2 and stirred for 1 h at rt.
The excess solvent was removed under reduced pressure. Then, 5.5
mg (9 μmol, 1.0 equiv) of idasanutlin, 4 mg (11 μmol, 1.2 equiv) of
HATU, and 3 μL (18 μmol, 2.0 equiv) of DIEA were dissolved in 1
mL of DMF and stirred for 15 min at rt. Then, a solution of
deprotected 6b and 31 μL (180 μmol, 10 equiv) of DIEA in 1 mL of
DMF were added to the solution and stirred for 12 h at rt. The
reaction mixture was quenched with 2 mL of water and 2 mL of
saturated NaHCO3; then, the reaction was extracted 3× with EA. The
organic phase was dried over MgSO4 and filtered, and the solvent was
removed under reduced pressure. The crude product was purified by
HPLC. The gained product was then dissolved in ethyl acetate and a
solution of saturated NaHCO3 and saturated NaCl solution and
extracted with ethyl acetate. The combined organic phases were dried
over MgSO4, and the solvent was removed under reduced pressure to
give 3.3 mg, 2.2 μmol, 25% of a clear oil. MALDI: (calculated) [M +
H+] 1448.56 g/mol, (found) [M + H+] 1448.53 g/mol. HRMS:
(calculated) [M + Na+] 1470.5378 g/mol, (found) [M + Na+]
4
= 15.1 Hz, 3J = 7.8 Hz, 4H), 7.37 (d, J = 2.1 Hz, 1H), 6.94 (s, 1H),
3
4.63 (s, 1H), 4.56 (s, 1H), 4.50 (s, 2H), 4.35 (d, J = 15.7 Hz, 1H),
3
3.91 (d, 3J = 10.7 Hz, 1H), 3.80 (dd, J = 10.9 Hz, 4J = 3.6 Hz, 1H),
3.64−3.60 (m, 2H), 3.44−3.39 (m, 2H), 3.36−3.24 (m, 4H), 3.20−
3.15 (m, 2H), 2.97 (s, 3H), 2.47 (s, 3H), 2.39−2.33 (m, 2H), 2.28−
2.15 (m, 1H), 2.13−2.08 (m, 1H), 1.79−1.59 (m, 4H), 1.04 (s, 9H)
ppm.
1
1470.5392 g/mol. HPLC: RT = 14.6 min (254 nm, 96%). H NMR
Synthesis of 2-Bromo-6,7-dihydro-5H-pyrrolo[1,2-a]imidazole
(11). This reaction was performed in two equal batches. First, 1.00
g (7.03 mmol, 1.0 equiv) of piracetam 10 and 4.00 g (14.0 mmol, 2.0
equiv) of POBr3 were dissolved in 20 mL of acetonitrile and heated in
a microwave under stirring for 80 min at 5 W to 70 °C. Solid POBr3
that had formed at the top of the vial was brought back into the
reaction mixture with a spatula, and the reaction mixture was heated
in a microwave for another 45 min. After cooling to rt, the batches
were combined and quenched with 35 mL of water. K2CO3 was added
until no gas formation was observed, and the solvent was removed
under reduced pressure. The aqueous mixture was extracted with
dichloromethane (5 × 35 ml), washed with brine, and dried with
MgSO4. The solvent was removed under reduced pressure.
Purification was performed by flash column chromatography
(CH2Cl2/MeOH) to give 2.16 g, 5.76 mmol, 82% of a colorless
solid. Rf (10% MeOH/CH2Cl2) 0.70. ESI: (calculated) [M + H+]
(400 MHz, DMSO) δ = 10.47 (s, 1H), 10.40 (s, 1H), 9.46 (s, 1H),
3
3
3
8.53 (t, J = 5.5 Hz, 1H), 8.48 (t, J = 5.4 Hz, 1H), 8.36 (d, J = 8.8
Hz, 1H), 8.32 (d, 3J = 8.4 Hz, 2H), 8.12 (d, 4J = 2.1 Hz, 1H), 7.92 (d,
3J = 8.5 Hz, 2H), 7.73 (t, 3J = 7.2 Hz, 2H), 7.67 (d, 3J = 8.5 Hz, 2H),
7.60−7.56 (m, 5H), 7.54−7.51 (m, 2H), 7.50−7.48 (m, 1H), 7.40
(dd, 3J = 8.4 Hz, 4J = 2.4 Hz, 1H), 7.38−7.34 (m, 3H), 7.34−7.32 (m,
3
1H), 7.25 (d, J = 8.4 Hz, 1H), 6.82 (s, 1H), 4.65−4.54 (m, 4H),
4.41−4.33 (m, 2H), 3.99−3.95 (m, 2H), 3.92 (s, 3H), 3.90 (s, 3H),
3.60−3.57 (m, 5H), 3.49−3.41 (m, 8H), 2.91−2.90 (m, 4H), 1.68−
1.61 (m, 2H), 1.44−1.33 (m, 2H), 0.96 (s, 9H) ppm. Contains
rotameres.
Synthesis of N-(4′-((4-((4-((2R,3S,4R,5S)-3-(3-Chloro-2-fluoro-
phenyl)-4-(4-chloro-2-fluorophenyl)-4-cyano-5-neopentylpyrroli-
dine-2-carboxamido)-3-methoxybenzamido)methyl)benzyl)-
carbamoyl)-4-(4-methylpiperazin-1-yl)-[1,1′-biphenyl]-3-yl)-6-hy-
droxy-4-(trifluoromethyl)nicotinamide (9c). First, 13.5 mg (24
μmol, 1.0 equiv) of intermediate 6c was dissolved in 2 mL of
TFA/CH2Cl2 and stirred for 1 h at rt. The excess solvent was
removed under reduced pressure. Then, 15.7 mg (25 μmol, 1.1 equiv)
of idasanutlin, 11 mg (29 μmol, 1.2 equiv) of HATU, and 8 μL (49
μmol, 2.0 equiv) of DIEA were dissolved in 1 mL of DMF and stirred
for 15 min at rt. Then, a solution of deprotected 6c and 84 μL (490
μmol, 10 equiv) of DIEA in 1 mL of DMF were added to the solution
and stirred for 12 h at rt. The reaction mixture was quenched with 2
mL of water and 2 mL of saturated NaHCO3; then, the reaction was
extracted 3× with EA. The organic phase was dried over MgSO4 and
filtered, and the solvent was removed under reduced pressure. The
crude product was purified by HPLC. The gained product was then
dissolved in ethyl acetate and a solution of saturated NaHCO3 and
saturated NaCl solution and extracted with ethyl acetate. The
combined organic phases were dried over MgSO4, and the solvent was
removed under reduced pressure to give 3.7 mg, 3.0 μmol, 13% of a
clear oil. MALDI: (calculated) [M + K+] 1254.36 g/mol, (found) [M
1
189.99 g/mol, (found) [M + H+] 189.09 g/mol; m.p. 95.7 °C. H
3
NMR (600 MHz, CD3OD) δ = 7.05 (s, 1H), 4.02 (t, J = 7.20 Hz,
3
2H), 2.82 (t, J = 7.40 Hz, 2H), 2.60−2.54 (m, 2H) ppm. 13C NMR
(125.8 MHz, CD3OD) δ = 155.4, 116.6, 116.0, 46.5, 26.4, 24.1 ppm.
Synthesis of 5-(6,7-Dihydro-5H-pyrrolo[1,2-a]imidazol-2-yl)-2-
methoxybenzonitrile (12). A solution of 538 mg (13.5 mmol, 5.2
equiv) of NaOH and 693 mg (3.92 mmol, 1.5 equiv) of (3-cyano-4-
methoxyphenyl)boronic acid in 24 mL of tetrahydrofuran/water (3/
1) was stirred at 50 °C for 5 min. Bromide 11 (480 mg, 2.57 mmol,
1.0 equiv) and 113 mg (0.13 mmol. 0.1 equiv) of the XPhos PdG3
catalyst were added, and the reaction mixture was stirred for 21 h at
80 °C. The two batches were combined, and the organic solvent was
removed under reduced pressure. The remaining aqueous layer was
extracted with dichloromethane (3×). The combined organic layers
were washed with brine and dried with MgSO4, and the solvent was
removed under reduced pressure. Purification by flash column
chromatography (EA) gave 386 mg, 1.62 mmol, 63% of a colorless
T
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
3
solid. Rf (EA) 0.43. ESI: (calculated) [M + H+] 240.12 g/mol,
2.73 (t, J = 7.13 Hz), 2.54−2.47 (m, 2H) ppm. 13C NMR (125.8
MHz, DMSO) δ = 169.6, 153.8, 153.4, 145.1, 137.6, 131.0, 130.7,
130.3, 129.5, 129.1, 126.4, 124.7, 124.4, 123.8, 115.0, 109.2, 44.3,
41.0, 37.8, 25.6, 22.4 ppm.
1
(found) [M + H+] 240.05 g/mol. M.p. 160.9 °C. H NMR (600
MHz, CDCl3) δ = 7.99 (dd, 3J = 8.82 Hz, 4J = 1.90 Hz, 1H), 7.87 (d,
4J = 1.90 Hz, 1H), 7.13 (s, 1H), 6.98 (d, 3J = 8.82 Hz, 1H), 4.05 (t, 3J
3
Synthesis of tert-Butyl 3-(2-(2-((2-(3,4-Dichlorophenyl)-
acetamido)methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-a]imidazol-2-yl)-
phenoxy)ethoxy)propanoate (16a). The reaction was carried out as
described in General Procedure B using tert-butyl 3-(2-
hydroxyethoxy)propanoate as the commercial available starting
material, obtaining the product as a TFA salt with an unknown
stoichiometry as a colorless oil (31 mg). MALDI: (calculated) [M +
H ] 588.21 g/mol, (found) [M + H ] 588.25 g/mol. 1H NMR (500
= 6.98 Hz, 2H), 3.94 (s, 3H), 2.97 (t, J = 7.48 Hz, 2H), 2.68−2.62
(m, 2H) ppm. 13C NMR (125.8 MHz, CDCl3) δ = 160.1, 155.1,
143.6, 130.8, 129.8, 127.8, 116.6, 111.7, 110.3, 102.0, 56.3, 45.3, 26.2,
23.2 ppm.
Synthesis of (5-(6,7-Dihydro-5H-pyrrolo[1,2-a]imidazol-2-yl)-2-
methoxyphenyl)methanamine (13). First, 16.1 mL (16.1 mmol, 5.0
equiv) of LiAlH4 (1 M in THF) was added dropwise to a colorless
solution of 772 mg (3.23 mmol, 1.0 equiv) of nitrile 12 in 32 mL of
tetrahydrofuran via a syringe. The reaction mixture was stirred at 60
°C for 2.5 h, became orange, and was stirred overnight at room
temperature. The reaction was quenched with an aqueous solution of
1 M NaOH (35 ml) and filtered, and the solvent was removed under
reduced pressure. The remaining aqueous phase was extracted with
dichloromethane (2×). The combined organic layers were washed
with brine and dried with MgSO4. The solvent was removed under
reduced pressure. The title compound 12 (691 mg, 2.84 mmol, 88%)
was isolated as a sticky yellow solid and used without further
purification. ESI (calculated) [M + H+] 244.15 g/mol, (found) [M +
H+] 244.22 g/mol. 1H NMR (600 MHz, CDCl3) δ = 7.59 (t, 4J = 1.28
Hz, 1H), 7.57 (dd, 3J = 8.26 Hz, 4J = 1.28 Hz, 1H), 7.07 (s, 1H), 6.84
(d, 3J = 8.26 Hz, 1H), 3−97 (t, 3J = 6.67 Hz, 2H), 3.84 (s, 3H), 3.81
3
4
MHz, CDCl3) δ = 7.72 (t, J = 6.00 Hz, 1H), 7.50 (d, J = 2.10 Hz,
1H), 7.45 (d, 4J = 1.98 Hz, 1H), 7.38 (dd, 3J = 8.44 Hz, 4J = 2.10 Hz,
1H), 7.31 (d, 3J = 8.22 Hz, 1H), 7.16 (dd, 3J = 8.22 Hz, 4J = 1.98 Hz,
3
3
1H), 7.14 (s, 1H) 6.78 (d, J = 8.57 Hz, 1H), 4.41 (d, J = 6.00 Hz,
3
2H), 4.16 (t, J = 7.25 Hz, 2H), 4.10−4.07 (m, 2H), 3.80−3.76 (m,
3
4H), 3.59 (s, 2H), 3.20 (t, J = 7.50 Hz, 2H), 2.77−2.70 (m, 2H),
2.50 (t, 3J = 6.12 Hz, 2H), 1.42 (s, 9H) ppm. 13C NMR (125.8 MHz,
CDCl3) δ = 171.2, 171.0, 157.4, 152.0, 139.2, 136.0, 132.3, 131.3,
130.9, 130.44, 129.1, 128.2, 125.9, 119.6, 112.2, 110.9, 81.0, 69.3,
68.1, 67.3, 47.6, 42.1, 38.1, 36.4, 28.2, 25.7, 23.5 ppm.
Synthesis of tert-Butyl 3-(2-(2-(2-((2-(3,4-Dichlorophenyl)-
acetamido)methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-a]imidazol-2-yl)-
phenoxy)ethoxy)ethoxy)propanoate (16b). The reaction was carried
out as described in General Procedure B using tert-butyl 3-(2-(2-
hydroxyethoxy)ethoxy)propanoate as the commercial available
starting material, obtaining the product as a TFA salt with an
unknown stoichiometry as a colorless oil (74 mg). MALDI:
(calculated) [M + H] 632.23 g/mol, (found) [M + H] 632.19
3
3
(s, 2H), 2.89 (t, J = 7.56 Hz, 2H), 2.58 (quin, J = 7.23 Hz, 2H),
1.92 (br, s) ppm. The spectrum contains minor impurities. 13C NMR
(125.8 MHz, DMSO) δ = 155.8, 154.5, 145.2, 128.3, 127.9, 125.4,
124.5, 111.0, 110.5, 55.9, 44.7, 39.6, 26.1, 22.3 ppm.
Synthesis of 2-(3,4-Dichlorophenyl)-N-(5-(6,7-dihydro-5H-
pyrrolo[1,2-a]imidazol-2-yl)-2-methoxybenzyl)acetamide (14).
First, 118 mg of EDC hydrochloride (0.647 mmol, 1.5 equiv) was
added to a solution of the amine 13 (100 mg, 0.411 mmol, 1.0 equiv),
126 mg (0.617 mmol, 1.5 equiv) of 2-(3,4-dichlorophenyl)acetic acid,
94 mg (0.65 μmol, 1.5 equiv) of HOBT monohydrate, and 0.11 mL
(0.63 mmol, 1.5 equiv) of DIPEA in 1 mL of dimethylformamide at 0
°C. The reaction mixture was stirred at room temperature overnight.
The reaction was quenched with water and extracted with ethyl
acetate (4×). The combined organic layers were dried with MgSO4,
and the solvent was removed under reduced pressure. Purification by
flash column chromatography (CH2Cl2/MeOH) yielded the title
compound 14; 110 mg, 0.259 mmol, 62% of a colorless solid. Rf (10%
MeOH/CH2Cl2) 0.59. ESI: (calculated) [M + H+] 430.11 g/mol,
(found) [M + H+] 430.09 g/mol. HPLC: RT = 12.4 min (254 nm,
100%). 1H NMR (600 MHz, CDCl3) δ = 7.64 (dd, 3J = 8.44 Hz, 4J =
1.79 Hz, 1H), 7.53 (s, 1H), 7.37 (s, 1H), 7.36 (d, 3J = 5.57 Hz, 1H),
1
3
g/mol. H NMR (500 MHz, CDCl3) δ = 7.63 (t, J = 6.00 Hz, 1H),
7.56 (d, 4J = 1.91 Hz, 1H), 7.47 (dd, 3J = 8.50 Hz, 4J = 1.91 Hz, 1H),
7.45 (d, 4J = 1.70 Hz, 1H), 7.32 (d, 3J = 8.17 Hz, 1H), 7.17 (dd, 3J =
8.17 Hz, 4J = 1.70 Hz, 1H), 7.12 (s, 1H), 6.86 (d, 3J = 8.50 Hz, 1H),
4.45 (d, 3J = 6.00 Hz, 2H), 4.21 (t, 3J = 7.24 Hz, 2H), 4.16−4.12 (m,
2H), 3.86−3.82 (m, 2H), 3.79−3.60 (m, 6H), 3.57 (s, 2H), 3.30 (t, 3J
= 7.48 Hz, 2H), 2.83−2.75 (m, 2H), 2.48 (t, 3J = 6.42 Hz, 2H), 1.42
(s, 9H) ppm. Spectrum contains CH2Cl2. 13C NMR (125.8 MHz,
CDCl3): δ = 171.1, 170.9, 157.5, 152.3, 139.7, 136.1, 132.3, 131.3,
130.9, 130.4, 129.1, 128.4, 126.1, 126.01, 119.7, 112.5, 110.6, 80.9,
70.8, 70.4, 69.6, 68.1, 67.0, 53.6 (CH2Cl2), 47.6, 42.2, 38.8, 36.36,
28.2, 25.8, 23.6 ppm.
Synthesis of tert-Butyl 3-(2-(2-(2-(2-((2-(3,4-Dichlorophenyl)-
acetamido)methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-a]imidazol-2-yl)-
phenoxy)ethoxy)ethoxy)ethoxy)propanoate (16c). The reaction was
carried out as described in General Procedure B using tert-butyl 3-(2-
(2-(2-hydroxyethoxy)ethoxy)ethoxy)propanoate as the commercial
available starting material, obtaining the product as a TFA salt with an
unknown stoichiometry as a colorless oil (43 mg). MALDI:
(calculated) [M + H ] 676.26 g/mol, (found) [M + H ] 676.25
3
3
7.11 (dd, J = 8.20 Hz, 4J = 1.51 Hz, 1H), 7.01 (s, 1H), 6.23 (t, J =
4.60 Hz, 1H), 4.42 (d, 3J = 5.60 Hz, 2H), 3.99 (t, 3J = 7.14 Hz, 2H),
3.76 (s, 3H), 7.49 (s, 2H), 2.90 (t, 3J = 7.46 Hz, 2H), 2.60 (quin, 3J =
7.46, 2H). 13C NMR (125.8 MHz, CDCl3) δ = 169.6, 156.6, 154.4,
145.0, 135.7, 132.6, 131.4, 131.2, 130.6, 129.0, 126.7, 126.1, 126.0,
125.2, 110.6, 109.7, 55.5, 45.3, 42.7, 39.7, 26.1, 23.2 ppm.
1
3
g/mol. H NMR (500 MHz, CDCl3) δ = 7.89 (t, J = 6.08 Hz, 1H),
7.51 (d, 4J = 2.10 Hz, 1H), 7.45 (d, 4J = 1.99 Hz, 1H), 7.38 (dd, 3J =
8.51 Hz, 4J = 2.10 Hz, 1H), 7.30 (d, 3J = 8.19 Hz, 1H), 7.17 (dd, 3J =
8.19 Hz, 4J = 1.99 Hz, 1H), 7.14 (s, 1H), 6.78 (d, 3J = 8.51 Hz, 1H),
4.41 (d, 3J = 6.08 Hz, 2H), 4.14 (t, 3J = 7.32 Hz, 2H), 4.12−4.09 (m,
2H), 3.84−3.81 (m, 2H), 3.72−3.53 (m, 12H), 3.18 (t, 3J = 7.66 Hz,
Synthesis of 2-(3,4-Dichlorophenyl)-N-(5-(6,7-dihydro-5H-
pyrrolo[1,2-a]imidazol-2-yl)-2-hydroxybenzyl) Acetamide (15).
First, 1.22 mL (1.22 mmol, 5.0 equiv) of a solution of 1 M BBr3 in
dichloromethane was added to a solution of 105 mg (0.244 mmol, 1.0
equiv) of the protected phenol 14 in 15 mL of dichloromethane at
−78 °C via a syringe. After 30 min, the reaction mixture was allowed
to warm to rt and turned orange while stirring for another 21 h. The
reaction was quenched by adding 6.5 mL of an aqueous solution of 1
M NaOH and stirred for 4 h. The organic layer was separated, and the
remaining aqueous layer was extracted with dichloromethane (2×).
The combined organic layers were dried with MgSO4, and the solvent
was removed under reduced pressure to give 101 mg, 0.242 mmol,
99% of a colorless solid without further purification. Rf (10% MeOH/
CH2Cl2) 0.41. ESI: (calculated) [M + H+] 416.10 g/mol, (found) [M
+ H+] 416.09 g/mol. 1H NMR (500 MHz, DMSO) δ = 9.45 (s, 1H),
3
2H), 2.75−2.67 (m, 2H), 2.45 (t, J = 6.46 Hz, 2H), 1.41 (s, 9H)
ppm. 13C NMR (125.8 MHz, CDCl3) δ = 171.0, 171.0, 157.3, 152.0,
139.1, 136.2, 132.2, 131.2, 130.7, 130.4, 129.1, 128.3, 125.8, 119.7,
112.2, 111.0, 80.8, 70.8, 70.5, 70.5, 70.4, 69.6, 68.1, 67.0, 47.6, 42.1,
38.7, 36.3, 28.2, 25.7, 23.4 ppm.
Synthesis of tert-Butyl 1-(2-((2-(3,4-Dichlorophenyl)acetamido)-
methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-a]imidazol-2-yl)phenoxy)-
3,6,9,12-tetraoxapentadecan-15-oate (16d). The reaction was
carried out as described in General Procedure B using tert-butyl 1-
hydroxy-3,6,9,12-tetraoxapentadecan-15-oate as the commercial avail-
able starting material, obtaining the product as a TFA salt with an
unknown stoichiometry as a colorless oil (44 mg). MALDI:
(calculated) [M + H] 720.28 g/mol, (found) [M + H] 720.33
3
8.50 (t, J = 5.70 Hz, 1H), 7.58−7.55 (m, 2H), 7.42−7.39 (m, 2H),
7.31 (dd, 3J = 8.31 Hz, 4J = 1.85 Hz, 1H), 7.15 (s, 1H), 6.77−6.74 (m,
g/mol; H NMR (500 MHz, CDCl3) δ = 7.93 (t, J = 6.03 Hz, 1H),
1
3
3
1H), 4.23−4.20 (m, 2H), 3.94 (t, J = 7.01 Hz, 2H), 3.54 (s, 2H),
7.47 (d, 4J = 2.19 Hz, 1H), 7.41 (d, 4J = 2.02 Hz, 1H), 7.39 (dd, 3J =
U
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
8.52 Hz, 4J = 2.19 Hz, 1H), 7.30 (d, 3J = 8.27 Hz, 1H), 7.19 (s, 1H),
7.13 (dd, 3J = 8.27 Hz, 4J = 2.02 Hz, 1H), 6.79 (d, 3J = 8.52 Hz, 1H),
4.41 (d, 3J = 6.03 Hz, 2H), 4.18 (t, 3J = 7.31 Hz, 2H), 4.13−4.08 (m,
2H), 3.85−3.81 (m, 2H), 3.76−3.52 (m, 16H), 3.20 (t, 3J = 7.53 Hz,
2H ] 945.67 g/mol. HRMS: (calculated) [M + Na ] 966.3153 g/
mol, (found) [M + Na ] 966.3156 g/mol. HPLC: Rt = 12.3 min (254
1
nm, 100%). H NMR (500 MHz, DMSO-d6) δ = 8.97 (s, 1H), 8.56
(t, 3J = 5.70 Hz, 1H), 8.42 (t, 3J = 5.85 Hz, 1H), 7.95 (d, 3J = 9.40 Hz,
1H), 7.58 (d, 2J = 2.11 Hz, 1H), 7.56 (d, 3J = 8.33 Hz, 1H), 7.53 (dd,
3J = 8.54 Hz, 4J = 2.10 Hz, 1H), 7.43 (d, 4J = 2.10 Hz, 1H), 7.42 (d, 3J
= 8.40 Hz, 2H), 7.38 (d, 3J = 8.40 Hz, 2H), 7.32 (dd, 3J = 8.33 Hz, 4J
3
2H), 2.79−2.71 (m, 2H), 2.46 (t, J = 6.45 Hz, 2H), 1.41 (s, 9H)
ppm. 13C NMR (125.8 MHz, CDCl3) δ = 171.6, 171.1, 157.5, 152.0,
139.0, 135.8, 132.3, 131.2, 131.0, 130.5, 129.1, 127.9, 126.2, 126.0,
119.5, 112.4, 111.1, 80.8, 70.7, 70.6, 70.5, 70.4, 70.4, 70.3, 69.5, 68.1,
66.9, 47.7, 41.9, 39.1, 36.3, 28.1, 25.7, 23.4 ppm.
Synthesis of tert-Butyl 1-(2-((2-(3,4-Dichlorophenyl)acetamido)-
methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-a]imidazol-2-yl)phenoxy)-
3,6,9,12,15-pentaoxaoctadecan-18-oate (16e). The reaction was
carried out as described in General Procedure B using tert-butyl 1-
hydroxy-3,6,9,12,15-pentaoxaoctadecan-18-oate as the commercial
available starting material, obtaining the product as a TFA salt with
an unknown stoichiometry as a colorless oil (39 mg). MALDI:
(calculated) [M + H ] 764.31 g/mol, (found) [M + H ] 764.36 g/
3
= 2.11 Hz, 1H), 7.25 (s, 1H, H-3e), 6.94 (d, J = 8.54 Hz, 1H), 5.14
(bs, 1H), 4.56 (d, 3J = 9.40 Hz, 1H), 4.46−4.39 (m, 2H), 4.35 (br, s,
1H), 4.26 (d, 3J = 5.85 Hz, 2H), 4.22 (dd, 2J = 15.86 Hz, 3J = 5.70 Hz,
1H), 4.09 Hz, (t, 3J = 4.64 Hz, 2H), 3.98 (t, 3J = 7.16 Hz, 2H), 3.75−
3.61 (m, 6H), 3.56 (s, 2H), 2.78 (t, 3J = 7.04 Hz, 2H), 2.62−2.55 (m,
1H), 2.50 (m, 2H), 2.44 (s, 3H), 2.42−2.36 (m, 1H), 2.07−2.01 (m,
1H), 1.94−1.87 (m, 1H), 0.92 (s, 9H) ppm. 13C NMR (126 MHz,
DMSO) δ = 171.9, 169.9, 169.5, 169.3, 154.4, 154.0, 151.4, 147.7,
144.6, 139.5, 137.7, 131.1, 131.0, 130.7, 130.3, 129.6, 129.5, 129.0,
128.8, 128.6, 127.8, 127.4, 126.8, 123.6, 111.9, 109.7, 68.9, 68.6, 67.7,
67.2, 58.7, 56.3, 56.3, 44.3, 41.6, 41.2, 37.9, 37.5, 35.7, 35.3, 26.3,
25.6, 22.5, 15.9 ppm.
1
3
mol. H NMR (500 MHz, CDCl3) δ = 7.92 (t, J = 6.09 Hz, 1H),
4
7.53−7.49 (m, 1H), 7.44 (d, J = 1.95 Hz, 1H), 7.42−7.37 (m, 1H),
3
7.29 (d, J = 8.24 Hz, 1H), 7.18−7.15 (m, 2H), 6.81−6.77 (m, 1H),
4.40 (d, 3J = 6.09 Hz, 2H), 4.14 (t, 3J = 7.72 Hz, 2H), 4.12−4.08 (m,
2H), 3.84−3.81 (m, 2H), 3.75−3.53 (m, 20H), 3.21−3.15 (m, 2H),
Synthesis of (2S,4R)-1-((S)-2-(3-(2-(2-(2-((2-(3,4-Dichlorophenyl)-
acetamido)methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-a]imidazol-2-yl)-
phenoxy)ethoxy)ethoxy)propanamido)-3,3-dimethylbutanoyl)-4-
hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxa-
mide (17b). The reaction was carried out as described in General
Procedure B using intermediate 16b, yielding in 30 mg, 30 μmol, 48%
of a white solid. MALDI: (calculated) [M + 2H ] 989.36 g/mol,
(found) [M + 2H ] 989.89 g/mol. HRMS: (calculated) [M + Na ]
1010.3415 g/mol, (found) [M + Na ] 1010.3442 g/mol. HPLC: Rt =
12.3 min (254 nm, 100%). 1H NMR (500 MHz, DMSO-d6) δ = 8.97
(s, 1H), 8.56 (t, 3J = 5.82 Hz, 1H), 8.41 (t, 3J = 5.64 Hz, 1H), 7.91 (d,
3
2.74−2.67 (m, 2H), 2.46 (t, J = 6.46 Hz, 2H), 1.43−1.41 (m, 9H)
ppm. 13C NMR (125.8 MHz, CDCl3) δ = 171.1, 171.0, 157.3, 152.0,
139.1, 136.2, 132.1, 131.2, 130.7, 130.4, 129.1, 128.3, 125.8, 125.8,
119.7, 112.2, 110.9, 80.7, 70.8, 70.7, 70.7, 70.6, 70.5, 70.5, 70.5, 70.3,
69.5, 68.1, 66.9, 47.6, 42.0, 38.7, 36.3, 28.2, 25.7, 23.4 ppm.
Synthesis of tert-Butyl 1-(2-((2-(3,4-Dichlorophenyl)acetamido)-
methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-a]imidazol-2-yl)phenoxy)-
3,6,9,12,15,18-hexaoxahenicosan-21-oate (16f). The reaction was
carried out as described in General Procedure B using tert-butyl 1-
hydroxy-3,6,9,12,15,18-hexaoxahenicosan-21-oate as the commercial
available starting material, obtaining the product as a TFA salt with an
unknown stoichiometry as a colorless oil (36 mg). MALDI:
(calculated) [M + H ] 808.34 g/mol, (found) [M + H ] 808.39
4
3
3J = 9.38 Hz, 1H), 7.58 (d, J = 2.04 Hz, 1H), 7.57 (d, J = 8.31 Hz,
1H), 7.54 (dd, 3J = 8.48 Hz, 4J = 2.25 Hz, 1H), 7.43 (d, 4J = 2.25 Hz,
1H), 7.42 (d, 3J = 8.37 Hz, 2H), 7.38 (d, 3J = 8.37 Hz, 2H), 7.32 (dd,
3J = 8.31 Hz, J = 2.04 Hz, 1H), 7.23 (s, 1H), 6.94 (d, J = 8.48 Hz,
1H), 5.14 (br, s, 1H), 4.55 (d, 3J = 9.38 Hz, 1H), 4.46−4.40 (m, 2H),
4.35 (bs, 1H), 4.26 (d, 3J = 5.82 Hz, 2H), 4.22 (dd, 2J = 15.89 Hz, 3J
= 5.64 Hz, 1H), 4.09 Hz, (t, 3J = 4.56 Hz, 2H), 3.97 (t, 3J = 7.02 Hz,
4
3
1
3
g/mol. H NMR (500 MHz, CDCl3) δ = 7.91 (t, J = 5.71 Hz, 1H),
4
7.51−7.48 (m, 1H), 7.43 (d, J = 1.86 Hz, 1H), 7.42−7.38 (m, 1H),
3
4
7.32−7.28 (m, 1H), 7.17 (s, 1H), 7.15 (dd, (m, J = 8.23 Hz, J =
3
3
3
1.86 Hz, 1H)), 6.82−6.77 (m, 1H), 4.41 (d, J = 5.71 Hz, 2H), 4.16
2H), 3.72 (t, J = 4.56 Hz, 2H), 3.69−3.46 (m, 10H), 2.78 (t, J =
6.62 Hz, 2H), 2.62−2.55 (m, 1H), 2.50 (m, 2H), 2.44 (s, 3H), 2.40−
2.32 (m, 1H), 2.06−2.00 (m, 1H), 1.94−1.87 (m, 1H), 0.93 (s, 9H)
ppm. 13C NMR (126 MHz, DMSO) δ = 171.9, 169.9, 169.5, 169.3,
154.4, 154.0, 151.4, 147.7, 144.7, 139.5, 137.7, 131.14, 131.0, 130.7,
130.3, 129.6, 129.5, 129.0, 128.6, 127.9, 127.4, 126.8, 123.6, 111.9,
109.7, 69.9, 69.5, 69.0, 68.8, 67.7, 66.9, 59.7, 58.7, 56.3, 56.3, 44.3,
41.6, 41.2, 37.9, 37.5, 35.6, 35.3, 26.3, 25.6, 22.4, 15.9 ppm.
(t, 3J = 6.88 Hz, 2H), 4.13−4.08 (m, 2H), 3.84−3.81 (m, 2H), 3.75−
3
3.53 (m, 24H), 3.23−3.15 (m, 2H), 2.7−2.69 (m, 2H), 2.47 (t, J =
6.70 Hz, 2H), 1.44−1.38 (m, 9H) ppm. 13C NMR (125.8 MHz,
CDCl3) δ = 171.2, 171.1, 157.4, 152.0, 139.1, 136.1, 132.2, 131.2,
130.8, 130.4, 129.1, 128.2, 126.0, 125.9, 119.6, 112.3, 111.0, 80.7,
70.7, 70.7, 70.7, 70.7, 70.6, 70.5, 70.5, 70.4, 70.4, 70.3, 69.5, 68.1,
66.9, 47.6, 42.0, 38.8, 36.3, 28.2, 25.7, 23.5 ppm.
Synthesis of tert-Butyl 1-(2-((2-(3,4-Dichlorophenyl)acetamido)-
methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-a]imidazol-2-yl)phenoxy)-
3,6,9,12,15,18,21-heptaoxatetracosan-24-oate (16g). The reaction
was carried out as described in General Procedure B using tert-butyl
1-hydroxy-3,6,9,12,15,18,21-heptaoxatetracosan-24-oate as the com-
mercial available starting material, obtaining the product as a TFA salt
with an unknown stoichiometry as a colorless oil (59 mg). MALDI:
(calculated) [M + H ] 852.36 g/mol, (found) [M + H ] 852.42 g/
Synthesis of (2S,4R)-1-((S)-14-(tert-Butyl)-1-(2-((2-(3,4-
dichlorophenyl)acetamido)methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-
a]imidazol-2-yl)phenoxy)-12-oxo-3,6,9-trioxa-13-azapentadecan-
15-oyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-
carboxamide (17c). The reaction was carried out as described in
General Procedure B using intermediate 16c, yielding in 24 mg, 23.4
μmol, 52% of a white solid. MALDI: (calculated) [M + 2H ] 1033.40
g/mol, (found) [M + 2H ] 1033.98 g/mol. HRMS: (calculated) [M
+ Na ] 1054.3677 g/mol, (found) [M + Na ] 1036.3689 g/mol.
HPLC: Rt = 12.4 min (254 nm, 100%). 1H NMR (500 MHz, DMSO-
d6) δ = 8.97 (s, 1H), 8.57 (t, 3J = 5.60 Hz, 1H), 8.42 (t, 3J = 5.80 Hz,
1H), 7.90 (d, 3J = 9.42 Hz, 1H), 7.58 (d, 4J = 2.08, 1H), 7.57 (d, 3J =
8.33 Hz, 1H), 7.54 (dd, 3J = 8.48 Hz, 4J = 2.20 Hz, 1H), 7.43 (d, 4J =
2.20 Hz, 1H), 7.41 (d, 3J = 8.39 Hz, 2H), 7.38 (d, 3J = 8.39 Hz, 2H),
7.32 (dd, 3J = 8.33 Hz, 4J = 2.08 Hz, 1H), 7.24 (s, 1H), 6.95 (d, 3J =
8.48 Hz, 1H), 5.15 (br, s, 1H), 4.55 (d, 3J = 9.42 Hz, 1H), 4.46−4.40
1
mol. H NMR (500 MHz, CDCl3) δ = 7.98−7.89 (m, 1H), 7.50−
7.46 (m, 1H), 7.43−7.41 (m, 1H), 7.40−7.36 (m, 1H), 7.30−7.27
(m, 1H), 7.17 (s, 1H), 7.16−7.12 (m, 1H), 6.80−6.76 (m, 1H), 4.40
(d, 3J = 5.38 Hz, 2H), 4.17−4.12 (m, 2H), 4.11−4.07 (m, 2H), 3.83−
3.79 (m, 2H), 3.74−3.51 (m, 28H), 3.21−3.14 (m, 2H), 2.75−2.67
(m, 2H), 2.48−2.44 (m 2H), 1.42−1.40 (m, 9H) ppm. 13C NMR
(125.8 MHz, CDCl3): δ = 171.1, 171.0, 157.4, 152.0, 139.0, 136.1,
132.1, 131.2, 130.7, 130.4, 129.1, 128.2, 125.9, 125.8, 119.6, 112.2,
111.0, 80.7, 70.7, 70.7, 70.7, 70.6, 70.5, 70.5, 70.5, 70.5, 70.5, 70.4,
70.4, 70.3, 69.5, 68.0, 66.9, 47.6, 42.0, 38.8, 36.3, 28.1, 25.6, 23.4 ppm.
Synthesis of (2S,4R)-1-((S)-2-(3-(2-(2-((2-(3,4-Dichlorophenyl)-
acetamido)methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-a]imidazol-2-yl)-
phenoxy)ethoxy)propanamido)-3,3-dimethylbutanoyl)-4-hydroxy-
N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide
(17a). The reaction was carried out as described in General Procedure
B using intermediate 16a, yielding in 17 mg, 18 μmol, 40% of a white
solid. MALDI: (calculated) [M + 2H ] 945.34 g/mol, (found) [M +
3
2
(m, 2H), 4.35 (br, s, 1H), 4.26 (d, J = 5.60 Hz, 2H), 4.22 (dd, J =
3
3
15.99 Hz, J = 5.80 Hz, 1H), 4.11−4.08 Hz, (m, 2H), 3.97 (t, J =
6.93 Hz, 2H), 3.74−3.70 (m, 2H), 3.69−3.42 (m, 14H), 2.77 (t, 3J =
6.93 Hz, 2H), 2.57−2.53 (m, 1H), 2.50 (m, 2H), 2.44 (s, 3H), 2.38−
2.30 (m, 1H), 2.07−2.01 (m, 1H), 1.94−1.87 (m, 1H), 0.93 (s, 9H)
ppm. 13C NMR (126 MHz, DMSO) δ = 171.9, 169.9, 169.5, 169.3,
154.5, 154.0, 151.4, 147.7, 144.6, 139.5, 137.7, 131.1, 131.0, 130.7,
130.3, 129.6, 129.5, 129.1, 128.8, 128.6, 127.8, 127.4, 126.8, 123.6,
V
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
112.0, 109.8, 70.0, 69.8, 69.72, 69.46, 69.0, 68.9, 67.8, 66.9, 58.7, 56.3,
56.3, 44.3, 41.6, 41.2, 37.9, 37.6, 35.7, 35.3, 26.3, 25.6, 22.5, 15.9 ppm.
Synthesis of (2S,4R)-1-((S)-17-(tert-Butyl)-1-(2-((2-(3,4-
dichlorophenyl)acetamido)methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-
a]imidazol-2-yl)phenoxy)-15-oxo-3,6,9,12-tetraoxa-16-azaoctade-
can-18-oyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)-
pyrrolidine-2-carboxamide (17d). The reaction was carried out as
described in General Procedure B using intermediate 16d, yielding in
6.9 mg, 6.4 μmol, 12% of a yellow oil. MALDI: (calculated) [M +
2H ] 1076.41 g/mol, (found) [M + 2H ] 1076.10 g/mol. HRMS:
(calculated) [M + Na ] 1098.3939 g/mol, (found) [M + Na ]
Hz, 2H), 3.70−3.42 (m, 26H), 3.18 (t, 3J = 7.58 Hz, 2H), 2.74−2.64
(m, 2H), 2.58−2.50 (m, 1H), 2.44 (s, 3H), 2.39−2.30 (m, 1H),
2.06−1.99 (m, 1H), 1.95−1.86 (m, 1H), 0.93 (s, 9H) ppm. 13C NMR
(126 MHz, DMSO) δ = 171.9, 169.9, 169.5, 169.2, 154.5, 154.0,
151.4, 147.7, 139.5, 137.7, 131.1, 131.0, 130.7, 130.3, 129.6, 129.5,
129.0, 128.8, 128.6, 128.0, 127.4, 126.8, 123.7, 123.6, 112.0, 109.8,
70.0, 69.8, 69.7, 69.7, 69.4, 69.0, 68.8, 67.8, 66.9, 58.7, 56.3, 44.4,
41.6, 41.2, 37.9, 37.5, 35.6, 35.3, 26.3, 25.6, 22.5, 15.9 ppm.
Synthesis of (2S,4R)-1-((S)-26-(tert-Butyl)-1-(2-((2-(3,4-
dichlorophenyl)acetamido)methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-
a]imidazol-2-yl)phenoxy)-24-oxo-3,6,9,12,15,18,21-heptaoxa-25-
azaheptacosan-27-oyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)-
benzyl)pyrrolidine-2-carboxamide (17g). The reaction was carried
out as described in General Procedure B using intermediate 16g,
yielding in 18 mg, 15 μmol, 36% of a yellow oil. MALDI: (calculated)
[M + 3H ] 1210.50 g/mol, (found) [M + 3H ] 1210.16 g/mol.
HRMS: (calculated) [M + Na ] 1230.4726 g/mol, (found) [M +
1
1098.3954 g/mol. HPLC: Rt = 12.4 min (254 nm, 100%). H NMR
3
(500 MHz, DMSO-d6) δ = 8.97 (s, 1H), 8.56 (t, J = 5.55 Hz, 1H),
8.40 (t, 3J = 5.76 Hz, 1H), 7.90 (d, 3J = 9.38 Hz, 1H), 7.58−7.55 (m,
2H), 7.54 (dd, 3J = 8.48 Hz, 4J = 2.07 Hz, 1H), 7.43 (d, 4J = 2.07 Hz,
1H), 7.42 (d, 3J = 8.31 Hz, 2H), 7.38 (d, 3J = 8.31 Hz, 2H), 7.32 (dd,
4
3
3J = 8.17 Hz, J = 1.93 Hz, 1H), 7.24 (s, 1H), 6.95 (d, J = 8.48 Hz,
1H), 5.13 (br, s, 1H), 4.55 (d, 3J = 9.38 Hz, 1H), 4.46−4.39 (m, 2H),
4.35 (br, s, 1H), 4.26 (d, 3J = 5.55 Hz, 2H), 4.22 (dd, 2J = 15.87 Hz,
3J = 5.76 Hz, 1H), 4.12−4.08 Hz, (m, 2H), 3.97 (t, 3J = 7.02 Hz, 2H),
1
Na ] 1230.4747 g/mol. HPLC: Rt = 12.4 min (254 nm, 100%). H
NMR (400 MHz, DMSO-d6, water supp.) δ = 8.98 (s, 1H), 8.56 (t, 3J
= 6.03 Hz, 1H), 8.39 (t, 3J = 5.59 Hz, 1H), 7.90 (d, 3J = 9.34 Hz, 1H),
7.82 (s, 1H), 7.59 (dd, 3J = 8.50 Hz, 4J = 2.15 Hz, 1H), 7.57−7.54 (m,
2H), 7.45 (d, 4J = 1.83 Hz, 1H), 7.42 (d, 3J = 8.15 Hz, 2H), 7.38 (d,
3J = 8.29 Hz, 2H), 7.28 (dd, 3J = 8.18 Hz, 4J = 1.89 Hz, 1H), 7.15 (d,
3.75−3.71 (m, 2H), 3.69−3.42 (m, 18H), 2.76 (t, 3J = 7.29 Hz, 2H),
2.56−2.50 (m, 1H), 2.50 (m, 2H), 2.44 (s, 3H), 2.37−2.30 (m, 1H),
2.07−2.00 (m, 1H), 1.94−1.87 (m, 1H), 0.93 (s, 9H) ppm. 13C NMR
(126 MHz, DMSO) δ = 171.9, 169.9, 169.5, 169.3, 154.5, 154.0,
151.4, 147.7, 144.6, 139.5, 137.7, 131.1, 131.0, 130.7, 130.3, 129.6,
129.5, 129.0, 128.8, 128.6, 127.8, 127.4, 126.8, 123.6, 112.0, 109.8,
70.0, 69.8, 69.7, 6978, 69.45, 69.0, 68.8, 67.8, 66.9, 58.7, 56.3, 56.3,
44.3, 41.6, 41.2, 37.9, 37.6, 35.6, 35.3, 26.3, 25.6, 22.5, 15.9 ppm.
Synthesis of (2S,4R)-1-((S)-20-(tert-Butyl)-1-(2-((2-(3,4-
dichlorophenyl)acetamido)methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-
a]imidazol-2-yl)phenoxy)-18-oxo-3,6,9,12,15-pentaoxa-19-azahe-
nicosan-21-oyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)-
pyrrolidine-2-carboxamide (17e). The reaction was carried out as
described in General Procedure B using intermediate 16e, yielding in
17 mg, 15.2 μmol, 36% of a yellow oil. MALDI: (calculated) [M +
3H ] 1122.45 g/mol, (found) [M + 3H ] 1122.14 g/mol. HRMS:
(calculated) [M + Na ] 1142.4202 g/mol, (found) [M + Na ]
3
3J = 8.63 Hz, 1H), 4.55 (d, J = 9.15 Hz, 1H), 4.47−4.39 (m, 2H),
3
4.38−4.33 (m, 1H), 4.28 (d, J = 5.38 Hz, 2H), 4.26−4.20 (m, 3H),
4.18 (t, 3J = 4.71 Hz, 2H), 3.76 (t, 3J = 4.46 Hz, 2H), 3.73−3.43 (m,
30H), 3.18 (t, 3J = 7.78 Hz, 2H), 2.73−2.64 (m, 2H), 2.58−2.50 (m,
1H), 2.44 (s, 3H), 2.39−2.30 (m, 1H), 2.08−2.00 (m, 1H), 1.95−
1.86 (m, 1H), 0.93 (s, 9H) ppm. 13C NMR (126 MHz, DMSO) δ =
171.9, 169.9, 169.5, 169.3, 154.5, 154.02, 151.4, 147.7, 144.6, 139.5,
137.7, 131.1, 131.0, 130.7, 130.3, 129.6, 129.5, 129.0, 128.6, 127.9,
127.4, 126.8, 123.6, 123.6, 112.0, 109.8, 70.0, 69.8, 69.7, 69.7, 69.5,
69.0, 68.9, 67.8, 66.9, 58.7, 56.3, 56.3, 44.3, 41.6, 41.2, 37.9, 37.6,
35.7, 35.3, 26.3, 25.6, 22.5, 15.9 ppm.
Synthesis of (2S,4S)-1-((S)-2-(3-(2-(2-(2-((2-(3,4-Dichlorophenyl)-
acetamido)methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-a]imidazol-2-yl)-
phenoxy)ethoxy)ethoxy)propanamido)-3,3-dimethylbutanoyl)-4-
hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxa-
mide (21). The reaction was carried out as described in General
Procedure B, yielding in 17 mg, 17.2 μmol, 39% of a yellow solid.
MALDI: (calculated) [M + H+] 988.36 g/mol, (found) [M + H+]
988.31 g/mol. HRMS: (calculated) [M + H+] 988.3596 g/mol,
(found) [M + H+] 988.3242 g/mol. HPLC: Rt = 11.8 min (254 nm,
1
1142.4229 g/mol. HPLC: Rt = 12.4 min (254 nm, 100%). H NMR
3
(500 MHz, DMSO-d6) δ = 8.98 (s, 1H), 8.56 (t, J = 5.98 Hz, 1H),
3
3
8.40 (t, J = 5.68 Hz, 1H), 7.90 (d, J = 9.41 Hz, 1H), 7.82 (s, 1H),
3
4
3
7.59 (dd, 1H, J = 8.55, J = 2.05, 1H), 7.56 (d, J = 8.00 Hz, 1H),
4
3
7.55 (s, 1H), 7.45 (d, J = 2.05 Hz, 1H), 7.42 (d, J = 8.32 Hz, 2H),
7.38 (d, 3J = 8.32 Hz, 2H), 7.28 (dd, 3J = 8.00 Hz, 4J = 1.95 Hz, 1H),
7.15 (d, 3J = 8.55 Hz, 1H), 4.55 (d, 3J = 9.41 Hz, 1H), 4.46−4.40 (m,
1
100%). H NMR (500 MHz, DMSO) δ = 8.98 (s, 1H), 8.44−8.37
3
(m, 2H), 7.81 (s, 1H), 7.59 (dd, 3J = 8.5 Hz, 4J = 2.3 Hz, 1H), 7.58−
2H), 4.37−4.33 (m, 1H), 4.28 (d, J = 5.68 Hz, 2H), 4.25−4.19 (m,
3
7.54 (m, 2H), 7.46−7.39 (m, 3H), 7.38−7.34 (m, 2H), 7.28 (dd, 3J =
3H), 4.18 (t, J = 4.42 Hz, 2H), 3.78−3.74 (m, 2H), 3.70−3.41 (m,
22H), 3.18 (t, 3J = 7.53 Hz, 2H), 2.73−2.65 (m, 2H), 2.57−2.51 (m,
1H), 2.44 (s, 3H), 2.38−2.31 (m, 1H), 2.07−2.01 (m, 1H), 1.94−
1.88 (m, 1H), 0.93 (s, 9H) ppm. 13C NMR (126 MHz, DMSO) δ =
171.9, 169.9, 169.5, 169.2, 154.5, 154.0, 151.4, 147.70, 139.5, 137.68,
131.1, 131.0, 130.7, 130.3, 129.6, 129.5, 129.0, 128.8, 128.6, 128.0,
127.41, 126.81, 123.7, 123.6, 112.0, 109.8, 70.0, 69.8, 69.7, 69.7, 69.4,
69.0, 68.8, 67.8, 66.9, 58.7, 56.3, 44.4, 41.6, 41.2, 37.9, 37.6, 35.6,
35.3, 26.3, 22.5, 15.9 ppm.
4
3
3
8.2 Hz, J = 1.9 Hz, 1H), 7.16 (d, J = 8.7 Hz, 1H), 4.54 (t, J = 7.5
Hz, 1H), 4.51−4.42 (m, 1H), 4.39−4.30 (m, 4H), 4.28−4.26 (m
3H), 4.25−4.21 (m, 3H), 4.20−4.14 (m, 3H), 3.77−3.73 (m, 2H),
3.64−3.52 (m, 8H), 3.51−3.48 (m, 2H), 3.38−3.36 (m, 1H), 3.18 (t,
3J = 7.5 Hz, 2H), 2.74−2.65 (m, 2H), 2.44 (s, 3H), 2.31−2.28 (m,
1H), 2.24−2.20 (m, 1H), 2.07−2.01 (m, 1H), 1.97−1.87 (m, 1H),
1.81−1.77 (m, 1H) ppm. 13C NMR (75 MHz, DMSO) δ = 172.2,
170.6, 169.3, 168.7, 154.4, 154.0, 151.4, 147.8, 144.7, 139.2, 137.7,
131.1, 131.0, 130.7, 130.4, 129.8, 129.5, 129.1, 128.7, 128.6, 127.9,
127.4, 126.8, 123.6, 112.0, 109.8, 82.0, 69.9, 69.7, 69.3, 69.0, 68.7,
67.8, 66.2, 58.8, 56.5, 54.7, 44.3, 41.7, 41.2, 37.5, 36.9, 34.3, 25.6,
22.5, 15.9 ppm.
Synthesis of (2S,4R)-1-((S)-23-(tert-Butyl)-1-(2-((2-(3,4-
dichlorophenyl)acetamido)methyl)-4-(6,7-dihydro-5H-pyrrolo[1,2-
a]imidazol-2-yl)phenoxy)-21-oxo-3,6,9,12,15,18-hexaoxa-22-aza-
tetracosan-24-oyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)-
pyrrolidine-2-carboxamide (17f). The reaction was carried out as
described in General Procedure B using intermediate 16f, yielding in
6.2 mg, 5.3 μmol, 27% of a yellow oil. MALDI: (calculated) [M +
3H ] 1166.48 g/mol, (found) [M + 3H ] 1166.20 g/mol. HRMS:
(calculated) [M + Na ] 1186.4464 g/mol, (found) [M + Na ]
Protein Purification. WDR5A was expressed and purified as
described elsewhere.17 Plasmids of WDR5A (aa 1-334 and aa 33-334)
were a kind gift of M. Vedadi from the SGC Toronto. Briefly, WDR5
was overexpressed in Escherichia coli BL21 using TB media. Protein
expression was induced by addition of 0.5 mM IPTG. Cells were
grown overnight at 18 °C. Next morning, the cells were harvested and
resuspended in Lysis buffer (50 mM HEPES buffer, pH 7.5, 500 mM
NaCl, 20 mM imidazole, 0.5 mM TCEP, and 5% glycerol). For
purification, the cells were lysed by sonication. After centrifugation,
the supernatant was loaded onto a Nickel−Sepharose column
equilibrated with 30 mL of lysis buffer. The column was washed
with 100 mL of lysis buffer. WDR5 was eluted by an imidazole step
1
1186.4497 g/mol. HPLC: Rt = 12.4 min (254 nm, 100%). H NMR
(400 MHz, DMSO-d6, water supp.) δ = 8.98 (s, 1H), 8.55 (t, 3J = 5.69
Hz, 1H), 8.38 (t, 3J = 5.52 Hz, 1H), 7.90 (d, 3J = 9.22 Hz, 1H), 7.82
(s, 1H), 7.61−7.53 (m, 3H), 7.44 (d, 4J = 1.64 Hz, 1H), 7.42 (d, 3J =
8.27 Hz, 2H), 7.38 (d, 3J = 8.27 Hz, 2H), 7.28 (dd, 3J = 8.18 Hz, 4J =
1.64 Hz, 1H), 7.15 (d, 3J = 8.62 Hz, 1H), 4.55 (d, 3J = 9.22 Hz, 1H),
3
4.47−4.39 (m, 2H, H-10a), 4.35 (br, s, 1H), 4.27 (d, J = 5.52 Hz,
2H), 4.26−4.20 (m, 3H), 4.18 (t, 3J = 4.19 Hz, 2H), 3.76 (t, 3J = 4.19
W
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
gradient (50, 100, 200, 300 mM). Fractions containing WDR5 were
pooled together, concentrated, and loaded onto a Superdex 200 16/
60 HiLoad gel filtration column equilibrated with a final buffer (25
mM HEPES pH 7.5, 300 mM NaCl, and 0.5 mM TCEP). The
protein was concentrated to approx. 400 μM. The buffer was kept and
used for ITC experiments.
Differential Scanning Fluorimetry. Ligand binding to protein
was detected using DSF on an MX3005P qPCR system from Agilent
Technologies as described elsewhere.37 Briefly, protein was buffered
in 25 mM HEPES (pH 7.5), 500 mM NaCl, and 0.5 mM TCEP and
diluted to a final concentration of 2 μM, and the fluorescent dye
SYPRO Orange was added at a dilution of 1:1000. Compounds were
dissolved in DMSO (10 mM) and added at a final concentration of 10
μM to 20 μL of a protein−dye mix in a 96-well plate. Real-time
melting curves were then recorded by heating the samples from 25 to
96 °C in 71 cycles (heating rate of 270 K/h, excitation/emission
filters = 492/610 nm), and the melting point, Tm, was calculated using
the Boltzmann equation.
SpeI sites. The sequence of the cloned VHL was identified as isoform
1 by sanger sequencing.
Cell-Line Generation. Lentiviral infection was used to generate
stable MV4-11WDR5‑HiBiT, MV4-11VHL, and MV4-11WDR5‑HiBiT/VHL
cells. Lentivirus was produced using plasmids psPAX2, pMD2.G,
and HiBiT-WDR5 or the HA-VHL plasmid in HEK293 cells. MV4-11
cells were infected with a filtered virus supernatant and selected after
72 h of infection for generation of MV4-11WDR5‑HiBiT and MV4-11VHL
cells. MV4-11WDR5‑HiBiT cells were used to prepare MV4-
11WDR5‑HiBiT/VHL cells.
HiBiT Assay. The HiBiT assay was performed as described
previously.35 MV4-11WDR5‑HiBiT or MV4-11WDR5‑HiBiT/VHL cells were
seeded and treated with serial dilutions of compounds for 6 or 24 h.
The Nano-Glo HiBiT Lytic Detection System (Promega) was used
for the assay. Luminescence was measured on a GloMax 96
Microplate Luminometer (Promega). DC50 was calculated using
lower concentrations (showing sigmoidal behavior) with the dose−
response (four parameters) equation.
Immunoblotting. After the treatment, cells were lysed in RIPA
lysis buffer (50 mM HEPES pH 7.9, 140 mM NaCl, 1 mM EDTA, 1%
Triton X-100, 0.1% sodium dodecyl sulfate (SDS), 0.1% sodium
deoxycholate) supplemented with protease and phosphatase inhib-
itors (Sigma) for 20 min at 4 °C head-over-tail. Supernatants were
collected after centrifugation. The bicinchoninic acid (BCA) assay
was used for protein quantification. Per sample equal amounts of
protein were separated by Bis-Tris-PAGE and transferred to
poly(vinylidene fluoride) (PVDF) membranes (Millipore). The
membranes were incubated with 5% (w/v) nonfat dry milk in TBS-
T (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1% (v/v) Tween-20)
for 1 h at room temperature for blocking and then incubated with the
primary antibody overnight at 4 °C. For visualization, horseradish
peroxidase (HRP)-labeled secondary antibodies were used and
detected using the chemiluminescent HRP substrate (Millipore) in
LAS4000 Mini (Fuji). The signal was quantified using ImageJ
(version 1.53g) or Image Studio Lite (LI-COR Biosciences, version
5.2.5). Vinculin was used as a loading control. Antibodies used in this
study were WDR5 (Santa Cruz Biotechnology; sc-393080), HA
(Santa Cruz Biotechnology; sc-805), VHL (Santa Cruz Biotechnol-
ogy; sc-135657), and vinculin (Sigma; V9131).
Isothermal Titration Calorimetry. Binding constant (Kd),
stoichiometry (n), and thermodynamic binding parameters (ΔH,
ΔS, and ΔG) of ligand−protein interactions were determined on a
nano-ITC from TA Instruments as described elsewhere.38 Briefly,
compounds were diluted to a final concentration of 10−25 μM in
buffer and placed into the sample cell. Proteins (80−120 μM) were
added using an initial injection of 3 or 4 μL, followed by 12−30
injections of 6 or 8 μL at 22 °C. Collected data were corrected by
subtraction of pure DMSO injection heats. Data were analyzed by
assuming a sigmoidal dose−response relationship (four parameters).
Errors of fits were calculated using standard deviation and a
confidence interval of 68% in GraphPad Prism.
NanoBRET. The NanoBRET assay was performed as described
previously.39,40 Briefly, full-length WDR5 was cloned in frame as the
N- or C-terminal NanoLuc-fusion pNLF1 vector using ligation-
independent in-fusion cloning (Takara Bio) and sequence-verified.
Plasmids were transfected into HEK293T cells using FuGENE HD
(Promega, E2312), and proteins were allowed to express for 20 h.
Serially diluted inhibitor and Tracer molecule 19c at a concentration
of 1 μM determined previously as the Tracer 19c KD,app were pipetted
into white 384-well plates (Greiner 781 207) using an Echo acoustic
dispenser (Labcyte). The corresponding protein-transfected cells were
added and reseeded at a density of 2 × 105 cells/mL after
trypsinization and resuspending in Opti-MEM without phenol red
(Life Technologies). The system was allowed to equilibrate for 2 h at
37 °C/5% CO2 prior to BRET measurements. To measure BRET,
NanoBRET Nano-Glo Substrate and Extracellular NanoLuc Inhibitor
(Promega, N2540) was added as per the manufacturer’s protocol, and
filtered luminescence was measured on a PHERAstar plate reader
(BMG Labtech) equipped with a luminescence filter pair (450 nm BP
filter (donor) and 610 nm LP filter (acceptor)). Competitive
displacement data were then graphed using GraphPad Prism 8
software using a normalized 3-parameter curve fit.
Cell Culture. Human MV4-11 (male) and human HL-60 (female)
cells were cultured in RPMI-1640 medium, whereas human HEK293
(female) cells were cultured in Dulbecco’s modified Eagle’s medium
(DMEM) medium at 37 °C in 5% CO2. Both media were
supplemented with 10% fetal bovine serum (FBS) and 1%
penicillin/streptomycin solution.
Cloning. WDR5-HiBiT was cloned by PCR amplification of the
vector containing full-length WDR5 using the forward primer:
CGCACCGGTATGGCGACGGAGGAGAAGAAGC and the reverse
primer: CGCGACGCGTTTAGCTAATCTTCTTGAACAGCCGC-
CAGCCGCTCACACCGGAGCTCCCGCAGTCACTCTTCCA-
CAGT. The PCR product was inserted into the pRRL-PGK vector
using AgeI/MluI restriction sites. HA-tagged VHL was cloned by PCR
amplification of cDNA from MV4-11 cells as the template (forward
primer: CGCACCGGTATGTACCCTTACGACGTGCCCGAC-
TACGCCGGGAGCTCCGGTCCCCGGAGGGCGGAGAAC and
reverse primer: GGACTAGTTCAATCTCCCATCCGTT-
GATGTG) and inserted into the pRRL-SFFV vector using AgeI/
Cycloheximide Chase Assay. The cycloheximide chase assay
was performed as described previously.35 MV4-11 cells were treated
with 50 μg/mL CHX with or without PROTACs for different time
points. The cells were harvested in RIPA buffer and probed for
immunoblotting. The intensity of the WDR5 band at 0 h was set as 1.
The mean SD from n = 2 biological experiments was plotted as
log10 values.
RT-qPCR. RT-qPCR was performed as described previously.35
Total RNA was extracted using peqGOLD TriFast (Peqlab). cDNA
synthesis was carried out, and cDNA were analyzed by qPCR on a
StepOnePlus Real-Time PCR System (Thermo Fisher Scientific)
using the SYBR Green Master Mix (Thermo Fisher Scientific). Equal
amounts of cDNA and SYBR Green Master Mix were added along
with WDR5 primers (forward: CCAGTCTCGGCCGTTCATTT and
reverse: CGTTCGGGGAGAACTTCACA). For analysis, expression
was normalized to the β2-microglobulin expression. qPCR was done
in technical triplicates.
Cell Proliferation Assay. MV4-11 or MV4-11VHL cells were
seeded at a density of 1 × 105 cells per mL and treated with
compounds. Cells were counted every third day and reseeded to the
original density of 1 × 105 cells per mL in fresh media with
compounds. The mean cumulative cell number
SEM (n = 2
biological experiments) was plotted as a log10 value over the course of
time. P-values were calculated from the cumulative cell number from
the endpoint using a two-tailed unpaired t-test assuming equal
variance against DMSO-treated cells.
Quantitative Proteomics. In total, 4 million MV4-11 cells (in 10
mL) were seeded at least in triplicates for each treatment on the
evening before the treatment. Cells were treated with 1 μM 6, 1 μM
8g, 5 μM 17b, 5 μM 14, or DMSO as a control for 9 h. After the
treatment, cells were washed twice with ice-cold phosphate-buffered
X
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
saline (PBS) supplemented with protease and phosphatase inhibitor
and lysed in SDS lysis buffer (2% SDS in 40 mM Tris-HCl, pH 7.6).
To reduce viscosity, the sample was sonicated using a sonication
water bath (10 cycles, 15 s sonication, 15 s pause on ice), boiled at 95
°C for 10 min, and trifluoroacetic acid was added to a final
concentration of 1%. To neutralize the sample (final pH 7.6−8.0),
300 mM N-methylmorpholin was added to a final concentration of
2%. The protein concentration in the cell lysate was determined using
the Pierce BCA Protein Assay Kit (ThermoScientific) according to
the protocol of the manufacturer. The bead suspension for the sp3
sample workup was prepared by mixing magnetic SeraMag-A and
SeraMag-B beads (10 μL per sample of each type; Cytiva) in a ratio of
1:1, washing them three times with ddH2O, and resuspending them in
10 μL of ddH2O per sample. A total of 200 μg per sample was mixed
with 10 μL of bead suspension. Acetonitrile (ACN) was added to a
final concentration of 70% and incubated at room temperature, 18
min, 800 rpm. After discarding the supernatant, beads were washed
twice using 200 μL of 80% ethanol. For reduction and alkylation,
beads were resuspended in 70 μL of 2 mM CaCl2 in 40 mM Tris pH
7.6. Proteins were reduced with 10 mM dithiothreitol (DTT) for 45
min at 37 °C and 800 rpm and alkylated with 55 mM
chloroacetamide (CAA) at room temperature in the dark for 30
min. Proteins were digested (1:50 trypsin/substrate weight) overnight
at 37 °C and 1000 rpm. Samples were centrifuged (5 min, 20 000 rcf)
and sonicated 3 times for 30 s, and the supernatant was collected.
Beads were washed once with 100 μL of ddH2O and sonicated 3
times for 30 s, and supernatants were combined with previous
supernatants. Samples were acidified with formic acid (FA) to a final
concentration of 1%. Peptides were desalted using tC18 RP solid-
phase extraction cartridges (Waters Corp.; wash solvent: 0.1% FA;
elution solvent: 0.1% FA in 50% acetonitrile (ACN)). Samples were
frozen in a −80 °C freezer, dried in a SpeedVac, and reconstituted in
0.1% FA, and the peptide concentration was determined using a
NanoDrop and stored at −20 °C until LC-MS2 analysis.
A microflow LC-MSMS setup with a Q Exactive HF-X mass
spectrometer (Thermo Fisher Scientific) was used as described in
detail in previous publications.41,42 Peptides of weight 50 μg dissolved
in 0.1% FA were directly injected onto the microflow LC system.
Online chromatography was performed using a commercially available
Thermo Fisher Scientific Acclaim PepMap 100 C18 LC column (2
μm particle size, 1 mm ID × 150 mm; catalog number 164711).
Column temperature was maintained at 55 °C using the integrated
column oven. Peptides were delivered at a flow rate of 50 μL/min and
separated using a two-step linear gradient (120 min) ranging from 1−
24% (105 min) and 24−35% (15 min) of LC solvent B (0.1% FA, 3%
DMSO in ACN) in LC solvent A (0.1% FA, 3% DMSO).43 The Q
Exactive HF-X was operated as follows: positive polarity; spray
voltage 4 kV; capillary temperature 320 °C; vaporizer temperature
200 °C. The flow rates of sheath gas, aux gas, and sweep gas were set
to 40, 3, and 0, respectively. TopN was set to 50. Full MS was read
out in the orbitrap, the resolution was set to 120 000, and the mass
range was set to 360−1300. The full MS AGC target value was 3E6
with a maximum IT of 100 ms, and the RF lens value was set to 40.
Peptide match was set to the preferred value, and the default charge
state was set to 2. The dynamic exclusion duration was set to 40 s, and
exclude isotopes were switched on. For readout of MS2 spectra, the
orbitrap resolution was set to 15 000 and the mass range was set to
200−2000. The isolation width was set to 1.3 m/z, the first mass was
fixed at 100 m/z, and NCE was 28. The AGC target value was set to
1E5 at a maximum IT of 22 ms.
(PSM) and 1% protein false discovery rate (FDR). LFQ-based
quantification was enabled including the match between runs option
and without normalization.
Data analysis was performed using the Perseus software suite46
(version 1.6.14.0) and Microsoft Excel on identified and quantified
protein groups as provided in the proteinGroups.txt file. Proteing-
roups.txt was filtered for contaminants and reverse hits, and median
centric normalization and log 2 transformation were performed. The
14-treated replicate 1 showed high differences from the other
conditions and was not considered for further analysis. Entries were
filtered for at least three valid values in one condition. Two-sample t-
tests were performed (S0:0.1, permutation-based FDR: 5%; number
of randomizations: 250). For principal component analysis (PCA),
the remaining missing values were replaced from normal distribution
(width 0.3, downshift: 1.8).
The mass spectrometry proteomics data and complete MaxQuant
search results have been deposited to the ProteomeXchange
Consortium (http://www.proteomexchange.org/) via the PRIDE47
partner repository with the data set identifier PXD025257.
Computational Studies on WDR5 Degraders. Structure
Preparation. Preparation of protein structures started from the
published crystal structures of WDR5 in complex with OICR-9429
(PDB: 4QL1; resolution: 1.50 Å)17 and of VHL in complex with
VH032 (PDB: 4W9H; resolution: 2.10 Å).36 The structures were
curated within the Molecular Operating Environment (MOE)
2019.0102348 using its structure preparation utility. Chain F of
structure 4W9H, containing VHL and VH032, was used, and the
termini were capped. The dimethylarsenic-cystein in position 77 was
mutated to cystein, side chains of unresolved amino acids were added
automatically, and the system was protonated (Protonate3D4)49 at
the pH of the crystallization buffer (6.3). Chain A of the WDR5
structure 4QL1 was similarly prepared; its termini were capped, and
missing side chains were added automatically. Alternate conforma-
tions with occupancies of 0.5 were resolved based on visual inspection
(conformation A was selected for residues 81, 84, 91, 154, 209, 256),
and conformers with the highest occupancies were chosen where
possible (conformation C for residue 325). The structure file
contained an unknown atom, which was removed. Also, the partially
resolved methylene-morpholino substituent of OICR-9429 was
deleted and a para-positioned methyl group added to the terminal
aromatic ring, where the amide bond to the linker in the studied
PROTACs is formed. The structure was protonated at pH 6.5. All
water molecules, ions, and other small molecules were removed from
the structures.
Protein−Protein Docking. The prepared structures of WDR5 with
the modified OICR-9429 ligand and VHL with VH032 were docked
onto each other using MOE’s Protein/Protein Docking (PPD) utility.
VHL and VH032 were defined as “receptor”, whereas WDR5 and the
modified OICR-9429 were used as “ligand”. Receptor- and ligand-
sites were defined around the small molecules. Hydrophobic patch
potentials were enabled, and antibody-specific options were turned
off. Termination criteria were set to 800 iterations and a gradient of
0.001 kcal/(mol*Å) during the final minimization. The maximum
numbers of returned poses after preplacement, placement, and
refinement were set to 100 000, 10 000, and 1000, respectively. The
obtained protein−protein complexes were evaluated based on the
score assigned by MOE and the distance between the atoms in the
modified OICR-9429 and VH032 ligands, which are linked in the final
PROTACs. Ten protein/protein complexes showed a distance under
4 Å between the two critical carbon atoms, with five being ranked in
the top 20% (ranks 52, 53, 59, 78, and 79). These five complexes were
used as receptors for a subsequent small-molecule docking.
Protein and peptide identification and quantification were
performed using MaxQuant44 (version 1.6.12.0) by searching the
MS2 data against all canonical protein sequences as annotated in the
UniProt reference database (human proteins only, downloaded
24.08.2020) using the search engine Andromeda.45 Carbamidomethy-
lated cysteine was set as a fixed modification; oxidation of methionine
and N-terminal protein acetylation were set as variable modifications.
Trypsin/P was specified as a proteolytic enzyme, and up to two
missed cleavage sites were allowed. The minimum peptide length was
set to seven, and all data were adjusted to 1% peptide-spectrum-match
Small-Molecule Docking. A protocol for small-molecule docking
was verified by redocking the modified OICR-9429 and VH032
ligands to their respective receptors. Small-molecule docking was
performed with GOLD V 5.8.1550 using the implemented scoring
function ChemPLP. For each ligand, 100 docking solutions were
generated without allowing for early termination. Default values for
the genetic algorithm were kept but with the number of operations
fixed at 100 000. Docking solutions were evaluated based on a
Y
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
rescoring with DrugscoreX651 (V0.90, CSD potentials), and RMSD
values were calculated with fconv V 1.247.52 The DSX top-ranked
pose of VH032 showed an RMSD value of 0.27 Å, and the modified
OICR-9429 ligand achieved 0.36 Å, indicating perfect reproduction of
the crystallographically observed binding modes. Degraders 8e−j
were built and minimized (MMFF94×, gradient: 0.0001 kcal/
(mol•Å)) using MOE and docked to the protein−protein complexes
(obtained by PPD as described above) as receptor structures. Fifty
docking solutions were created for each ligand−receptor pair. The
non-hydrogen atoms of VH032 and the p-tolyl-phenyl-piperazinyl
moiety of OICR-9429 were used as mild scaffold constraints during
docking (constraint weight: 1.0) with the binding site defined as the
region within 6 Å of these scaffolds.
Janik Weckesser − Structural Genomics Consortium (SGC),
Buchmann Institute for Life Sciences (BMLS), Goethe
University Frankfurt am Main, 60438 Frankfurt am Main,
̈
Germany; Institut fur Pharmazeutische Chemie, Goethe
University Frankfurt am Main, 60438 Frankfurt am Main,
Germany; orcid.org/0000-0001-5100-2776
Nicola Berner − Chair of Proteomics and Bioanalytics,
Technical University of Munich, 85354 Freising, Germany;
German Cancer Consortium (DKTK), German Cancer
Research Center (DKFZ), 69120 Heidelberg, Germany
Lena-Marie Berger − Structural Genomics Consortium
(SGC), Buchmann Institute for Life Sciences (BMLS),
Goethe University Frankfurt am Main, 60438 Frankfurt am
The small-molecule docking solutions were again evaluated based
on a rescoring with DrugscoreX as well as the RMSD values with
respect to the same scaffolds used as constraints.
Main, Germany; Institut fur Pharmazeutische Chemie,
̈
Goethe University Frankfurt am Main, 60438 Frankfurt am
Main, Germany; orcid.org/0000-0002-7835-8067
Figures of structures were created using PyMOL Molecular
̈
Graphics System, Version 2.2.3. Schrodinger, LLC.
Mathias Diebold − Institut fu
Lebensmittelchemie, University of Wu
Wurzburg, Germany; orcid.org/0000-0002-7595-3901
̈
r Pharmazie und
̈
rzburg, 97074
ASSOCIATED CONTENT
* Supporting Information
The Supporting Information is available free of charge at
https://pubs.acs.org/doi/10.1021/acs.jmedchem.1c00146.
■
̈
sı
Magdalena M. Szewczyk − Structural Genomics Consortium,
University of Toronto, Toronto, ON M5G 1L7, Canada
Dalia Barsyte-Lovejoy − Structural Genomics Consortium,
University of Toronto, Toronto, ON M5G 1L7, Canada;
Department of Pharmacology and Toxicology, University of
Toronto, Toronto, ON M5G 2M9, Canada
Thermal shift data; ITC data; BRET assay data; HiBiT
data; immunoblotting data; proteomics data; computa-
tional data; experimental details for synthesis of all
degraders, intermediates and negative controls; appendix
with spectra for all degraders, intermediates, and
negative controls (PDF)
Cheryl H. Arrowsmith − Structural Genomics Consortium,
University of Toronto, Toronto, ON M5G 1L7, Canada;
Princess Margaret Cancer Centre, University Health
Network, Toronto, ON M5G 2C1, Canada; Department of
Medical Biophysics, University of Toronto, Toronto, ON
M5G 2M9, Canada; orcid.org/0000-0002-4971-3250
Jakob Gebel − Structural Genomics Consortium (SGC),
Buchmann Institute for Life Sciences (BMLS), Goethe
University Frankfurt am Main, 60438 Frankfurt am Main,
Germany; Institute of Biophysical Chemistry and Center for
Biomolecular Magnetic Resonance and Cluster of Excellence
Macromolecular Complexes (CEF), Goethe University
Frankfurt am Main, 60438 Frankfurt am Main, Germany
Frank Löhr − Structural Genomics Consortium (SGC),
Buchmann Institute for Life Sciences (BMLS), Goethe
University Frankfurt am Main, 60438 Frankfurt am Main,
Germany; Institute of Biophysical Chemistry and Center for
Biomolecular Magnetic Resonance and Cluster of Excellence
Macromolecular Complexes (CEF), Goethe University
Frankfurt am Main, 60438 Frankfurt am Main, Germany;
orcid.org/0000-0001-6399-9497
Quantitative proteomics table (CSV)
Molecular formula strings (CSV)
AUTHOR INFORMATION
Corresponding Authors
■
Elmar Wolf − Cancer Systems Biology Group, Theodor Boveri
Institute, University of Wurzburg, 97074 Wurzburg,
̈ ̈
Germany; Email: elmar.wolf@biozentrum.uni-
wuerzburg.de
Stefan Knapp − Structural Genomics Consortium (SGC),
Buchmann Institute for Life Sciences (BMLS), Goethe
University Frankfurt am Main, 60438 Frankfurt am Main,
Germany; Institut fur Pharmazeutische Chemie, Goethe
̈
University Frankfurt am Main, 60438 Frankfurt am Main,
Germany; German Cancer Consortium (DKTK), German
Cancer Research Center (DKFZ), 69120 Heidelberg,
Germany; orcid.org/0000-0001-5995-6494;
Email: knapp@pharmchem.uni-frankfurt.de
Volker Dötsch − Structural Genomics Consortium (SGC),
Buchmann Institute for Life Sciences (BMLS), Goethe
University Frankfurt am Main, 60438 Frankfurt am Main,
Germany; Department of Medical Biophysics, University of
Toronto, Toronto, ON M5G 2M9, Canada
Authors
Anja Dölle − Structural Genomics Consortium (SGC),
Buchmann Institute for Life Sciences (BMLS), Goethe
University Frankfurt am Main, 60438 Frankfurt am Main,
̈
Germany; Institut fur Pharmazeutische Chemie, Goethe
University Frankfurt am Main, 60438 Frankfurt am Main,
Germany; orcid.org/0000-0002-1816-8982
Martin Eilers − Department of Biochemistry and Molecular
Biology, Theodor Boveri Institute, University of Wurzburg,
̈
97074 Wurzburg, Germany
̈
Stephanie Heinzlmeir − Chair of Proteomics and
Bikash Adhikari − Cancer Systems Biology Group, Theodor
Bioanalytics, Technical University of Munich, 85354 Freising,
Germany; orcid.org/0000-0002-1066-6565
Boveri Institute, University of Wurzburg, 97074 Wurzburg,
̈ ̈
Germany; orcid.org/0000-0002-9064-0356
Bernhard Kuster − Chair of Proteomics and Bioanalytics,
Technical University of Munich, 85354 Freising, Germany;
German Cancer Consortium (DKTK), German Cancer
Research Center (DKFZ), 69120 Heidelberg, Germany;
Bavarian Biomolecular Mass Spectrometry Center
Andreas Krämer − Structural Genomics Consortium (SGC),
Buchmann Institute for Life Sciences (BMLS), Goethe
University Frankfurt am Main, 60438 Frankfurt am Main,
̈
Germany; Institut fur Pharmazeutische Chemie, Goethe
University Frankfurt am Main, 60438 Frankfurt am Main,
Germany
Z
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
(BayBioMS), Technical University of Munich, 85354
Freising, Germany; orcid.org/0000-0002-9094-1677
scanning fluorimetry; HMT, histone methyltransferase; ITC,
isothermal titration calorimetry; KMT, lysine methyltransfer-
ase; MbIIIb, Myc-box IIIb; MLL, mixed-lineage leukemia;
PROTAC, proteolysis targeting chimera; RBBP5, retinoblas-
toma binding protein 5; SET, Su(var)3-9, Enhancer-of-zeste,
and Trithorax; WBM, WDR5-binding; WDR5, WD-repeat-
containing protein 5; WIN, WDR5-interacting
Christoph Sotriffer − Institut fu
Lebensmittelchemie, University of Wu
Wurzburg, Germany; orcid.org/0000-0003-4713-4068
̈
r Pharmazie und
̈
rzburg, 97074
̈
Complete contact information is available at:
https://pubs.acs.org/10.1021/acs.jmedchem.1c00146
REFERENCES
Author Contributions
■
∥∥A.D. and B.A. contributed equally to this work.
(1) Lai, W. K. M.; Pugh, B. F. Understanding Nucleosome Dynamics
and their Links to Gene Expression and DNA Replication. Nat. Rev.
Mol. Cell Biol. 2017, 18, 548−562.
Author Contributions
A.D. synthesized all OICR-9429-based compounds, all E3
ligase linkers, and negative controls. A.D. evaluated all
compounds in biophysical studies (DSF and calorimetry
assays) with the help of J.W. and J.G. B.A. performed all
cellular studies. J.W. synthesized all pyrroloimidazole-based
compounds. J.G., F.L., and V.D. contributed to the chemical
analysis of the degrader. A.K. expressed and purified the
recombinant protein. L.-M.B. performed the BRET assays for
all compounds. M.D. performed all computational modeling.
C.S. supervised computational modeling studies. M.M.S.
cloned the plasmids for the BRET assay. D.B.-L. supervised
the cloning procedure for BRET assay clones. C.H.A. and M.E.
gave critical input on the project and edited the manuscript.
S.H. and N.B. performed the proteomic study and data analysis
together with B.A. and B.K., who supervised the proteomic
study. S.K. supervised the synthesis and biophysical experi-
ments, and E.W. supervised the cell-based assays. E.W. and
S.K. designed the study. A.D., B.A., E.W., and S.K. wrote the
manuscript, which was approved by all authors.
(2) Asano, T.; Yao, Y.; Zhu, J.; Li, D.; Abbruzzese, J. L.; Reddy, S. A.
G. The PI 3-kinase/Akt Signaling Pathway is activated due to aberrant
Pten Expression and Targets Transcription Factors NF-kappaB and c-
Myc in Pancreatic Cancer Cells. Oncogene 2004, 23, 8571−8580.
(3) Darnell, J. E. Transcription Factors as Targets for Cancer
Therapy. Nat. Rev. Cancer 2002, 2, 740−749.
(4) Zheng, R.; Blobel, G. A. GATA Transcription Factors and
Cancer. Genes Cancer 2010, 1, 1178−1188.
(5) Sakuma, K.; Aoki, M.; Kannagi, R. Transcription Factors c-Myc
and CDX2 mediate E-selectin Ligand Expression in Colon Cancer
Cells undergoing EGF/bFGF-induced epithelial-mesenchymal Tran-
sition. Proc. Natl. Acad. Sci. U.S.A. 2012, 109, 7776−7781.
(6) Roth, J. A. Modulation of Oncogene and Tumor-suppressor
Gene Expression: a novel Strategy for Cancer Prevention and
Treatment. Ann. Surg. Oncol. 1994, 1, 79−86.
(7) Wang, L.-H.; Wu, C.-F.; Rajasekaran, N.; Shin, Y. K. Loss of
Tumor Suppressor Gene Function in Human Cancer: An Overview.
Cell. Physiol. Biochem. 2018, 51, 2647−2693.
(8) Bernstein, B. E.; Humphrey, E. L.; Erlich, R. L.; Schneider, R.;
Bouman, P.; Liu, J. S.; Kouzarides, T.; Schreiber, S. L. Methylation of
Histone H3 Lys 4 in coding Regions of active Genes. Proc. Natl. Acad.
Sci. U.S.A. 2002, 99, 8695−8700.
(9) Black, J. C.; van Rechem, C.; Whetstine, J. R. Histone Lysine
Methylation Dynamics: Establishment, Regulation, and biological
Impact. Mol. Cell 2012, 48, 491−507.
(10) Soares, L. M.; He, P. C.; Chun, Y.; Suh, H.; Kim, T.;
Buratowski, S. Determinants of Histone H3K4 Methylation Patterns.
Mol. Cell 2017, 68, 773−785.e6.
(11) Rao, R. C.; Dou, Y. Hijacked in Cancer: the KMT2 (MLL)
Family of Methyltransferases. Nat. Rev. Cancer 2015, 15, 334−346.
(12) Rea, S.; Eisenhaber, F.; O’Carroll, D.; Strahl, B. D.; Sun, Z. W.;
Schmid, M.; Opravil, S.; Mechtler, K.; Ponting, C. P.; Allis, C. D.;
Jenuwein, T. Regulation of Chromatin Structure by site-specific
Histone H3 Methyltransferases. Nature 2000, 406, 593−599.
(13) Sha, L.; Ayoub, A.; Cho, U.-S.; Dou, Y. Insights on the
Regulation of the MLL/SET1 Family Histone Methyltransferases.
Biochim. Biophys. Acta, Gene Regul. Mech. 2020, 1863, No. 194561.
(14) Dou, Y.; Milne, T. A.; Ruthenburg, A. J.; Lee, S.; Lee, J. W.;
Verdine, G. L.; Allis, C. D.; Roeder, R. G. Regulation of MLL1 H3K4
Methyltransferase Activity by its Core Components. Nat. Struct. Mol.
Biol. 2006, 13, 713−719.
Funding
Research was supported by the European research council
(TarMYC to E.W.), the Federal Ministry of Education and
Research (CANCER to E.W., A.D., M.E., and S.K.), the DFG
(WO 2108/1-1 and GRK 2243 to E.W.), and the Germain
Cancer Aid (MSNZ Wurzburg to E.W.). A.D., A.K., J.W., L.-
̈
M.B., M.M.S., D.B.-L., C.H.A., and S.K. are grateful for support
by the SGC, a registered charity (no. 1097737) that receives
funds from AbbVie, BayerAG, Boehringer Ingelheim, the
Canada Foundation for Innovation, Eshelman Institute for
Innovation, Genentech, Genome Canada through Ontario
Genomics Institute [OGI-196], EU/EFPIA/OICR/McGill/
KTH/Diamond, InnovativeMedicines Initiative 2 Joint Under-
taking [EUbOPEN grant 875510], Janssen, Merck KGaA,
Merck & Co, Pfizer, the Sao Paulo Research Foundation-
̃
FAPESP, Takeda, and Wellcome. A.K. and S.K. are also
grateful for support from the German translational cancer
network (DKTK) as well as the Frankfurt Cancer Institute
(FCI).
(15) Chacón Simon, S.; Wang, F.; Thomas, L. R.; Phan, J.; Zhao, B.;
Olejniczak, E. T.; Macdonald, J. D.; Shaw, J. G.; Schlund, C.; Payne,
W.; Creighton, J.; Stauffer, S. R.; Waterson, A. G.; Tansey, W. P.;
Fesik, S. W. Discovery of WD Repeat-Containing Protein 5 (WDR5)-
MYC Inhibitors Using Fragment-Based Methods and Structure-Based
Design. J. Med. Chem. 2020, 63, 4315−4333.
(16) Getlik, M.; Smil, D.; Zepeda-Velázquez, C.; Bolshan, Y.; Poda,
G.; Wu, H.; Dong, A.; Kuznetsova, E.; Marcellus, R.; Senisterra, G.;
Dombrovski, L.; Hajian, T.; Kiyota, T.; Schapira, M.; Arrowsmith, C.
H.; Brown, P. J.; Vedadi, M.; Al-Awar, R. Structure-Based
Optimization of a Small Molecule Antagonist of the Interaction
Between WD Repeat-Containing Protein 5 (WDR5) and Mixed-
Lineage Leukemia 1 (MLL1). J. Med. Chem. 2016, 59, 2478−2496.
(17) Grebien, F.; Vedadi, M.; Getlik, M.; Giambruno, R.; Grover, A.;
Avellino, R.; Skucha, A.; Vittori, S.; Kuznetsova, E.; Smil, D.; Barsyte-
Notes
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
We thank Nina Krause and Lennart Laube from the University
of Frankfurt for their synthesis of the pomalidomide linkers as
well as Achim Glaesmann and Dominic Löw from the
University of Frankfurt for their synthetic support in the lab.
We thank Masoud Vedadi for donation of WDR5 plasmids.
ABBREVIATIONS
ASH2L, absent, small, or homeotic-2 like; BRET, bio-
luminescence resonance energy transfer; DSF, differential
■
AA
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
Lovejoy, D.; Li, F.; Poda, G.; Schapira, M.; Wu, H.; Dong, A.;
Senisterra, G.; Stukalov, A.; Huber, K. V. M.; Schönegger, A.;
Marcellus, R.; Bilban, M.; Bock, C.; Brown, P. J.; Zuber, J.; Bennett, K.
L.; Al-Awar, R.; Delwel, R.; Nerlov, C.; Arrowsmith, C. H.; Superti-
Furga, G. Pharmacological Targeting of the Wdr5-MLL Interaction in
C/EBPα N-terminal Leukemia. Nat. Chem. Biol. 2015, 11, 571−578.
(18) Wang, F.; Jeon, K. O.; Salovich, J. M.; Macdonald, J. D.;
Alvarado, J.; Gogliotti, R. D.; Phan, J.; Olejniczak, E. T.; Sun, Q.;
Wang, S.; Camper, D.; Yuh, J. P.; Shaw, J. G.; Sai, J.; Rossanese, O.
W.; Tansey, W. P.; Stauffer, S. R.; Fesik, S. W. Discovery of Potent 2-
Aryl-6,7-dihydro-5 H-pyrrolo1,2- aimidazoles as WDR5-WIN-Site
Inhibitors Using Fragment-Based Methods and Structure-Based
Design. J. Med. Chem. 2018, 61, 5623−5642.
(19) Aho, E. R.; Wang, J.; Gogliotti, R. D.; Howard, G. C.; Phan, J.;
Acharya, P.; Macdonald, J. D.; Cheng, K.; Lorey, S. L.; Lu, B.; Wenzel,
S.; Foshage, A. M.; Alvarado, J.; Wang, F.; Shaw, J. G.; Zhao, B.;
Weissmiller, A. M.; Thomas, L. R.; Vakoc, C. R.; Hall, M. D.; Hiebert,
S. W.; Liu, Q.; Stauffer, S. R.; Fesik, S. W.; Tansey, W. P.
Displacement of WDR5 from Chromatin by a WIN Site Inhibitor
with Picomolar Affinity. Cell Rep. 2019, 26, 2916−2928.e13.
(20) Li, D.-D.; Chen, W.-L.; Xu, X.-L.; Jiang, F.; Wang, L.; Xie, Y.-Y.;
Zhang, X.-J.; Guo, X.-K.; You, Q.-D.; Sun, H.-P. Structure-based
Design and Synthesis of Small Molecular Inhibitors disturbing the
Interaction of MLL1-WDR5. Eur. J. Med. Chem. 2016, 118, 1−8.
(21) Li, D.-D.; Chen, W.-L.; Wang, Z.-H.; Xie, Y.-Y.; Xu, X.-L.; Jiang,
Z.-Y.; Zhang, X.-J.; You, Q.-D.; Guo, X.-K. High-affinity Small
Molecular Blockers of Mixed Lineage Leukemia 1 (MLL1)-WDR5
Interaction inhibit MLL1 Complex H3K4 Methyltransferase Activity.
Eur. J. Med. Chem. 2016, 124, 480−489.
(22) Carroll, P. A.; Freie, B. W.; Mathsyaraja, H.; Eisenman, R. N.
The MYC Transcription Factor Network: balancing Metabolism,
Proliferation and Oncogenesis. Front. Med. 2018, 12, 412−425.
(23) Thomas, L. R.; Adams, C. M.; Fesik, S. W.; Eischen, C. M.;
Tansey, W. P. Targeting MYC through WDR5. Mol. Cell. Oncol. 2020,
7, No. 1709388.
(24) Dang, C. V.; Reddy, E. P.; Shokat, K. M.; Soucek, L. Drugging
the ‘undruggable’ Cancer Targets. Nat. Rev. Cancer 2017, 17, 502−
508.
(25) Soucek, L.; Whitfield, J. R.; Sodir, N. M.; Massó-Vallés, D.;
Serrano, E.; Karnezis, A. N.; Swigart, L. B.; Evan, G. I. Inhibition of
Myc Family Proteins eradicates KRas-driven Lung Cancer in Mice.
Genes Dev. 2013, 27, 504−513.
(26) Wolf, E.; Eilers, M. Targeting MYC Proteins for Tumor
Therapy. Annu. Rev. Cancer Biol. 2020, 4, 61−75.
(27) Thomas, L. R.; Wang, Q.; Grieb, B. C.; Phan, J.; Foshage, A.
M.; Sun, Q.; Olejniczak, E. T.; Clark, T.; Dey, S.; Lorey, S.; Alicie, B.;
Howard, G. C.; Cawthon, B.; Ess, K. C.; Eischen, C. M.; Zhao, Z.;
Fesik, S. W.; Tansey, W. P. Interaction with WDR5 promotes Target
Gene Recognition and Tumorigenesis by MYC. Mol. Cell 2015, 58,
440−452.
(28) Bryan, A. F.; Wang, J.; Howard, G. C.; Guarnaccia, A. D.;
Woodley, C. M.; Aho, E. R.; Rellinger, E. J.; Matlock, B. K.; Flaherty,
D. K.; Lorey, S. L.; Chung, D. H.; Fesik, S. W.; Liu, Q.; Weissmiller,
A. M.; Tansey, W. P. WDR5 is a conserved Regulator of Protein
Synthesis Gene Expression. Nucleic Acids Res. 2020, 48, 2924−2941.
(29) Macdonald, J. D.; Chacón Simon, S.; Han, C.; Wang, F.; Shaw,
J. G.; Howes, J. E.; Sai, J.; Yuh, J. P.; Camper, D.; Alicie, B. M.;
Alvarado, J.; Nikhar, S.; Payne, W.; Aho, E. R.; Bauer, J. A.; Zhao, B.;
Phan, J.; Thomas, L. R.; Rossanese, O. W.; Tansey, W. P.; Waterson,
A. G.; Stauffer, S. R.; Fesik, S. W. Discovery and Optimization of
Salicylic Acid-Derived Sulfonamide Inhibitors of the WD Repeat-
Containing Protein 5-MYC Protein-Protein Interaction. J. Med. Chem.
2019, 62, 11232−11259.
Complex that drives a Protumorigenic Gene Expression Signature in
Neuroblastoma. Cancer Res. 2015, 75, 5143−5154.
(31) Carugo, A.; Genovese, G.; Seth, S.; Nezi, L.; Rose, J. L.; Bossi,
D.; Cicalese, A.; Shah, P. K.; Viale, A.; Pettazzoni, P. F.; Akdemir, K.
C.; Bristow, C. A.; Robinson, F. S.; Tepper, J.; Sanchez, N.; Gupta, S.;
Estecio, M. R.; Giuliani, V.; Dellino, G. I.; Riva, L.; Yao, W.; Di
Francesco, M. E.; Green, T.; D’Alesio, C.; Corti, D.; Kang, Y.; Jones,
P.; Wang, H.; Fleming, J. B.; Maitra, A.; Pelicci, P. G.; Chin, L.;
DePinho, R. A.; Lanfrancone, L.; Heffernan, T. P.; Draetta, G. F. In
Vivo Functional Platform Targeting Patient-derived Xenografts
identifies WDR5-Myc Association as a critical Determinant of
Pancreatic Cancer. Cell Rep. 2016, 16, 133−147.
(32) Suganuma, T.; Pattenden, S. G.; Workman, J. L. Diverse
Functions of WD40 Repeat Proteins in Histone Recognition. Genes
Dev. 2008, 22, 1265−1268.
(33) Patel, A.; Vought, V. E.; Dharmarajan, V.; Cosgrove, M. S. A
conserved Arginine-containing Motif crucial for the Assembly and
Enzymatic Activity of the Mixed Lineage Leukemia Protein-1 Core
Complex. J. Biol. Chem. 2008, 283, 32162−32175.
(34) Buckley, D. L.; van Molle, I.; Gareiss, P. C.; Tae, H. S.; Michel,
J.; Noblin, D. J.; Jorgensen, W. L.; Ciulli, A.; Crews, C. M. Targeting
the Von Hippel-Lindau E3 Ubiquitin Ligase Using Small Molecules to
disrupt the VHL/HIF-1α Interaction. J. Am. Chem. Soc. 2012, 134,
4465−4468.
(35) Adhikari, B.; Bozilovic, J.; Diebold, M.; Schwarz, J. D.;
Hofstetter, J.; Schröder, M.; Wanior, M.; Narain, A.; Vogt, M.;
Dudvarski Stankovic, N.; Baluapuri, A.; Schönemann, L.; Eing, L.;
Bhandare, P.; Kuster, B.; Schlosser, A.; Heinzlmeir, S.; Sotriffer, C.;
Knapp, S.; Wolf, E. PROTAC-mediated Degradation reveals a non-
catalytic Function of AURORA-A Kinase. Nat. Chem. Biol. 2020, 16,
1179−1188.
(36) Galdeano, C.; Gadd, M. S.; Soares, P.; Scaffidi, S.; van Molle, I.;
Birced, I.; Hewitt, S.; Dias, D. M.; Ciulli, A. Structure-guided Design
and Optimization of Small Molecules targeting the Protein-Protein
Interaction between the Von Hippel-Lindau (VHL) E3 Ubiquitin
Ligase and the Hypoxia Inducible Factor (HIF) Alpha Subunit with in
vitro Nanomolar Affinities. J. Med. Chem. 2014, 57, 8657−8663.
(37) Niesen, F. H.; Berglund, H.; Vedadi, M. The Use of Differential
Scanning Fluorimetry to detect Ligand Interactions that promote
Protein Stability. Nat. Protoc. 2007, 2, 2212−2221.
(38) Wiseman, T.; Williston, S.; Brandts, J. F.; Lin, L.-N. Rapid
Measurement of Binding Constants and Heats of Binding using a new
Titration Calorimeter. Anal. Biochem. 1989, 179, 131−137.
(39) Vasta, J. D.; Corona, C. R.; Wilkinson, J.; Zimprich, C. A.;
Hartnett, J. R.; Ingold, M. R.; Zimmerman, K.; Machleidt, T.;
Kirkland, T. A.; Huwiler, K. G.; Ohana, R. F.; Slater, M.; Otto, P.;
Cong, M.; Wells, C. I.; Berger, B.-T.; Hanke, T.; Glas, C.; Ding, K.;
Drewry, D. H.; Huber, K. V. M.; Willson, T. M.; Knapp, S.; Muller, S.;
̈
Meisenheimer, P. L.; Fan, F.; Wood, K. V.; Robers, M. B.
Quantitative, Wide-Spectrum Kinase Profiling in Live Cells for
Assessing the Effect of Cellular ATP on Target Engagement. Cell
Chem. Biol. 2018, 25, 206−214.e11.
(40) Robers, M. B.; Dart, M. L.; Woodroofe, C. C.; Zimprich, C. A.;
Kirkland, T. A.; Machleidt, T.; Kupcho, K. R.; Levin, S.; Hartnett, J.
R.; Zimmerman, K.; Niles, A. L.; Ohana, R. F.; Daniels, D. L.; Slater,
M.; Wood, M. G.; Cong, M.; Cheng, Y.-Q.; Wood, K. V. Target
Engagement and Drug Residence Time can be observed in living Cells
with BRET. Nat. Commun. 2015, 6, No. 10091.
(41) Bian, Y.; Bayer, F. P.; Chang, Y.-C.; Meng, C.; Hoefer, S.; Deng,
N.; Zheng, R.; Boychenko, O.; Kuster, B. Robust Microflow LC-MS/
MS for Proteome Analysis: 38 000 Runs and Counting. Anal. Chem.
2021, 93, 3686−3690.
(42) Bian, Y.; Zheng, R.; Bayer, F. P.; Wong, C.; Chang, Y.-C.;
Meng, C.; Zolg, D. P.; Reinecke, M.; Zecha, J.; Wiechmann, S.;
Heinzlmeir, S.; Scherr, J.; Hemmer, B.; Baynham, M.; Gingras, A.-C.;
Boychenko, O.; Kuster, B. Robust, Reproducible and Quantitative
Analysis of Thousands of Proteomes by Micro-Flow LC-MS/MS. Nat.
Commun. 2020, 11, No. 157.
(30) Sun, Y.; Bell, J. L.; Carter, D.; Gherardi, S.; Poulos, R. C.;
Milazzo, G.; Wong, J. W. H.; Al-Awar, R.; Tee, A. E.; Liu, P. Y.; Liu,
B.; Atmadibrata, B.; Wong, M.; Trahair, T.; Zhao, Q.; Shohet, J. M.;
Haupt, Y.; Schulte, J. H.; Brown, P. J.; Arrowsmith, C. H.; Vedadi, M.;
̈
MacKenzie, K. L.; Huttelmaier, S.; Perini, G.; Marshall, G. M.;
Braithwaite, A.; Liu, T. WDR5 supports an N-Myc Transcriptional
AB
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Featured Article
(43) Hahne, H.; Pachl, F.; Ruprecht, B.; Maier, S. K.; Klaeger, S.;
Helm, D.; Médard, G.; Wilm, M.; Lemeer, S.; Kuster, B. DMSO
enhances Electrospray Response, boosting Sensitivity of Proteomic
Experiments. Nat. Methods 2013, 10, 989−991.
(44) Cox, J.; Mann, M. MaxQuant enables high Peptide
Identification Rates, Individualized p.p.b.-Range Mass Accuracies
and Proteome-wide Protein Quantification. Nat. Biotechnol. 2008, 26,
1367−1372.
(45) Cox, J.; Neuhauser, N.; Michalski, A.; Scheltema, R. A.; Olsen,
J. V.; Mann, M. Andromeda: a Peptide Search Engine integrated into
the MaxQuant Environment. J. Proteome Res. 2011, 10, 1794−1805.
(46) Tyanova, S.; Temu, T.; Sinitcyn, P.; Carlson, A.; Hein, M. Y.;
Geiger, T.; Mann, M.; Cox, J. The Perseus Computational Platform
for comprehensive Analysis of (Prote)omics Data. Nat. Methods 2016,
13, 731−740.
(47) Vizcaíno, J. A.; Csordas, A.; del-Toro, N.; Dianes, J. A.; Griss, J.;
Lavidas, I.; Mayer, G.; Perez-Riverol, Y.; Reisinger, F.; Ternent, T.;
Xu, Q.-W.; Wang, R.; Hermjakob, H. 2016 Update of the PRIDE
Database and its related Tools. Nucleic Acids Res. 2016, 44, D447−56.
(48) Molecular Operating Environment (MOE); Chemical Computing
Group ULC: 1010 Sherbooke St West, Suite #910, Montreal, OC,
Canada, H3A 2R7, 2019.
(49) Labute, P. Protonate3D: Assignment of Ionization States and
Hydrogen Coordinates to Macromolecular Structures. Proteins 2009,
75, 187−205.
(50) Jones, G.; Willett, P.; Glen, R. C.; Leach, A. R.; Taylor, R.
Development and Validation of a Genetic Algorithm for flexible
Docking. J. Mol. Biol. 1997, 267, 727−748.
(51) Neudert, G.; Klebe, G. DSX: A Knowledge-based Scoring
Function for the Assessment of Protein-Ligand Complexes. J. Chem.
Inf. Model. 2011, 51, 2731−2745.
(52) Neudert, G.; Klebe, G. fconv: Format Conversion, Manipu-
lation and Feature Computation of Molecular Data. Bioinformatics
2011, 27, 1021−1022.
AC
https://doi.org/10.1021/acs.jmedchem.1c00146
J. Med. Chem. XXXX, XXX, XXX−XXX