Pentamethylquercetin improves adiponectin expression in differentiated 3t3-l1 cells via a mechanism that implicates pparγ together with tnf-α and il-6

Article abstract of DOI:10.3390/molecules16075754

Adiponectin is an adipocyte-derived hormone that plays a pivotal role in the regulation of lipid and glucose metabolism. Up-regulation of adiponectin expression and production has been shown to benefit for metabolic disorders, including type 2 diabetes, hyperlipidemia, etc. The present study investigated whether the novel polymethoxylated flavonoid pentamethylquercetin (PMQ), a member of polymethoxylated flavonoids family which is present in seabuckthorn (Hippophae L.) would affect adiponectin production in differentiated 3T3-L1 adipocytes. It was found that PMQ increased the adiponectin mRNA and protein expressions in adipocytes in time- and concentration-dependent manners. The PPARγ pathway plays a important roles in this effect of PMQ because blockade of PPARγ by GW9662 eliminates the PMQ-induced up-regulation of adiponectin expression. Furthermore, significant decreases of mRNA expression and secretion of TNF-α and IL-6 were also observed in PMQ-treated cells. Taken together, our study demonstrated that PMQ up-regulates adiponectin expression via a mechanism that implicates PPARγ together with TNF-α and IL-6, suggesting that PMQ might be a potential candidate for the treatment of metabolic diseases.

Full text of DOI:10.3390/molecules16075754

Molecules 2011, 16, 5754-5768; doi:10.3390/molecules16075754
OPEN ACCESS
molecules
ISSN 1420-3049
www.mdpi.com/journal/molecules
Article
Pentamethylquercetin Improves Adiponectin Expression in
Differentiated 3T3-L1 Cells via a Mechanism that Implicates
PPARγ together with TNF-α and IL-6
Lei Chen, Ting He, Yi Han, Ji-Zhong Sheng, Si Jin and Man-Wen Jin *
Department of Pharmacology, Tongji Medical College, Huazhong University of Science and
Technology, Wuhan 430030, China; E-Mail: clean829940@sina.com (L.C.)
*
Author to whom correspondence should be addressed; E-Mail: tjmwjin@163.com;
Tel.: +86-027-62581360; Fax: +86-027-83692608.
Received: 18 April 2011; in revised form: 23 June 2011 / Accepted: 1 July 2011 /
Published: 6 July 2011
Abstract: Adiponectin is an adipocyte-derived hormone that plays a pivotal role in the
regulation of lipid and glucose metabolism. Up-regulation of adiponectin expression and
production has been shown to benefit for metabolic disorders, including type 2 diabetes,
hyperlipidemia, etc. The present study investigated whether the novel polymethoxylated
flavonoid pentamethylquercetin (PMQ), a member of polymethoxylated flavonoids family
which is present in seabuckthorn (Hippophae L.) would affect adiponectin production in
differentiated 3T3-L1 adipocytes. It was found that PMQ increased the adiponectin mRNA
and protein expressions in adipocytes in time- and concentration-dependent manners. The
PPARγ pathway plays a important roles in this effect of PMQ because blockade of PPARγ
by GW9662 eliminates the PMQ-induced up-regulation of adiponectin expression.
Furthermore, significant decreases of mRNA expression and secretion of TNF-α and IL-6
were also observed in PMQ-treated cells. Taken together, our study demonstrated that
PMQ up-regulates adiponectin expression via a mechanism that implicates PPARγ together
with TNF-α and IL-6, suggesting that PMQ might be a potential candidate for the treatment
of metabolic diseases.
Keywords: adiponectin; pentamethylquercetin (PMQ); 3T3-L1 adipocytes; PPARγ;
TNF-α; IL-6

Molecules 2011, 16
. Introduction
Obesity or excess accumulation of visceral fat increases the likelihood of various diseases,
5755
1
including heart disease, type 2 diabetes, hyperlipidemia, and osteoarthritis [1]. Numerous works over
the past decades have demonstrated that adipose tissue serves not only as the storage site of fat, but
also an active endocrine and paracrine organ secreting adipokines, which participate in diverse
metabolic processes [2]. Among the adipokines which were secreted by adipocytes, adiponectin has
been particularly studied. Adiponectin is an adipocyte-derived hormone that plays a pivotal role in the
regulation of lipid and glucose metabolism [3,4]. Physiologically, adiponectin stimulates fatty acid
oxidation and enhances insulin-sensitivity of peripheral organs, leading to increase of glucose uptake
and fatty acid oxidation in muscles [5,6]. It also exerts protective roles against chronic inflammatory
and atherosclerosis [7-10]. Furthermore, several lines of evidence have indicated that plasma
concentration of adiponectin is severely decreased in patients with obesity [11], type 2 diabetes, and
cardiovascular diseases [12,13]. Considering the important role of adiponectin in energy metabolism,
agents that up-regulate adiponectin expression and production may benefit obesity, insulin resistance,
type 2 diabetes and other related metabolic diseases.
Accumulated evidence suggests that a high intake of plant foods is associated with lower risk of
chronic diseases [14,15]. Recently, the flavonoids, a class of secondary metabolites extensively present
in a wide range of plant foods, have received substantial attention by its manifold biological roles.
Studies have shown that flavonoids protect tissues against chronic pathologies such as coronary events,
cardiovascular disease mortality, and diabetes [15-17]. Compared with flavonoids aglycone,
methoxylated flavonoids have higher intestinal absorption and are much more resistant to hepatic
metabolism [18]. Furthermore, polymethoxylated flavonoids (PMFs) have been shown to alleviate
metabolic disorders. For instance, nobiletin improves lipid and glucose homeostasis and modulates
adipokines in fructose-induced insulin resistant hamsters [19]. Results from in vitro experiments also
reveal that polymethoxylated flavones positively regulate adiponectin expression and production [20,21].
Polymethoxylated flavonoids have been shown to have better pharmacodynamic and
pharmacokinetic properties compared to their polyhydroxylated analogs, however, it is hard to obtain
large amounts of PMF from the natural world. Thus, we synthesized pentamethylquercetin (PMQ), a
nature polymethoxylated flavonoid present in the common seabuckthorn (Hippophae rhamnoides) [22]
and hypothesized that, in addition to myocardial protection effects [23], PMQ could regulate
adiponectin expression in 3T3-L1 adipocytes. In order to elucidate its potential mechanisms, we
investigated whether PPARγ, a key modulator of adiponectin production, played a role in this effect
of PMQ.
2
. Results and Discussion
2
.1. Structure Confirmation and Identification of Synthetic PMQ
1
The chemical structure of PMQ was showed in Figure 1. This structure was confirmed by H-NMR
1
3
and C-NMR (Table 1) and was concordant with data in previous reports [24,25]. PMQ was
quantified via HPLC analysis and the purity of PMQ reaches up to 99.5%.

Molecules 2011, 16
5756
Figure 1. Chemical structure of pentamethylquercetin (PMQ).
OMe
3'
OMe
4
'
2
'
1
O
8
MeO
9
2
3
5'
1
'
7
6
6
'
1
0
OMe
4
5
OMe
O
1
13
Table 1. H- (500 MHz) and C-NMR (125 MHz) data of PMQ (CDCl3).
1
3
1
C-NMR
H-NMR
Position
δC
δH
1
2
3
4
5
6
7
8
9
-
-
-
-
-
-
2
152.5 sp
141.1 sp
173.9 sp
158.7 sp
95.7 sp
163.8 sp
2
2
2
2
6.343–6.348 d
2
-
2
92.3 sp
6.502–6.508 d
2
160.9 sp
109.4 sp
123.3 sp
111.1 sp
148.6 sp
150.7 sp
110.7 sp
121.5 sp
-
-
-
2
2
2
2
2
2
2
1
0
1
2
3
4
5
6
’
’
’
’
’
’
7.715 s
-
-
6.968–6.911 d
7.697–7.715 d
3.847–3.989 m
3
3
3
3
3
5
X-OCH
3
55.7 sp
5
5
5
5
5.9 sp
6.0 sp
6.3 sp
9.9 sp
2
.2. Adipogenesis in Mouse 3T3-L1 Preadipocytes and the Effects of PMQ on Cytotoxicity and Lipid
Content in Maturate Adipocyte
Preadipocytes were cultured in medium until they reached confluency and were induced to
differentiate for 10 days. Figure 2A illustrates the process during which mouse 3T3-L1 preadipocytes
differentiated into mature adipocytes. Images showed cells stained by Oil Red O at day 0, 4, 8, 10. At
day 10, cells were incubated with various concentrations of PMQ for 24 hours. We did not find any
detrimental effect of PMQ on cell viability at concentrations ranging from 0.1 to 10 μM when
incubating cells for 24 hours (P > 0.05 vs. vehicle) (Figure 2B). PMQ also did not show any effects on
lipid content in maturate adipocytes (P > 0.05 vs. vehicle) (Figure 2C).

Molecules 2011, 16
Figure 2. Representative morphological images of lipid uptake in cells stained by Oil Red
5757
O at day 0, 4, 8, 10 (panel A). Cells were induced to differentiate as described in the
Experimental section. Panel (B) shows that incubating cells with PMQ for 24 hours did not
exhibit any detrimental effect on cell viability at concentrations ranging from 0.1 to 10 μM
on day 10.
Values are expressed as means ± SD, n = 6. Panel (C) shows the effect of of PMQ on lipid content
in maturate adipocytes. Differentiated 3T3-L1 adipocytes were treated with 0.1% DMSO, 0.1, 0.3,
1
, 3, 10 μM PMQ for 24 hours. Then cells were stained by Oil Red O. After washing, Oil Red O
was extracted by isopropanol and its optical density was monitored spectrophotometrically at 490
nm. Values are expressed as means ± SD. n = 6 for each group.
2
.3. Effect of PMQ on Adiponectin Expression in 3T3-L1 Adipocytes
Figures 3 show the effects of PMQ on adiponectin mRNA and protein expressions in differentiated
T3-L1 adipocytes. We found that PMQ increased adiponectin mRNA expression in a time-dependent
3
manner (Figure 3A). This increase started at 6 hours after PMQ treatment and reached a peak level at
4 hours. Western blot analysis with an anti-adiponectin antibody revealed that the level of adiponectin
2
protein significantly increased at 12 hours, but not at 3 or 6 hours after PMQ treatment, compared to 0
hours controls (Figure 3B). Figure 3C showed representative RT-PCR results of differentiated 3T3-L1
cells treated with various concentrations of PMQ (0.1, 0.3, 1, 3 and 10 μM) for 24 hours, with 0.1%
DMSO treated cells as controls. It was found that PMQ increased adiponectin mRNA (P < 0.05)
expression at the concentrations of 1, 3 and 10 μM, but not at 0.1 and 0.3 μM (Figure 3C). Results

Molecules 2011, 16
5758
from Western blot analysis also confirmed the dose-dependent change in adiponectin protein
expression after PMQ treatment (Figure 3D).
Figure 3. Effects of PMQ on adiponectin mRNA and protein expression in 3T3-L1
adipocytes. A. RT-PCR images and semi-quantatative values of adiponectin mRNA level
in 3T3-L1 adipocytes treated with PMQ (3 μM) for 0, 3, 6, 12, 24, 48 hours. B. Western
blot images and semi-quantatative values of adiponectin protein level in 3T3-L1
adipocytes. C. RT-PCR images and semi-quantatative values of adiponectin mRNA level
in 3T3-L1 adipocytes treated with different concentrations of PMQ or vehicle for 24 hours.
D. Western blot images and semi-quantatative value of adiponectin protein level in 3T3-L1
adipocytes.
Values are expressed as means ± SD. n = 3 for each group, * P < 0.05 and ** P < 0.01 vs. vehicle group.
2
.4. PMQ Regulates Adiponectin Expression via PPARγ Pathway
PPARγ is a pivotal modulator for adiponectin production in adipocytes. In the current study, we
investigated whether PPARγ pathway were involved in the effect of PMQ on adiponectin regulation in

Molecules 2011, 16
5759
3
T3-L1 adipocytes. RT-PCR and Western blot analysis revealed that PMQ significantly increased the
PPARγ mRNA and protein expressions in adipocytes at concentrations above 1 μM (Figure 4).
Figure 4. Effects of PMQ on PPARγ mRNA and protein expression in 3T3-L1 adipocytes.
A. RT-PCR images and semi-quantatative values of PPARγ in 3T3-L1 adipocytes treated
with different concentrations of PMQ or vehicle. B. Western blot images and semi-
quantatative values of PPARγ protein level in 3T3-L1 adipocytes.
Values are expressed as means ± SD. n = 3, *P < 0.05 and **P < 0.01 vs. vehicle group.
Figure 5. Effects of PPARγ inhibitor GW9662 on PMQ-induced adiponectin expression in
3
3
T3-L1 adipocytes. A. RT-PCR images and semi-quantatative values of adiponectin in
T3-L1 adipocytes treated with PMQ (3 μM), either with or without GW9662 (10 μM.). B.
Western blot images and semi-quantatative values of adiponectin protein level in 3T3-L1
adipocytes.
Values are expressed as means ± SD. n = 3 for each group. * P < 0.05 and ** P < 0.01 vs. PMQ
treated group.

Molecules 2011, 16
5760
GW9662, an inhibitor of PPARγ, was applied in order to corroborate this observation. Figure 5
shows the mRNA and protein levels of adiponectin in 3T3-L1 adipocytes treated with vehicle, PMQ,
GW9662 and GW9662 + PMQ. We showed that treating cells with 10 μM GW9662 alone had no
effect on adiponectin expression. However, GW9662 could significantly attenuate PMQ-induced
increase of adiponectin in mRNA and protein levels (Figure 5). These results indicated that PPARγ
pathway mediates the increase of adiponectin expression induced by PMQ.
2
.5. Effects of PMQ on Expression and Secretion of TNF-α and IL-6
Both TNF-α and IL-6 are negative regulators of adiponectin expression [26,27]. Here we
investigated whether PMQ also modulated the expressions of TNF-α and IL-6 in 3T3-L1 adipocytes.
RT-PCR analysis revealed that PMQ decreased mRNA expression of TNF-α and IL-6 in a
concentration-dependent manner, with the peak change at 3 and 10 μM (Figures 6A and B). Results
from ELISA detection also showed that secretion of TNF-α and IL-6 in culture medium decreased
significantly in cells treated with PMQ. These data suggested that TNF-α and IL-6 were also involved
in PMQ-induced adiponectin expression (Figures 6C and D).
Figure 6. Effects of PMQ on TNF-α and IL-6 mRNA expression and secretion in 3T3-L1
adipocytes. A. RT-PCR images and semi-quantatative values of TNF-α in 3T3-L1
adipocytes treated with different concentrations of PMQ or vehicle. B. RT-PCR images
and semi-quantatative values of IL-6. Values are expressed as means ± SD. n = 3 for each
group. * P＜ 0.05, ** P＜ 0.01 vs. vehicle. C. Quantitative value of TNF-α secretion in
culture medium by ELISA kits. D. IL-6 secretion in culture medium. Data are expressed
as % (means ± SD) of three separate samples each performed in duplicate. n = 3 for each
group, *P＜ 0.05 vs. vehicle group.

Molecules 2011, 16
5761
Figure 6. Cont.
In the present study, we have demonstrated that the synthetic polymethoxylated flavonoid
pentamethylquercetin (PMQ) increased adiponectin expression in differentiated 3T3-L1 adipocytes in
time- and dose-dependent manners. This effect is mediated by PPARγ pathway because blockade of
PPARγ by GW9662 eliminates PMQ-induced increase of adiponectin production. Furthermore, TNF-α
and IL-6 are also involved in PMQ-mediated up-regulation of adiponectin expression. Considering the
important role of adiponectin in energy metabolism, we postulate that PMQ treatment may benefit
obesity, insulin resistance, type 2 diabetes and other related metabolic diseases.
Obesity is a pandemic health problem in both developed and developing countries, which increases
the risks of many common diseases, including coronary artery disease (CAD), type 2 diabetes,
hypertension, gall bladder disease, and osteoarthritis [28]. Plasma adiponectin is found to be lower in
obese human subjects, and reducing body weight is helpful for improving plasma adiponectin level
[
11,29]. Furthermore, the steady state mRNA of adiponectin was found to be down-regulated in ob/ob
mice, suggesting the relationship between obesity and adiponectin expression [4]. Correspondingly,
deletion of the mouse adiponectin gene, which induces low plasma adiponectin levels, is associated
with metabolic syndrome including insulin-resistant diabetes and atherosclerotic disease [30].
Considering its extensive beneficial effects in diabetes, atherosclerotic, inflammation etc, adiponectin
is deemed as a new target for treatment of metabolic syndrome. Some pharmaceutical companies have
attempted syntheses of adiponectin, however, no synthetic adiponectin with in vivo bioactivity has
been obtained so far. Therefore, it is of great clinical significance to search a new medicine which can
stimulate the production of endogenous adiponectin. In this study, we show that polymethoxylated
flavonoid pentamethylquercetin (PMQ) increase adiponectin mRNA expression and intracellular
content in 3T3-L1 adipocytes, suggesting that PMQ could be a potential candidate for the treatment of
obesity, metabolic syndrome, and type 2 diabetes.
PPARγ is a type II nuclear receptor that in humans is encoded by the PPARγ gene and plays a
significant role in mediating insulin sensitivity [31]. It regulates fatty acid storage and glucose
metabolism by regulating the transcription of many adipocyte-specific genes to stimulate lipid uptake
and adipogenesis in fat cells. A large body of evidence confirms that PPARγ, mainly expressed in
adipose tissue, is a positive regulator of adiponectin gene expression. For instance, adipose-tissue-
specific deletion of the PPARγ gene exhibits a decay of plasma adiponectin levels in mice [32].

Molecules 2011, 16
5762
Thiazolidinediones (TZDs), a well-known PPARγ agonist, stimulates adiponectin transcription both in
vitro and in vivo [33,34]. In addition, both human [35] and mouse [36] adiponectin promoters contain a
putative PPAR-responsive element (PPRE) and point mutations at this site lead to reduced basal and
TZD-induced adiponectin promoter transactivation [35]. These suggest that PPARγ may enhance
cellular adiponectin level by acting directly on its promoter. Herein, for the first time, we report that
PMQ enhances PPARγ mRNA and protein levels, and PPARγ antagonist GW9662 abolishs the
increase of adiponectin mRNA and protein level induced by PMQ. Although the exact mechanism
through which PMQ modulates PPARγ remains unknown, these data still strongly suggest that PMQ
regulates adiponectin production via a PPARγ-dependent manner.
TNF-α and IL-6 are negative regulators of adiponectin expression. Serum concentration of IL-6 is
elevated in insulin-resistant states such as obesity [37-39], impaired glucose tolerance [40] and type 2
diabetes [41,42]. Furthermore, IL-6 treatment suppresses mRNA levels and secretion of adiponectin in
3T3-L1 adipocytes [26], suggesting a negative role of IL-6 in the modulation of adiponectin levels and
insulin sensitivity. Previous studies have shown that TNF-α down-regulates adiponectin gene
expression in adipocytes by suppressing the expression of activators involved in promoting
adiponectin gene expression, such as PPARγ [43], C/EBP [44,45]. This suppressive effect of TNF-α on
adiponectin transcription may be mediated by JNK (c-Jun N-terminal kinase), which has been shown
to phosphorylate PPARγ and decrease its DNA-binding activity [27,46]. Our present study showed that
PMQ treatment significantly decreased TNF-α and IL-6 mRNA expressions and secretions in 3T3-L1
adipocytes, suggested that TNF-α and IL-6 may be involved in PMQ-induced adiponectin expression.
As mentioned above that TNF-α suppresses the expression of PPARγ, it suggests that PMQ might
enhance adiponectin expression through decreasing the repressive effect of TNF-α on PPARγ pathway.
3. Experimental
3.1. Chemicals
Quercetin was obtained from Sewoer Industry and Trade Co., Ltd. (Hangzhou, China). Acetone,
sodium hydroxide and anhydrous potassium were obtained from Sinopharm Chemical Reagent Co.,
Ltd. (Beijing, China). Dimethyl sulfate was obtained from Kelong Chemical Reagent Factory
(
Chengdu, China). Isobutyl-3-methylxanthine (IBMX), GW9662, wortmannin, dexamethasone, insulin
and Oil Red O were obtained from Sigma-Aldrich Chemical Co. (St Louis, MO, USA). Dulbecco’s
modified Eagle’s medium (DMEM) was purchased from Gibco (Invitrogen, Carlsbad, CA, USA) and
fetal bovine serum (FBS) was purchased from Sijiqing (Hangzhou, China). Anti-PPARγ rabbit IgG ,
anti-β-actin mouse IgG and anti-adiponectin goat IgG were obtained from Santa Cruz Biotechnologies
(Santa Cruz, CA, USA). HRP-linked anti-rabbit IgG, anti-mouse IgG and anti-goat IgG were obtained
from Pierce (Thermo Scientific, Rockford, IL, USA). ELISA Kits for TNF-α and IL-6 were obtained
from R&D Systems (Minneapolis, MN, USA).
3
.2. Preparation of Pentamethylquercetin
Firstly, we converted quercetin into 3,7,3’,4’-tetramethylquercetin by heating to 50 °C with acetone,
dimethyl sulfate and anhydrous potassium carbonate for 7 hours. Pentamethylquercetin (PMQ) is

Molecules 2011, 16
5763
obtained through the agency of additional dimethyl sulfate and sodium hydroxide added after 2 hours.
1
13
The structure of the end product was confirmed by mass spectrometry, H-NMR and C-NMR. The
purity of PMQ was examined by high performance liquid chromatography and reached 99.5% after
being recrystallized twice from anhydrous alcohol.
3.3. Cell Culture and Treatment
Mouse 3T3-L1 preadipocytes from American Type Culture Collection (Manassas, VA, USA), were
cultured in DMEM containing 25 mM glucose supplemented with 10% bovine serum at 37 °C in a
humidified atmosphere with 5% CO . Cells were subcultured every 3–4 days at approximately 90%
2
confluence and cells were plated at a density that allowed them to reach confluence in 2 days.
Completely confluent plates were incubated in DMEM containing 10% FBS with 0.5 μM 3-isobutyl-1-
methylxanthine (IBMX), 0.25 μM dexamethasone and 10 μg/mL insulin.Two days after incubation,
the medium was replaced with DMEM containing 10 μg/ml insulin. Thereafter, cells were maintained
in the original propagation DMEM with medium changes every 2–3 days, the differentiation was
completed at day 10. At day 10, cells were incubated with various concentrations of PMQ or vehicle
for 24 hours. 3T3-L1 cells differentiated for 10 days were incubated for 24 hours with PMQ (3 μM.),
either with or without GW9662 (10 μM.).
3
.4. Oil Red O Staining
Adipocyte differentiation was monitored by measurement of lipid accumulation through staining of
neutral fats and cholesterol esters with Oil Red O. Cells were fixed with 4% formalin for 5 min, and
stained for 10 min in freshly diluted Oil Red O solution (0.5%). After washing, Oil Red O was
extracted by isopropanol and its optical density was monitored spectrophotometrically at 490 nm.
3
.5. Cell Viability Assay
Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
(
MTT) assay. 3T3-L1 cells were plated into 96-well until they reached confluency and quiescent. Then
the cells were induced to differentiate for 10 days. The maturate adipocytes were switched to a culture
medium containing PMQ for 24 h and then PBS-buffered MTT (20 μL, 5 mg/mL) solution was added
to each well and the plates were incubated at 37 °C for additional 4 h. The medium was then removed,
and 100 μL/well DMSO was applied to each well to dissolve the purple formazan crystals. The plates
were read (wavelengths: test, 492 nm; reference, 570, 630 nm) using a microplate spectrophotometer
(
Tecan, Genois Ltd, Männedorf, Switzerland). Results were standardized using vehicle group values.
3
.6. Reverse Transcription-Polymerase Chain Reaction
Total RNA of 3T3-L1 cells was extracted using Trizol reagent (Invitrogen) following the
manufacturer’s instruction. Reverse transcription (RT) was performed with the RT system (Promega)
protocol in a 50 μL reaction mixture using oligo(dT)18 primers. After the RT procedure, the reaction
mixture (cDNA) was used for polymerase chain reaction (PCR). Primers of corresponding genes are
shown in Table 2. The reaction was conducted with the following protocol: initial denaturing of the

Molecules 2011, 16
5764
template for 5 minutes at 94 °C followed by 40 repeating cycles of denaturing for 30 seconds at 94 °C,
annealing for 30 seconds at 50–63 °C, extension for 1 minute at 72 °C, and a final elongation at 72 °C
for 10 minutes. The PCR products were size-fractionated by 2.5% agarose gel electrophoresis and
visualized by SYBR Green I (Solarbio) staining.
Table 2. Mouse gene-specific primers for RT-PCR.
Gene
Sequences (5’ -3’)
Forward: ACTGCCTATGAGCACTTCAC
Reverse: CAATCGGATGGTTCTTCGGA
Forward:
GGGTGAGACAGGAGATGTTGGAATG
Reverse:
GCCAGTAAATGTAGAGTCGTTGACG
Forward: AGTTGCCTTCTTGGGACTGA
Reverse: GCCACTCCTTCTGTGACTCC
Forward:
TGGAGTCATTGCTCTGTGAAGGGA
Reverse:
Accession No Length (bp)
PPARγ
NM_011146
NM_009605
NM_031168
NM_013693
448
478
521
250
Adiponectin
IL-6
TNF-α
AGTCCTTGATGGTGGTGCATGAGA
Forward:
GAPDH
GACAAAATGGTGAAGGTCGGTG
Reverse: TGATGTTAGTGGGGTCTCGCTC
NM_008084
256
3.7. Western Blotting
Cells were harvested and lysed in RIPA buffer containing 150 mM NaCl, 1% NP-40, 0.5% sodium
deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 50 mM Tris–HCl (pH 7.4), 50 mM
glycerophosphate, 20 mM NaF, 20 mM EGTA, 1 mM DTT, 1 mM Na VO , 1 mM
3
4
phenylmethylsulfonyl fluoride, and protease inhibitors. Total cell proteins were separated by 12%
SDS–polyacrylamide gel electrophoresis, transferred to a polyvinylidene fluoride membrane, and then
hybridized with primary antibodies (diluted 1:400–1,000) overnight at 4 °C. After incubation with
horseradish-peroxidase-conjugated secondary antibody (diluted 1:3,000) for 1 h at room temperature,
immunoreactive proteins were visualized using an enhanced chemiluminescent reagent (Amersham
Pharmacia Biotech, Piscataway, NJ, USA).
3
.8. ELISIA
Secretion of TNF-α and IL-6 was determined by the ELISA Quantikine Mouse TNF-α and IL-6
Immunoassay (R&D Systems, Minneapolis, MN), according to the manufacturer's instruction.
3
.9. Statistical Analysis
Data are expressed as means ± SD. One-way ANOVA followed by Student’s two-tailed unpaired
t-test was used for the statistical analysis by SPSS 11.0 software. Values of P < 0.05 were considered
to indicate statistical significance.

Molecules 2011, 16
. Conclusions
The data herein presented demonstrates that pentamethylquercetin (PMQ), a synthetic
5765
4
polymethoxylated flavonoid, improved adiponectin mRNA expression and protein levels in 3T3-L1
adipocytes. This effect is related to enhanced PPARγ function and down-regulated TNF-α and IL-6.
Our study raises a novel finding that PMQ could be a promising new candidate for the treatment of
metabolic diseases in the future.
Acknowledgements
This study was supported by grants from Natural Science Foundation of China (no. 30772575) .We
thank GuiRong Li for the helpful comments on the manuscript and Yan Hu for the excellent
technical assistance.
References and Notes
1
2
.
.
Haslam, D.W.; James, W.P. Obesity. Lancet 2005, 366, 1197-1209.
Szmitko, P.E.; Teoh, H.; Stewart, D.J.; Verma, S. Adiponectin and cardiovascular disease: State
of the art? Am. J. Physiol. Heart Circ. Physiol. 2007, 292, H1655-H1663.
3
4
5
.
.
.
Scherer, P.E.; Williams, S.; Fogliano, M.; Baldini, G.; Lodish, H.F. A novel serum protein similar
to C1q, produced exclusively in adipocytes. J. Biol. Chem. 1995, 270, 26746-26749.
Hu, E.; Liang, P.; Spiegelman, B.M. AdipoQ is a novel adipose-specific gene dysregulated in
obesity. J. Biol. Chem. 1996, 271, 10697-10703.
Lara-Castro, C.; Fu, Y.; Chung, B.H.; Garvey, W.T. Adiponectin and the metabolic syndrome:
Mechanisms mediating risk for metabolic and cardiovascular disease. Curr. Opin. Lipidol. 2007,
1
8, 263-270.
Oh, D.K.; Ciaraldi, T.; Henry, R.R. Adiponectin in health and disease. Diabetes Obes. Metab.
007, 9, 282-289.
6
.
.
2
7
Matsuda, M.; Shimomura, I.; Sata, M.; Arita, Y.; Nishida, M.; Maeda, N.; Kumada, M.; Okamoto, Y.;
Nagaretani, H.; Nishizawa, H.; et al. Role of adiponectin in preventing vascular stenosis. The
missing link of adipo-vascular axis. J. Biol. Chem. 2002, 277, 37487-37491.
8
9
1
.
.
Ouchi, N.; Kihara, S.; Arita, Y.; Nishida, M.; Matsuyama, A.; Okamoto, Y.; Ishigami, M.;
Kuriyama, H.; Kishida, K.; Nishizawa, H.; et al. Adipocyte-derived plasma protein, adiponectin,
suppresses lipid accumulation and class A scavenger receptor expression in human monocyte-
derived macrophages. Circulation 2001, 103, 1057-1063.
Ouchi, N.; Kihara, S.; Arita, Y.; Okamoto, Y.; Maeda, K.; Kuriyama, H.; Hotta, K.; Nishida, M.;
Takahashi, M.; Muraguchi, M.; et al. Adiponectin, an adipocyte-derived plasma protein, inhibits
endothelial NF-kappaB signaling through a cAMP-dependent pathway. Circulation 2000, 102,
1
296-1301.
0. Ouchi, N.; Kihara, S.; Funahashi, T.; Nakamura, T.; Nishida, M.; Kumada, M.; Okamoto, Y.;
Ohashi, K.; Nagaretani, H.; Kishida, K.; et al. Reciprocal association of C-reactive protein with
adiponectin in blood stream and adipose tissue. Circulation 2003, 107, 671-674.

Molecules 2011, 16
5766
11. Arita, Y.; Kihara, S.; Ouchi, N.; Takahashi, M.; Maeda, K.; Miyagawa, J.; Hotta, K.; Shimomura, I.;
Nakamura, T.; Miyaoka, K.; et al. Paradoxical decrease of an adipose-specific protein, adiponectin,
in obesity. Biochem. Biophys. Res. Commun. 1999, 257, 79-83.
1
1
2. Matsubara, M.; Maruoka, S.; Katayose, S. Decreased plasma adiponectin concentrations in
women with dyslipidemia. J. Clin. Endocrinol. Metab. 2002, 87, 2764-2769.
3. Hotta, K.; Funahashi, T.; Arita, Y.; Takahashi, M.; Matsuda, M.; Okamoto, Y.; Iwahashi, H.;
Kuriyama, H.; Ouchi, N.; Maeda, K.; et al. Plasma concentrations of a novel, adipose-specific
protein, adiponectin, in type 2 diabetic patients. Arterioscler Thromb. Vasc. Biol. 2000, 20,
1
595-1599.
4. Serafini, M.; Peluso, I.; Raguzzini, A. Flavonoids as anti-inflammatory agents. Proc. Nutr. Soc.
006, 69, 273-278.
1
1
2
5. Knekt, P.; Kumpulainen, J.; Jarvinen, R.; Rissanen, H.; Heliovaara, M.; Reunanen, A.;
Hakulinen, T.; Aromaa, A. Flavonoid intake and risk of chronic diseases. Am. J. Clin. Nutr. 2002,
7
6, 560-568.
1
1
6. Hertog, M.G.; Feskens, E.J.; Hollman, P.C.; Katan, M.B.; Kromhout, D. Dietary antioxidant
flavonoids and risk of coronary heart disease: The Zutphen Elderly Study. Lancet 1993, 342,
1
007-1011.
7. Mink, P.J.; Scrafford, C.G.; Barraj, L.M.; Harnack, L.; Hong, C.P.; Nettleton, J.A.; Jacobs, D.R., Jr.
Flavonoid intake and cardiovascular disease mortality: A prospective study in postmenopausal
women. Am. J. Clin. Nutr. 2007, 85, 895-909.
1
8. Walle, U.K.; Walle, T. Bioavailable flavonoids: Cytochrome P450-mediated metabolism of
methoxyflavones. Drug Metab. Dispos. 2007, 35, 1985-1989.
1
9. Li, R.W.; Theriault, A.G.; Au, K.; Douglas, T.D.; Casaschi, A.; Kurowska, E.M.; Mukherjee, R.
Citrus polymethoxylated flavones improve lipid and glucose homeostasis and modulate
adipocytokines in fructose-induced insulin resistant hamsters. Life Sci. 2006, 79, 365-373.
0. Liu, L.; Shan, S.; Zhang, K.; Ning, Z.Q.; Lu, X.P.; Cheng, Y.Y. Naringenin and hesperetin, two
flavonoids derived from Citrus aurantium up-regulate transcription of adiponectin. Phytother. Res.
2
2
2
2
2
008, 22, 1400-1403.
1. Kunimasa, K.; Kuranuki, S.; Matsuura, N.; Iwasaki, N.; Ikeda, M.; Ito, A.; Sashida, Y.;
Mimaki, Y.; Yano, M.; Sato, M.; et al. Identification of nobiletin, a polymethoxyflavonoid, as an
enhancer of adiponectin secretion. Bioorg. Med. Chem. Lett. 2009, 19, 2062-2064.
2. Hibasami, H.; Mitani, A.; Katsuzaki, H.; Imai, K.; Yoshioka, K.; Komiya, T. Isolation of five
types of flavonol from seabuckthorn (Hippophae rhamnoides) and induction of apoptosis by some
of the flavonols in human promyelotic leukemia HL-60 cells. Int. J. Mol. Med. 2005, 15, 805-809.
3. Mao, Z.; Liang, Y.; Du, X.; Sun, Z. 3,3',4',5,7-Pentamethylquercetin reduces angiotensin II-
induced cardiac hypertrophy and apoptosis in rats. Can. J. Physiol. Pharmacol. 2009, 87,
7
20-728.
2
2
4. Dong, H.; Gou, Y.-L.; Cao, S.-G.; Chen, S.-X.; Sim, K.-Y.; Goh, S.-H.; Kini, R.M. Eicosenones
and methylated flavonols from Amomumkoenigii Phytochemistry 1999, 50, 899-902.
5. Heijnen, C.G.M.; Haenen, G.R.M.M.; Vekemansb, J.A.J.M.; Basta, A. Peroxynitrite scavenging
of flavonoids: Structure activity relationship. Environ. Toxicol. Pharmacol. 2001, 10, 199-206.

Molecules 2011, 16
5767
2
2
6. Fasshauer, M.; Kralisch, S.; Klier, M.; Lossner, U.; Bluher, M.; Klein, J.; Paschke, R. Adiponectin
gene expression and secretion is inhibited by interleukin-6 in 3T3-L1 adipocytes. Biochem.
Biophys. Res. Commun. 2003, 301, 1045-1050.
7. Kim, K.Y.; Kim, J.K.; Jeon, J.H.; Yoon, S.R.; Choi, I.; Yang, Y. c-Jun N-terminal kinase is
involved in the suppression of adiponectin expression by TNF-alpha in 3T3-L1 adipocytes.
Biochem. Biophys. Res. Commun. 2005, 327, 460-467.
2
2
8. Must, A.; Spadano, J.; Coakley, E.H.; Field, A.E.; Colditz, G.; Dietz, W.H. The disease burden
associated with overweight and obesity. JAMA 1999, 282, 1523-1529.
9. Yang, W.S.; Lee, W.J.; Funahashi, T.; Tanaka, S.; Matsuzawa, Y.; Chao, C.L.; Chen, C.L.;
Tai, T.Y.; Chuang, L.M. Weight reduction increases plasma levels of an adipose-derived anti-
inflammatory protein, adiponectin. J. Clin. Endocrinol. Metab. 2001, 86, 3815-3819.
0. Kondo, H.; Shimomura, I.; Matsukawa, Y.; Kumada, M.; Takahashi, M.; Matsuda, M.; Ouchi, N.;
Kihara, S.; Kawamoto, T.; Sumitsuji, S.; Funahashi, T.; Matsuzawa, Y. Association of
adiponectin mutation with type 2 diabetes: A candidate gene for the insulin resistance syndrome.
Diabetes 2002, 51, 2325-2328.
3
3
3
1. Michalik, L.; Auwerx, J.; Berger, J.P.; Chatterjee, V.K.; Glass, C.K.; Gonzalez, F.J.;
Grimaldi, P.A.; Kadowaki, T.; Lazar, M.A.; O'Rahilly, S.; et al. International Union of
Pharmacology. LXI. Peroxisome proliferator-activated receptors. Pharmacol. Rev. 2006, 58,
7
26-741.
2. He, W.; Barak, Y.; Hevener, A.; Olson, P.; Liao, D.; Le, J.; Nelson, M.; Ong, E.; Olefsky, J.M.;
Evans, R.M. Adipose-specific peroxisome proliferator-activated receptor gamma knockout causes
insulin resistance in fat and liver but not in muscle. Proc. Natl. Acad. Sci. USA 2003, 100,
1
5712-15717.
3
3
3. Yu, J.G.; Javorschi, S.; Hevener, A.L.; Kruszynska, Y.T.; Norman, R.A.; Sinha, M.; Olefsky, J.M.
The effect of thiazolidinediones on plasma adiponectin levels in normal, obese, and type 2
diabetic subjects. Diabetes 2002, 51, 2968-2974.
4. Kanatani, Y.; Usui, I.; Ishizuka, K.; Bukhari, A.; Fujisaka, S.; Urakaze, M.; Haruta, T.;
Kishimoto, T.; Naka, T.; Kobayashi, M. Effects of pioglitazone on suppressor of cytokine
signaling 3 expression: Potential mechanisms for its effects on insulin sensitivity and adiponectin
expression. Diabetes 2007, 56, 795-803.
3
5. Iwaki, M.; Matsuda, M.; Maeda, N.; Funahashi, T.; Matsuzawa, Y.; Makishima, M.; Shimomura, I.
Induction of adiponectin, a fat-derived antidiabetic and antiatherogenic factor, by nuclear
receptors. Diabetes 2003, 52, 1655-1663.
3
6. Seo, J.B.; Moon, H.M.; Noh, M.J.; Lee, Y.S.; Jeong, H.W.; Yoo, E.J.; Kim, W.S.; Park, J.;
Youn, B.S.; Kim, J.W.; et al. Adipocyte determination- and differentiation-dependent factor
1
/sterol regulatory element-binding protein 1c regulates mouse adiponectin expression. J. Biol.
Chem. 2004, 279, 22108-22117.
3
7. Fernandez-Real, J.M.; Vayreda, M.; Richart, C.; Gutierrez, C.; Broch, M.; Vendrell, J.; Ricart, W.
Circulating interleukin 6 levels, blood pressure, and insulin sensitivity in apparently healthy men
and women. J. Clin. Endocrinol. Metab. 2001, 86, 1154-1159.

Molecules 2011, 16
5768
3
3
4
8. Mohamed-Ali, V.; Goodrick, S.; Rawesh, A.; Katz, D.R.; Miles, J.M.; Yudkin, J.S.; Klein, S.;
Coppack, S.W. Subcutaneous adipose tissue releases interleukin-6, but not tumor necrosis factor-
alpha, in vivo. J. Clin. Endocrinol. Metab. 1997, 82, 4196-4200.
9. Straub, R.H.; Hense, H.W.; Andus, T.; Scholmerich, J.; Riegger, G.A.; Schunkert, H. Hormone
replacement therapy and interrelation between serum interleukin-6 and body mass index in
postmenopausal women: A population-based study. J. Clin. Endocrinol. Metab. 2000, 85, 1340-1344.
0. Muller, S.; Martin, S.; Koenig, W.; Hanifi-Moghaddam, P.; Rathmann, W.; Haastert, B.;
Giani, G.; Illig, T.; Thorand, B.; Kolb, H. Impaired glucose tolerance is associated with increased
serum concentrations of interleukin 6 and co-regulated acute-phase proteins but not TNF-alpha or
its receptors. Diabetologia 2002, 45, 805-812.
4
4
4
1. Kado, S.; Nagase, T.; Nagata, N. Circulating levels of interleukin-6, its soluble receptor and
interleukin-6/interleukin-6 receptor complexes in patients with type 2 diabetes mellitus. Acta
Diabetol. 1999, 36, 67-72.
2. Pickup, J.C.; Mattock, M.B.; Chusney, G.D.; Burt, D. NIDDM as a disease of the innate immune
system: Association of acute-phase reactants and interleukin-6 with metabolic syndrome X.
Diabetologia 1997, 40, 1286-1292.
3. Zhang, B.; Berger, J.; Hu, E.; Szalkowski, D.; White-Carrington, S.; Spiegelman, B.M.;
Moller, D.E. Negative regulation of peroxisome proliferator-activated receptor-gamma gene
expression contributes to the antiadipogenic effects of tumor necrosis factor-alpha. Mol.
Endocrinol. 1996, 10, 1457-1466.
4
4. Kita, A.; Yamasaki, H.; Kuwahara, H.; Moriuchi, A.; Fukushima, K.; Kobayashi, M.;
Fukushima, T.; Takahashi, R.; Abiru, N.; Uotani, S.; Kawasaki, E.; Eguchi, K. Identification of
the promoter region required for human adiponectin gene transcription: Association with
CCAAT/enhancer binding protein-beta and tumor necrosis factor-alpha. Biochem. Biophys. Res.
Commun. 2005, 331, 484-490.
4
5. Ron, D.; Brasier, A.R.; McGehee, R.E., Jr.; Habener, J.F. Tumor necrosis factor-induced reversal
of adipocytic phenotype of 3T3-L1 cells is preceded by a loss of nuclear CCAAT/enhancer
binding protein (C/EBP). J. Clin. Invest. 1992, 89, 223-233.
4
6. Lim, J.Y.; Kim, W.H.; Park, S.I. GO6976 prevents TNF-alpha-induced suppression of adiponectin
expression in 3T3-L1 adipocytes: Putative involvement of protein kinase C. FEBS Lett. 2008,
5
82, 3473-3478.
Sample Availability: Samples of the compound PMQ is available from the authors.
©
2011 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article
distributed under the terms and conditions of the Creative Commons Attribution license
http://creativecommons.org/licenses/by/3.0/).
(