Cellular delivery and photochemical activation of antisense agents through a nucleobase caging strategy

Article abstract of DOI:10.1021/cb400293e

Antisense oligonucleotides are powerful tools to regulate gene expression in cells and model organisms. However, a transfection or microinjection is typically needed for efficient delivery of the antisense agent. We report the conjugation of multiple HIV TAT peptides to a hairpin-protected antisense agent through a light-cleavable nucleobase caging group. This conjugation allows for the facile delivery of the antisense agent without a transfection reagent, and photochemical activation offers precise control over gene expression. The developed approach is highly modular, as demonstrated by the conjugation of folic acid to the caged antisense agent. This enabled targeted cell delivery through cell-surface folate receptors followed by photochemical triggering of antisense activity. Importantly, the presented strategy delivers native oligonucleotides after light-activation, devoid of any delivery functionalities or modifications that could otherwise impair their antisense activity.

Full text of DOI:10.1021/cb400293e

Articles
pubs.acs.org/acschemicalbiology
Cellular Delivery and Photochemical Activation of Antisense Agents
through a Nucleobase Caging Strategy
†
†
†
†
‡
Jeane M. Govan, Rajendra Uprety, Meryl Thomas, Hrvoje Lusic, Mark O. Lively,
†
,
and Alexander Deiters *
†
North Carolina State University, Department of Chemistry, Raleigh, North Carolina 27695, United States
‡
Wake Forest University School of Medicine, Center for Structural Biology, Winston-Salem, North Carolina 27157, United States
S Supporting Information
*
ABSTRACT: Antisense oligonucleotides are powerful tools
to regulate gene expression in cells and model organisms.
However, a transfection or microinjection is typically needed
for efficient delivery of the antisense agent. We report the
conjugation of multiple HIV TAT peptides to a hairpin-
protected antisense agent through a light-cleavable nucleobase
caging group. This conjugation allows for the facile delivery of
the antisense agent without a transfection reagent, and
photochemical activation offers precise control over gene
expression. The developed approach is highly modular, as
demonstrated by the conjugation of folic acid to the caged
antisense agent. This enabled targeted cell delivery through
cell-surface folate receptors followed by photochemical triggering of antisense activity. Importantly, the presented strategy
delivers native oligonucleotides after light-activation, devoid of any delivery functionalities or modifications that could otherwise
impair their antisense activity.
INTRODUCTION
structural features have been identified (e.g., repeats of
positively charged amino acids). CPPs can be covalently
■
9
The regulation of gene expression is an important biological
process that occurs in many cellular pathways. The
misregulation of a single gene can be detrimental to a
physiological process, as it can cause a variety of diseases,
attached to their cargo or can be used to form noncovalent
8
complexes. Covalently linked CPPs have been shown to
potentially reduce the bioactivity of the cargo, depending on
15
1
2
3
the CPP, the cargo molecule, and the covalent linker. For
example, the conjugation of an HIV TAT peptide to a siRNA
oligonucleotide led to a significant decrease in its gene silencing
ranging from muscular dystrophy and cancer to neurological
1
,4
and heart diseases. Several biomolecular tools have been
developed to perturb and study gene expression in a variety of
different cellular pathways, including antisense agents (phos-
phorothioate DNA, peptide nucleic acids, locked nucleic acids,
and others), small interfering RNAs (siRNAs), DNA decoys,
16
ability. We speculated that this limitation could be completely
prevented through the use of a light-cleavable linker between
the CPP and the cargo oligonucleotide. Importantly, this
approach not only solves delivery and activity issues of
oligonucleotides but also enables the precise spatial and
temporal regulation of oligonucleotide function using light as
a minimally invasive external control element.
5
−7
and triplex-forming oligonucleotides.
In addition to being
excellent molecular probes, these reagents have the potential to
be highly specific therapeutic agents. However, poor bioavail-
ability and in vivo delivery of the oligonucleotides limit their
applicability.
Photochemical control of cellular processes can be achieved
through the introduction of caging groups into biologically
Cell penetrating peptides (CPPs), short (8−30 amino acid)
17−22
active molecules.
Caging technology stems from the use of
synthetic peptides that facilitate cellular uptake of the peptide
8
−10
organic protecting groups to mask biological activity until light
as an external trigger is applied, thereby removing the
protecting group and restoring biological function. Previously,
we and others have introduced caging groups to the
photochemical control of a variety of biological macro-
28
and its cargo,
have been conjugated to a variety of
11 12
biomacromolecules including plasmids, oligonucleotides,
1
3
and proteins for efficient delivery into mammalian cells.
Different CPPs have been discovered, including heparan
derived CPPs (DPV3 and DPV1047), HIV TAT, penetratin,
23−27
9
molecules, including antisense agents,
DNA decoys,
K-FGF, Bac7, and others. Even though the mechanism of
cellular uptake for each CPP has not been fully elucidated, the
two favored models for cell delivery are direct translocation and
Received: February 21, 2013
Accepted: August 5, 2013
Published: August 5, 2013
1
4
endocytosis. While CPPs can have very diverse sequences,
within a specific class of CPPs sequence similarities and similar
©
2013 American Chemical Society
2272
dx.doi.org/10.1021/cb400293e | ACS Chem. Biol. 2013, 8, 2272−2282

ACS Chemical Biology
Articles
triplex-forming DNA, siRNAs,30−32 and proteins.
2
9
33,34
How-
Scheme 2. Synthesis of the Propargyl-6-
ever, all reported reagents need to be either transfected or
injected into cells and organisms.
nitroveratryloxymethyl (PNVOM) Caged Thymidine
Phosphoramidite 6
a
Building on the developed caging approach, we designed new
caged phosphoramidites containing an alkyne handle, intro-
duced them into synthetic antisense agents, and conjugated
HIV TAT peptides to the nucleobase-caged oligonucleotides in
order to allow for (1) efficient delivery of the antisense agent
into mammalian cells without the need for injection or
transfection and (2) the photochemical release of the native
antisense agent from the CPP and its concomitant activation.
Thus, a propargyl-6-nitroveratryloxymethyl (PNVOM) caging
group was developed and installed on the nucleobase of a
thymidine phosphoramidite. This PNVOM-caged thymidine
was incorporated into antisense agents and conjugated with
azide-containing CPPs in a copper-catalyzed 1,3-dipolar
cycloaddition reaction. The CPP-caged antisense conjugate
was then simply added to the cell culture media in order to be
taken up by the cells (Scheme 1). Due to the presence of the
Scheme 1. Delivery and Light-Activation of Antisense Agents
Containing Caging Groups Conjugated with Cell-
a
Penetrating Peptides
a
DCM: dichloromethane, DMTr: dimethoxytrityl, DBU: 1,8-
diazabicyclo[5.4.0]undec-7-ene, DMF: dimethylformamide, DIPEA:
N,N-diisopropylethylamine.
a
PNVOM-caged thymidine nucleotides are site-specifically incorpo-
with sulfuryl chloride at −78 °C as the corresponding
propargyl-6-nitroveratryloxymethyl chloride (PNVOM-Cl)
and was directly reacted with DMT-protected thymidine in
the presence of DBU in DMF to obtain PNVOM-caged
thymidine 5 in 67% yield. Finally, reaction of the caged
nucleoside 5 with 2-cyanoethyl-N,N-diisopropylchlorophos-
phoramidite delivered the caged thymidine phosphoramidite
rated into antisense agents and are bioconjugated with azido-CPPs.
The CPP-caged antisense agent conjugates are (1) simply added to the
cell culture media and (2) taken up by mammalian cells but remain
inactive due to the presence of the caging groups. (3) UV irradiation
triggers decaging, cleaving the CPPs from the antisense agent and
inducing sequence-specific mRNA binding. This leads to (4) the
silencing of gene expression either by blocking the ribosome or by
inducing RNase H-mediated mRNA degradation.
6
as a white solid in 90% yield.
Hairpin-protected antisense agents have previously been
shown to be efficient in inhibiting gene expression without the
2
3,28,36
caging groups, the antisense agent is unable to hybridize to the
target mRNA and hence is inactive, allowing expression of the
target gene. After a brief UV irradiation, the caging groups,
together with the linked CPPs, are cleaved, activating the
antisense agent and resulting in the silencing of the target gene.
need for additional backbone modifications.
The hairpin
loop structure protects the phosphodiester antisense agents
from intracellular degradation without inhibiting their silencing
36
activity. Based on previous literature reports, a GC-rich stem
region of the hairpin structure was designed based on strong
Watson−Crick base pair interactions to generate stable DNA
duplex formation. The hairpin-protected antisense agents
contain no stabilizing chemical modifications (e.g., phosphor-
RESULTS AND DISCUSSION
■
In order to conduct a site-specific DNA conjugation, an azido-
modified HIV TAT peptide and a PNVOM-caged thymidine
phosphoramidite were synthesized. The five-step synthesis of
3
7
othioates) that could elicit an immune response or increase
3
8
nonspecific protein binding. PNVOM-caged thymidine
nucleotides were site-specifically incorporated into hairpin-
protected antisense agents using standard DNA synthesis
conditions (Table 1). Two previously reported antisense agent
targets were selected to demonstrate light-activation of TAT-
35
the phosphoramidite 6 started with the known aldehyde 1,
which was prepared from vanillin (Scheme 2). Nitration of 1
with concentrated HNO3 gave the corresponding ortho-
nitrobenzaldehyde 2 as a yellow solid in 71% yield. Methylation
39
of 2 with AlMe in DCM at 0 °C provided the alcohol 3 in 70%
conjugated antisense agents: Renilla luciferase as a classical
3
40
yield, which was subsequently reacted with methylsulfide in the
presence of benzoyl peroxide to furnish the thiomethylene
derivative 4 in 78% yield. The sulfide 4 was activated in situ
reporter gene that can be easily assayed, and Eg5 as an
endogenous gene that generates a distinct phenotype when
silenced. PNVOM-caged thymidine nucleotides were strategi-
2
273
dx.doi.org/10.1021/cb400293e | ACS Chem. Biol. 2013, 8, 2272−2282

ACS Chemical Biology
Articles
a
Table 1. Sequences of the Hairpin Protected Antisense Agents
a
pT represents the PNVOM-caged thymidine nucleotide, installed through coupling of the phosphoramidite 6 during solid-phase DNA synthesis.
cally installed throughout the antisense sequence for the two
target genes. Equal distribution of the PNVOM-caged
thymidine within the antisense sequence will ensure that
hybridization to its complementary mRNA is fully inhibited and
that multiple alkyne moieties are available for conjugation. We
have previously shown that the use of three evenly distributed
caging groups throughout 18−19mers is sufficient to prevent
Scheme 3. Bioconjugation of the PNVOM Caged Antisense
Agent to the Azido-HIV TAT Peptide and Decaging
Reaction of the HIV TAT Conjugated Antisense Agent
a
2
4,41
DNA/RNA hybridization.
One of the first transduction proteins discovered was the
HIV TAT trans-activating factor. The protein transduction
domain responsible for cellular delivery was later elucidated to
42
be the peptide sequence Tat48−60
.
The conjugation of this
HIV TAT CPP to macromolecules has shown efficient cellular
delivery and thus was selected for this study. In order to
conduct a copper-catalyzed [3 + 2] cycloaddition for the
bioconjugation of the HIV TAT peptide to the antisense
43
agents, 6-azidohexanoic acid was prepared and added at the
N-terminus of the CPP during solid-phase peptide synthesis
(
GenScript, Inc.). The antisense agents containing three
PNVOM groups were then reacted with the N −HIV TAT
3
peptide in an aqueous environment under mild conditions
4
4
(
Scheme 3).
Addition of a tris(3-hydroxypropyl-
triazolylmethyl)amine (THPTA) ligand showed enhanced
reaction rates and improved water solubility over an
unsuccessfully tested tris(benzyltriazolylmethyl)amine
4
5,46
(
TBTA) ligand.
The HIV TAT conjugated antisense
agents were immediately purified using a NAP5 column in
order to minimize potential DNA degradation caused by any
residual copper catalyst.
a
HIV TAT = GRKKRRQRRRPPQ.
4
5,47
Activation of the antisense agent is achieved by photolysis of
the CPP conjugates through a brief UV irradiation at 365 nm.
In order to confirm that the HIV TAT peptide is indeed
photochemically cleaved, thus releasing the native antisense
agent, a 5′ radiolabeled caged oligonucleotide-TAT conjugate
was analyzed via gel shift assay (Figure 1) before and after UV
irradiation. First, the gel reveals a complete conversion of the
caged antisense agent (lane 1) to the TAT conjugate (lane 2)
through three [3 + 2] cycloaddition reactions. Upon UV
irradiation (365 nm, 2 min), the HIV TAT peptide is readily
cleaved resulting in the generation of the free oligonucleotide
(lane 3). These in vitro experiments set the stage for the
photochemical activation of antisense activity in mammalian
cells.
The HIV TAT-conjugated antisense agents were subse-
quently evaluated in mammalian cell culture. Human
embryonic kidney (HEK) 293T cells were treated with the
CNTRL (negative control), Luc-AA (positive control), caged
CLuc-AA, and caged HIV TAT-conjugated CLuc-AA-TAT by
2
274
dx.doi.org/10.1021/cb400293e | ACS Chem. Biol. 2013, 8, 2272−2282

ACS Chemical Biology
Articles
Figure 1. Gel shift assay of the radiolabeled, caged HIV TAT
conjugated antisense agent before and after UV irradiation. A
substantial gel shift was observed for the conjugated CLuc-AA-TAT
in comparison to CLuc-AA. However, a brief irradiation (2 min, 365
nm) restored the free, noncaged antisense agent. Lane 1: CLuc-AA.
Lane 2: CLuc-AA-TAT −UV. Lane 3: CLuc-AA-TAT +UV. Minimal
CLuc-AA-TAT spillover from lane 2 is most likely causing the small
high molecular weight band in lane 1.
Figure 2. Light-activation of antisense agents targeting Renilla
luciferase. Antisense agents (CNTRL, Luc-AA, CLuc-AA, and CLuc-
AA-TAT) were simply added to HEK 293T cell culture media or
actively transfected (CNTRL and Luc-AA). Cells were either
irradiated (365 nm, 2 min, 25 W) or kept in the dark. The cells
were expressing firefly and Renilla luciferase from pGL3 and pRL-TK
plasmids, respectively, and a dual-luciferase assay was performed after
simple addition directly to the cell culture media, in the absence
of any transfection reagent, and incubated overnight. The cells
were either irradiated (2 min, 365 nm) or kept in the dark and
were then cotransfected with the reporter plasmids pGL3 and
pRL-TK, encoding firefly luciferase and Renilla luciferase,
respectively. A double-transfection was performed in order to
normalize reporter gene expression in a dual-luciferase assay
and thus account for cell viability and transfection efficiency.
The scrambled antisense agent (CNTRL) and a noncaged
Renilla luciferase antisense agent (Luc-AA) were also trans-
fected as negative and positive controls, respectively. All
transfections were conducted using X-tremeGENE according
to the manufacturer’s instructions. As expected, the transfected
CNTRL antisense agent did not inhibit luciferase expression,
while transfected Luc-AA reduced Renilla luciferase expression
by 85% relative to the CNTRL antisense agent (Figure 2). The
control antisense agents, CNTRL and Luc-AA, led to little or
no inhibition of luciferase expression when just added to the
cell culture media, confirming that they are not sufficiently
taken up by the cells. Additionally, CLuc-AA induced no
inhibition of luciferase expression in the presence or absence of
UV irradiation. Together, this indicates that the nonconjugated
antisense agents did not enter the cells in the absence of a
transfection agent; thus, no silencing of luciferase expression
was observed. When the CPP conjugate CLuc-AA-TAT was
added to the cell culture media, no inhibition of gene
expression was observed when the cells were kept in the
dark. However, after a brief UV irradiation (2 min, 365 nm),
the caging groups were removed resulting in a 92% inhibition
of Renilla luciferase expression, even exceeding the results
obtained when using a transfection reagent. A dose−response
titration of CLuc-AA-TAT was performed to achieve optimal
inhibition of luciferase expression after UV irradiation (see
Supporting Information (SI) Figure S1). Therefore, the
covalent linkage of the HIV TAT peptide allowed the antisense
agent to enter the cells; however, only after UV irradiation were
the HIV TAT peptide sequences removed through nucleobase
decaging, activating the antisense agent and inducing gene
silencing. These results confirm the ability to deliver light-
activated antisense agents into live cells through the generation
of transduction peptide conjugates at nucleobase-caging groups,
obviating the need for a transfection reagent.
4
8 h. Renilla luciferase expression was normalized to firefly luciferase
expression and the negative control antisense agent (CNTRL) was set
to 100%. All experiments were performed in triplicate, and error bars
represent standard deviations. ** p value < 0.005.
Light-activation of antisense agents enables precise temporal
control over their activity and thus over the activity of the
specific gene that they are targeting. In order to explore the
ability to regulate the function of the HIV TAT conjugated
antisense agent CLuc-AA-TAT with temporal resolution, it was
added to the cell culture media of HEK 293T cells. After an
overnight incubation, the media was removed and the cells
were transfected with the pGL3 and pRL-TK reporter
constructs followed by UV irradiation after 0, 12, 24, 36, 40,
or 46 h. The scrambled negative control antisense agent
CNTRL and the noncaged positive control antisense agent
Luc-AA were transfected into cells as well. Luciferase
expression was measured after a total incubation period of 48
h. As expected, the CNTRL antisense agent showed no
inhibition of luciferase expression, while Luc-AA inhibited 90%
luciferase function regardless of the duration of irradiation
(Figure 3). Prior to irradiation, CLuc-AA-TAT showed no
inhibition of luciferase expression. Irradiation immediately after
reporter plasmid transfection showed 93% inhibition of
luciferase activity and displayed a steady increase in luciferase
expression for later time points of irradiation. At time points 40
and 46 h, no inhibition of luciferase activity was observed,
presumably due to the short incubation period of the activated
antisense agent before luciferase readout at 48 h and the already
present abundance of luciferase mRNA and protein.
To demonstrate applicability of the developed delivery and
light-activation approach beyond the regulation of reporter
genes, a caged TAT-conjugated antisense agent targeting the
endogenous Eg5 gene was synthesized and tested in cell
culture. Eg5 is a member of the kinesin-5 family and is an
essential gene involved in the regulation of the cell cycle,
specifically for bipolar spindle formation.
results in the arrest of a multitude of cellular functions
including spindle formation, mitosis, and cell proliferation.
Due to its importance in cell cycle regulation and concomitant
4
8,49
Inhibition of Eg5
40,50
5
1,52
therapeutic potential in cancer,
(CEg5-AA, Table 1) was designed based on a literature-
a caged Eg5 antisense agent
2
275
dx.doi.org/10.1021/cb400293e | ACS Chem. Biol. 2013, 8, 2272−2282

ACS Chemical Biology
Articles
Figure 3. Temporal activation of luciferase antisense agents. CLuc-AA-
TAT was added directly to cell culture media of HEK 293T cells. After
an overnight incubation, the media was removed and the cells were
transfected with the reporter plasmids pGL3 and pRL-TK, and
selected wells were also transfected with negative and positive control
antisense agents, CNTRL and Luc-AA, respectively. The cells were
irradiated at 0, 12, 24, 36, 40, or 46 h post-transfection (365 nm, 2
min, 25 W), and a dual-luciferase assay was performed after 48 h.
Renilla luciferase expression was normalized to firefly luciferase
expression, and the CNTRL −UV Renilla luciferase expression was
set to 100%. All experiments were performed in triplicate, and error
bars represent standard deviations.
Figure 4. Light-activated Eg5 inhibition in HeLa cells. CEg5-AA and
its corresponding HIV TAT peptide conjugate CEg5-AA-TAT were
added to the cell culture media. After an overnight incubation, the cells
were briefly irradiated (365 nm, 2 min) or kept in the dark. Negative
(
CNTRL) and positive (Eg5-AA) control antisense agents were
4
0
reported sequence and covalently labeled with the N −HIV
transfected into HeLa cells. All cells were subsequently fixed and
stained with FITC−phallodin and DAPI, and imaged using a Zeiss 710
confocal microscope (40× oil objective).
3
TAT peptide, generating CEg5-AA-TAT. The CEg5-AA and
CEg5-AA-TAT antisense agents were added to the cell culture
media of HeLa cells, followed by an overnight incubation and a
brief UV irradiation (365 nm, 2 min). The scrambled
oligonucleotide CNTRL and the noncaged Eg5 antisense
agent Eg5-AA were transfected into HeLa cells as negative and
positive controls, respectively. After 48 h incubation, the cells
were fixed and the actin filaments were stained with FITC-
phalloidin and the nucleus was counterstained with DAPI.
Confocal imaging revealed a binucleated phenotype in cells
transfected with Eg5-AA (Figure 4), in agreement with previous
reports that knockdown of Eg5 arrests HeLa cells in
4
9,50
mitosis.
In contrast, cells transfected with the CNTRL
antisense agent displayed no obvious phenotypic changes. In
agreement with our results discussed above, CEg5-AA directly
added to the media also did not result in a phenotype change
either before or after UV irradiation, confirming the necessity of
a covalently linked HIV TAT transduction peptide for delivery
of the antisense agent. The presence of the CEg5-AA-TAT
antisense agent in the cell culture media did not induce a
change in cell morphology until the three nucleobase-caging
groups were cleaved through UV exposure, activating the Eg5
antisense agent and generating the same binucleated cell
phenotype. The frequency of the binucleated phenotype was
assessed by scoring 100 cells per experiment. Cells transfected
with CNTRL showed no binucleated cells, whereas 40% of cells
transfected with the positive control agent Eg5-AA displayed an
Eg5 knockdown phenotype (see SI Figure S2). Only a minimal
number (<3%) of binucleated cells were observed when CEg5-
AA was added directly to the cell culture media in the presence
and absence of subsequent UV light exposure, again indicating
a lack of cellular uptake of a nonbioconjugated caged antisense
agent. When CEg5-AA-TAT was added to the cell culture
media, a small number of binuclear cells were observed (12%;
some background activity could be the result of conducting the
decaging experiment in the same chamber slide; no leakiness
was observed in the luciferase and qRT PCR experiments
Figure 5. Quantitative RT PCR analysis of Eg5 gene expression.
CEg5-AA-TAT was added directly to the cell culture media and
incubated overnight at 37 °C and 5% CO . The media was replaced
2
and the cells were irradiated (365 nm, 2 min, 25 W). A negative
CNTRL antisense agent and a noncaged Eg5 antisense agent Eg5-AA
were transfected in HeLa cells. After 48 h incubation, RNA was
isolated and subjected to qRT PCR analysis. Eg5 expression was
normalized to GAPDH expression and the CNTRL was set to 100%.
All experiments were performed in triplicate and error bars represent
standard deviations.
shown in Figures 2, 3, and 5), until UV irradiation restored
antisense activity leading to an Eg5 inhibition phenotype in
37% of observed cells. These results demonstrate, for the first
time, the ability to generate reagents that display facile cellular
uptake followed by photochemical regulation of an endogenous
gene.
Quantitative real-time PCR was performed to confirm that
the observed phenotypic change was indeed the result of Eg5
2
276
dx.doi.org/10.1021/cb400293e | ACS Chem. Biol. 2013, 8, 2272−2282

ACS Chemical Biology
Articles
inhibition. The cell culture experiments were conducted in an
identical fashion as before, but instead of fixing, staining, and
imaging, total RNA was isolated and subjected to qRT PCR.
Eg5 expression was normalized to GAPDH expression, and the
transfected negative control antisense agent CNTRL was set to
Scheme 4. Synthesis of the Azido Folate 8 in Three Steps
from Commercially Available Starting Materials
a
1
00%. Transfection of the noncaged, positive control Eg5
antisense agent Eg5-AA into HeLa cells resulted in 60%
inhibition of Eg5 expression (Figure 5). Additionally, no change
in Eg5 expression was observed in the presence of UV
irradiation. Upon treatment of HeLa cells with CEg5-AA-TAT
without UV irradiation, no inhibition of Eg5 expression was
detected due to the complete inactivity of the antisense agents
taken up by the cells due to the presence of the nucleobase
caging groups. However, silencing of Eg5 expression to the
same level as the positive control was observed after exposure
to UV light, in agreement with the luciferase reporter results
and the phenotypic assays shown above. Additionally, the
reduction of Eg5 mRNA levels indicates that the synthesized
hairpin-modified antisense agents induce gene silencing
through an RNase H-mediated mRNA degradation mechanism,
a
DCC: N,N′-dicyclohexylcarbodiimide, DMSO: dimethyl sulfoxide.
same Cu-catalyzed [3 + 2] cycloaddition conditions as
described for the HIV TAT peptide (see Scheme 3), thus
setting the stage for targeted cell delivery and light activation.
The cellular delivery of the folic acid-conjugated antisense
agent was evaluated in mammalian cell culture using the
previously described luciferase assay (see Figure 2). The
conjugated antisense agent, CLuc-AA-FA was added directly to
HeLa cells due to the overexpression of folate receptors in this
5
3,54
as expected for unmodified phosphodiester DNA.
Furthermore, Eg5 visualization by Western blot is in agreement
with the qRT PCR results, as HeLa cells treated with CEg5-AA-
TAT exhibited a 45% inhibition of Eg5 expression after UV
irradiation (see SI Figure S3). These results confirmed that the
CEg5-AA-TAT conjugate was taken up by cells and that
activation of the antisense agent occurred only after UV
irradiation, allowing temporal control over gene expression.
Moreover, the phenotypic change observed by the Eg5-AA
antisense agent is supported by an expression analysis of Eg5,
demonstrating the applicability of the developed oligonucleo-
tide delivery and light-activation methodology to any reporter
or endogenous gene.
6
5,66
cell line.
As a negative control, CLuc-AA was also directly
added to the cell culture media. As a positive control, Luc-AA
was transfected into HeLa cells using X-tremeGENE according
to the manufacturer’s protocol. As expected, in cells transfected
with Luc-AA, 80% inhibition of Renilla luciferase was detected
regardless of UV irradiation (Figure 6A). In agreement with the
previous assay (see Figure 2), CLuc-AA did not inhibit
luciferase expression in the presence or absence of UV
irradiation due to the lack of a transfection reagent, a CPP or
a small molecule carrier. Addition of the folic acid conjugate
CLuc-AA-FA directly to the cell culture media did not lead to a
decrease in luciferase expression when cells were kept in the
dark, as expected. A brief UV irradiation (2 min, 365 nm)
activated the antisense agent by cleaving the folic acid residues,
resulting in 76% inhibition of Renilla luciferase expression.
Thus, the covalent linkage of the folic acid to the antisense
agent facilitated the direct uptake of the antisense agent into
HeLa cells and only after UV irradiation were the antisense
agents activated to inhibit luciferase expression. Finally, to show
the selectivity of the folic acid conjugate to certain cancer cells,
the above experiment was performed in MCF7 cells, which lack
The mechanism of CPP delivery is still under debate, while
passive diffusion and endocytosis have been proposed as the
55
two main models. Each mode of cellular uptake depends on
several parameters, including CPP concentration, cargo size,
56,57
CPP type, and cell type.
Several studies have demonstrated
that the HIV TAT CPP undergoes an endocytosis mecha-
5
8,59
nism.
A potential drawback of this mechanism is that the
cargo can be trapped within endosomes, thereby limiting its
activity. However, in addition to transduction peptides,
macromolecules can be successfully delivered into cells via
natural vitamin endocytosis pathways, for example through
6
0
67
folate receptors. The abundance of folate receptors in certain
folate receptors. As a positive control, MCF7 cells transfected
61
cancer cells, while only low levels are present in healthy cells,
with Luc-AA displayed 50% inhibition of luciferase expression
(Figure 6B). CLuc-AA added directly to the cell culture media
resulted in no inhibition of luciferase expression regardless of
UV irradiation, in agreement with the previous assays.
Additionally, the folic acid conjugated antisense agent, CLuc-
AA-FA, also showed no inhibition of luciferase expression when
added directly to the cell culture media either before or after
UV irradiation. The lack of gene silencing shown by the folic
acid conjugate confirms the ability to selectively deliver light-
activated antisense agents into cells.
allows for the selective delivery. For this reason, cancer drugs
such as maytansine and desacetylvinblastine have recently been
60
conjugated to folate for targeted delivery. Additionally, folic
acid has previously been conjugated to an antisense agent
through the 3′ terminus for selective delivery into human
6
2
ovarian cancer. Thus, we hypothesized that conjugating folic
acid molecules to the NPVOM-caged antisense agents will
allow for selective uptake of the antisense agents into cancer
cells and photoregulation of gene function.
In order to achieve targeted delivery of NPVOM-caged
antisense agents, the folic acid azide 8 was synthesized (Scheme
CONCLUSION
■
4
). First, 6-azidohexan-1-amine (7) was prepared in 2 steps
In summary, a new methodology was developed that
simultaneously enables cellular uptake and precise optochem-
ical control of antisense oligonucleotide function in mammalian
tissue culture. This was achieved by developing a new
nucleotide caging group that not only inhibits oligonucleotide
hybridization but also provides a functional handle for the
63
from commercially available 1,6-dibromohexane. Subsequent
coupling of folic acid with 7 was performed with N,N′-
dicyclohexylcarbodiimide (DCC) and pyridine in DMSO to
64
deliver the desired azido-folic acid probe 8 in 72% yield.
Bioconjugations of 8 and CLuc-AA were conducted under the
2
277
dx.doi.org/10.1021/cb400293e | ACS Chem. Biol. 2013, 8, 2272−2282

ACS Chemical Biology
Articles
endogenous gene under control of its native promoter.
Through luciferase and phenotypic assays, as well as
quantitative real-time PCR and Western blot analysis, it was
shown that HIV TAT antisense agent conjugates can be used to
photoregulate gene expression with excellent off → on
switching behavior. The developed methodology displays full
activation of the conjugated antisense agent after UV
irradiationwith comparable or better gene silencing activity
as a commercially available, transfected antisense agent.
Moreover, the direct covalent attachment of a CPP to the
antisense agent alleviates the need for any noncovalent
liposomal CPP formation. We expect that this methodology
is generally applicable to any antisense agent, with any CPP,
and in any cell type. In addition to the direct conjugation of an
HIV TAT peptide, we showed that this approach allows for the
selective targeting of cervical cancer cells via conjugation of
folic acid residues to the caged antisense agent. This will greatly
facilitate the spatiotemporal investigation of gene function, as it
does not require any transfection reagents or other design of
oligonucleotide delivery vehicles. The developed technology
can be easily adapted to any antisense agent or biomolecule
through direct conjugation to a carrier peptide or small
molecule ligand for targeted delivery through a cell surface
68
receptor (e.g., the sigma receptor ). Additionally, conjugating
other tags to the antisense agent (e.g., fluorophores, peptides,
aptamers, etc.) in conjunction with or without a CPP can be
envisioned in order to visualize cellular trafficking of the
oligonucleotide or for selective delivery to certain cell types.
Two-photon caging groups, such as 3-nitro-2-ethyldibenzofur-
an, modified with alkyne handles could be used for activation
with IR light, allowing for optochemical activation in deeper
69−71
tissue and with high spatial resolution.
Figure 6. Targeted delivery and light-activation of antisense agents.
Antisense agents (CLuc-AA and CLuc-AA-FA) were added directly to
cell culture media of (A) HeLa cells or (B) MCF7 cells, or
alternatively transfected. Cells were either irradiated (2 min, 365
nm, 25 W) or kept in the dark. Firefly and Renilla luciferase were
expressed from pGL3 and pRL-TK plasmids, respectively, and a dual-
luciferase assay was performed after 48 h. Renilla luciferase expression
was normalized to firefly luciferase expression and the negative control
antisense agent (CLuc-AA−UV) was set to 100%. All experiments
were performed in triplicate, and error bars represent standard
deviations. ** = p value < 0.005.
METHODS
■
Synthesis of PNVOM-Caged Antisense Agents. DNA synthesis
was performed using an Applied Biosystems Model 394 automated
DNA/RNA Synthesizer using standard β-cyanoethyl phosphoramidite
chemistry. The caged antisense agents were synthesized using 40 nmol
scale, low volume solid phase supports obtained from Glen Research.
Reagents for automated DNA synthesis were also obtained from Glen
Research. Standard synthesis cycles provided by Applied Biosystems
were used for all normal bases using 2 min coupling times. The
coupling time was increased to 10 min for the positions at which the
caged-T modified phosphoramidites were incorporated. Each synthesis
cycle was monitored by following the release of dimethoxy trityl
bioconjugation with cell penetrating peptides (CPPs) and small
molecule carriers. Specifically, [3 + 2] cycloaddition reactions
(
DMT) cations after each deprotection step. No significant loss of
were used to conjugate N −HIV TAT peptides to antisense
DMT was noted following the addition of the caged-T to the DNA, so
10 min was sufficient to allow maximal coupling of the caged
nucleotides. Yields of caged DNAs were close to theoretical yields
routinely obtained.
3
agents containing three propargyl-6-nitroveratryloxymethyl
(
PNVOM) groups at specific thymidine nucleobases. The
HIV TAT peptide facilitates the delivery of the antisense agent
directly into mammalian cells without the need of any
transfection reagents or injection protocols. The antisense
agent is completely inactive until a brief UV irradiation cleaves
the caging group and thereby the peptide domains from the
oligonucleotide. This photolysis then provides a regular,
nonmodified antisense agent that is fully active and efficiently
and sequence-specifically silences the gene of interest. Since a
nonmodified oligonucleotide is generated through light
activation, this methodology can be directly applied to any
antisense agent type and modification without the need for
newly establishing the gene silencing behavior of the CPP
conjugates. We tested the developed approach in HEK 293T
cells and in HeLa cells targeting two different genes, a
transiently transfected luciferase reporter gene and an
Conjugation of the TAT-Azide Peptides and the Folic Acid
Azide to the Antisense Agents. A solution of the PNVOM-caged
antisense agent (2 μM) in 0.1 M phosphate buffer was incubated at
RT for 2 h with the azido-HIV TAT peptide (12 μM) or azido-folic
acid (12 μM) in the presence of the tris(3-hydroxypropyl-
triazolylmethyl)amine (THPTA) ligand (0.5 mM), CuSO4 (0.1
mM), and sodium ascorbate (5 mM). The reaction mixture was
purified using a NAP 5 column (GE Healthcare) and concentrated
with a speed vac.
Luciferase Assay of the Cellular Activity of HIV TAT-
Conjugated Antisense Agents. HEK 293T cells were grown at
3
7 °C, 5% CO in Dulbecco’s modified Eagle’s medium (Hyclone),
2
supplemented with 10% Fetal Bovine serum (Hyclone), and 10%
streptomycin/penicillin (MP Biomedicals). Cells were passaged into a
4
96 well plate (200 μL per well, ∼ 1 × 10 cells per well) and grown to
∼70% confluence within 24 h. Conjugated antisense agents (100 nM)
2
278
dx.doi.org/10.1021/cb400293e | ACS Chem. Biol. 2013, 8, 2272−2282

ACS Chemical Biology
Articles
were added directly to the cell culture media and incubated overnight
(Hyclone), and 10% streptomycin/penicillin (MP Biomedicals). Cells
4
at 37 °C, 5% CO . The media was removed, and the cells were
were passaged into a 96 well plate (200 μL per well, ∼1 × 10 cells per
2
transfected with the reporter plasmids, pGL3 (Promega) and pRL-TK
well) and grown to ∼70% confluence within 24 h. Folate-conjugated
(
Promega), and selected wells were also transfected with control
antisense agents using X-tremeGENE siRNA transfection reagent
Roche). Cells were incubated at 37 °C, 5% CO , for 4 h, the
antisense agents (100 nM) were added directly to the cell culture
media and incubated overnight at 37 °C, 5% CO . The cells were then
2
(
transfected with the reporter plasmids, pGL3 and pRL-TK, and
selected wells were also transfected with control antisense agents using
X-tremeGENE siRNA transfection reagent (Roche). Cells were
incubated at 37 °C for 4 h, the media was removed, and the cells
were irradiated for 2 min on a UV transilluminator (365 nm, 25W).
DMEM media was added, and the cells were incubated at 37 °C, 5%
2
transfection medium was removed, and the cells were irradiated for 2
min on a UV transilluminator (365 nm, 25 W). DMEM media was
added, and the cells were incubated at 37 °C, 5% CO , for 48 h. The
2
media was removed, and a dual-luciferase assay (Promega) was
performed. Renilla luciferase was normalized to firefly luciferase. All
experiments were performed in triplicate, and the error bars represent
the standard deviation in three independent experiments.
CO for 48 h. The media was removed, and a dual-luciferase assay
2
(Promega) was performed. Renilla luciferase was normalized to firefly
Temporal Control of HIV TAT-Conjugated Antisense Agents.
luciferase. All experiments were performed in triplicate, and the error
bars represent the standard deviation in three independent experi-
ments.
HEK 293T cells were passaged into a 96 well plate (200 μL per well,
4
∼
1 × 10 cells per well) and grown to ∼70% confluence within 24 h.
Conjugated antisense agents (100 nM) were added directly to the cell
5
-Methoxy-2-nitro-4-(prop-2-yn-1-yloxy)benzaldehyde (2). The
culture media and incubated overnight at 37 °C, 5% CO . The cells
2
benzaldehyde 1 (3.0 g, 15.7 mmol) was dissolved in ice-cold
were transfected with the reporter plasmids, pGL3 and pRL-TK, and
selected wells were also transfected with control antisense agents using
X-tremeGENE siRNA transfection reagent (Roche). Cells were
incubated at 37 °C for 4 h, and the transfection medium was replaced
with DMEM media. The cells were then irradiated 0, 12, 24, 36, 40, or
concentrated HNO (30 mL) for 4 h and slowly warmed up to RT
overnight. The reaction mixture was then poured into ice-cold water
3
(200 mL), and the yellow precipitate was filtered off. The solid was
redissolved in DCM (50 mL), was washed with saturated aqueous
NaHCO (20 mL) and with brine (20 mL), and was dried with
3
4
6 h later (365 nm, 2 min, 25 W). After a total incubation period of 48
anhydrous sodium sulfate. After filtration, the solvent was evaporated
under reduced pressure and the residue was purified by silica gel
chromatography using DCM/hexane (7:3) to deliver the correspond-
h after reporter plasmid transfection at 37 °C, 5% CO , media was
2
removed and a dual-luciferase assay (Promega) was performed. Renilla
luciferase was normalized to firefly luciferase. All experiments were
performed in triplicate, and the error bars represent the standard
deviation in three independent experiments.
1
ing nitrobenzaldehyde 2 (2.56 g, yield 71%) as a yellow solid. H
NMR (300 MHz, CDCl ): δ = 2.57 (s, 1H), 3.96 (s, 3H), 4.85 (s,
3
13
2
H), 7.17 (s, 1H), 7.73 (s, 1H), 10.39 (s, 1H). C NMR (75 MHz,
Phenotypic Assay of Photochemical Eg5 Inhibition. HeLa
DMSO-d6): δ = 57.1, 78.5, 80.3, 109.8, 111.0, 126.3, 143.7, 150.0,
cells were grown at 37 °C, 5% CO in Dulbecco’s modified Eagle’s
+
2
1
53.7, 189.2. HRMS: m/z calcd for C H NO [M+H] 236.0553;
11 10 5
medium (Hyclone), supplemented with 10% fetal bovine serum
found 236.0063.
(
Hyclone), and 10% streptomycin/penicillin (MP Biomedicals). Cells
1
-(5-Methoxy-2-nitro-4-(prop-2-yn-1-yloxy)phenyl)ethanol (3).
4
were passaged into 4-well chamber slide (1 mL per well, ∼4 × 10 cells
per well) and grown to ∼70% confluence within 24 h. Conjugated
antisense agents (100 nM) were added directly to the cell culture
Trimethylaluminium (12.6 mmol, 2.0 M in hexane) was slowly
added to a solution of the nitrobenzaldehyde 2 (1.9 g, 8.0 mmol) in
DCM (30 mL) and stirred at 0 °C under an argon atmosphere. After 2
h, ice cold water (5 mL) was very slowly added to the reaction mixture
in order to quench any unreacted reagent. Then, aqueous NaOH (40
mL, 1 M) was added, and the reaction mixture was stirred for 1 h. The
organic layer was separated and washed with 1 M NaOH (2 × 20 mL)
and brine (20 mL), dried with anhydrous sodium sulfate, and filtered.
The solvent was evaporated under reduced pressure, and the residue
was purified by silica gel chromatography using CHCl /CH COCH
3
media and incubated overnight at 37 °C, 5% CO . The media was
2
removed and the cells were irradiated for 2 min on a UV
transilluminator (365 nm, 25 W). Control antisense agents were
transfected into the cells with X-tremeGENE siRNA reagent (Roche).
DMEM media was added, and the cells were incubated at 37 °C, 5%
CO , for 48 h. The cells were fixed with formaldehyde (3.75%) and
2
permeabilized with Triton-X100, strained with Alexa Fluor 488
Phalloidin (ex/em 488 nm/495−630 nm, Invitrogen) and DAPI
3
3
1
(
(
1
9:1) to furnish alcohol 3 (2.4 g, yield 70%) as a yellow solid. H NMR
300 MHz, DMSO-d6): δ = 1.38 (t, J = 4.5 Hz, 3H), 3.65−3.63 (s,
(
ex/em 405 nm/410−495 nm, Invitrogen). Cells were imaged on a
Zeiss LSM 710 confocal microscope (40× oil objective).
H), 3.91 (s, 3H), 4.91 (d, J = 1.2 Hz, 2H), 5.28−5.25 (m, 1H), 5.509
Quantitative RT-PCR. HeLa cells were passaged into 6-well plates
13
5
(d, J = 2.1 Hz, 2H), 7.38 (s, 1H), 7.66 (s, 1H). C NMR (75 MHz,
(
2 mL per well, ∼2 × 10 cells per well) and grown to ∼70%
acetone-d6): δ = 24.8, 55.9, 65.0, 77.2, 78.4, 109.6, 110.4, 124.2, 139.3,
confluence in 24 h. Conjugated antisense agents (100 nM) were added
directly to the cell culture media and incubated overnight at 37 °C and
5
+
1
45.4, 154.6. HRMS: m/z calcd for C H NO [M+H] 274.0686;
12 13
5
found 274.0731.
% CO . The media was removed and the cells were irradiated for 2
2
(
(1-(5-Methoxy-2-nitro-4-(prop-2-yn-1-yloxy)phenyl)ethoxy)-
min on a UV transilluminator (365 nm, 25 W). Control antisense
agents were transfected into the cells with X-tremeGENE siRNA
reagent (Roche). DMEM media was added and the cells were
methyl)(methyl)sulfane (4). Methyl sulfide (4.7 mL, 63.3 mmol) was
added to a solution of the alcohol 3 (1.6 g, 6.36 mmol) in acetonitrile
(20 mL) and stirred under a nitrogen atmosphere at 0 °C. Benzoyl
incubated at 37 °C and 5% CO for 48 h. RNA was isolated with
2
peroxide (6.1 g, 25.4 mmol) was added in 4 portions to the reaction
mixture with an interval of 30 min each. After the addition of the last
portion, the mixture was stirred for an additional 3 h. Aqueous NaOH
TRIZOL reagent (Invitrogen). cDNAs were synthesized with the
iScript cDNA Synthesis kit (Bio-Rad), and quantitative RT PCR was
performed with SsoFast EvaGreen Supermix (Bio-Rad) using an Eg5
forward primer 5′ CAGCTGAAAAGGAAACAGCC, Eg5 reverse
(100 mL, 1 M) was added, and the mixture was vigorously stirred
5
0
overnight. The aqueous layer was extracted with ether (3 × 30 mL),
and the combined ether layers were washed with aqueous NaOH (2 ×
primer 5′ ATGAACAATCCACACCAGCA, GAPDH forward
primer 5′ TGCACCACCAACTGCTTAGC, and GAPDH reverse
72
2
0 mL, 1 M) and with brine (20 mL) and dried with anhydrous
primer 5′ GGCATGGACTGTGGTCATGAG. The threshold cycles
sodium sulfate. After filtration, the solvent was evaporated under
reduced pressure, and the residue was purified by silica gel
(
Ct) of each sample were normalized to the GAPDH housekeeping
gene, and the inhibition of gene silencing is represented as percent of
Eg5 expression. For each of the triplicates, the data were averaged and
standard deviations were calculated.
Luciferase Assay of the Cellular Activity of Folic Acid
Conjugated Antisense Agents. HeLa cells and MCF7 cells were
chromatography using EtOAc/hexane (1:9) to obtain 4 (1.5 g, yield
1
7
8%) as a brown solid. H NMR (300 MHz, CDCl ): δ = 1.51 (d, J =
3
6.3 Hz, 3H), 2.14 (s, 3H), 2.57 (t, J = 2.4 Hz, 1H), 3.97 (s, 3H), 4.34
(d, J = 6.3 Hz, 1H), 4.46 (d, J = 6.3 Hz, 1H), 4.81 (d, J = 1.6 Hz, 2H),
1
3
grown at 37 °C, 5% CO in Dulbecco’s modified Eagle’s medium
5.54 (q, J = 6.3 Hz, 1H), 7.21 (s, 1H), 7.74 (s, 1H). C NMR (75
2
without folate (Sigma), supplemented with 10% fetal bovine serum
MHz, CDCl ): δ = 14.3, 23.5, 56.6, 57.2, 70.9, 73.5, 77.2, 77.4, 109.2,
3
2
279
dx.doi.org/10.1021/cb400293e | ACS Chem. Biol. 2013, 8, 2272−2282

ACS Chemical Biology
Articles
1
10.5, 136.0, 140.4, 145.6, 154.5. HRMS: m/z calcd for C H NO S
(s, 1H), 7.94 (d, J = 7.9 Hz, 1H), 7.82 (d, J = 5.5 Hz, 1H), 7.64 (d, J =
8.5 Hz, 2H), 6.61 (d, J = 8.5 Hz, 4H), 4.47 (s, 2H), 4.34−4.24 (m,
1H), 3.28−3.24 (m, 3H), 3.03−2.98 (m, 2H), 2.26−2.18 (m, 2H),
1.49−1.43 (m, 2H), 1.37−1.31 (m, 2H), 1.29−1.17 (m, 5H). The
analytical data matched previous report of azido folate with C4 azido
14
17
5
+
[
M+Na] 334.0720; found 334.0789.
1
-((2R,4S,5R)-5-((bis(4-Methoxyphenyl)(phenyl)methoxy)methyl)-
4
2
-hydroxytetrahydrofuran-2-yl)-3-((1-(5-methoxy-2-nitro-4-(prop-
-yn-1-yloxy)phenyl)ethoxy)methyl)-5-methylpyrimidine-2,4-
(
1H,3H)-dione (5). Sulfuryl chloride (22 μL, 0.26 mmol) was slowly
74
+
linker. LRMS: m/z calcd for C H N O [M+H] : 566.3 found
23
31 11
5
added to a solution of the thioether 4 (75 mg, 0.24 mmol) in DCM
5
66.6.
(
0.4 mL), and the mixture was stirred at −78 °C under an argon
atmosphere. After 20 min, the solvent was removed under high
vacuum, and the residue was dried for 5 h. The residue was dissolved
in dry DMF (0.5 mL) and added to a solution of the DMT-protected
ASSOCIATED CONTENT
Supporting Information
■
*
S
73
thymidine (130 mg, 0.24 mmol) and DBU (107 μL, 0.72 mmol) in
DMF (0.5 mL). The reaction mixture was stirred at under an argon
atmosphere at RT for 12 h and then poured into saturated aqueous
NaHCO (10 mL). The aqueous layer was extracted with DCM (2 ×
1
Antisense-conjugate titration, binucleated cell phenotype
frequency, Western blot analysis, and NMR spectra of
synthesized compounds. This material is available free of
charge via the Internet at http://pubs.acs.org.
3
0 mL), and the combined organic layers were washed with saturated
aqueous NaHCO (2 × 10 mL) and with brine (10 mL) and dried
3
with anhydrous sodium sulfate. After filtration, the solvent was
evaporated under reduced pressure, and the residue was purified by
silica gel chromatography using DCM/acetone (9:1) with 1% TEA to
AUTHOR INFORMATION
■
*
Corresponding Author
E-mail: alexdeiters@gmail.com.
1
provide 4 (1.5 g, yield 78%) as a brown solid. H NMR (300 MHz,
CDCl ): δ = 1.36 (s, 1.5 H), 1.39 (s, 1.5H), 1.47−1.53 (m, 3H), 2.10−
3
Notes
2
2
6
.21 (m, 1.5H), 2.27−2.28 (m, 0.5H), 2.32−2.41 (m, 2H), 2.52 (t, J =
.0 Hz, 0.5H), 2.57 (t, J = 2.0 Hz, 0.5H), 3.30−3.48 (m, 2H), 3.78 (s,
H), 3.96 (s, 3H), 3.99−4.04 (m, 1H), 4.51 (br, 1 H), 4.74 (d, J = 4.0
The authors declare no competing financial interest.
Hz, 2 H), 5.26−5.29 (m, 1H), 5.38−5.49 (m, 2H), 6.20 (t, J = 6.6 Hz,
ACKNOWLEDGMENTS
■
0
1
.5H), 6.29 (t, J = 6.3 Hz, 0.5H), 6.82−6.85 (m, 4H), 7.23−7.43 (m,
3 H), 7.67 (s, 0.5H), 7.70 (s, 0.5H). 13CNMR (75 MHz, CDCl3): δ
This research was supported in part by the National Institutes
of Health (P30CA012197, R01GM079114), the Beckman
Foundation (Beckman Young Investigator Award for A.D.),
and the Research Corporation (Cottrell Scholar Award for
A.D.).
=
12.5, 24.1, 41.2, 55.5, 56.7, 56.9, 57.2, 63.6, 70.2, 72.2, 72.5, 73.6,
8
1
1
5.2, 85.5, 86.1, 87.1, 109.4, 109.7, 110.1, 110.3, 110.5, 113.5, 127.4,
28.3, 130.2, 134.5, 135.5, 135.6, 136.8, 137.1, 139.7, 140.0, 144.4,
45.4, 150.8, 151.0, 154.0, 154.3, 158.9, 163.3. LRMS: m/z calcd for
+
C H N O [M+Na] 830.2803; found 830.2953.
44
45
3
12
(
2R,3S,5R)-2-((bis(4-Methoxyphenyl)(phenyl)methoxy)methyl)-5-
(
3-((1-(5-methoxy-2-nitro-4-(prop-2-yn-1-yloxy)phenyl)ethoxy)-
REFERENCES
■
methyl)-5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-
tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite
6). DIPEA (43 μL, 0.24 mmol) and 2-cyanoethyl N,N-diisopropyl-
chlorophosphoramidite (28 μL, 0.12 mmol) were added to a solution
of the alcohol 5 (35 mg, 0.04 mmol) in DCM (1.0 mL), and the
mixture was stirred under an argon atmosphere for 2 h. The TLC
indicated complete consumption of starting material and the solvent
was evaporated under reduced pressure. The residue was purified by
(
1) Tupler, R., Perini, G., Pellegrino, M. A., and Green, M. R. (1999)
Profound misregulation of muscle-specific gene expression in
facioscapulohumeral muscular dystrophy. Proc. Natl. Acad. Sci. U.S.A.
(
9
(
6, 12650−12654.
2) Waterfall, J. J., and Meltzer, P. S. (2012) Targeting epigenetic
misregulation in synovial sarcoma. Cancer Cell 21, 323−324.
3) Buee, L., Bussiere, T., Buee-Scherrer, V., Delacourte, A., and Hof,
(
́
̀
́
P. R. (2000) Tau protein isoforms, phosphorylation, and role in
neurodegenerative disorders. Brain Res. Brain Res. Rev. 33, 95−130.
(4) Tian Wang, Q. (2012) Epigenetic regulation of cardiac
development and function by polycomb group and trithorax group
proteins. Dev. Dyn. 241, 1021−1033.
silica gel chromatography using CHCl /acetone (20:1) with 1% TEA
to furnish the caged phosphoramidite 6 (39 mg, yield 90%) as a white
solid. H NMR (300 MHz, CDCl ): δ = 1.04 (d, J = 6.6 Hz, 3H),
3
1
3
1
2
7
.14−1.18 (m, 9 H), 1.30−1.36 (m, 3H), 1.50−1.54 (m, 3H), 2.08−
.26 (m, 1H), 2.37−2.71 (m, 4H), 3.25−3.66 (m, 5H), 3.71−3.89 (m,
H), 3.93 (s, 3H), 4.07−4.19 (m, 1H), 4.54−4.65 (m, 1H), 4.72−4.77
(
5) Deleavey, G. F., and Damha, M. J. (2012) Designing chemically
modified oligonucleotides for targeted gene silencing. Chem. Biol. 19,
(
m, 2H), 5.23−5.31 (m, 1H), 5.37−5.47 (m, 2H), 6.14−6.29 (m, 1
13
937−954.
H), 6.81−6.85 (m, 4H), 7.20−7.50 (m, 11H), 7.65−7.68 (m, 1H).
C
(
6) Brennan, P., Donev, R., and Hewamana, S. (2008) Targeting
NMR (75 MHz, CDCl3): δ = 12.3, 20.4, 20.5, 23.9, 24.7, 40.1, 43.2,
transcription factors for therapeutic benefit. Mol. Biosyst. 4, 909−919.
7) Jain, A., Wang, G., and Vasquez, K. M. (2008) DNA triple
helices: Biological consequences and therapeutic potential. Biochimie
4
7
1
1
1
1
3.4, 55.3, 56.5, 56.8, 57.0, 57.1, 57.9, 58.2, 58.5, 58.8, 63.3, 70.2, 73.6,
3.85, 74.0, 85.2, 86.9, 109.2, 109.5, 109.9, 110.1, 110.2, 110.4, 113.3,
17.5, 117.8, 127.2, 128.0, 128.2, 130.1, 134.4, 135.3, 136.6, 136.8,
37.0, 139.6, 139.6, 139.8, 139.9, 140.1, 144.2, 145.2, 150.7, 150.8,
(
9
0, 1117−1130.
53.8, 154.0, 154.1, 158.7, 163.1. 31P NMR (121 MHz, CDCl3): δ =
(8) Heitz, F., Morris, M. C., and Divita, G. (2009) Twenty years of
cell-penetrating peptides: From molecular mechanisms to therapeutics.
Br. J. Pharmacol. 157, 195−206.
(9) Milletti, F. (2012) Cell-penetrating peptides: Classes, origin, and
current landscape. Drug Discov. Today. 15, 850−860.
(10) Schmidt, N., Mishra, A., Lai, G. H., and Wong, G. C. (2010)
Arginine-rich cell-penetrating peptides. FEBS Lett. 584, 1806−1813.
(11) Mann, A., Thakur, G., Shukla, V., Singh, A. K., Khanduri, R.,
Naik, R., Jiang, Y., Kalra, N., Dwarakanath, B. S., Langel, U., and
Ganguli, M. (2011) Differences in DNA condensation and release by
lysine and arginine homopeptides govern their DNA delivery
efficiencies. Mol. Pharm. 8, 1729−1741.
(12) Turner, J. J., Jones, S., Fabani, M. M., Ivanova, G., Arzumanov,
A. A., and Gait, M. J. (2007) RNA targeting with peptide conjugates of
oligonucleotides, siRNA, and PNA. Blood Cells Mol. Dis. 38, 1−7.
48.5, 148.6, 149.0, 149.1.
(
benzamido)-5-((6-azidohexyl)amino)-5-oxopentanoic Acid (8). To
S)-2-(4-(((2-amino-4-hydroxypteridin-6-yl)methyl)amino)-
a solution of folic acid (118 mg, 0.26 mmol) in DMSO (2 mL) was
63
added the known 6-azidohexan-1-amine 7 (38 mg, 0.26 mmol),
DCC (138 mg, 0.67 mmol), and pyridine (0.53 mL). The reaction
mixture was stirred at RT for 2 days. The mixture was then filtered,
and the filtrate was slowly poured into ice-cold Et O (45 mL). The
precipitates were collected by centrifugation and washed 3 times by
centrifugation in MeOH:Et O (3:30 mL). The solvent was removed,
and the precipitate was dried to dryness under vacuum to afford a
yellow solid (106 mg, 72%). The compound was further purified by
reverse phase HPLC (Hewlett-Packard 1100, column Agilent Zorbax
C18, ACN/H O 0.1% TFA). H NMR (400 MHz, DMSO-d6) δ 8.63
2
2
1
2
2
280
dx.doi.org/10.1021/cb400293e | ACS Chem. Biol. 2013, 8, 2272−2282

ACS Chemical Biology
Articles
(
13) El-Andaloussi, S., Johansson, H. J., Holm, T., and Langel, U.
2007) A novel cell-penetrating peptide, M918, for efficient delivery of
proteins and peptide nucleic acids. Mol. Ther. 15, 1820−1826.
14) Madani, F., Lindberg, S., Langel, U., Futaki, S., and Graslund, A.
2011) Mechanisms of cellular uptake of cell-penetrating peptides. J.
Biophys. 2011, 414729.
15) Juliano, R., Alam, M. R., Dixit, V., and Kang, H. (2008)
Reddy, T., Pushpavalli, S. N., and Pal-Bhadra, M. (2011) Synthesis and
anticancer activity of chalcone-pyrrolobenzodiazepine conjugates
linked via 1,2,3-triazole ring side-armed with alkane spacers. Eur. J.
Med. Chem. 46, 3820−3831.
(
(
̈
(
(36) Abdelgany, A., Wood, M., and Beeson, D. (2007) Hairpin
DNAzymes: A new tool for efficient cellular gene silencing. J. Gene
Med. 9, 727−738.
(
Mechanisms and strategies for effective delivery of antisense and
siRNA oligonucleotides. Nucleic Acids Res. 36, 4158−4171.
(
Visualizing a correlation between siRNA localization, cellular uptake,
and RNAi in living cells. Chem. Biol. 11, 1165−1175.
(
(37) Agrawal, S. (1999) Importance of nucleotide sequence and
chemical modifications of antisense oligonucleotides. Biochim. Biophys.
Acta 1489, 53−68.
16) Chiu, Y. L., Ali, A., Chu, C. Y., Cao, H., and Rana, T. M. (2004)
(38) Brown, D. A., Kang, S. H., Gryaznov, S. M., DeDionisio, L.,
Heidenreich, O., Sullivan, S., Xu, X., and Nerenberg, M. I. (1994)
Effect of phosphorothioate modification of oligodeoxynucleotides on
specific protein binding. J. Biol. Chem. 269, 26801−26805.
17) Deiters, A. (2009) Light activation as a method of regulating
and studying gene expression. Curr. Opin. Chem. Biol. 13, 678−686.
18) Young, D. D., and Deiters, A. (2007) Photochemical control of
biological processes. Org. Biomol. Chem. 5, 999−1005.
19) Deiters, A. (2010) Principles and applications of the
photochemical control of cellular processes. ChemBioChem 11, 47−53.
20) Riggsbee, C. W., and Deiters, A. (2010) Recent advances in the
photochemical control of protein function. Trends Biotechnol. 28, 468−
75.
21) Dmochowski, I. J., and Tang, X. J. (2007) Taking control of
gene expression with light-activated oligonucleotides. Biotechniques 43,
61−163.
22) Mayer, G., and Heckel, A. (2006) Biologically active molecules
with a “light switch”. Angew. Chem., Int. Ed. 45, 4900−4921.
23) Young, D., Lively, M., and Deiters, A. (2010) Activation and
(
(39) Xu, Y., Zhang, H. Y., Thormeyer, D., Larsson, O., Du, Q.,
Elmen, J., Wahlestedt, C., and Liang, Z. (2003) Effective small
́
(
interfering RNAs and phosphorothioate antisense DNAs have different
preferences for target sites in the luciferase mRNAs. Biochem. Biophys.
Res. Commun. 306, 712−717.
(
(40) Koller, E., Propp, S., Zhang, H., Zhao, C., Xiao, X., Chang, M.,
4
(
Hirsch, S. A., Shepard, P. J., Koo, S., Murphy, C., Glazer, R. I., and
Dean, N. M. (2006) Use of a chemically modified antisense
oligonucleotide library to identify and validate Eg5 (kinesin-like 1)
as a target for antineoplastic drug development. Cancer Res. 66, 2059−
1
(
2
(
066.
41) Young, D. D., Edwards, W. F., Lusic, H., Lively, M. O., and
(
Deiters, A. (2008) Light-triggered polymerase chain reaction. Chem.
Commun., 462−464.
deactivation of DNAzyme and antisense function with light for the
photochemical regulation of gene expression in mammalian cells. J.
Am. Chem. Soc. 132, 6183−6193.
(
̀
42) Vives, E., Brodin, P., and Lebleu, B. (1997) A truncated HIV-1
Tat protein basic domain rapidly translocates through the plasma
(
24) Young, D. D., Lusic, H., Lively, M. O., Yoder, J. A., and Deiters,
membrane and accumulates in the cell nucleus. J. Biol. Chem. 272,
A. (2008) Gene silencing in mammalian cells with light-activated
antisense agents. Chembiochem 9, 2937−2940.
(
J. (2008) Regulating gene expression in human leukemia cells using
light-activated oligodeoxynucleotides. Nucleic Acids Res. 36, 559−569.
(
1
(
6010−16017.
43) Grandjean, C., Boutonnier, A., Guerreiro, C., Fournier, J. M.,
25) Tang, X., Swaminathan, J., Gewirtz, A. M., and Dmochowski, I.
and Mulard, L. A. (2005) On the preparation of carbohydrate-protein
conjugates using the traceless Staudinger ligation. J. Org. Chem. 70,
7
(
123−7132.
26) Deiters, A., Garner, R. A., Lusic, H., Govan, J. M., Dush, M.,
44) Lallana, E., Riguera, R., and Fernandez-Megia, E. (2011)
Nascone-Yoder, N. M., and Yoder, J. A. (2010) Photocaged
morpholino oligomers for the light-regulation of gene function in
zebrafish and xenopus embryos. J. Am. Chem. Soc. 132, 15644−15650.
Reliable and efficient procedures for the conjugation of biomolecules
through Huisgen azide-alkyne cycloadditions. Angew. Chem., Int. Ed.
5
(
0, 8794−8804.
(
27) Ouyang, X., Shestopalov, I. A., Sinha, S., Zheng, G., Pitt, C. L.,
45) Hong, V., Presolski, S. I., Ma, C., and Finn, M. G. (2009)
Li, W. H., Olson, A. J., and Chen, J. K. (2009) Versatile synthesis and
Analysis and optimization of copper-catalyzed azide-alkyne cyclo-
rational design of caged morpholinos. J. Am. Chem. Soc. 131, 13255−
addition for bioconjugation. Angew. Chem., Int. Ed. 48, 9879−9883.
1
3269.
(46) Presolski, S. I., Hong, V., Cho, S. H., and Finn, M. G. (2010)
(
28) Govan, J. M., Lively, M. O., and Deiters, A. (2011)
Tailored ligand acceleration of the Cu-catalyzed azide-alkyne cyclo-
addition reaction: Practical and mechanistic implications. J. Am. Chem.
Soc. 132, 14570−14576.
Photochemical control of DNA decoy function enables precise
regulation of nuclear factor κB activity. J. Am. Chem. Soc. 133,
1
(
3176−13182.
(47) Shelbourne, M., Brown, T., and El-Sagheer, A. H. (2012) Fast
29) Govan, J. M., Uprety, R., Hemphill, J., Lively, M. O., and
and efficient DNA crosslinking and multiple orthogonal labelling by
Deiters, A. (2012) Regulation of transcription through light-activation
and light-deactivation of triplex-forming oligonucleotides in mamma-
lian cells. ACS Chem. Biol. 7, 1247−1256.
copper-free click chemistry. Chem. Commun. 48, 11184−11186.
(48) Cole, D. G., Saxton, W. M., Sheehan, K. B., and Scholey, J. M.
(
1994) A “slow” homotetrameric kinesin-related motor protein
purified from Drosophila embryos. J. Biol. Chem. 269, 22913−22916.
49) Ma, N., Tulu, U. S., Ferenz, N. P., Fagerstrom, C., Wilde, A., and
(
30) Mikat, V., and Heckel, A. (2007) Light-dependent RNA
interference with nucleobase-caged siRNAs. RNA 13, 2341−2347.
(
(
31) Jain, P. K., Shah, S., and Friedman, S. H. (2010) Patterning of
Wadsworth, P. (2010) Poleward transport of TPX2 in the mammalian
mitotic spindle requires dynein, Eg5, and microtubule flux. Mol. Biol.
Cell 21, 979−988.
gene expression using new photolabile groups applied to light
activated RNAi. J. Am. Chem. Soc. 133, 440−446.
(
siRNAs for spatiotemporal control of gene silencing. Mol.
Pharmaceutics 6, 669−685.
(
32) Casey, J. P., Blidner, R. A., and Monroe, W. T. (2009) Caged
(50) Zhu, C., Zhao, J., Bibikova, M., Leverson, J. D., Bossy-Wetzel, E.,
Fan, J. B., Abraham, R. T., and Jiang, W. (2005) Functional analysis of
human microtubule-based motor proteins, the kinesins and dyneins, in
mitosis/cytokinesis using RNA interference. Mol. Biol. Cell 16, 3187−
3199.
(51) Zhang, Y., and Xu, W. (2008) Progress on kinesin spindle
protein inhibitors as anti-cancer agents. Anticancer Agents Med. Chem.
8, 698−704.
(52) Knight, S. D., and Parrish, C. A. (2008) Recent progress in the
identification and clinical evaluation of inhibitors of the mitotic kinesin
KSP. Curr. Top. Med. Chem. 8, 888−904.
33) Edwards, W. F., Young, D. D., and Deiters, A. (2009) Light-
activated Cre recombinase as a tool for the spatial and temporal
control of gene function in mammalian cells. ACS Chem. Biol. 4, 441−
445.
(
34) Chou, C. J., Young, D. D., and Deiters, A. (2010) Photocaged
T7 RNA polymerase for the light activation of transcription and gene
function in pro- and eukaryotic cells. ChemBioChem 11, 972−977.
(
35) Kamal, A., Prabhakar, S., Janaki Ramaiah, M., Venkat Reddy, P.,
Ratna Reddy, C., Mallareddy, A., Shankaraiah, N., Lakshmi Narayan
2
281
dx.doi.org/10.1021/cb400293e | ACS Chem. Biol. 2013, 8, 2272−2282

ACS Chemical Biology
Articles
(
53) Dias, N., and Stein, C. (2002) Antisense oligonucleotides: Basic
concepts and mechanisms. Mol. Cancer Ther. 1, 347−355.
54) Bennett, C. F., and Swayze, E. E. (2010) RNA targeting
biogenesis in kidney proximal tubular cells. Proc. Natl. Acad. Sci. U.S.A.
104, 5407−5412.
(
(73) Denny, W. A., Leupin, W., and Kearns, D. R. (1982) Simplified
liquid-phase preparation of four decadeoxyribonucleotides and their
preliminary spectroscopic characterization. Helvetica Chem. Acta 65,
2372−2393.
therapeutics: Molecular mechanisms of antisense oligonucleotides as a
therapeutic platform. Annu. Rev. Pharmacol. Toxicol. 50, 259−293.
(
penetrating peptides as delivery vehicles for biology and medicine. Org.
Biomol. Chem. 6, 2242−2255.
(
55) Stewart, K. M., Horton, K. L., and Kelley, S. O. (2008) Cell-
̈
(74) Mindt, T. L., Muller, C., Melis, M., de Jong, M., and Schibli, R.
(2008) “Click-to-chelate”: in vitro and in vivo comparison of a
99mTc(CO)3-labeled N(tau)-histidine folate derivative with its
isostructural, clicked 1,2,3-triazole analogue. Bioconjug. Chem. 19,
1689−1695.
56) van den Berg, A., and Dowdy, S. F. (2011) Protein transduction
domain delivery of therapeutic macromolecules. Curr. Opin. Biotechnol.
2, 888−893.
57) Juliano, R. L., Ming, X., and Nakagawa, O. (2012) The
chemistry and biology of oligonucleotide conjugates. Acc. Chem. Res.
5, 1067−1076.
58) Guterstam, P., Madani, F., Hirose, H., Takeuchi, T., Futaki, S.,
El Andaloussi, S., Graslund, A., and Langel, U. (2009) Elucidating cell-
2
(
4
(
̈
penetrating peptide mechanisms of action for membrane interaction,
cellular uptake, and translocation utilizing the hydrophobic counter-
anion pyrenebutyrate. Biochim. Biophys. Acta 1788, 2509−2517.
(
59) Wolfrum, C., Shi, S., Jayaprakash, K. N., Jayaraman, M., Wang,
G., Pandey, R. K., Rajeev, K. G., Nakayama, T., Charrise, K., Ndungo,
E. M., Zimmermann, T., Koteliansky, V., Manoharan, M., and Stoffel,
M. (2007) Mechanisms and optimization of in vivo delivery of
lipophilic siRNAs. Nat. Biotechnol. 25, 1149−1157.
(
60) Vlahov, I. R., and Leamon, C. P. (2012) Engineering folate-drug
conjugates to target cancer: From chemistry to clinic. Bioconjug. Chem.
3, 1357−1369.
61) Leamon, C. P. (2008) Folate-targeted drug strategies for the
treatment of cancer. Curr. Opin. Investig. Drugs 9, 1277−1286.
62) Li, S., Deshmukh, H. M., and Huang, L. (1998) Folate-mediated
2
(
(
targeting of antisense oligodeoxynucleotides to ovarian cancer cells.
Pharm. Res. 15, 1540−1545.
(
63) Romuald, C., Busseron, E., and Coutrot, F. (2010) Very
contracted to extended co-conformations with or without oscillations
in two- and three-station [c2]daisy chains. J. Org. Chem. 75, 6516−
6531.
(
64) Schneider, R., Schmitt, F., Frochot, C., Fort, Y., Lourette, N.,
Guillemin, F., Muller, J. F., and Barberi-Heyob, M. (2005) Design,
̈
synthesis, and biological evaluation of folic acid targeted tetraphe-
nylporphyrin as novel photosensitizers for selective photodynamic
therapy. Bioorg. Med. Chem. 13, 2799−2808.
(
65) Willibald, J., Harder, J., Sparrer, K., Conzelmann, K. K., and
Carell, T. (2012) Click-modified anandamide siRNA enables delivery
and gene silencing in neuronal and immune cells. J. Am. Chem. Soc.
1
(
34, 12330−12333.
66) Shakeri-Zadeh, A., Ghasemifard, M., and Mansoor, G. (2010)
Structural and optical characterization of folate-conjugated gold-
nanoparticles. Phys. E 42, 1272−1280.
(
67) Lee, S. M., Chen, H., O’Halloran, T. V., and Nguyen, S. T.
(
2009) Clickable polymer-caged nanobins as a modular drug delivery
platform. J. Am. Chem. Soc. 131, 9311−9320.
68) Nakagawa, O., Ming, X., Huang, L., and Juliano, R. L. (2010)
(
Targeted intracellular delivery of antisense oligonucleotides via
conjugation with small-molecule ligands. J. Am. Chem. Soc. 132,
8
(
848−8849.
69) Lusic, H., Uprety, R., and Deiters, A. (2010) Improved synthesis
of the two-photon caging group 3-nitro-2-ethyldibenzofuran and its
application to a caged thymidine phosphoramidite. Org. Lett. 12, 916−
919.
(
70) Momotake, A., Lindegger, N., Niggli, E., Barsotti, R. J., and Ellis-
Davies, G. C. (2006) The nitrodibenzofuran chromophore: A new
caging group for ultra-efficient photolysis in living cells. Nat. Methods
3
(
, 35−40.
71) Ando, H., Furuta, T., Tsien, R. Y., and Okamoto, H. (2001)
Photo-mediated gene activation using caged RNA/DNA in zebrafish
embryos. Nat. Genet. 28, 317−325.
(
72) Nielsen, R., Courtoy, P. J., Jacobsen, C., Dom, G., Lima, W. R.,
Jadot, M., Willnow, T. E., Devuyst, O., and Christensen, E. I. (2007)
Endocytosis provides a major alternative pathway for lysosomal
2
282
dx.doi.org/10.1021/cb400293e | ACS Chem. Biol. 2013, 8, 2272−2282