DNA-directed formation of peptide bond: A model study toward DNA-programmed peptide ligation

Article abstract of DOI:10.1016/j.tet.2012.04.032

A model study of DNA-directed peptide ligation has been developed by transferring fluorescent reporting group from small molecule thioester to a DNA strand (template DNA) in the presence of a thiol-functionalized DNA strand (auxiliary DNA), mimicking the Native Chemical Ligation (NCL) reaction. This DNA-directed transfer shows dependence on the sequence complementarity of the two DNA strands, with in situ generated 4-thiolphenylmethyl functionalized oligonucleotide as the auxiliary DNA strand, under mild basic condition (pH=8.5), and with tris(2-carboxyethyl) phosphine hydrochloride (TCEP) as a reducing agent. Reactions with different amino acid α-thioesters resulted in varied transfer efficiencies from glycine to α-substituted amino acids. This study has provided the basic foundation to use DNA-programmed chemistry toward the chemical synthesis or unnatural modification of protein molecules.

Full text of DOI:10.1016/j.tet.2012.04.032

Tetrahedron 68 (2012) 5152e5156
Contents lists available at SciVerse ScienceDirect
Tetrahedron
journal homepage: www.elsevier.com/locate/tet
DNA-directed formation of peptide bond: a model study toward
DNA-programmed peptide ligation
Chi Zhang, Yizhou Li, Mingda Zhang, Xiaoyu Li *
Beijing National Laboratory of Molecular Sciences (BNLMS), Key Laboratory of Bioorganic Chemistry and Molecular Engineering of the Ministry of Education, Institute of Organic
Chemistry, College of Chemistry and Molecular Engineering, Peking University, Beijing 100871, China
a r t i c l e i n f o
a b s t r a c t
Article history:
A model study of DNA-directed peptide ligation has been developed by transferring fluorescent reporting
group from small molecule thioester to a DNA strand (template DNA) in the presence of a thiol-
functionalized DNA strand (auxiliary DNA), mimicking the Native Chemical Ligation (NCL) reaction.
This DNA-directed transfer shows dependence on the sequence complementarity of the two DNA
strands, with in situ generated 4-thiolphenylmethyl functionalized oligonucleotide as the auxiliary DNA
strand, under mild basic condition (pH¼8.5), and with tris(2-carboxyethyl) phosphine hydrochloride
Received 3 February 2012
Received in revised form 3 April 2012
Accepted 9 April 2012
Available online 14 April 2012
Keywords:
(
TCEP) as a reducing agent. Reactions with different amino acid
a-thioesters resulted in varied transfer
DNA-templated synthesis
Peptide bond formation
Thiolethioester exchange
Acyl transfer reaction
Native chemical ligation
efficiencies from glycine to -substituted amino acids. This study has provided the basic foundation to
a
use DNA-programmed chemistry toward the chemical synthesis or unnatural modification of protein
molecules.
Ó 2012 Elsevier Ltd. All rights reserved.
1. Introduction
intermolecular acyl transfer to a much faster intramolecular S to N
shift (Scheme 1a), which is the origin of NCL’s excellent chemo-
Chemical synthesis and site-selective modification of large
proteins call for versatile ligation strategies to assemble small
peptide fragments generated from conventional solid-phase pep-
tide synthesis (SPPS). Inspired by the thiol capture strategy de-
specificity for peptide chemical ligation where amino acid side
chains remain unprotected.
4
Among the numerous methods to control the reactivity in or-
10e18
ganic synthesis, DNA-templated synthesis (DTS)
has emerged
1
veloped by Kemp and co-workers, several ligation methods have
as a novel approach to achieve such goal at very low reactant
concentration while increasing the effective molarity of DNA-
linked substrates through DNA hybridization. DTS has been sys-
tematically developed and applied in programmed synthesis of
small molecule libraries, interrogation, and selection against bi-
ological targets, sequence specific modification of DNA/RNA, re-
action discovery, bio-detection, as well as evolution and
2
been introduced. Among them, Native Chemical Ligation (NCL) is
arguably the most powerful one and, due to its mild reaction
condition, high efficiency, and excellent chemospecificity, has
shown great utility and versatility in broad applications of protein
3
chemical synthesis. In NCL, the cysteine residue at the N-terminus
of one peptide can capture the a-thioester of another peptide by
19e22
thiolethioester exchange, followed by the S to N shift, to afford the
manipulation of DNA-conjugated molecules.
The high fidelity
4
amide bond at the ligation site. However, despite its wide appli-
of WatsoneCrick base pairing confers great selectivity and se-
14
cations, the requirement of an N-cysteine residue, a low abundance
quence specificity to DNA-templated chemical reactions.
5
amino acid in natural proteins, has limited NCL as a general
Previously, efforts have been focused on using DNA-templated
acyl transfer reaction to generate peptide or peptidomimetic
bond. Liu and co-workers have applied DNA-templated amide bond
method for protein chemical synthesis.
Therefore a variety of elegant strategies have been developed to
either transform N-cysteine residue to other amino acid after li-
formation reactions in the synthesis of DNA-encoded libraries with
6
22,23
gation, or to utilize template structures to fulfill the function of
peptidic structures.
Stulz group has systematically assessed the
7
e9
cysteine in order to overcome this limitation.
In NCL and other
efficiencies of DNA-templated attack of thioesters by a variety of
2
4
ligation methods, thiolethioester exchange is usually considered
as a fast step, and the kinetic advantage changes the slow
nucleophiles. Using a DNA-conjugated peptide thioester, Joyce
and co-workers have shown that the peptide component could be
transferred to another DNA strand by DNA-templated acyl transfer
2
5
reaction. In addition, native chemical ligation has been used by
Grossmann and Seitz group in the DNA-catalyzed transfer of
*
Corresponding author. E-mail address: xiaoyuli@pku.edu.cn (X. Li).
0
040-4020/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved.
doi:10.1016/j.tet.2012.04.032

C. Zhang et al. / Tetrahedron 68 (2012) 5152e5156
5153
Scheme 1. A: Native chemical ligation (NCL); B: DNA-directed formation of peptide bond by acyl transfer. After the thiolethioester exchange between the thiol-functionalized
auxiliary DNA with the small molecule thioester labeled with fluorescent dye (TAM: TAMRA (tetramethyl-6-carboxyrhodamine)), DNA-templated S to N shift transfers TAM to
the template DNA.
peptide from PNA-linked peptide thioester to another PNA-linked
peptide.26 These previous DNA-templated acyl transfer reactions
highlight their potential application in the controlled synthesis of
polypeptides.
(4-carboxymethyl)thiophenol (MPAA) was usually added as cata-
lyst to generate the reactive thioester species in situ. Therefore, we
4
synthesized the 2-(4-(pyridin-2-yldisulfanyl)phenyl)acetic acid
modified oligonucleotides as the auxiliary DNA. Reduction of the
disulfide bond will generate the reactive thiol-modified DNA in
situ. We envisioned that three major factors will affect the reaction
yield. First, the intermolecular nature of thiolethioester exchange
requires higher concentration of the small molecule thioester and
the template DNA for greater reaction yield; second, the nucleo-
philicity of the amino and thiol group on the DNA strands are
heavily influenced by the pH of the reaction solution: protonation
of the nitrogen at low pH will substantially slow down the acyl
transfer reaction; while high pH should also be avoided to prevent
the reaction from competing hydrolysis of the thioester; third, re-
ducing agent should be added to reduce the disulfide bond and
protect the in situ generated thiol group against oxidation.
However, previously demonstrated DNA-templated acyl trans-
fer reactions are limited by the requirement of an existing DNA-
conjugated thioester and the fact that such reactions only pro-
ceeded in a DNA-templated coupling format. Enabling the acyl
transfer from free, non-DNA-conjugated thioesters to peptides in
a DNA-directed manner will significantly expand the scope of DNA-
directed synthesis of peptide bond and hold further potential for
DNA-programmed peptide ligation and protein chemical synthesis,
especially modifications by unnatural amino acid thioesters. NCL
relies on the irreversible intramolecular S to N shift to capture the
transferred acyl group and a series of studies have shown auxiliary
groups can be used as surrogates in the absence of a terminal
9
cysteine. Here in this report, we propose to use the hybridization
We first examined the effects of reactant concentration. As
expected, reaction yield increases with higher concentrations of
of two complementary oligonucleotides to enable the intra-
molecular S to N shift to form the peptide bond. As shown in
Scheme 1b, a thiol-modified oligonucleotide (auxiliary DNA) and
a complementary amine-bearing oligonucleotide (template DNA)
form a DNA duplex. The thiolethioester exchange brings the thio-
ester in close proximity to the amine group on the template DNA,
eventually leading to intramolecular S to N shift and formation of
the peptide bond, analogous to NCL. Different from other DNA-
based approaches, this design does not require a DNA-conjugated
thioester and the ligation specificity depends on the sequence
complementarity of the two participating oligonucleotides.
TAM-Gly-thioester (Fig. 1a, lane 1, 4, 5). At 50
mM (lane 1), the
reaction yield reaches the plateau and further increasing thioester
concentration did not improve the yield, suggesting saturation and
the S to N shift is now the limiting step. In contrast, very little
product was observed in the absence of tris(2-carboxyethyl)
phosphine hydrochloride (TCEP) (Fig. 1a, lane 3), indicating the
necessity of activation of the auxiliary DNA by disulfide cleavage to
generate the free thiol group. Importantly, as a unique feature for
DNA-directed reactions, with a mismatched auxiliary DNA (labeled
MR in Fig. 1a, lane 2), also very little product was formed, proving
the intramolecular nature of the acyl transfer between the two
DNA strands. The faint band observed with mismatched DNA is
possibly due to the background direct aminolysis between the
Reaction yield of NCL is mainly influenced by amino acid resi-
2
dues at the ligation site; therefore, in our study, the amine-
modified DNA and the TAMRA (TAM)-linked amino acid thioester
could mimic the two amino acid residues at the ligation site. And
the conjugated TAMRA group permits easy monitoring and quan-
tification of reaction yield by polyacrylamide gel electrophoresis
and fluorescent densitometry.
2
7
template DNA and the high concentration thioester. Moreover,
consistent with reported NCL, reaction yield was achieved at
mildly basic pH¼8.5 (Fig. 1a, lane 1 and lane 6e9), which seems to
be the balanced condition conferring enough nucleophilicity to the
amino group while keeping the hydrolysis of thioester sufficiently
slow.
2
. Results and discussion
The overall reaction yield is still lower than other reported
7e9
Mechanistic studies show that aryl-thioesters are more reactive
auxiliary-mediated ligation methods.
To understand the un-
than alkyl-thioesters in native chemical ligation reactions, and
derlying reasons, we first performed the reaction with organic

5154
C. Zhang et al. / Tetrahedron 68 (2012) 5152e5156
Fig. 1. Investigation of reaction conditions. R: matched auxiliary DNA; MR: mismatched auxiliary DNA; SM: TAM-Gly-thioester. Reactions were carried out in 1 M NaCl solution,
ꢂ
0.1 M HEPES buffer, 5 mM TCEP, with DNA concentration of 0.5
m
M for each strand at 37 C after 96 h. 0.05
m
M 21 bp TAMRA-linked oligonucleotide was added to each reaction
mixture as internal standard for reaction yield quantification. Yield was calculated from the ratio of fluorescent intensity of product bands to internal 21 bp standard bands. A:
denaturing PAGE analysis of reactions performed in different conditions. B: reactions with matched auxiliary DNA and mismatched auxiliary DNA were analyzed at different time
points.
co-solvent, previously used to reduce competing thioester hydro-
Indeed, previous reports show that direct intermolecular ami-
nolysis of the thioester with amine has very slow kinetics, while
reactions with NHS activated ester proceed to near completion
9
g
lysis. However, addition of several organic solvents did not lead to
improved yield (supplementary data, Fig. S1), suggesting thioester
availability is not the limiting factor in our reaction. Second, we
performed direct NCL between thioester and cysteine-labeled
template DNA strand as a comparison (supplementary data,
2
3,27
rapidly.
Typically, DNA-templated reactions have high sequence speci-
14
ficity. We further compared the kinetics of the reactions with
matched and mismatched auxiliary DNAs under conditions de-
veloped above. The initial rate of reaction with matched auxiliary
DNA is 15-fold faster than that of auxiliary DNA bearing mis-
Fig. S2). Indeed, the reaction yield increased significantly to
3
4
5e50%, comparable to regular NCL. In addition, a DNA-directed
acyl transfer similar to Fig. 1 but with a cysteine-labeled template
DNA instead of a simple amine also gives improved yield (38.4%,
ꢁ
5
ꢁ1 ꢁ1
ꢁ5
ꢁ1 ꢁ1
M s
matches. (kapp¼7.5ꢀ10
mM
s
vs kapp¼7.5ꢀ10
m
47.7%, supplementary data, Fig. S2). Collectively, the data strongly
Fig. 1b). These results clearly showed the necessity of DNA strand
sequence complementarity and the template effect in our system.
To evaluate the substrate scope, we prepared other two TAM-
suggest that the S to N shift is rate-limiting in our system, in con-
2
,7e9
sistency with other NCL-based ligation methods.
We reason
that possibly the formation of a large 44-memebered macrocyclic
transition state is entropically much less favored than the five-
membered ring in NCL (see supplementary data, Fig. S3), there-
linked amino acid a-thioesters bearing the residues of Leu and
Pro (see supplementary data for details). Together with TAM-Gly-
thioester, these three thioesters represent three sterically differ-
ent types of amino acids. We also conjugated different types of
amino acids to the amine-modified template DNA strand. Similar
to NCL and other ligation methods, reaction yield decreases with
amino acids that have bulkier side chains (Fig. 2). Higher reaction
yields were observed with TAM-Gly-thioester, while almost no
product was formed when TAM-Pro-thioester was used. Reactions
with oligonucleotides modified with sterically hindered amino
acids (Val, Pro, Phe) showed lower yields. Polar or charged resi-
dues (Gln, Glu) did not show significant effects on the ligation
yields. Interestingly, Ala-Gly pair gives higher yield than Gly-Gly,
indicating effecting parameters other than simple steric hin-
drance. It should be noted that the desired product was observed
even with phenylglycine-linked oligonucleotides, which sug-
gested the potential for incorporating unnatural functionality into
the peptide linkage using our DNA-directed ligation method.
9
g,h
fore leading to slower reaction kinetics.
We also prepared an
auxiliary DNA with a shortened linker (supplementary data, Fig. S2,
auxiliary DNA A2); the reaction also gave even lower yield, sug-
gesting steric or conformational factors may also be implicated.
Wong and co-workers have reported w20% to w80% yields with
either a 15- or 18-membered transition states in Sugar-Assisted
Ligation (SAL),9
feh
providing the possibility of yield improvement
via further optimization of the DNA and linker structures in our
system.
In agreement with previous studies on DNA-templated acyl
12
transfer reaction between DNA-linked amine and thioester, the
reaction efficiency is lower than that of DNA-templated amide
bond formation with N-hydroxylsuccinimidyl (NHS) activated
2
3
ester as the electrophile, presumably due to the lower elec-
trophilicity of thioester compared with NHS activated ester.

C. Zhang et al. / Tetrahedron 68 (2012) 5152e5156
5155
Fig. 2. DNA-directed formation of peptide bond with various terminal amino acid residues on the template DNA (Xaa1) and small molecule thioester (Xaa2). Reaction conditions are
the same as those developed in Fig. 1a.
0
3
. Conclusion
incorporated to DNA oligonucleotides using 5 -amino-modifier.
Oligonucleotides were quantitated by UV using BioTek
Epoch UVevis spectrometer. Reaction yields were quantitated
by denaturing polyacrylamide gel electrophoresis (PAGE)
followed by measuring fluorescent intensity using BioRad Gel-
Doc system. Relative yields were calculated as the ratio of fluo-
rescent volume between the product bands and the internal
standard bands.
In summary, we have demonstrated the feasibility of using
DNA to direct the ligation of small molecule thioester with com-
plementary amine-modified oligonucleotides. Phenylthiol-linked
oligonucleotide was generated in situ and used for thio-
lethioester exchange with small molecule thioesters, following S
to N shift transferred the fluorescent reporting group to the
complementary DNA strand. The DNA-directed acyl transfer and
peptide bond formation shows excellent specificity on the DNA
sequence complementarity, providing the potential of performing
multiplexed peptide ligation in a single solution directed by dif-
ferent DNA strands. The DNA-directed reaction’s substrate scope
was investigated and, as expected, ligation yield decreases with
amino acids that have bulky side chains. Collectively, this study
provides the potential applicability of this method in cysteinyl-free
ligation of peptides directed by DNA. Data show that the rate-
limiting step in our system is the intramolecular S to N shift,
possibly due to the formation of an entropically disfavored mac-
rocyclic transition state between the two DNA strands, instead of
the five-membered ring in NCL. Further studies will focus on im-
proving the reaction kinetics, including: (1) chemically modifying
the DNA and linker structure to reduce the entropic loss in the S to
N shift; and (2) shifting the hybridization position of the auxiliary
DNA on the template to optimize the conformation and steric ef-
fects in the S to N shift.
4.2. Oligonucleotide functionalization
4.2.1. 2-(4-(Pyridin-2-yldisulfanyl)phenyl)acetic acid modified oligo-
nucleotides. After automated DNA synthesis, the CPG was sus-
pended in 3% TCA in DCM for 10 min to remove the 5 -MMTr
protecting group, the resin was washed thoroughly with DCM
and dried under vacuum. For 35 mg CPG resin (up to 1
0
mmol DNA
loaded), 2-(4-(pyridin-2-yldisulfanyl)phenyl)acetic acid (11 mg,
50
m
mol), HOBt (7 mg, 50
mmol), HBTU (17 mg, 45 mmol), DIPEA
L, 115 mol) and anhydrous DMF (1.2 mL) were added, and
the reaction mixture was agitated at 25 C for 12 h. The resin was
washed with DMF and then thoroughly with DCM and dried
under vacuum. Treatment for 50 min with AMA (NH OH/CH NH ,
v/v¼1/1.4) at 55 C fully deprotected the oligonucleotide and
liberated the disulfide protected auxiliary DNA. The functional-
ized oligonucleotide was purified by reverse-phase HPLC and
characterized by MALDI-TOF mass spectrometry. Matched auxil-
iary DNA in Figs. 1 and 2: observed as reduced thiol-modified
auxiliary DNA, observed mass¼4839ꢃ5 (expected: 4836). Mis-
matched auxiliary DNA in Figs. 1 and 2: observed as reduced
thiol-modified auxiliary DNA, observed mass¼4813ꢃ5 (expected:
(20
m
m
ꢂ
4
3
2
ꢂ
4
4
. Experimental section
.1. General methods
4
809).
Unless otherwise noted, all reagents and solvents were pur-
chased from commercial sources and used as received. DNA ol-
igonucleotides were synthesized on an Applied Biosystem 3940
DNA synthesizer using standard phosphoramidite protocols and
4.2.2. Amino acid-conjugated oligonucleotides. FmocNH-Xaa-COOH
(90 mol) (For Glu-conjugated DNA, FmocNH-Xaa(OFm)-COOH
was used), Sulfo-NHS (20 mg, 90 mol), EDCI (18 mg, 90 mol) in
m
m
m
purified by reverse-phase HPLC with triethylammonium acetate
anhydrous DMF (100
Sulfo-NHS esters in situ. The DMF solution (50
amino template DNA (up to 10 nmol) in 200 mM phosphate
m
mol) were agitated for 2 h to generate the
0
0
(
TEAA)/CH
3
CN gradient. Oligonucleotides bearing 3 -amino
mL) was added to 3 -
0
0
group were synthesized using 3 -amino-CPG. 5 -amino was

5156
C. Zhang et al. / Tetrahedron 68 (2012) 5152e5156
(
pH¼7.0) at room temperature under sonication for 2 h. The
Supplementary data
Fmoc-Xaa-OH functionalized oligonucleotides were purified by
gel filtration and reverse-phase HPLC and lyophilized. The Fmoc
protecting group was removed by suspending the purified
oligonucleotides in 0.1 M NaOH for 1 h, the amino acids conjugated
oligonucleotides were purified by gel filtration and reverse-phase
HPLC and characterized by MALDI-TOF mass spectrometry
Supplementary data related to this article can be found online at
doi:10.1016/j.tet.2012.04.032.
References and notes
(
using the mixture of 3-hyroxylpyridine-2-carboxylic acid (3-
1. (a) Kemp, D. S. Biopolymers 1981, 20, 1793e1804; (b) Kemp, D. S.; Carey, R. I. J.
Org. Chem. 1993, 58, 2216e2222.
HPA) and ammonium citrate as matrix). Glycine conjugated
2. Dawson, P. E.; Muir, T. W.; Clark-Lewis, I.; Kent, S. B. H. Science 1994, 266,
oligonucleotide: observed mass 10,806ꢃ11 (expected: 10,801
776e779.
þ
[
MþcitrateþH] ); valine conjugated oligonucleotide: observed
3. For recent examples, see: (a) Hirano, K.; Macmillan, D.; Tezuka, K.; Tsuji, T.;
Kajihara, Y. Angew. Chem., Int. Ed. 2009, 48, 9557e9560; (b) Sohma, Y.; Hua, Q.
X.; Whittaker, J.; Weiss, M. A.; Kent, S. B. H. Angew. Chem. 2010, 122,
þ
mass 10,809ꢃ11 (expected: 10,811 [MþmatrixþNa] ); proline
conjugated oligonucleotide: observed mass 10,765ꢃ11 (expected:
5621e5625; Angew. Chem., Int. Ed. 2010, 49, 5489e5493; (c) Wu, Y. W.; Oes-
þ
1
0,788 [MþmatrixþH] ); alanine conjugated oligonucleotide: ob-
terlin, K.; Tan, K. T.; Waldmann, H.; Alexandrov, K.; Goody, R. S. Nat. Chem. Biol.
2010, 6, 534e540; (d) Scheuermann, J. C.; Alonso, A. G. D.; Oktaba, K.; Ly-Hartig,
N.; McGinty, R. K.; Fraterman, S.; Muir, T. W.; Muller, J. Nature 2010, 465,
þ
served mass 10,653ꢃ11 (expected: 10,645 [MþNa] ).
2
43e547.
. Johnson, E. C. B.; Kent, S. B. H. J. Am. Chem. Soc. 2006, 128, 6640e6646.
5. McCaldon, P.; Argos, P. Proteins: Struct., Funct., Genet. 1988, 4, 99e122.
0
.2.3. TAM-linked internal standard oligonucleotide. 21 bp 3 -Amino
4
4
DNA oligonucleotide (up to 20 nmol) was combined with TAM NHS
ester (1 mg) in 200 mM sodium phosphate (pH¼7.0) at room
temperature for 2 h. The functionalized oligonucleotide was puri-
fied by gel filtration and reverse-phase HPLC.
6
. For selected examples, see (a) Perlstein, M. T.; Atassi, M. Z.; Cheng, S. H. Biochim.
Biophys. Acta, Protein Struct. 1971, 446, 1105e1109; (b) Bernardes, G. J. L.;
Chalker, J. M.; Errey, J. C.; Davis, B. G. J. Am. Chem. Soc. 2008, 130, 5052e5053; (c)
Crich, D.; Banerjee, A. J. Am. Chem. Soc. 2007, 129, 10064e10065.
7. For recent review on chemoselective ligation of peptides, see Hackenberger, C.
P. R.; Schwarzer, D. Angew. Chem., Int. Ed. 2008, 47, 10030e10074.
8
9
. For recent highlight on cysteinyl-free ligation, see: Macmillan, D. Angew. Chem.
4
.3. DNA-templated reactions
2006, 118, 7830e7834; Angew. Chem., Int. Ed. 2006, 45, 7668e7672.
. For selected examples, see (a) Canne, L. E.; Bark, S. J.; Kent, S. B. H. J. Am. Chem.
Soc. 1996, 118, 5891e5896; (b) Low, D. W.; Hill, M. G.; Carrasco, M. R.; Kent, S. B.
H.; Botti, P. Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 6554e6559; (c) Offer, J.; Boddy,
C.; Dawson, P. E. J. Am. Chem. Soc. 2002, 124, 4642e4646; (d) Macmillan, D.;
Anderson, D. W. Org. Lett. 2004, 6, 4659e4662; (e) Lu, Y.-A.; Tam, J. P. Org. Lett.
2005, 7, 5003e5006; (f) Brik, A.; Yang, Y. eY.; Ficht, S.; Wong, C.-H. J. Am. Chem.
Soc. 2006, 128, 5626e5627; (g) Ficht, S.; Payne, R. J.; Brik, A.; Wong, C.-H. An-
gew. Chem., Int. Ed. 2007, 46, 5975e5979; (h) Brik, A.; Wong, C.-H. Chem.dEur. J.
Reactions were performed as described in Figs. 1 and 2. Starting
materials and products were ethanol-precipitated from the re-
action mixture, analyzed by denaturing PAGE, quantified as de-
scribed above.
2
1
007, 13, 5670e5675; (i) Li, X.; Lam, H. Y.; Zhang, Y.; Chan, C. K. Org. Lett. 2010,
2, 1724e1727.
0. Brudno, Y.; Liu, D. R. Chem. Biol. 2009, 16, 265e276.
1. Prins, L. J.; Scrimin, P. Angew. Chem., Int. Ed. 2009, 48, 2288e2306.
12. Jacobsen, M. F.; Ravnsbaek, J. B.; Gothelf, K. V. Org. Biomol. Chem. 2010, 8,
0e52.
4
.4. Oligonucleotide sequences
1
1
Sequences are as follows:
Template DNA in Fig. 1: 5 AGTGGGGATTGTGAGGGCTTGGGAATT
0
5
CAGCTC-NH
2
;
13. Meguellati, K. G.; Koripelly, S. L. Angew. Chem., Int. Ed. 2010, 49, 2738e2742.
14. Gartner, Z. J.; Liu, D. R. J. Am. Chem. Soc. 2001, 123, 6961e6963.
0
Template DNA in Fig. 2: 5 AGTGGGGATTGTGAGGGCTTGGGAATT
1
1
1
5. Li, X.; Liu, D. R. Angew. Chem., Int. Ed. 2004, 43, 4848e4870.
6. Grossmann, T.; Strohbach, A.; Seitz, O. ChemBioChem 2008, 9, 2185e2192.
7. Boll, I.; Kramer, R.; Brunner, J.; Mokhir, A. J. Am. Chem. Soc. 2005, 127,
CAGCTC-NHCO-Xaa1-NH
2
; Matched auxiliary DNA in Figs. 1 and 2:
0
5
protected thiol-CONH-GACCTGAATTCCCAA; Mismatched auxil-
0
iary DNA in Fig. 1: 5 protected thiol-CONH-GTCCTCTATTGCCTA;
TAM-linked internal standard DNA in Figs. 1 and 2:
GACGGCTTGGGAATTCAGGTC-NH-TAM.
7849e7856.
0
18. Summerer, D.; Marx, A. Angew. Chem., Int. Ed. 2002, 41, 89e90.
5
19. Rozenman, M.; McNaughton, B.; Liu, D. Curr. Opin. Chem. Biol. 2007, 11,
2
59e268.
0. Pieck, J. C.; Kuch, D.; Grolle, F.; Linne, U.; Haas, C.; Carell, T. J. Am. Chem. Soc.
006, 128, 1404e1405.
1. Silverman, A.; Kool, E. T. Chem. Rev. 2006, 106, 3775e3789.
2
2
2
Acknowledgements
2
2. (a) Gartner, Z. J.; Tse, B. N.; Grubina, R.; Doyon, J. B.; Snyder, T. M.; Liu, D. R.
Science 2004, 305, 1601e1605; (b) Kanan, M. W.; Rozeman, M. M.; Sakurai, K.;
Snyder, T. M.; Liu, D. R. Nature 2004, 431, 545e549.
This work is supported by National Natural Science Foundation
of China (21002003 and 91013003), Ministry of Science and
Technology Basic Research Program (2011CB809100) and Beijing
Nova program (2010B002). C.Z. would like to thank the Hui-Chun
Chin and Tsung-Dao Lee Chinese Undergraduate Research En-
dowment (CURE) for generous support. This project is partially
supported by National Fund for Fostering Talents of Basic Sciences
23. Synder, T. M.; Liu, D. R. Angew. Chem., Int. Ed. 2005, 44, 7379e7382.
2
2
2
2
4. Mckee, M. L.; Evans, A. C.; Gerrard, S. R.; O’Reilly, R. K.; Turerfield, A. J.; Stulz, E.
Org. Biomol. Chem. 2011, 9, 1661e1666.
5. Bruick, R. K.; Dawson, P. E.; Kent, S. B. H.; Usman, N.; Joyce, G. F. Chem. Biol.
1996, 3, 49e56.
6. Erben, A.; Grossmann, T. N.; Seitz, O. Bioorg. Med. Chem. Lett. 2011, 21,
4993e4997.
7. Payne, R. J.; Ficht, S.; Greenberg, W. A.; Wong, C.-H. Angew. Chem., Int. Ed. 2008,
47, 4411e4415.
(
J0630421).