Heterologous production of extreme alkaline thermostable NAD+-dependent formate dehydrogenase with wide-range pH activity from Myceliophthora thermophila

Article abstract of DOI:10.1016/j.procbio.2017.06.017

NAD⁺-dependent formate dehydrogenase(s) (EC 1.2.1.2, FDH) catalyzes the interconversion of formate anion to carbon dioxide coupled with the conversion of NAD⁺ or NADH. FDHs attract significant attention in biotechnology due to their potential applications in NAD(H)-dependent industrial biocatalysis as well as in the production of renewable fuels and chemicals from carbon dioxide. In the present work, a new FDH from thermophilic fungus Myceliophthora thermophile (MtFDH) was characterized. The gene of the enzyme was synthesised, cloned, expressed in E. coli, as 6His-tagged protein, and purified to homogeneity by metal chelate affinity chromatography. Kinetic analysis suggested that MtFDH exhibits higher catalytic efficiency on NaHCO₃ compared to formate. Notable, recombinant MtFDH displays a pH optimum for the conversion of formate anion to carbon dioxide at extreme alkaline pH (pH 10.5). Thermal stability analysis showed that the enzyme displays good thermostability with T_m 48 °C. Homology modelling and phylogenetic analysis suggested that the enzyme belongs to the D-specific 2-hydroxy acid dehydrogenases family. The active-site residues are well conserved compared to other homologous FDHs. The results of the present work provide new knowledge on the structure, function and diversity of FDHs and indicate that MtFDH possess a huge potential for CO₂ reduction or NADH generation and under extreme alkaline conditions.

Full text of DOI:10.1016/j.procbio.2017.06.017

Accepted Manuscript
Title: Heterologous production of extreme alkaline
thermostable NAD+-dependent formate dehydrogenase with
wide-range pH activity from Myceliophthora thermophila
Authors: Nilay Altas¸, As¸kın Sevinc¸ Aslan, Ersin Karatas¸,
Evangelia Chronopoulou, Nikolaos E. Labrou, Barıs¸ Binay
PII:
S1359-5113(17)30608-6
DOI:
Reference:
http://dx.doi.org/doi:10.1016/j.procbio.2017.06.017
PRBI 11076
To appear in:
Process Biochemistry
Received date:
Revised date:
Accepted date:
12-4-2017
9-6-2017
15-6-2017
Please cite this article as: Altas¸ Nilay, Aslan As¸kın Sevinc¸, Karatas¸ Ersin,
Chronopoulou Evangelia, Labrou Nikolaos E, Binay Barıs¸.Heterologous production
of extreme alkaline thermostable NAD+-dependent formate dehydrogenase with
wide-range pH activity from Myceliophthora thermophila.Process Biochemistry
http://dx.doi.org/10.1016/j.procbio.2017.06.017
This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof
before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that
apply to the journal pertain.

Heterologous production of extreme alkaline thermostable NAD+-
dependent formate dehydrogenase with wide-range pH activity
from Myceliophthora thermophila
Nilay Altaş1, Aşkın Sevinç Aslan2, Ersin Karataş3, Evangelia Chronopoulou4, Nikolaos E.
Labrou4 and Barış Binay5*
1Yildiz Technical University, Faculty of Science and Letters, Department of Chemistry,
34210, Istanbul, Turkey
2Gebze Technical University, Department of Chemistry, 41400 Gebze, Kocaeli, Turkey
3Gebze Technical University, Department of Molecular Biology and Genetics, 41400 Gebze,
Kocaeli, Turkey
4Laboratory of Enzyme Technology, Department of Biotechnology, School of Food,
Biotechnology and Development, Agricultural University of Athens, 75 Iera Odos Street,
GR-11855-Athens, Greece
5Gebze Technical University, Department of Bioengineering, 41400 Gebze, Kocaeli, Turkey
*Corresponding author
Email: binay@gtu.edu.tr
1

Graphical abstract
2

Highlights
-
-
A new FDH from Myceliophthora thermophile (MtFDH) was biochemically
characterized.
MtFDH displays an extreme alkaline pH for the conversion of formate (pH 10.5).
-
-
-
MtFDH possess a huge potential for NADH generation and CO2 reduction.
The enzyme displays good thermostability with Tm 48 °C.
The enzyme belongs to the D-specific 2-hydroxy acid dehydrogenases family.
3

Abstract
NAD+-dependent formate dehydrogenase(s) (EC 1.2.1.2, FDH) catalyzes the interconversion
of formate anion to carbon dioxide coupled with the conversion of NAD+ or NADH. FDHs
attract significant attention in biotechnology due to their potential applications in NAD(H)-
dependent industrial biocatalysis as well as in the production of renewable fuels and
chemicals from carbon dioxide. In the present work, a new FDH from thermophilic fungus
Myceliophthora thermophile (MtFDH) was characterized. The gene of the enzyme was
synthesised, cloned, expressed in E. coli, as 6His-tagged protein, and purified to homogeneity
by metal chelate affinity chromatography. Kinetic analysis suggested that MtFDH exhibits
higher catalytic efficiency on NaHCO3 compared to formate. Notable, recombinant MtFDH
displays a pH optimum for the conversion of formate anion to carbon dioxide at extreme
alkaline pH (pH 10.5). Thermal stability analysis showed that the enzyme displays good
thermostability with Tm 48 °C. Homology modelling and phylogenetic analysis suggested
that the enzyme belongs to the D-specific 2-hydroxy acid dehydrogenases family. The active-
site residues are well conserved compared to other homologous FDHs. The results of the
present work provide new knowledge on the structure, function and diversity of FDHs and
indicate that MtFDH possess a huge potential for CO2 reduction or NADH generation and
under extreme alkaline conditions.
Key words: Myceliophthora thermophila, NAD+-dependent formate dehydrogenase,
heterologous production, extreme alkaline, computational modeling, NADH regeneration,
CO2 reduction
4

Introduction
Application of enzymes in commercial synthesis of chiral value-added chemicals has
increased with the contribution of recombinant DNA technology and protein engineering
[1,2]. However, the required high cost of cofactor/coenzyme by enzymes is still an
impediment in biocatalysis. For example, the NAD(H)-dependent industrial biocatalysis
needs the continuous supply of expensive cofactors in stoichiometric amounts. Instead of
using stoichiometric amounts of NAD(H), enzymatic regeneration of NAD+/NADH is more
viable in all aspects. Formate dehydrogenases (FDHs) have been successfully used for the
regeneration of NADH from NAD+ by converting formate to carbon dioxide without any
undesirable effect [3-8]. Other applications of this enzyme include its use for L-tert-Leucine
production [9], therapeutic use in cases of formate poisoning [10], enzymatic reduction of
CO2 for the production of valuable chemicals, such as formic acid [11]. Thus, FDHs have the
potential as an innovative tool, giving decisive impetus to numerous fields of application.
Extensive published studies have reported the discovery of new FDHs or the creation of
mutated forms of the enzyme by protein engineering with improved structural and catalytic
features suitable for industrial applications [12-18].
An essential requirement for sustainable carbon-based economy and ecology is the
production of fuels and chemical stocks by reducing CO2. This problem can be overcome by
enzymatic rapid reduction of CO2. Recently, the reversible reduction of CO2 by FDHs has
been evaluated as another superior potential of FDHs. The reaction product (formate) is a
promising renewable chemical. Therefore, NAD+-dependent FDHs are attractive enzymes,
able to produce renewable fuels and chemicals by biocatalysis [19-23].
5

In the present study, we report the cloning, expression and characterization of a new FDH
from Myceliophthora thermophila (MtFDH). The results showed that the enzyme catalyzes
the reversible NAD+-dependent interconversion of formate anion to carbon dioxide.
Molecular modeling, kinetic analysis together with the study of enzyme‟s structural stability
suggested that MtFDH displays interesting properties, suitable for the development of novel
biocatalytic applications and processes for the reduction of CO2 and synthesis of formate.
Materials and Methods
Strains, Chemicals and Plasmids
All chemicals were purchased from Sigma-Aldrich (USA) and were of analytical grade.
Molecular biology enzymes were from NEB (USA). Bicinchoninic acid (BCA) Protein Assay
Kit was purchased from Thermo Scientific (USA). Chemically competent E.coli strain BL21
-
-
Star [F-ompT hsdSB (rB , mB ) galdcmrne131 (DE3)] was purchased from Life Technologies
(USA). The plasmid pET45b(+) was purchased from Novagen (USA). Plasmid purification
and Western blotting kits were from Life Technologies (USA). The His-Trap and PD-10
column were purchased from GE Healthcare (USA).
Cloning of Myceliophthora thermophila fdh gene into pET45b(+) vector
The fdh gene (approximately 1.1-kb nucleotides) from Myceliophthora thermophila (strain
ATCC 42464 / BCRC 31852 / DSM 1799) was optimized by codon usage preference for E.
coli expression. The gene was synthesized (Genscript) based on the amino acid sequence
(UniProt accession number: MYCTH_110931). KpnI-XhoI cloning sites were added to the
synthesized, fdh gene by the following primers:
5‟-GGTACCATGGCGCATCACCATCATCATCATGTGGGG-3‟ (forward) and 5‟-
ACGCGAAGTGAGCACCAGCTAACTCGAG-3‟ (reverse). The gradient PCR program
6

o
o
o
composed of denaturation at 95 C for 1 min, annealing at 50-65 C, increasing 2 C
o
periodically for 2 min, and extension at 72 C for 10 min with a total of 30 cycles. The His-
tag sequence (MAHHHHHHVG) was introduced at the N-terminus of the gene by the
forward primer. The PCR product was digested by KpnI and XhoI enzymes and ligated into
the expression plasmid pET45b(+) which was previously digested by the same enzymes
(KpnI and XhoI). The resulted construct (pET45b(+)Mtfdh) was sequenced with the T7
promoter forward primer (5‟ TAATACGACTCACTATAGGG) [12].
Optimization of MtFDH expression in E. coli
E. coli BL21 (DE3) cells was used as a host cells for MtFDH production. E. coli BL21 (DE3)
cells were transformed by pET45b(+)Mtfdh plasmid. A single colony from the Laura Bertani
(LB) medium plates was inoculated into LB medium containing ampicillin (100 mg/mL).
Recombinant E. coli BL21 (DE3) cells was incubated at 15°C or 37°C with stirring (200
rpm). The synthesis of MtFDH was induced by 1 mM isopropyl β-D-thiogalactoside (IPTG)
o
o
and the culture was incubated at 15 C or 37 C for 4 h and 16 h respectively. After
incubation, the cultures were centrifuged (1000 g, 4 °C) for 10 min. The collected cell paste
was resuspended in the lysis buffer (200 mM potassium phosphate buffer, pH 7.0) and
sonicated at high power for 10 min (micro probe) (Bandelin, UW2070). The suspension was
centrifuged and the supernatant was analyzed by SDS‐PAGE. The gel was stained by
Coomassie Brilliant Blue R-250.
Proteins on the SDS-PAGE gel were transferred to a nitrocellulose membrane for Western
blot analysis. The expressed His-tagged FDH was detected by anti‐His antibody using a
commercial Western blotting kit (Life Technologies). The staining was performed by
horseradish peroxidase reaction [12].
7

Purification of MtFDH
Following expression, E. coli BL21 (DE3) cells were harvested by centrifugation at 12,000
rpm (2 min, 4°C) and resuspended in Buffer A (20 mM NaH2PO4, 500 mM NaCl, 30 mM
imidazole, pH 7.4). The suspension was sonicated at high power for 10 min (micro probe)
(Bandelin, UW2070). The cell lysate was filtered through 0.45 µm filter. The filtered sample
was loaded on a 5mL His-Trap column previously equilibrated by Buffer A (5 mL). Then, the
column was washed with 5 mL of Buffer A. MtFDH was eluted with a series of elution
buffers: 3 mL of Buffer A supplemented with 100 mM imidazole (CL), 5mL of Buffer A
supplemented with 200 mM imidazole (W), and finally 3 mL of Buffer A with 400 mM
imidazole (E1-5). The collected fractions were loaded onto a PD-10 column (GE-Healtcare)
to remove salts and imidazole. The protein concentration was measured with BCA method
(Serva). The purity of the protein was determined by SDS-PAGE according to the method of
Laemmli [24] and the gel was stained by Coomassie Brilliant Blue R-250.
Enzyme activity assay and stability studies of MtFDH
o
The activity of MtFDH was measured (5 min) at 25 C in different buffers (20 mM, pH 4-
10.5). For pH 4-6, acetate buffers were used; for pH 6-8, potassium phosphate buffers were
used; for pH 7-9, Tris-HCl buffers were used; for pH 9.5-10.5, glycine buffers were used.
Enzyme assays were carried using the above buffers containing 20 mM formate and 1 mM
NAD+. Appropriate control measurements in the optimum buffer without enzyme in the
presence of NAD+/NADH were carried out, to correct for the spontaneous reaction rate at
high pHs.
8

Thermostability of the purified MtFDH was measured by incubating the purified enzyme for
o
o
20 min at different temperatures (25 C to 65 C) in 20 mM glycine buffer pH 10.5. The
samples were subsequently assayed for residual activity. The Tm value (i.e. the temperature at
which 50 % of the initial enzyme activity is lost after heat treatment) was determined from
the plot of relative activity (%) versus temperature (ºC).
The storage stability of the enzyme was studied at four different temperatures: -80 oC, -20 oC,
o
o
+4 C and 25 C. Aliquots of the purified enzyme (E3-E5 fractions, Fig. 2C) in 20 mM
o
glycine buffer pH 10.5 was incubated at -80, -20, +4 and +25 C for 30 days. The remaining
activity was measured fourteen and thirty days after the incubation. The experiments were
done in triplicates.
Kinetic analysis
The enzyme activity was assayed by monitoring (5 min, 25 oC) the increase or decrease of the
absorbance at 340 nm after adding the purified MtFDH to the optimized reaction mixture
containing 20 mM buffer, NAD(H) (at saturated concentration) and variable concentrations
of sodium formate or NaHCO3. NaHCO3 was used as CO2 source [23]. Alternatively, enzyme
activity was assayed by monitoring (5 min, 25 oC) the increase or decrease of the absorbance
at 340 nm after adding the purified MtFDH (E3-E5 fractions, Fig. 2C) to the optimized
reaction mixture containing 20 mM buffer, formate or NaHCO3 (at saturated concentration)
and variable concentrations of NAD(H). The Michaelis-Menten equation was fitted to the
steady-state data, derived from triplicate measurements, by nonlinear regression analysis
using the GraFit 3 computer program [25]. The Michaelis-Menten kinetic constants (kcat and
Km for NAD+, NADH, NaHCO3 and formate) were determined.
9

Bioinformatic analysis and molecular modeling Myceliophthora thermophila FDH
MtFDH models were constructed using the IntFOLD2-TS method [26] as implemented in the
IntFOLD server [27]. Disorder prediction was carried out using DISOclust [28]. Ligand
binding site prediction was carried out using FunFOLD [29]. Model quality assessment was
carried out using ModFOLDclust2 [30]. The available crystal structures of FDHs that were
used as templates for model construction were 3jtm, 2j6i and 2nac (PDB codes). The global
model quality score was estimated 0.8776 and the p-value 9.846E-5 (probability that the
model is incorrect), suggesting high quality of the model. An alternative model was
constructed using SWISS-MODEL [31]. In this case the crystal structure of FDH 5dn9 (PDB
code) was used as template for model (with NAD+ and azide bound) construction (QMEAN4
-0.46) [32]. For inspection of models and crystal structures the program PyMOL [33] was
used. CastP server [34] was used for pocket calculations using as probe radius 1.4 Angstrom.
Sequences homologous to MtFDH were sought in the PDB using BLASTp [35]. The
resulting sequence set was aligned with Clustal Omega [36]. ESPript and ENDscript were
used for alignment visualization and analysis [37].
Results and discussion
Cloning, expression, and purification of FDH
The codons corresponding to MtFDH were optimized (Genescript, USA) for expression in E.
coli, maintaining the amino acid sequence identical to that of the native protein (UniProt
accession number: MYCTH_110931). The synthetic fdh gene consisted of 1,137-nt including
six codons of polyhistidine-tag and a stop codon (TGA). The codon-optimized synthetic gene
of MtFDH was cloned into the pET45b(+) expression vector under the direction of T7
10

promoter and the resulting construct was used to transform E.coli BL21 (DE3) cells for
protein expression. The fidelity and orientation of the fdh gene in the vector were confirmed
by sequencing before expression. The native MtFDH consists of 372 amino acids with
theoretical molecular weight approximately 42 kDa and isoelectric point (pI) 6.15. Amino
acid sequence alignments resulting from the BLAST search of MtFDH sequence against
homologues enzymes with crystallographic determined structures (Protein Data Bank, [38])
are shown in Fig. 1. MtFDH exhibits 62.6 %, 54% and 53.8 % identity to the well
characterized FDHs from Candida boidinii, Arabidopsis thaliana and Pseudomonas sp. 101,
respectively. Similarly, sequence alignment of MtFDH with the known FDHs from Moraxella
Sp.c2, Granulicella mallensis MP5ACTX8, and Thiobacillus sp. KNK65MA reveals
sequence identities of 53.63 %, 54.75 % and 53.07 %, respectively. Despite the relative low
sequence identity with other FDHs, the multiple sequence alignment allowed the
identification of several conserved residues that are invariant and therefore may be
considered as “key” residues for enzyme function. For example, the amino acid residues that
are involved in substrates binding and/or catalysis [39-44] are all conserved in MtFDH:
His312, Arg259, Asn120, Tyr197, Asp196, Ile94, Phe70, Pro69 (numbering according to
MtFDH).
A phylogenetic analysis was performed in an effort to examine the genetic relationships
amongst FDHs used in the alignment. The phylogenetic reconstruction (Fig. 1B) shows the
evolutionarily distance relation between the eukaryotic and prokaryotic FDHs, which were
clearly separated in two branches. In the eukaryotic branch, the fungus FDHs (MtFDH and
CtFDH), are closely related to the yeast FDHs and less related to the plant FDHs. The FDH
from Granulicella mallensis (GmFDH), an acidobacterium isolated from Arctic tundra soil, is
the oldest member of this clade.
11

From the multiple sequence alignment shown in Fig. 1 it is evident that the bacterial FDHs
from Pseudomonas sp., Thiobacillus sp and Moraxella sp have an extra large loop region at
N-terminal end, whereas the eukaryotic FDHs from yeast, plant and fungus (e.g. Granulicella
mallensis and Myceliophthora thermophila) have shorter or luck this loop region. It has been
suggested that this region may have an important role in the discrimination of the kinetic
mechanism of the two different groups of FDHs [45]. However, the N-terminal loop does not
have direct interactions with the substrate binding pocket and it has been reported that the C-
terminal loop is formed upon sequential binding of cofactor and substrate in the case of the
bacterial type FDH (e.g. Pseudomonas sp) [45]. This structural rearrangement has been
linked with the CO2 accessibility or its binding to the active site [23].
As illustrated in Fig. 2, SDS‐PAGE and Western blot analysis established that MtFDH was
produced in E. coli as a soluble protein. Higher expression level (10 mg/L) was achieved at
37 oC (4 h incubation), instead at lower temperature (17 oC, 16 h incubation). The presence of
the 6×His-tag at the N-terminus allowed the efficient purification of active MtFDH using the
His-Trap affinity chromatography column (Fig. 2C).
Effect of pH and buffers on MtFDH activity
The pH dependence of Vmax was determined over the pH range, 4.0 to 10.5 (Fig. 3). The
enzyme is active over a broad range of pH. The highest activity was observed at the alkaline
range with optimum at pH 10.5. It is intriguing that compared to the its highest activity at pH
10.5 (0.28 µmol/min.mg), enzyme still maintains about half of its activity at pH 4.0 (0.17
µmol/min.mg) which indicates its lowest value. It is noteworthy that all known NAD+-
dependent FDHs exhibit optimum activity at neutral or acidic pH [3,12] (Table 1). Therefore,
12

MtFDH is the first characterized FDH with pH optimum at extreme alkaline pH and
significant activity over a broad-range of pH (5 to 10.5). Another FDH with broad pH
optimum has been characterized from Bacillus sp. F1. [46]. This enzyme exhibits narrower
pH optimum (pH 6-9.5), compared to MtFDH. This property makes MtFDH a suitable
candidate for developing biotechnological applications especially when alkaline range of pH
is required. Previous investigations have established that the active site Gln/His pair (Gln321
and His340 in MtFDH) forms the proton relay system required for acid–base catalysis [3].
The presence of Gln in this position, instead of Glu as in other dehydrogenases, allows a wide
pH optimum. This has been confirmed by site-directed mutagenesis. For example, the
mutation Gln313Glu in FDH from Pseudomonas sp. 101 narrows the pH optimum of the
enzyme from 6.0-9.0 to 6.0-7.0. Similarly, the mutation Gln287Glu in C. boidinii FDH
narrows the pH optimum of the enzyme from 7-8.5 to 6.6-7.0. [39].
MtFDH accepts as substrate NaHCO3 and catalyzes the conversion of carbon dioxide to
formate using as cofactor NADH. This reaction is favored in pH range pH 4-6 with optimum
at pH 5.5 (Fig. 3B).
Kinetic analysis
Kinetic analysis of purified MtFDH was achieved in 20 mM glycine buffer, pH 10.5, since
the enzyme exhibits its highest activity at this pH. The enzyme did not show activity against
formic acid in the presence of NADP+, therefore MtFDH is an NAD+-dependent
dehydrogenase. In general, most FDHs exhibit absolute specificity towards NAD+, although a
recent report showed that the FDH from Granulicella mallensis MP5ACTX8 displays double
cofactor specificity [4]. It is well established that the absolute specificity towards NAD+ is
due to the presence of a conserved Asp residues which is located at the conserved
13

„fingerprint' sequence GXGXXGX17-18D (X is any amino acid) [39-43]. The hydroxyl groups
of the ribose component of adenine hydrogen bond with the side chain of this Asp residue.
According to the MtFDH sequence, Asp196 is the responsible amino acid which is located 18
residues downstream from the Gly residue at the end of the „fingerprint‟ sequence (Fig. 1).
The Km values for formate and NAD+ were determined 7.2 mM and 1.2 mM, respectively
(Table 2). The kcat value for formate was determined 0.32 s-1. These results show that the
catalytic efficiency (kcat/Km) of MtFDH is lower compared to other well characterized FDHs
(Table 1). Most of the FDHs that have been characterized so far, display Km values for
formate, which fall within the range 3-10 mM [3], very close to that observed in the present
study for MtFDH. However, the Km value for NAD+ appears to be higher, compared to other
bacterial and yeast FDHs (e.g. 35-90 µM) [3]. The kcat values of bacterial and methylotrophic
yeast FDHs are significant higher than those of the MtFDH enzyme, however the kcat value of
MtFDH is similar to that found in plant FDHs, such as from A. thaliana [48].
Comparison of the catalytic efficiency of MtFDH for the two different substrates, NaHCO3
and formate, showed that the kcat/Km is about 5-fold higher for NaHCO3, compared to that of
formate. This preference towards NaHCO3 places MtFDH among extraordinary FDHs [19].
Thermal stability analysis of MtFDH
The thermal stability of the MtFDH was assessed by measuring its residual activity after heat
treatment for 20 min at various temperatures (25-65 C, Fig. 4A). The Tm was measured 48
°C, indicating that the enzyme exhibits moderate thermostability, although it is derived from
a thermophilic microorganism. The Tm value indicates that the MtFDH displays similar
structural stability to other homologues FDHs suggesting that the potential of a fdh gene to
14

evolve a new catalytic function upon evolution may depend on its ability to accept mutations
that do not affect the stability of the encoded protein. The reported Tm values for other
o
NAD+-dependent FDHs varies between 45-65 C, with the bacterial enzymes being more
stable, compared with the yeast and plant enzymes [3,12,39]. The lower thermostability of
MtFDH, compared to bacterial FDHs [45], is presumably the result of the longer N-terminal
region loop that is present in bacterial FDHs, but not in yeast, plant and fungi enzymes. This
loop has been shown to be very rigid, due to a high number of proline residues (e.g. seven
Pro residues in Pseudomonas sp. 101 enzyme, Fig 1A). The multiple interactions of this
region with several parts of the subunit has been reported to be responsible for the higher
thermostability of bacterial FDHs, compared to the FDHs from other sources [45].
The kinetics of isothermal inactivation of MtFDH at 35 ºC, was studied (Fig. 4B). The results
showed that the enzyme displays biphasic kinetics. Initial, within the first 21 min, the enzyme
activity is progressively increased (about 20%) to reach its highest activity. Following this
initial phase, the enzyme is progressively inactivated to completely inactive enzyme after
about 64 min.
The storage stability of MtFDH in glycine buffer, pH 10.5 was measured after incubation at
o
o
o
o
four different temperatures: -80 C, -20 C, 4 C and 25 C for fourteen and thirty days. As
illustrated in Fig. 5, MtFDH retains about 75-80% of its activity after incubation at 4 oC, -20
o
o
oC and -80 C for fourteen days. However, at 25 C the enzyme loose about 35% of its
activity after fourteen days and completely inactivated after thirty days. The low stability of
FDH at 25°C may be the result of enzyme‟s aggregation or cysteine oxidation as it has been
reported in other FDHs [49,52]. On the other hand, the enzyme retains about 55-62% of its
activity at other temperatures (-80 oC, -20 oC, 4 oC). It is evident that none of these conditions
15

deteriorated significant MtFDH after fourteen days storage. However, the enzyme‟s activity
was significantly decreased after thirty days in all storage conditions. The lost of activity at
o
o
very low temperatures (e.g. -80 C, -20 C) may be due to changes in the pH of buffer
solution as a consequence of freezing. Another reason may be the cold denaturation effect,
owing to the weakening of the hydrophobic effect and the change in interaction between
water molecules and hydrophobic groups in the protein [51].
Molecular modelling and structure analysis of MtFDH
To understand the structural and catalytic properties of MtFDH, the enzyme sequence was
subjected to structure prediction using the IntFOLD2-TS method (Fig. 6). Active site solvent
accessible surface (Richards' surface) for MtFDH has been calculated equal to 906.5 Ų,
suggesting that the active site is large enough to accommodate its substrates. Solvent
accessibility and hydropathy analysis suggests a buried active site with a rather hydrophobic
character (Fig. 6A). Sequence conservation analysis along the 3D structure (Fig. 6B) showed
that the most conserved regions with higher degree of identity are located at the C-terminal
domain (cofactor binding site), whereas less conserved regions are located at the N-terminal
domain. The higher degree of conservation at the C-terminal domain and the large variations
at the N-terminal domain suggest that FDH evolution is guided mainly by invariant residues
at the N-terminal domain.
Analysis of the modelled structure in complex with the inhibitor sodium azide (azide is
considered as formate/CO2 analogue) and NAD+, showed that the inhibitor interacts with
MtFDH in a specific mode. Important residues that are directly involved in the formation of
the substrate binding site are: Pro69, Phe70, Ile94, Asn120, Arg259, His312 (Fig. 7A)
[38,39]. These amino acid residues provide a combination of positive charged/hydrophophic
16

side-chains that allow the creation of a mixed-type catalytic environment for formate/CO2.
The model shows that the side chains of the conserved residues Arg292 and Asn120
participate in the formation of H-bonds with the azide, suggesting that the positively charged
side-chain of Arg292 enhances the stability of the hydride ion during the oxidation (formic
acid) or reduction (CO2) reactions. In addition, Arg292 may provide a ligand for the
productive orientation of formate/CO2 in the active site (Fig. 7B). The hydrophobic residues
Pro69, Phe70, Ile94 may play important role in formate/CO2 destabilization. The negatively
charged formate ion and the partially charged mesomeric forms of CO2 may be destabilised
in this hydrophobic region. Another important feature of the active site is the presence of the
conserved His-Gln pair (His312 and Gln288 in the MtFDH enzyme) [38,39]. Despite the
locking of the His340 in its unprotonated state by Gln321, His340 may contribute to
formate/CO2 binding as its side chain participates in a H-bond formation with the azide (Fig.
7B) [38].
The predicted binding mode of the cofactor to the MtFDH is shown in Fig. 7B. The
hydrophobic wall, which is formed by the conserved residues Val158 and Ile210, may
destabilise the positively charged NAD+ and enhance the stability of the neutral product
NADH.
The results from the previous investigations [38] indicate that the active site of FDHs
comprises two carboxylate groups, which contribute in formate binding and catalysis.
Asp283 has been linked with the proper orientation and polarisation of the cofactor since its
carboxyl group forms a hydrogen bond with the amide group of the nicotinamide moiety of
NAD+ [39-44]. This amino acid residue has been assigned the pKa in the acidic pH range
observed in the Pseudomonas enzyme [40]. The high pKa in the kcat-pH profile (pKa = 10.16),
17

which was found in the Pseudomonas and C. boidinii enzymes, is believed to have a
conformational origin which promotes protein structural reorganisation [39-43]. Taking into
account the high homology between MtFDH and the FDHs from Pseudomonas and C.
boidinii, it is conceivable to assume that the alkaline preference of MtFDH may be relevant to
the conformational changes discussed above.
Taking into account this observation and considering the kinetic properties of selected FDH
(Table 2) it is reasonable to propose that this structural feature may affect the kcat towards
formate/bicarbonate.
Conclusion
In the present work a new form of FDH from the thermophilic fungus Myceliophthora
thermophile (MtFDH) was characterized. The enzyme was produced in E. coli BL21 (DE3)
and purified to homogeneity using affinity chromatography. MtFDH displays its pH
optimum, for the conversion of formate anion to carbon dioxide, at extreme alkaline pH (pH
10.5) and exhibits higher catalytic efficiency for NaHCO3, compared to formate. MtFDH
displays moderate thermostability, compared to other FDHs from thermophilic organisms.
However, MtFDH is a unique enzyme, showing high catalytic efficiency for both formate and
NaHCO3. Homology modelling analysis suggested that MtFDH shares the same overall fold,
domain organization and active-site residues as other bacterial/yeast FDHs. The extraordinary
kinetic properties of MtFDH make this enzyme suitable candidate for further engineering
work aiming at developing new biotechnological applications.
Acknowledgements
This work was fully supported by a grant from the TUBITAK (Grant number: 214Z292).
18

References
[1] Hannig G, Makrides S. Strategies for optimizing heterologous protein expression in
Escherichia coli. Trends Biotechnol. 16 (1998) 54–60.
[2] Liszewski K. Speeding up the protein assembly line. Genetic Engineering&Biotechnology
news paper 35 (2015) 1.
[3] Tishkov VI, Popov VO. Protein engineering of formate dehydrogenase. Biomol Eng. 23
(2006) 89-110.
[4] Fogal S, Beneventi E, Cendron L, Bergantino E. Structural basis for double cofactor
specificity in a new formate dehydrogenase from the acidobacterium Granulicella mallensis
MP5ACTX8. Appl Microbiol Biotechnol. 99:22 (2015) 9541-9554.
[5] Zhu Y, Li H, Liu P, Yang J, Zhang X, Sun Y. Construction of allitol synthesis pathway by
multi-enzyme coexpression in Escherichia coli and its application in allitol production. J Ind
Microbiol Biotechnol. 42:5 (2015) 661-699.
[6] Gai P, Ji Y, Chen Y, Zhu C, Zhang J, Zhu JJ. A nitrogen-doped graphene/gold
nanoparticle/formate dehydrogenase bioanode for high power output membrane-less formic
acid/O2 biofuel cells. Analyst. 140:6 (2015) 1822-1826.
[7] Hummel W, Gröger H. Strategies for regeneration of nicotinamide coenzymes
emphasizing self-sufficient closed-loop recycling systems. J Biotechnol. 191 (2014) 22-31.
[8] Gao X, Yang S, Zhao C, Ren Y, Wei D. Artificial multienzyme supramolecular device:
highly ordered self-assembly of oligomeric enzymes in vitro and in vivo. Angew Chem Int
Ed Engl. 53:51 (2014) 14027-14030.
[9] Lu J, Zhang Y, Sun D, Jiang W, Wang S, Fang B. The Development of Leucine
Dehydrogenase and Formate Dehydrogenase Bifunctional Enzyme Cascade Improves the
Biosynthsis of L-tert-Leucine. Appl Biochem Biotechnol. 180:6 (2016) 1180-1195.
[10] Muthuvel, A, Rajamani, R, Sheeladevi, R. Therapeutic response to single intravenous
bolus administration of formate dehydrogenase in methanol-intoxicated rats. Toxicol Lett.
161 (2006) 89-95.
[11] Noji T, Jin T, Nango M, Kamiya N, Amao Y. CO2 Photoreduction by Formate
Dehydrogenase and a Ru-Complex in a Nanoporous Glass Reactor. ACS Appl Mater
Interfaces. 9:4 (2017) 3260-3265.
[12] Özgün G, Karagüler NG, Turunen O, Turner NJ and Binay B. Characterization of a new
acidic NAD+-dependent formate dehydrogenase from thermophilic fungus Chaetomium
thermophilum. J Mol Cat B:Enzym. 122 (2015) 212–217.
19

[13] Tishkov VI, Goncharenko KV, Alekseeva AA, Kleymenov SY, Savin SS. Role of a
Structurally Equivalent Phenylalanine Residue in Catalysis and Thermal Stability of Formate
Dehydrogenases from Different Sources. Biochemistry (Mosc). 80:13 (2015) 1690-700.
[14] Tishkov VI, Goncharenko KV, Alekseeva AA, Kleymenov SY, Savin SS. Role of a
Structurally Equivalent Phenylalanine Residue in Catalysis and Thermal Stability of Formate
Dehydrogenases from Different Sources. Biochemistry (Mosc). 80:13 (2015) 1690-700.
[15] Zheng J, Yang T, Zhou J, Xu M, Zhang X, Rao Z. Elimination of a Free Cysteine by
Creation of a Disulfide Bond Increases the Activity and Stability of Candida boidinii
Formate Dehydrogenase. Appl Environ Microbiol. 83:2 (2016) pii: e02624-16.
[16] Jiang W, Lin P, Yang R, Fang B. Identification of catalysis, substrate, and coenzyme
binding sites and improvement catalytic efficiency of formate dehydrogenase from Candida
boidinii. Appl Microbiol Biotechnol. 100:19 (2016) 8425-8437.
[17] Carter JL1, Bekhouche M, Noiriel A, Blum LJ, Doumèche B. Directed evolution of a
formate dehydrogenase for increased tolerance to ionic liquids reveals a new site for
increasing the stability. Chembiochem. 15:18 (2014) 2710-2718.
[18] Ansorge-Schumacher MB1, Slusarczyk H, Schümers J, Hirtz D. Directed evolution of
formate dehydrogenase from Candida boidinii for improved stability during entrapment in
polyacrylamide. FEBS J. 273:17 (2006) 3938-3945.
[19] Appel AM, Bercaw JE, Bocarsly AB, Dobbek H, DuBois DL, Dupuis M, Ferry JG,
Fujita E, Hille R, Kenis PJA, Kerfeld CA, Morris RH, Peden CHF, Portis AR, Ragsdale SW,
Rauchfuss TB, Reek JNH, Seefeldt LC, Thauer RK, Waldrop GL. Frontiers, opportunities,
and challenges in biochemical and chemical catalysis of CO2 fixation. Chem Rev. 113
(2013) 6621-58.
[20] Ihara M, Kawano Y, Fujiwaraa Y, Kodo T, Mizuguchi M, Mochiduki Y, Kodoh K,
Okabe A,
Matsuno I. Expression systems for soluble metal-dependent formate
dehydrogenase. J Photoch Photobio A. 313 (2015) 154-62.
[21] Bassegoda A, Madden C, Wakerley DW, Reisner E, Hirst J. Reversible interconversion
of CO2 and formate by a molybdenum containing formate dehydrogenase. J Am Chem Soc.
136 (2014) 15473-6.
[22] Maia LB, Moura I, Moura JG. 2017. Molybdenum and tungsten-containing formate
dehydrogenases: Aiming to inspire a catalyst for carbon dioxide utilization. Inorg Chim
Acta. 455 (2017) 350-363.
20

[23] Choe H, Joo JC, Cho DH, Kim MH, Lee, SH, Jung KD, Kim YH. Efficient CO2-
reducing activity of NAD-dependent formate dehydrogenase from Thiobacillus sp.
KNK65MA for formate production from CO2 gas. Plos One 9 (2014) e103111.
[24] Laemmli UK. Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227 (1970) 680-85.
[25] Leatherbarrow RJ. (2001). GraFit version 5. Erytacus Software Ltd, Staines, UK.
[26] Buenavista MT, Roche DB, McGuffin LJ. Improvement of 3D protein models using
multiple templates guided by single-template model quality assessment. Bioinformatics. 28
(2012) 1851-7.
[27] Roche DB, Buenavista MT, Tetchner SJ, McGuffin LJ. The IntFOLD server: an
integrated web resource for protein fold recognition, 3D model quality assessment, intrinsic
disorder prediction, domain prediction and ligand binding site prediction. Nucleic Acids Res.
39 (2011) 171-6.
[28] McGuffin LJ. Intrinsic disorder prediction from the analysis of multiple protein fold
recognition models. Bioinformatics. 24 (2008) 1798-1804.
[29] Roche DB, Tetchner SJ, McGuffin LJ. FunFOLD: an improved automated method for
the prediction of ligand binding residues using 3D models of proteins. Bioinformatics. 12
(2011) 160-79.
[30] McGuffin LJ, Roche DB. Rapid model quality assessment for protein structure
predictions using the comparison of multiple models without structural alignments.
Bioinformatics. 26 (2010) 182-88.
[31] Arnold K, Bordoli L, Kopp J, Schwede T. The SWISS-MODEL workspace: a web-
based environment for protein structure homology modelling. Bioinformatics. 22 (2006) 195-
201.
[32] Guo L, Gakhar Q, Wickersham K, Francis K, Vardi-Kilshtain A, Major DT, Cheatum
CM. Structural and kinetic studies of formate dehydrogenase from Candida boidinii.
Biochemistry. 55( 2016) 2760-71.
[33] DeLano WL. (2004). The PyMOL Molecular graphics system. DeLano Scientific San
Carlos, CA, USA. W.L.
[34] Dundas J, Ouyang Z, Tseng J, Binkowski A, Turpaz Y, Liang J. CASTp: computed atlas
of surface topography of proteins with structural and topographical mapping of functionally
annotated residues. Nucleic Acids Res. 34 (2006) 116-18.
[35] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search
tool. J Mol Biol. 215 (1990) 403-10.
[36] Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H,
Remmert M, Söding J, Thompson JD, Higgins DG. Fast, scalable generation of high-quality
21

protein multiple sequence alignments using Clustal Omega. Mol Syst Biol. 11
(2011) 539.
[37] Robert X, Gouet P. Deciphering key features in protein structures with the new
ENDscript server. Nucleic Acids Res. 42 (2014) 320-24.
[38] Bernstein FC, Koetzle TF, Williams GJ, Meyer Jr EE, Brice MD, Rodgers JR, Kennard
O, Shimanouchi T, Tasumi M. The Protein Data Bank: a computer-based archival file for
macromolecular structures. J Mol Biol. 112 (1977) 535-42.
[39] Labrou NE, Rigden DJ. Active-site characterization of Candida boidinii formate
dehydrogenase. Biochem. J 354 (2011) 455-63.
[40] Popov VO, Lamzin VS. NAD+-dependent formate dehydrogenase. Biochem J. 301
(1994) 625-43.
[41] Carugo O, Argos P. NADP-dependent enzymes. I: Conserved stereochemistry of
cofactor binding. Proteins. 28 (1997) 10-28.
[42] Scrutton NS, Berry A, Perham RN. Redesign of the coenzyme specificity of a
dehydrogenase by protein engineering. Nature. 343 (1990) 38-43.
[43] Andreadeli A, Platis D, Tishkov V, Popov V, Labrou NE. Structure‐guided alteration of
coenzyme specificity of formate dehydrogenase by saturation mutagenesis to enable efficient
utilization of NADP+. FEBS J. 275 (2008) 3859-69.
[44] Mesentsev AV, Lamzin VS, Tishkov VI, Ustinnikova TB, Popov VO. Effect of pH on
kinetic parameters of NAD+-dependent formate dehydrogenase. Biochem J. 321 (1997)
475-80.
[45] Tishkov VI, Popov VO. Catalytic mechanism and application of formate dehydrogenase.
Biochemistry (Moscow). 69 (2004) 1252–1267.
[46] Ding HT, Liu DF, Li ZL, Du YQ, Xu XH, Zhao YH. Characterization of a thermally
stable and organic solvent-adaptative NAD+ -dependent formate dehydrogenase from
Bacillus sp. F1. J Appl Microbiol. 2011 Nov;111(5):1075-85.
[47] Tishkov, V. I., Matorin, A. D., Rojkova, A. M., Fedorchuk, V. V., Savitsky, P. A.,
Dementieva, L. A., Lamzin, V. S., Mezentzev, A. V., and Popov, V. O. (1996) FEBS Lett.,
390, 104-108.
[48] Baack, R. D., Markwell, J., Herman, P. L., and Osterman, J. C. (2003) J. Plant Physiol.,
160, 445-450.
[49] Yoshimoto M, Kozono R, Tsubomura N. Liposomes as chaperone mimics with
controllable affinity toward heat-denatured formate dehydrogenase from Candida boidinii.
Langmuir. 2015 Jan 20;31(2):762-70.
22

[50] Slusarczyk H, Felber S, Kula MR, Pohl M. Stabilization of NAD-dependent formate
dehydrogenase from Candida boidinii by site-directed mutagenesis of cysteine residues. Eur J
Biochem. 2000 Mar;267(5):1280-9.
[51] Cao E, Chen Y, Cui Z, Foster PR. Effect of freezing and thawing rates on denaturation
of proteins in aqueous solutions. Biotechnol Bioeng. 2003 Jun 20;82(6):684-90.
[52] Aslan A.S, Valjakka J, Ruupunen J, Yildirim D, Turner N.J, Turunen O, Binay B.
Chaetomium thermophilum formate dehdyrogenase has high activity in the reduction of
hydrogen cabonate (HCO3)- to formate. PEDS. 30:1 (2017) 47-55.
23

Table 1. Kinetic and biochemical parameters of other well characterized FDH‟s
Formate
Km (mM)
NAD+
Bicarbonate
Km (mM)
NADH
(mM)
kcat
pH
Tm (°C)
References
Wild-type FDH source
Km (mM)
(s-1)
Myceliophthora thermophile
Candida boidinii
7.20±1.50
8.55±2.60
15.00±2.0
0.28±0.08
1.20±0.20
0.40±0.03
31.30±8.10
-
0.03±0.00
0.50±0.20
-
[a] 0.30±0.02
[b] 0.10±0.00
[c] 10.5
[d] 6.0
48
57
63
53
This study
0.10±0.03
0.11±0.00
0.00±0.00
[a] 1.10 ±0.10
[b]0.01±0.00
[c] 7.5
[d] 5.5
[23]
[3]
Pseudomonas sp. 101
[a] 10.00±0.00
[c] 7.0
[d] -
[b]
-
Thiobacillus sp. (KNK65MA)
9.23±3.98
0.26±0.08
[a] 1.77±0.44
[b] 0.32±0.05
[c] 6.5
[d] 5.5
[23]
Chaetomium thermophilum
Candida methylica
3.30 ± 0.26
1.80±0.01
0.32 ± 0.07
0.02 ± 0.00
0.02± 0.00
-
[a] 2.04 ± 0.46
[b] 0.02 ± 0.00
[c] 5.0
[d] 6.5
58
59
[12]
[50]
7.01 ± 0.37 0.78 ± 0.15
[a] 1.31 ± 0.02
[b] 0.00 ± 0.000
[c] 8.0
[d] 8.0
[50]
[50]
[a ] Kinetic parameters for formate oxidation, [b] Kinetic parameters for CO reduction, [c] Optimum pH when substrate is formate, [d] Optimum pH when substrate is CO
2
2
24

Table 2. The kinetic parameters of MtFDH.
Formate
NAD+
Bicarbonate NADH
kcat (s-1)
0.32±0.02
7.2±1.5
0.04
0.76±0.05
1.2±0.19
0.63
0.10±0.00 0.03±0.00
0.43±0.03 0.18±0.02
Km (mM)
kcat/Km (s-1mM-1)
0.23
0.17
25

Fig 1. A. Sequence alignments of MtFDH with other FDHs with crystallographic
determined structures. The alignments were produced using CLUSTAL Omega [36].
ESPript 3 [37] was used for the visualization of the alignments. PDB accession number for
FDHs are in brackets: CbFDH: Candida boidinii FDH (5DN9); AtFDH: Arabidopsis thaliana
FDH (3N7U); AcidFDH: acidophilic FDH from Thiobacillus sp. KNK65MA (3WR5);
PspFDH Pseudomonas sp. 101 FDH (2NAD). MspFDH: FDH from Moraxella sp.c2
(2GSD); GmFDH: FDH from Granulicella mallensis MP5ACTX8. Conserved areas are
shown shaded. A column is framed, if more than 70% of its residues are similar according to
physico-chemical properties. The secondary structure elements of MtFDH model is shown
above the alignments. Two additional sequences of CtFDH from Chaetomium thermophilum
var. thermophilum DSM 1495 (GenBank accession number: EGS17433) and CmFDH from
Candida methylica (Uniprot accession number: Q00498) were included. B. Phylogenetic
analysis of FDHs. The analysis was performed on the Phylogeny.fr platform using the
PhyML program (v3.0). The Phylogram was formed after alignment of the protein sequences
using CLUSTAL Omega [36].
26

A.
27

B.
28

Fig 2. A. SDS‐PAGE analysis of MtFDH expression and purification with Coomassie
Brilliant Blue staining. Lanes: M, Molecular weight marker; PC1: 1μg BSA, PC2: 2μg BSA
NC, Cell lysate without induction; 1, Cell lysate with induction for 16 h at 15 °C; 2, Cell
lysate with induction for 4 h at 37 °C; NC1, Supernatant of cell lysate non‐induced; NC2,
Pellet of cell lysate non‐induced; 3, Supernatant of cell lysate with induction for 16 h at 15
°C; 4, Pellet of cell lysate with induction for 16 h at 15 °C; 5, Supernatant of cell lysate with
induction for 4 h at 37 °C; 6, Pellet of cell lysate with induction for 4 h at 37 °C.
B. Western blotting analysis of MtFDH protein expression. Lanes: M, Molecular weight
marker; lanes1-6 are the same than in Fig. 1A.
C. SDS-PAGE of fractions from the affinity purification of MtFDH. Results are from
15% gel run. Lanes: CL, cell lysate; W, washing fraction; E1–E5, eluted fractions, M,
Molecular weight marker.
29