Analyzing the function of the insert region found between the α and β-subunits in the eukaryotic nitrile hydratase from Monosiga brevicollis

Article abstract of DOI:10.1016/j.abb.2018.08.013

The functional roles of the (His)₁₇ region and an insert region in the eukaryotic nitrile hydratase (NHase, EC 4.2.1.84) from Monosiga brevicollis (MbNHase), were examined. Two deletion mutants, MbNHase^Δ238?257 and MbNHase^Δ219?272, were prepared in which the (His)₁₇ sequence and the entire insert region were removed. Each of these MbNHase enzymes provided an α₂β₂ heterotetramer, identical to that observed for prokaryotic NHases and contains their full complement of cobalt ions. Deletion of the (His)₁₇ motif provides an MbNHase enzyme that is ～55% as active as the WT enzyme when expressed in the absence of the Co-type activator (ε) protein from Pseudonocardia thermophila JCM 3095 (PtNHase^act) but ～28% more active when expressed in the presence of PtNHase^act. MbNHase^Δ219?272 exhibits ～55% and ～89% of WT activity, respectively, when expressed in the absence or presence of PtNHase^act. Proteolytic cleavage of MbNHase provides an α₂β₂ heterotetramer that is modestly more active compared to WT MbNHase (k_cat = 163 ± 4 vs 131 ± 3 s^?1). Combination of these data establish that neither the (His)₁₇ nor the insert region are required for metallocentre assembly and maturation, suggesting that Co-type eukaryotic NHases utilize a different mechanism for metal ion incorporation and post-translational activation compared to prokaryotic NHases.

Full text of DOI:10.1016/j.abb.2018.08.013

Accepted Manuscript
Analyzing the function of the insert region found between the α and β-subunits in the
eukaryotic nitrile hydratase from Monosiga brevicollis
Xinhang Yang, Brian Bennett, Richard C. Holz
PII:
S0003-9861(18)30338-2
10.1016/j.abb.2018.08.013
YABBI 7800
DOI:
Reference:
To appear in: Archives of Biochemistry and Biophysics
Received Date: 27 April 2018
Revised Date: 30 August 2018
Accepted Date: 31 August 2018
Please cite this article as: X. Yang, B. Bennett, R.C. Holz, Analyzing the function of the insert region
found between the α and β-subunits in the eukaryotic nitrile hydratase from Monosiga brevicollis,
Archives of Biochemistry and Biophysics (2018), doi: 10.1016/j.abb.2018.08.013.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT
Analyzing the Function of the Insert Region Found Between the α and
β-Subunits in the Eukaryotic Nitrile Hydratase from Monosiga brevicollis
†
Xinhang Yang,1 Brian Bennett,2 and Richard C. Holz1,*
1Department of Chemistry, Marquette University, PO Box 1881, Milwaukee, Wisconsin 53201
and the 2Department of Physics, Marquette University, PO Box 1881, Milwaukee, Wisconsin
53201-1881
†
This work was supported by National Science Foundation (CHE-1808711, RCH and BB;
CHE-1532168 BB & RCH), the Todd Wehr Foundation, Bruker Biospin, and the National
Institutes of Health/NIBIB National Biomedical EPR Center (P41-EB001980).
*To whom correspondence should be addressed: Richard C. Holz, Department of
Chemistry, Marquette University, PO Box 1881, Milwaukee, WI 53201, Phone (414)
288-7230, E-mail: richard.holz@marquette.edu
1

ACCEPTED MANUSCRIPT
Abstract
The functional roles of the (His)17 region and an insert region in the eukaryotic nitrile
hydratase (NHase, EC 4.2.1.84) from Monosiga brevicollis (MbNHase), were examined.
Two deletion mutants, MbNHase∆238-257 and MbNHase∆219-272, were prepared in which the
(His)17 sequence and the entire insert region were removed. Each of these MbNHase
enzymes provided an α2β2 heterotetramer, identical to that observed for prokaryotic NHases
and contains their full complement of cobalt ions. Deletion of the (His)17 motif provides an
MbNHase enzyme that is ~55% as active as the WT enzyme when expressed in the absence
of the Co-type activator (ε) protein from Pseudonocardia thermophila JCM 3095 (PtNHaseact)
but ~28% more active when expressed in the presence of PtNHaseact. MbNHase∆219-272
exhibits ~55% and ~89% of WT activity, respectively, when expressed in the absence or
presence of PtNHaseact. Proteolytic cleavage of MbNHase provides an α2β2 heterotetramer
that is modestly more active compared to WT MbNHase (kcat = 163 + 4 vs 131 + 3 s-1).
Combination of these data establish that neither the (His)17 nor the insert region are required
for metallocentre assembly and maturation, suggesting that Co-type eukaryotic NHases
utilize a different mechanism for metal ion incorporation and post-translational activation
compared to prokaryotic NHases.
Keywords
Nitrile hydratase, enzyme kinetics, cobalt, protein biosynthesis, metal transport, and metal
insertion.
2

ACCEPTED MANUSCRIPT
Introduction
Nitrile hydratases (NHases, EC 4.2.1.84) are metalloenzymes that contain either a
non-heme Fe(III) ion (Fe-type) or a non-corrin Co(III) ion (Co-type) in their active site [1, 2].
NHases catalyze the hydration of nitriles to their corresponding higher value amides under
mild conditions (room temperature and physiological pH) and have attracted substantial
interest as biocatalysts in preparative organic chemistry and bioremediation processes [3-8].
NHases have historically been only found in prokaryotes; however, multiple eukaryotic
organisms were shown to contain genes that potentially encode NHase enzymes [9, 10]. We
recently cloned and over-expressed the candidate gene from the eukaryotic organism
Monosiga brevicollis in E. coli and characterized a fully functional Co-type NHase gene
product, with fused α- and β-subunits linked by a (His)17 containing region (MbNHase)
(Figure 1) [11]. Size-exclusion chromatography indicated that MbNHase is an (αβ)2
homodimer in solution, analogous to the α2β2 heterotetrameric architecture of prokaryotic
NHases, of which numerous X-ray crystal structures exist [1, 2, 12, 13].
Several open reading frames (ORFs) have been identified just downstream from the
structural α- and β-subunit genes in prokaryotic NHases, and one of these genes has been
proposed to function as an activator (ε) protein [14-16]. The prevailing dogma is that both
Co- and Fe-type NHase enzymes require the co-expression of an (ε) protein to be fully
metallated, post-translationally modified, and fully functional [14-16]. No such (ε) protein
has been identified for eukaryotic NHases, such as MbNHase [9, 10]. It is tempting to
speculate that the insert region within MbNHase, which contains a (His)17 motif, plays the
role of the (ε) protein. Histidine rich regions are present in some cobalamin (vitamin B12)
3

ACCEPTED MANUSCRIPT
biosynthetic pathway proteins, e.g., the chelatase CbiX enzyme from Bacillus megaterium
and CobW from Pseudomonas denitrificans [17]. Histidine rich regions are also found in
accessory proteins involved in metallocentre assembly of nickel hydrogenases and ureases,
such as HypB from Bradyrhizobium japonicum and Rhizobium leguminosarum, SlyD from
Escherichia coli and Helicobacter pylori, UreE from Klebsiella aerogenes, and Hpn and
Hpn-like proteins from Helicobacter pylori [18].
To investigate metallocentre assembly in MbNHase, we created three different altered
MbNHase enzymes. First, we obtained a proteolytically cleaved MbNHase enzyme in
which the α- and β-subunits were separated providing an enzyme that structurally mimics
prokaryotic NHase enzymes. Second, a mutant MbNHase enzyme, in which the entire
(His)17 motif was removed (MbNHase∆238-257), was constructed and expressed in the presence
and absence of the prototypical prokaryotic Co-type (ε) activator protein from
Pseudonocardia thermophila JCM 3095 (PtNHaseact). Finally, a mutant was constructed in
which the entire insert region was deleted (MbNHase∆219-272), leaving only the classical
prokaryotic NHase α- and β-subunit analogs; this mutant was also expressed in the presence
and absence PtNHaseact. Functional interrogation of these species provides important
insight into the role of the insert region in MbNHase and how eukaryotic NHase enzymes are
metallated and post-translationally modified.
Materials and Methods
Materials. Acrylonitrile, 2-Amino-2-hydroxymethyl-propane-1,3-diol (Tris-HCl),
4

ACCEPTED MANUSCRIPT
and 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES) were obtained from
Sigma-Aldrich. Oligonucleotides and genes were obtained from Integrated DNA
Technologies, Inc. All other reagents were purchased commercially and were the highest
purity available.
Expression and Purification of MbNHase. Protein sequences for the α- and
β-subunit genes of the putative WT MbNHase were obtained from ORF 37534 (UniProt ID
A9V2C1.1) of M. brevicollis and the predicted gene was synthesized by Integrated DNA
Technologies, Inc. with optimized E. coli codon usage. This gene was cloned into the
kanamycin resistant pET21a+ (EMD Biosciences) expression vector to create the plasmid
pSMMαβ, as previously reported [11].
A single colony was used to inoculate separate starter cultures of 50 mL LB Miller
media containing the appropriate antibiotics (pET28a+: 50 mg/mL kanamycin) and allowed
to grow at 37 °C with constant shaking overnight. These cultures were used to inoculate 6 L
of LB Miller media containing the appropriate antibiotics and allowed to grow at 37 °C with
constant shaking until an optical density of ~0.8-1.0 at 600 nm was reached. The cultures
were cooled on ice to 20 °C and induced with 0.1 mM Isopropyl-β-D-1-
thiogalactopyranoside (IPTG), supplemented with 0.25 mM of CoCl2, and shaken for an
additional 16 hours at 20 °C.
Cells were pelleted by centrifugation at 6,370 × g for 10 minutes at 4 °C in a
Beckman Coulter Avanti JA-10 rotor and resuspended in buffer A (50 mM sodium phosphate
buffer, pH 7.5, containing 300 mM NaCl, 5% glycerol, and 10 mM imidazole) at a ratio of 5
mL per gram of cells. Cells were lysed by ultrasonication (Misonix Sonicator 3000) for 4
5

ACCEPTED MANUSCRIPT
min (alternating 30s on and 45s off) at 21 W. Cell lysate was separated from cell debris by
centrifugation in a JA-20 rotor at 31,000 × g at 4 °C for 20 min. Cell lysate was purified
using immobilized metal affinity chromatography (IMAC; 100 mg protein/5mL column) on a
GE ÄKTA Fast Protein Liquid Chromatography (FPLC) system at 4 °C. The column was
washed with 50 mL of buffer A followed by 50 mL of buffer A containing additional
imidazole (35 mM). The protein was eluted using a linear gradient (0-100%) of buffer B
(50 mM NaH2PO4 pH 7.5, 300 mM NaCl, 10% glycerol, 525 mM imidazole) at a flow rate of
1 mL/min resulting in MbNHase being eluted between 150 to 240 mM imidazole.
Fractions containing WT MbNHase were pooled and concentrated to ~1 mL using an
Amicon Ultra-15 (Millipore) and loaded onto a 16/60 Superdex 200 prep grade (GE
Healthcare) polishing column using buffer C (50 mM HEPES and 300 mM NaCl at pH 8.0).
Pure WT MbNHase was concentrated using an Amicon Ultra-15 (Millipore) and analyzed by
SDS-PAGE with a 12.5% polyacrylamide SPRINT NEXT GEL™ (Amresco). Gels were
stained with Gel Code Blue (Thermo-Fisher Scientific). The protein concentration of
purified WT MbNHase was determined by measuring the absorbance at 280 nm on a
Shimadzu UV-2450 spectrophotometer. The calculated molecular weight for the WT
MbNHase homodimer is 111,207 g/mol with an extinction coefficient of 143,700 cm-1 M-1.
The molecular weight is in good agreement with SDS-PAGE data [11].
Expression and Purification of MbNHase Mutants. The genes encoding for the
MbNHase α- and β-subunits, where the entire (His)17 motif was removed (MbNHase∆238-257),
were synthesized by Integrated DNA Technologies, Inc. with optimized E. coli codon usage
and cloned into the kanamycin resistant pET28a+ (EMD Biosciences) plasmid. The α- and
6

ACCEPTED MANUSCRIPT
β-subunit genes were designed for co-expression by overlapping the “TGA” stop codon of
the β-subunit with the “ATG” start codon of the α subunit (Figure SI-1), like the expression
of PtNHase [16]. In addition, the α- and β-subunit genes where the entire insert region was
deleted (MbNHase∆219-272), were obtained by polymerase chain reaction (PCR) using the
primers (Sense primer: CAACCATGGGTACCG AGCAGGCGGCGGTG; Anti-sense primer:
CATAAGCTTTTAGTGGTGGTGGTGATGATGATCAACACGCGGCA) for the α-subunit
and (Sense primer: ACG CATATG ATGCACCTGT TCA CCTACGACCTGCA; Anti-sense
primer: AGTCCTCGAGTTACGCTTG CGGCGGGTTGCTA) for the β-subunit. The
α-subunit gene was sub-cloned between NcoI and HindIII sites, while the β-subunit gene was
sub-cloned between NdeI and XhoI sites within the pCOLADuet-1 expression vector
(Novagen). The sequences were confirmed by Functional Biosciences. The plasmids
containing the MbNHase∆238-257 and MbNHase∆219-272 deletion mutant genes were transformed
into BL21 magic cells for the soluble expression of the MbNHase∆238-257 and MbNHase∆219-272
enzymes. Expression and purification of these mutant enzymes were carried out in an
identical manner to that described above for WT MbNHase [11].
Expression and Purification of WT MbNHase and the Mutants in the Absence or
Presence of PtNHaseact. The gene encoding the Co-type activator (ε) protein from
Pseudonocardia thermophila JCM 3095 (PtNHaseact) was synthesized by Integrated DNA
Technologies, Inc. with optimized E. coli codon usage and cloned into the kanamycin
resistant pET21a+ (EMD Biosciences) expression vector to create the pSPTact plasmid. The
pSPTact plasmid was co-expressed with the previously reported pSMMαβ plasmid encoding
recombinant MbNHase [11] that had been freshly transformed into BL21(DE3) (Stratagene)
7

ACCEPTED MANUSCRIPT
competent cells. In addition, the pSPTact plasmid was co-expressed with the plasmids
containing the MbNHase∆238-257 and MbNHase∆219-272 deletion mutant genes in BL21 magic
cells. Expression and purification of WT MbNHase, MbNHase∆238-257 and MbNHase∆219-272
co-expressed with PtNHaseact was carried out in an identical manner to that described above
for WT MbNHase [11].
Kinetic Analysis. The enzymatic activity of WT MbNHase and each variant was
determined using acrylonitrile as the substrate (acrylamide; ∆ε225 = 2.9 mM-1 cm-1). The
rate of nitrile hydration was determined by continuously monitoring the formation of
acrylamide at 225 nm using a Shimadzu UV-2450 spectrophotometer equipped with a
TCC-240A temperature controlled cell holder [19]. A typical 1 mL reaction consisted of 50
mM Tris-HCl buffer pH 7.0 at 25 °C and various concentrations of acrylonitrile (0 to 450
mM). One unit (U) of MbNHase activity is defined as the formation of 1 µmol of
acrylamide per minute. To obtain the kinetic parameters, Vmax and Km, the initial velocities
from at least three independent measurements were fitted to the Michaelis-Menten equation
using OriginPro 9.0 (OriginLab, Northampton, MA). Kinetic data for each MbNHase
variant was determined more than three times for multiple purifications, all of which
provided consistent results.
Metal Analysis. The metal content of WT MbNHase and each variant, expressed in
the presence and absence of CoCl2, was determined by inductively-coupled plasma mass
spectrometry (ICP-MS). For comparison purposes, the Co-type NHase from
Pseudonocardia thermophila JCM 3095 (PtNHase) was expressed and purified as previously
described [20], and the metal content determined along with a buffer control that contained
8

ACCEPTED MANUSCRIPT
no protein. All protein samples were pretreated with 1 M urea and digested with
concentrated nitric acid (0.863 mL) followed by heating at 70 °C for 1 h, allowed to cool to
room temperature, and then diluted to a final concentration of 5% nitric acid. Samples were
submitted for analysis at the Water Quality Center in the College of Engineering at Marquette
University (Milwaukee, WI, USA).
Electronic Absorption and Electron Paramagnetic Resonance Spectra. Electronic
absorption spectra were recorded on a Shimadzu UV-2450 spectrophotometer equipped with
a TCC-240A temperature-controlled cell holder. Spectra for WT MbNHase and each variant
as well as PtNHase were obtained at 25 °C in a 1 cm quartz cuvette in 50 mM HEPES buffer
containing 300 mM NaCl, pH 8.0. X-band EPR spectra for WT MbNHase were recorded at
4 K, 0.1 mW in 50 mM HEPES buffer containing 300 mM NaCl, pH 8.0 on a Bruker
EMXplus spectrometer equipped with an ER4116DM (~ 9.6 GHz) resonator, an Oxford
Instruments ESR900 helium flow cryostat, and Oxford Instruments ITC503 temperature
controller.
Results and Discussion
Proteolytic Cleavage of WT MbNHase. Active, mature MbNHase was obtained
when expressed in the absence of an (ε) protein or the E. coli GroES/EL molecular
chaperones [11][13], whereas prokaryotic NHase activation appears to absolutely require an
activator protein [14-16]. These findings beg the question: “how is MbNHase functionally
expressed?” We hypothesized that the insert region, which contains a His17 section, (Figure
9

ACCEPTED MANUSCRIPT
1) plays a key role in metallocentre assembly and therefore, created three altered MbNHase
enzymes targeting this insert region.
Purified WT MbNHase exhibits a single band at ~55 kDa on SDS-PAGE (Figure 2)
and a kcat value of 131 ± 3 s-1 (Km = 83 ± 10 mM) in 50 mM Tris-HCl buffer pH 7.0 at 25 °C
using acrylonitrile as the substrate, values that are indistinguishable from those reported
previously (Table 1) [11]. Size-exclusion chromatography revealed that WT MbNHase
exists primarily as an (αβ)2 homodimer in solution, analogous to the α2β2 heterotetramer
architecture observed for prokaryotic NHases. However, storage of WT MbNHase at 4 ℃ in
50 mM Tris-HCl buffer, pH 7.0 for approximately two weeks, provided an MbNHase enzyme
with a modestly increased kcat value of 163 ± 4 s-1 but a similar Km value of 93 ± 15 mM,
using acrylonitrile as the substrate (Table 1). SDS-PAGE analysis of aged MbNHase
samples revealed two polypeptides of ~24 and ~26 kDa (Figure 2), while size exclusion
chromatography suggested an α2β2 heterotetramer, identical to that observed for prokaryotic
NHases. These data suggested that WT MbNHase is cleaved, likely by trace amounts of
proteases. The observed increase in kcat for the proteolytically cleaved MbNHase enzyme,
represents an ~20% increase in rate over WT MbNHase. The increased rate was very
reproducible for batch-to-batch preparations, providing the calculated error of ± 4 s-1. The
observed increase in activity is perhaps due to an easing of conformational stress induced by
the insert region in and around the active site, although structural characterization will be
required to confirm this.
Confirmation of an α2β2 heterotetramer after proteolytic cleavage of WT MbNHase
was obtained by MALDI-TOF mass spectroscopy (Figure 3). Two masses were clearly
10

ACCEPTED MANUSCRIPT
observed at 24,848 Da and 25,530 Da, values that are consistent with SDS-PAGE estimates
(Figure 2) and correspond to the α- and β-subunits of MbNHase based on sequence
comparison with the prototypical Co-type PtNHase enzyme (Figure 4). The two
MALDI-TOF MS peaks were of similar intensities, indicating a ~1:1 α:β ratio. Interestingly,
the observed molecular masses from MALDI-TOF MS suggests that a 5,226 Da peptide is
lost after proteolytic cleavage, comparable to the size of the complete insert region of WT
MbNHase. Attempts to isolate the cleaved fragment by gel-filtration were unsuccessful
suggesting that the fragment is likely cleaved into small peptides by protease contaminants.
Cleavage of MbNHase could be prevented by an additional gel-filtration purification step
performed directly after IMAC; however, the addition of metal ion inhibitors such as EDTA
or 1,10-phenanthroline had no effect on MbNHase cleavage. Addition of protease inhibitor
cocktails, such as AEBSF, resulted in precipitation of MbNHase. Taken together, these data
indicate that the single polypeptide of freshly isolated WT MbNHase, which contains fused α-
and β-subunits linked by an insert region, is cleaved into separate α- and β-subunits upon
ageing, likely by trace amounts of proteases, resulting in a modestly more active α2β2
heterotetrameric form of MbNHase.
A combination of UV-Vis and EPR spectroscopy coupled with metal analyses was
used to determine that the proteolytically cleaved MbNHase enzyme contained its full
complement of Co(III). ICP-MS data indicated that the proteolytically cleaved MbNHase
enzyme contained 1.9 ± 0.1 equivalents of cobalt per α2β2 heterotetramer, indistinguishable
from WT MbNHase (Table 1) with no other metal ions detected above the background level
of <10 ppb [11]. Proteolytically cleaved MbNHase exhibited the typical amber color of
11

ACCEPTED MANUSCRIPT
Co-type NHase enzymes in 50 mM HEPES buffer containing 300 mM NaCl, pH 8.0 (Figure
5) [1], and the UV-Vis spectrum reveals the characteristic S → Co(III)
ligand-to-metal-charge-transfer (LMCT) band at 315 nm (ε = 2,500 M-1 cm-1) (Figure 5),
which is blue-shifted by ~10 nm compared to WT MbNHase [11]. EPR spectra show no
detectable Co(II) signals consistent with the presence of low-spin Co(III), which is
diamagnetic (Figure SI-2). These data indicate that proteolytically cleaved MbNHase,
retains its full complement of Co(III) and that neither the insert region nor the (His)17 motif is
required for catalysis in the proteolytically cleaved MbNHase enzyme.
Examination of the functional role of the (His)17 insert. To investigate whether the
(His)17 region plays a role in metal ion insertion and/or the posttranslational modification of
the active site, the MbNHase∆238-257 (His)17 deletion mutant, was prepared. SDS-PAGE
analysis revealed two bands at ~25.5 and ~28.5 KDa for MbNHase∆238-257 while
size-exclusion chromatography indicated that MbNHase∆238-257 exists primarily as an α2β2
heterotetramer with a molecular weight of ~108 kDa, much like prokaryotic Co-type NHases
(Figure 6). Kinetic analyses of the MbNHase∆238-257 (His)17 deletion mutant, expressed in
the absence or presence of the prototypical Co-type activator (ε) protein, PtNHaseact, using
acrylonitrile as the substrate, were performed in triplicate for multiple purifications in 50 mM
Tris-HCl buffer, pH 7.0 at 25 °C providing kcat values of 71 ± 4 s-1 and 166 ± 5 s-1
respectively. Km values for the MbNHase∆238-257 (His)17 deletion mutant expressed in the
absence or presence of the PtNHaseact were 104 ± 17 mM and 125 ± 17 mM, respectively
(Table 1). The MbNHase∆238-257 (His)17 deletion mutant expressed in the absence or
presence of PtNHaseact contained 1.8 ± 0.1 and 2.3 ± 0.2 equivalents of cobalt per α2β2
12

ACCEPTED MANUSCRIPT
heterotetramer, respectively, with no other metal ions detected above the background level of
<10 ppb. The MbNHase∆238-257 (His)17 deletion mutant expressed in either the absence or
presence of PtNHaseact in 50 mM HEPES buffer containing 300 mM NaCl, pH 8.0 exhibited
the characteristic S → Co(III) LMCT band at ~320 nm (ε =2,200 M-1 cm-1) (Figure 5), nearly
identical to WT MbNHase [11]. While the (His)17 region is not required for metal uptake or
active site maturation, expression in the presence of the prototypical prokaryotic activator
protein, PtNHaseact, does enhance the observed kcat value by ~60%, which is greater than
would be expected from the slight increase (~20%) in metal content. Therefore, PtNHaseact
does assist in the activation of the MbNHase∆238-257 (His)17 deletion mutant but is not required
for post-translational modification of the active enzyme.
Investigation of the Insert region of MbNHase. The MbNHase∆219-272 insert region
deletion mutation provides an enzyme with the entire insert region between the α and β
regions of WT MbNHase removed (Figure 1). Removal of this insert region essentially
converts the eukaryotic MbNHase into a prokaryotic NHase analog, allowing the direct
comparison of MbNHase∆219-272 and PtNHase. The MbNHase∆219-272 insert region deletion
mutant expressed in the absence of PtNHaseact exhibited two bands on SDS-PAGE at ~25.5
and ~26.5 kDa. Size-exclusion chromatography indicated that MbNHase∆219-272 exists
primarily as an α2β2 heterotetramer with a molecular weight of ~104 kDa, indistinguishable
from proteolytically cleaved WT MbNHase and prokaryotic Co-type NHases such as
PtNHase. Surprisingly, co-expression of MbNHase∆219-272 in the presence of PtNHaseact
yielded a single band at ~52 kDa on SDS-PAGE which is consistent with an αβ complex.
However, it could also be due to the formation of an α(ε)2 complex as PtNHaseact is ~14 kDa
13

ACCEPTED MANUSCRIPT
so an α(ε)2 complex would have a mass of ~53.5 kDa. Interestingly, the Co-type (ε) protein
from Rhodococcus rhodochrous J1 was shown to form an α(ε)2 complex, which was proposed
to bind Co(II) and insert it into apo-α2β2 NHase via a “self-subunit swapping” mechanism
[21]. The Co-type (ε) protein was also proposed to facilitate oxidation of two active site
Cys-residues. Attempts to separate the ~52 kDa proteins into their individual components
were unsuccessful even in the presence of 8 M urea, 1 M dichlorodiphenyltrichloroethane
(DDT) or SDS at 95 °C for 10 min (Figure 7).
Kinetic analysis of the MbNHase∆219-272 insert region deletion mutant expressed in the
absence or presence of PtNHaseact in 50 mM Tris-HCl buffer, pH 7.0 at 25 °C provided kcat
values of 75 ± 8 s-1 and 117 ± 10 s-1, respectively, using acrylonitrile as the substrate (Table 1).
These kinetic data suggest that the MbNHase∆219-272 insert region deletion mutant expressed
in the presence of PtNHaseact, is likely an αβ complex, even so, the Co-type NHase (ε)
proteins are known to have significant sequence identity with the NHase β-subunit [22, 23],
so α(ε)2 complex might be expected to be catalytically competent, but not likely more active
than an α2β2 heterotetramer such as was observed for the MbNHase∆219-272 insert region
deletion mutant expressed in the absence of PtNHaseact. The MbNHase∆219-272 insert region
deletion mutant expressed in the absence or presence of PtNHaseact is not particularly stable
in 50 mM Tris-HCl buffer, pH 7.0 at 25 °C and loses > 95% of its activity over the course of
a few hours, indicating that the insert region plays a role in stabilizing the WT MbNHase
enzyme. The MbNHase∆219-272 insert region deletion mutant contained 1.7 ± 0.1 equivalents
of cobalt per α2β2 heterotetramer, irrespective of the co-expression of PtNHaseact
, a value
nearly identical to that observed for WT MbNHase (Table 1). UV-Vis spectra of the
14

ACCEPTED MANUSCRIPT
MbNHase∆219-272 insert region deletion mutant expressed in the absence or presence of
PtNHaseact in 50 mM HEPES buffer containing 300 mM NaCl, pH 8.0 were indistinguishable
from each other and WT MbNHase (Figure 5). Therefore, MbNHase∆238-257 binds its full
complement of Co(III) ions without the assistance of an (ε) protein, indicating that the insert
region is also not required for metal ion binding or active site maturation.
Conclusion
Characterization of the eukaryotic NHase from Monosiga brevicollis constructs
described herein, confirm that MbNHase does not require an NHase activator protein or the E.
coli chaperone proteins GroEL/ES for metallocentre assembly, including metal ion insertion
and active site post-translational maturation. In addition, these data indicate that the (His)17
region found within the insert that links the α- and β-subunits is not required for metal ion
incorporation or active site maturation. The fact that the proteolytically cleaved WT
MbNHase enzyme and the MbNHase∆238-257 (His)17 deletion mutant each exhibit a modest
increase in activity compared to WT MbNHase, suggests that the insert region likely induces
a structural strain on the active site that has a limiting effect on the catalytic rate of hydration.
The lack of the need for either an intrinsic or an extrinsic activator polypeptide for MbNHase
is in stark contrast to the absolute requirement for an activator for assembly and activation of
the otherwise similar prokaryotic NHases. The pertinent and related outstanding questions
are, "How can the MbNHase metallocentre self-assemble and self-activate?" and, "Why do
the prokaryotic NHase metallocenters require activators for assembly and activation?" The
15

ACCEPTED MANUSCRIPT
genetically engineered functional constructs of MbNHase described herein represent an
important new tool with which to further address these important questions using structural
and spectroscopic methods.
Supporting Information. Supplementary information includes the gene design for the
MbNHase∆238-257 mutant (Figure SI-1) and an EPR spectrum of WT MbNHase (Figure SI-2).
Abbreviations. NHase, nitrile hydratase; ORF, open reading frame; ICP-MS,
inductively-coupled plasma mass spectrometry; IMAC, immobilized metal affinity
chromatography;
16

ACCEPTED MANUSCRIPT
References
1
2
3
4
5
6
7
8
J. A. Kovacs (2004) Chem Rev 104:825-848
T. C. Harrop and P. K. Mascharak (2004) Acc Chem Res 37:253-260
M. Kobayashi, T. Nagasawa and H. Yamada (1992) Trends Biotechnol 10:402–408
T. Nagasawa, H. Shimizu and H. Yamada (1993) Appl Microbiol Biotechnol 40
T. Nagasawa and H. Yamada (1995) Pure Appl Chem 67:1241–1256
H. Yamada and M. Kobayashi (1996) Biosci Biotech Biochem 60:1391-1400
S. Prasad and T. C. Bhalla (2010) Biotechnology Advances 28:725-741
T. Nagasawa, C. D. Mathew, J. Mauger and H. Yamada (1988) Appl Environ
Microbiol 54:1766-1760
9
A. O. Marron, M. Akam and G. Walker (2012) PLoS ONE 7:e32867
K. U. Foerstner, T. Doerks, J. Muller, J. Raes and P. Bork (2008) PLoS ONE 3:e3976
S. Martinez, X. Yang, B. Bennett and R. C. Holz (2017) Biochimica et Biophysica
Acta (BBA) - Proteins and Proteomics 1865:107-112
10
11
12
13
14
M. Tsujimura, M. Odaka, H. Nakayama, N. Dohmae, H. Koshino, T. Asami, M.
Hoshino, K. Takio, S. Yoshida, M. Maeda and I. Endo (2003) J Am Chem Soc
125:11532-11538
A. Dey, M. Chow, K. Taniguchi, P. Lugo-Mas, S. Davin, M. Maeda, J. A. Kovacs, M.
Odaka, K. O. Hodgson, B. Hedman and E. I. Solomon (2006) J Am Chem Soc
128:533 - 541
M. Nishiyama, S. Horinouchi, M. Kobayashi, T. Nagasawa, H. Yamada and T. Beppu
(1991) J Bacteriol 173:2465-2472
17

ACCEPTED MANUSCRIPT
15
16
17
N. Hashimoto Y., M., Horinouchi S., Beppu T. (1994) Bioscience, biotechnology, and
biochemistry 58:1859-1869
M. Nojiri, M. Yohda, M. Odaka, Y. Matsushita, M. Tsujimura, T. Yoshida, N. Dohmae,
K. Takio and I. Endo (1999) Journal of Biochemistry 125:696-704
R. R. Mendel, A. G. Smith, A. Marquet and M. J. Warren (2007) Natural Product
Reports 24:963-971
18
19
K. A. Higgins, C. E. Carr and M. J. Maroney (2012) Biochemistry 51:7816-7832
J. M. Stevens, N. Rao Saroja, M. Jaouen, M. Belghazi, J.-M. Schmitter, D. Mansuy, I.
Artaud and M.-A. Sari (2003) Protein Expression and Purification 29:70-76
S. Martinez, R. Wu, R. Sanishvili, D. Liu and R. Holz (2014) Journal of the American
Chemical Society 136:1186-1189
20
21
22
23
Z. Zhou, Y. Hashimoto, T. Cui, Y. Washizawa, H. Mino and M. Kobayashi (2010)
Biochemistry 49:9638-9648
Z. Zhou, Y. Hashimoto and M. Kobayashi (2009) The Journal of Biological Chemistry
284:14930-14938
Z. Zhou, Y. Hashimoto, K. Shiraki and M. Kobayashi (2008) Proceedings of the
National Academy of Sciences 105:14849-14854
18

ACCEPTED MANUSCRIPT
Table 1. Kinetic constants for the wild-type and mutant MbNHasesa
kcat (s-1)
Km (mM)
kcat/Km (s-1mM-1) Metal Content
Wild-typeb
1.6
131 ± 3
163 ± 4
71 ± 4
83 ± 10
93 ± 15
104 ± 17
125 ± 17
73 ± 14
149 ± 23
1.8 ± 0.1
Cleaved
1.8
0.7
1.3
1.0
0.8
1.9 ± 0.1
1.8 ± 0.1
2.3 ± 0.2
1.7 ± 0.1
1.7 ± 0.1
∆238-257
∆238-257 + PtNHaseact
∆219-272
166 ± 5
75 ± 8
∆219-272 + PtNHaseact
117 ± 10
aAcrylonitrile was used as the substrate. bReference [11].
19

ACCEPTED MANUSCRIPT
FIGURE CAPTIONS
Figure 1. Scheme showing the arrangement of the NHase β- and α-subunits in eukaryotes.
Figure 2. The SDS-PAGE of (a) WT MbNHase and (b) the proteolytically cleaved
MbNHase enzyme.
Figure 3. MALDI-TOF Mass Spectra of proteolytically cleaved MbNHase revealing two
peaks at 24.8 and 25.5 kDa corresponding to independent α- and β-subunits.
Figure 4. Sequence alignment of MbNHase and PtNHase shows that the α-subunits share
23% identity while the β-subunits exhibit 32% identity (Orange: active site; green: insert
region; yellow: histidine rich region).
Figure 5. UV-Vis spectra of various MbNHase constructs between (a)280 and 500 nm; (b)
300 and 480 nm in 50 mM HEPES buffer containing 300 mM NaCl at pH 8.0. (b)
Figure 6. Purification of the MbNHase∆238-268 mutant. a) size-exclusion column indicating
a single peak corresponding to an α2β2 heterotetramer; b) SDS-PAGE gel page showing that
the purified α and β-subunits are two independent proteins.
20

ACCEPTED MANUSCRIPT
Figure 7. SDS-PAGE gel of MbNHase∆219-272. Column 1: MbNHase∆219-272 from activator
co-expression; Column 2: MbNHase∆219-272 from PtNHase activator co-expression treated by
8mM Urea; Column 3: MbNHase∆219-272 from activator co-expression treated by 8M urea and
1M DDT; Column 4: MbNHase∆219-272 without activator.
21

ACCEPTED MANUSCRIPT
Figure 1
β subunit
α subunit
N-term
C-term
His-rich region
Conserved CTLCSC
Active Site
22

ACCEPTED MANUSCRIPT
Figure 2
β
α
β
α
β
α
~14 Days
+
β
α
23

ACCEPTED MANUSCRIPT
Figure 3
24

ACCEPTED MANUSCRIPT
Figure 4
25

ACCEPTED MANUSCRIPT
Figure 5
26

ACCEPTED MANUSCRIPT
Figure 6
27

ACCEPTED MANUSCRIPT
Figure 7
28

ACCEPTED MANUSCRIPT
Supplementary Material
Figure SI-1. Gene design for the MbNHase∆238-257 mutant showing that the α and β-subunit
genes overlap by sharing the “TG” based on TGA and ATG requiring on one promotor for the
expression of both genes.
29