A novel α2/α4 subtype-selective positive allosteric modulator of nicotinic acetylcholine receptors acting from the C-tail of an α subunit

Article abstract of DOI:10.1074/jbc.M115.676551

Positive allosteric modulators (PAMs) of nicotinic acetylcholine receptors (nAChR) are important therapeutic candidates as well as valuable research tools. We identified a novel type II PAM, (R)-7-bromo-N-(piperidin-3-yl)benzo[b]thiophene-2-carboxamide (Br-PBTC), which both increases activation and reactivates desensitized nAChRs. This compound increases acetylcholine-evoked responses of α2 and α4 nAChRs but is without effect on α3 or α6 nAChRs ( indicates the presence of other nAChR subunits). Br-BPTC acts from the C-terminal extracellular sequences of α4 subunits, which is also a PAM site for steroid hormone estrogens such as 17β-estradiol. Br-PBTC is much more potent than estrogens. Like 17β-estradiol, the non-steroid Br-PBTC only requires one α4 subunit to potentiate nAChR function, and its potentiation is stronger with more α4 subunits. This feature enables Br-BPTC to potentiate activation of (α4β2)(α6β2)β3 but not (α6β2)₂β3 nAChRs. Therefore, this compound is potentially useful in vivo for determining functions of different α6 nAChR subtypes. Besides activation, Br-BPTC affects desensitization of nAChRs induced by sustained exposure to agonists. After minutes of exposure to agonists, Br-PBTC reactivated short term desensitized nAChRs that have at least two α4 subunits but not those with only one. Three α4 subunits were required for Br-BPTC to reactivate long term desensitized nAChRs. These data suggest that higher PAM occupancy promotes channel opening more efficiently and overcomes short and long term desensitization. This C-terminal extracellular domain could be a target for developing subtype or state-selective drugs for nAChRs.

Full text of DOI:10.1074/jbc.M115.676551

crossmark
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 290, NO. 48, pp. 28834–28846, November 27, 2015
© 2015 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.
A Novel ␣2/␣4 Subtype-selective Positive Allosteric
Modulator of Nicotinic Acetylcholine Receptors Acting from
the C-tail of an ␣ Subunit*
Received for publication, July 8, 2015, and in revised form, September 22, 2015 Published, JBC Papers in Press, October 2, 2015, DOI 10.1074/jbc.M115.676551
Jingyi Wang‡, Alexander Kuryatov‡, Zhuang Jin§, Jack Norleans‡, Theodore M. Kamenecka§, Paul J. Kenny¶,
and Jon Lindstrom‡1
From the ‡Department of Neuroscience, Perelman School of Medicine at the University of Pennsylvania, Philadelphia,
Pennsylvania 19104, §Department of Molecular Therapeutics, Scripps Research Institute, Scripps, Florida 33458, and ¶Department
of Pharmacology and Systems Therapeutics, Icahn School of Medicine at Mount Sinai, New York, New York 10029
Background: Nicotinic acetylcholine receptors (nAChRs) are involved in nicotine addiction and some neurological
disorders.
Results: A novel positive allosteric modulator potentiates activation through the C-tail of one ␣4 subunit but requires two ␣4 to
reactivate desensitized nAChRs.
Conclusion: Higher occupancy in allosteric sites promotes nAChR opening and alleviates desensitization.
Significance: These ␣4 modulators may be useful for basic and clinical applications.
Nicotinic acetylcholine receptors (nAChRs)2 are critical for
nicotine addiction and important for several neuropsychiatric
disorders (1–3). They are ligand-gated ion channels formed
from five homologous subunits whose subtypes are defined by
their subunit composition. There are 12 neuronal types of sub-
units: ␣2–10 and ␤2–4. Homomeric nAChRs like ␣7 assemble
from only ␣7 subunits, whereas heteromeric nAChRs usually
require both ␣ and ␤ subunits (4, 5). Both homomeric and het-
eromeric nAChRs form orthosteric agonist binding sites at
interfaces between the subunits in the extracellular domain.
Recently, various ligands have been identified that activate,
inhibit, or potentiate activation of nAChRs from allosteric sites
other than the agonist binding sites (4, 6, 7). These include
positive allosteric modulators (PAMs), negative allosteric mod-
ulators, and allosteric agonists (6, 8, 9). These drugs bind to
various places in nAChRs, including the extracellular domain,
transmembrane domain, and the extracellular C terminus (e.g.
C-tail) (6, 7). There are interests in developing PAMs because
agonists both activate and desensitize nAChRs and because
subtype selectivity is hard to achieve with agonists due to sim-
ilarity between ACh binding in different nAChR subtypes. By
contrast, PAMs enhance nAChR function in an activity-depen-
dent manner, potentially modulating the endogenous pattern
of signaling rather than constantly activating or desensitizing
nAChRs. PAMs also increase the potential for subtype specific-
ity. This is because diversity of PAM binding sites in nAChRs
provides better chances to develop selective therapeutics than
does targeting the relatively similar ACh binding sites.
Positive allosteric modulators (PAMs) of nicotinic acetylcho-
line receptors (nAChR) are important therapeutic candidates as
well as valuable research tools. We identified a novel type II
PAM, (R)-7-bromo-N-(piperidin-3-yl)benzo[b]thiophene-2-
carboxamide (Br-PBTC), which both increases activation and
reactivates desensitized nAChRs. This compound increases ace-
tylcholine-evoked responses of ␣2* and ␣4* nAChRs but is with-
out effect on ␣3* or ␣6* nAChRs (* indicates the presence of
other nAChR subunits). Br-BPTC acts from the C-terminal
extracellular sequences of ␣4 subunits, which is also a PAM site
for steroid hormone estrogens such as 17␤-estradiol. Br-PBTC
is much more potent than estrogens. Like 17␤-estradiol, the
non-steroid Br-PBTC only requires one ␣4 subunit to potenti-
ate nAChR function, and its potentiation is stronger with more
␣4 subunits. This feature enables Br-BPTC to potentiate activa-
tion of (␣4␤2)(␣6␤2)␤3 but not (␣6␤2)2␤3 nAChRs. Therefore,
this compound is potentially useful in vivo for determining
functions of different ␣6* nAChR subtypes. Besides activation,
Br-BPTC affects desensitization of nAChRs induced by sus-
tained exposure to agonists. After minutes of exposure to ago-
nists, Br-PBTC reactivated short term desensitized nAChRs
that have at least two ␣4 subunits but not those with only one.
Three ␣4 subunits were required for Br-BPTC to reactivate long
term desensitized nAChRs. These data suggest that higher PAM
occupancy promotes channel opening more efficiently and
overcomes short and long term desensitization. This C-terminal
extracellular domain could be a target for developing subtype or
state-selective drugs for nAChRs.
Based on pharmacology, there are two types of PAMs (10).
Type I PAMs increase peak responses. Type II PAMs not only
increase peak responses but also the duration of channel open-
ing by delaying desensitization. This makes type II PAMs espe-
* This work was supported by National Institute on Drug Abuse Grant
DA030929. The authors declare that they have no conflicts of interest with
the contents of this article.
1 To whom correspondence should be addressed: Dept. of Neuroscience, 2 The abbreviations used are: nAChR, nicotinic acetylcholine receptor; ACh,
Perelman School of Medicine of the University of Pennsylvania, 130A John
Morgan, Philadelphia, PA 19104-6074. Tel.: 215-573-2859; Fax: 215-573-
2858; E-mail: JSLKK@mail.med.upenn.edu.
acetylcholine; Br-PBTC, (R)-7-bromo-N-(piperidin-3-yl)benzo[b]thiophene-
2-carboxamide; DH␤E, dihydro-␤-erythroidine hydrobromide; PAM, posi-
tive allosteric modulator.
28834 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 290•NUMBER 48•NOVEMBER 27, 2015

Allosteric Potentiation from ␣4 C-tail
cially efficacious. In some cases they can act as allosteric ago- ric acid (ϳpH ϭ 3) and cooled in an ice bath. The solids were
nists (8). Understanding the pharmacology and potentiation filtered and washed with cold water (about 6 ml) to give the title
mechanism of PAMs should facilitate design of more potent compound (392 mg, 90%).
and selective modulators. There is no direct correlation
Synthesis of Br-PBTC—A mixture of 7-bromobenzo[b]thio-
between where a PAM binds and which type of PAM it is (6). phene-2-carboxylic acid (25.6 mg, 0.1 mmol), (R)-tert-butyl
Some PAMs bind in the transmembrane domain near the gate 3-aminopiperidine-1-carboxylate (24.0 mg, 0.12 mmol), N,N-
for the cation channel whose opening they influence (6). These diisopropylethylamine (52 ␮l, 0.3 mmol), and 1-[bis(dimethyl-
transmembrane PAMs can be either type I or type II. Here we amino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid
describe a novel type II PAM, Br-PBTC,3 which acts from hexafluorophosphate (57.0 mg, 0.15 mmol) in dimethylforma-
the C-tail of the ␣4 subunit. Discovering how this site, which is mide (2 ml) was stirred at room temperature for 12 h. The
distant from both agonist binding sites and the channel gate, reaction mixture was diluted with ethyl acetate (15 ml) and
influences activation and desensitization should provide new washed with water (4 ml, 3ϫ). The organic layer was dried
insights on the structure and function of nAChRs.
(MgSO4) and concentrated in vacuo. The crude residue was
Higher occupancy of agonist sites increases activation and dissolved in CH2Cl2 (5 ml), trifluoroacetic acid (TFA) (5 ml)
speed of desensitization of both heteromeric and homomeric was added, and the reaction was stirred at room temperature
nAChRs (11–13). Knowledge of how binding of PAMs affects for 1 h. The reaction was concentrated in vacuo to give a crude
activation and desensitization is limited. Some estrogens act as product, which was purified by reverse-phase preparative
PAMs through the C-tail of ␣4 (14). Their PAM effect increases HPLC (A: methanol and acetonitrile (1:1, v/v); B: water contain-
with the number of ␣4 subunits with free C-tails in a nAChR ing TFA (0.1%, v/v)). The title compound was obtained as the
(15). By contrast, Br-PBTC potentiates ␣4 concatemers and TFA salt (31.6 mg, 70%). 1H NMR (CD3OD, 400 MHz) ␦ 8.10 (s,
free ␣4 subunits. Using this novel PAM and various concatem- 1H), 7.90 (dd, 1H, J ϭ 0.8, 8.0 Hz), 7.63 (dd, 1H, J ϭ 0.8, 7.6 Hz),
ers, we investigated how PAM site occupancy influences acti- 7.36 (t, 1H, J ϭ 8.0 Hz), 4.11 (m, 1H), 3.34 (m, 1H), 3.13 (m, 1H),
vation and desensitization of nAChRs expressed in Xenopus 2.74 (m, 2H), 2.08 (m, 1H), 1.69 (m, 2H). LC/MS (ESI) 339, 341
oocytes and mammalian cell lines. We found that occupying (MϩH). A 10 mM stock of Br-PBTC was prepared in dimethyl
one PAM site is sufficient to potentiate nAChR activation, and sulfoxide. Dilutions of drugs were prepared daily in testing
higher PAM site occupancy promotes nAChR opening and alle- buffer before use. All other chemicals were purchased from
viates short and long term desensitization more efficiently. This Sigma unless otherwise noted.
C-tail potentiation mechanism might be applicable to other
cDNAs and cRNAs—Human ␣2, ␣3, ␣4, ␣6, ␤2, and ␤4
nAChR subtypes and facilitate development of other subtype- were cloned in this laboratory (13, 16–19). Concatemers
selective drugs.
were formed by linking the C terminus of one subunit to
the N terminus of the next. The trimeric concatemer
␤2(QAP)n␣4(QAP)n␤2 (abbreviated as ␤2-␣4-␤2) was synthe-
sized through linking together ␤2(QAP)n␣4 with QAP linker
and ␤2. ␤2(QAP)n␣4 was made similarly as ␤3(QAP)n␣6,
which was described (20). A BspEI site was introduced at the
end of the mature peptide of ␤2 using a CCCAGCTC-
CAAGTCCGGACCTTCCTCATCTC oligonucleotide. The
(QAP)n linker was then inserted between the BspEI site at the
end of ␤2 and the FspI site at the beginning of ␣4. At the end of
the coding domain of ␣4 in the ␤2QAP␣4 dimer we introduced
a AgeI site (GCTGGCTGGCATGATCACCGGTGGGAC-
CGGGAGCCTG oligonucleotide), which is complementary to
the XmaI site of the second (QAP)n linker in the concatemer
␤2(QAP)n␣4(QAP)n␤2. The second (QAP)n linker was pre-
pared from the ␤2(QAP)n␣4 piece. We mutated the FspI site at
the beginning of the ␣4 sequence into a BstBI site. The second
(QAP)n linker with new restriction sites was cut out using XmaI
site and BstBI enzymes. We introduced a BstBI restriction site
at the beginning of the mature peptide of ␤2 using a GGCAT-
GATCTTCGAAACGGATACAGAGGAG oligonucleotide.
These allowed us to link together the ␤2QAP␣4 dimer with the
AgeI site, the QAP linker with XmaI and BstBI ends, and the ␤2
subunits with the BstBI restriction site at the beginning of
mature peptide. The resulting construct was recloned into the
pBS SK(Ϫ) vector using the EcoRI restriction enzyme. The
resulting clone linearized with EcoRV for expression in oocytes.
Syntheses of tetrameric and pentameric concatemers (i.e.
␤2-␣4-␤2-␣4 and ␤3-␣6-␤2-␣4-␤2) was described (21, 22).
Experimental Procedures
Chemicals—Methodology for preparing reactants for syn-
thesizing Br-PBTC is described as follows.
Ethyl 7-Bromobenzo[b]thiophene-2-carboxylate—3-Bromo-
2-fluorobenzaldehyde (406.0 mg, 2.0 mmol), ethyl mercaptoac-
etate (242 ␮l, 2.2 mmol), triethylamine (556 ␮l, 4.0 mmol), and
acetonitrile (10 ml) were added to a 50-ml round-bottom flask
and stirred at 60 °C overnight. The acetonitrile was removed in
vacuo, and the residue was dissolved in ethyl acetate (30 ml) and
water (10 ml). The layers were separated, and the aqueous layer
was extracted with ethyl acetate (2ϫ). The combined organics
were dried (MgSO4) and concentrated to give the title com-
1
pound (538 mg, 95%). H NMR (CDCl3, 400 MHz) ␦ 8.15 (s,
1H), 7.84 (d, 1H, J ϭ 8.0 Hz), 7.61 (d, 1H, J ϭ 7.6 Hz), 7.31 (t, 1H,
J ϭ 7.6 Hz), 4.43 (q, 2H, J ϭ 6.8 Hz), 1.46 (t, 3H, J ϭ 6.8 Hz).
7-Bromobenzo[b]thiophene-2-carboxylic Acid—Ethyl 7-bro-
mobenzo[b]thiophene-2-carboxylate (500.0 mg, 1.7 mmol),
lithium hydroxide (250.0 mg, 10.4 mmol), tetrahydrofuran (6
ml), and water (8 ml) were added to a 50-ml round-bottom flask
and stirred at room temperature until the starting material was
consumed as judged by thin layer chromatography analysis.
The majority of the tetrahydrofuran was removed in vacuo. The
resulting crude mixture was acidified with aqueous hydrochlo-
3 A provisional patent for Br-PBTC and its analogues has been applied for
through the Scripps Research Institute with the authors (T. M. Kamenecka,
P. J. Kenny, J. M. Lindstrom, J. Wang, Z. Jin, and C. Doebelin).
NOVEMBER 27, 2015•VOLUME 290•NUMBER 48
JOURNAL OF BIOLOGICAL CHEMISTRY 28835

Allosteric Potentiation from ␣4 C-tail
Four of the five chimeras of ␣3 and ␣4 subunits were pre- the maximum current peak at the saturating concentration,
pared previously (23). Chimeras were numbered according to
EC50 is the drug concentration required to achieve half of the
maximum response, and nH is the Hill coefficient.
the amino acid sequences of the mature subunit. ␣3(1–440)
/
␣4(561–594) was prepared by ligating three pieces of DNA: a
0.6-kb fragment from the NcoI to BstEII site of the ␣3 subunit,
a 1-kb fragment from the HidIII to BstEII site of the ␣3 subunit,
and a 3.1-kb fragment from the NcoI to HidIII site of the ␣4
subunit in the pSP64 vector. The ligation mixture was trans-
formed into XL10-Gold ultracompetent cells (Stratagene, La
Jolla, CA), and the right clone was chosen from a restriction
enzyme digest.
Ooctye Removal and Injection—Oocytes were removed sur-
gically from Xenopus laevis and defolliculated as described (13,
18).
Oocyte injections were performed within 48 h after sur-
gery. Oocytes were injected with 20–40 ng of concatemer
cRNA and free single subunit at a 1:1 ratio. A total of 2–20 ng
of cRNA was injected for free wild type or chimeric ␣ and ␤
subunits at a 4:1 ratio to force expression of the (␣)3(␤2)2
stoichiometry or at 1:4 ratio to force expression of the
(␣)2(␤)3 stoichiometry. To express homomeric ␣7 nAChRs,
70 ng of cRNA was injected to each oocyte. The function was
assayed 3–7 days after injection.
Electrophysiology—Currents in oocytes were measured using
the OpusXpress 6000A (Molecular Devices, Union City, CA),
an automated two-electrode voltage clamp amplifier that
enables recording up to eight oocytes in parallel (13). Oocytes
were voltage-clamped at a holding potential of Ϫ50 mV. 200 ␮l
of drugs were delivered on top of oocytes for 4 s (s) through the
sidewall of the bath to minimize disturbance to oocytes.
Between drug applications, oocytes received a 30-s prewash
and 223-s post-wash of ND96 solution (96 mM NaCl, 2 mM KCl,
1.8 mM CaCl2, 1 mM MgCl2, 5 mM HEPES, pH 7.6) with 0.5 ␮M
atropine perfused through the bath at a rate of 3 ml/min unless
otherwise noted.
A C-tail mutant (noted as ␣4AAC) was obtained by mutating
the last four amino acids of the ␣4 subunit, alanine-glycine-
methionine-isoleucine, to alanine-alanine-cysteine followed by
a stop codon. Mutations were introduced using the PfuUltra
high-fidelity DNA polymerase (Agilent, Santa Clara, CA) fol-
lowing the manufacturer’s instructions. All mutations were
confirmed by sequencing.
After linearization and purification of cDNAs, cRNA tran-
scripts were prepared in vitro using mMessage mMachine kits
(Ambion, Austin, TX). Concentrations of cDNAs and cRNAs
were calculated by spectrophotometry.
Cell Culture and Transfection—All cells were maintained as
described previously (17). The human embryonic kidney
tsA201 (HEK) cell lines stably expressing human ␣4␤2, ␣4␤4,
␣2␤2, ␣2␤4, ␣3␤2, and ␣3␤4 were described (13). The ␣4␤2
cell line expresses a mixture of (␣4␤2)2␣4 and (␣4␤2)2␤2
nAChRs (24). HEK cells that express only one stoichiometry,
either (␣4␤2)2␣4 or (␣4␤2)2␤2, were obtained by transfecting a
dimeric concatemer ␤2(QAP)n␣4 cell line with ␣4 or ␤2
subunits.4
Peak amplitudes of experimental responses were calculated
relative to ACh responses to normalize the data and compen-
sate for variable expression levels among oocytes. The PAM
effect of Br-PBTC was calculated by comparing increased
responses with Br-PBTC relative to responses to ACh alone.
Mean and S.E. were calculated from normalized responses. Sta-
tistical analyses were performed using Student’s t test. More
than four oocytes were tested for each experiment.
FLEXstation Experiments—For functional tests of nAChRs
expressed in HEK cells, we used a FLEXstation (Molecular
Devices, Sunnyvale, CA) bench-top scanning fluorometer as
described by Kuryatov et al. (25). To increase the expression
level of ␣2␤3, ␣3␤2, and (␣4␤2)2␤2 nAChRs, the plates were
incubated at 29 °C for 20 h before being tested. A membrane
potential fluorescent indicator kit (Molecular Devices) was
used according to the manufacturer’s protocols. In PAM exper-
iments, serial dilutions of Br-PBTC were manually added to the
assay plate 15 min before the addition of agonists during
recording unless otherwise noted. In short term desensitization
experiments, 6 min after agonists were added to cell culture
wells, Br-PBTC or dihydro-␤-erythroidine hydrobromide
(DH␤E) was automatically added into the wells during record-
ing. In long term desensitization experiments, nicotine or
DH␤E was incubated with cells for 6 h before recording. Br-
PBTC with or without DH␤E was added to the cell culture wells
during recording. Each data point was averaged from three to
four responses from separate wells. The potency and maximum
efficacy of drugs were calculated by fitting the Hill equation to
the concentration/response relationship using a nonlinear least
squares curve fitting method (Kaleidagraph; Abelbeck/Synergy,
Pre-application of Br-PBTC gave slightly higher PAM effects
on wild type and chimeric nAChRs than co-application with
agonists. But conclusions were the same for both application
methods. To save time, we thereafter used the co-application
method to evaluate the PAM effects in experiments performed
in oocytes. In short term desensitization experiments, 1 mM
ACh was applied to oocytes for 4 s at the rate of 3 ml/min
followed by another 56 s at 0.75 ml/min. Then the oocytes were
incubated for an additional 5 min in a static bath before a co-
application with 1 mM ACh plus 3 ␮M Br-PBTC for 4 s at 3
ml/min. Control experiments were performed on the same
oocytes before Br-PBTC applications following the same pro-
tocol in which 3 ␮M Br-PBTC was replaced with 0.1% (v/v)
DMSO. Reactivation by Br-PBTC was calculated by normaliz-
ing the response of 3 ␮M Br-PBTC to the response of ACh
applied before Br-PBTC. In antagonist inhibition experiments,
␣-conotoxin MII was applied for 4 s at the rate of 3 ml/min
followed by another 56 s at 0.75 ml/min. To fully block ACh
activation, the oocytes were then incubated for an additional 16
min in a static bath before co-application of ACh (3 ␮M) or ACh
together with Br-PBTC (3 ␮M).
n
Reading, PA): I(x) ϭ Imax [xnH/(xnH ϩ EC50 H)], where I(x) is
the peak current measured at the drug concentration x, Imax is
4 A. Kuryatov, J. Wang, and J. Lindstrom, manuscript in preparation.
28836 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 290•NUMBER 48•NOVEMBER 27, 2015

Allosteric Potentiation from ␣4 C-tail
TABLE 1
Potencies and maximum efficacies of potentiation by Br-PBTC on acti-
vation by EC20–30 ACh
nAChR subtypes were expressed in HEK cell lines. ND refers to data not detected
when the PAM effects were too small to obtain meaningful potency and efficacy
values.
Br-PBTC
nAChR subtypes
EC50
nHill
Imax
␮M
%
␣2␤2
0.660 Ϯ 0.377
0.286 Ϯ 0.039
ND
1.07 Ϯ 0.47
1.10 Ϯ 0.09
ND
560 Ϯ 102
202 Ϯ 7
Ͻ0
␣2␤4
␣3␤2
␣3␤4
ND
ND
Ͻ21
␣4␤2
0.446 Ϯ 0.086
0.237 Ϯ 0.340
0.165 Ϯ 0.033
0.275 Ϯ 0.100
1.16 Ϯ 0.17
0.770 Ϯ 0.552
1.67 Ϯ 0.47
1.17 Ϯ 0.40
651 Ϯ 47
119 Ϯ 45
246 Ϯ 17
101 Ϯ 10
␣4␤4
(␣4␤2)2␣4
(␣4␤2)2␤2
Br-PBTC having greater effects on the (␣␤)2␣ stoichiometry or
from the preference of Br-PBTC for ␤2 over ␤4. Our ␣4␤4
nAChR cell line expresses both (␣4␤4)2␤4 and (␣4␤4)2␣4 sto-
ichiometries (13). To express fixed stoichiometries of ␣4␤2 and
␣4␤4, we transiently overexpressed one subunit over the other
in oocytes. We used 3 ␮M Br-PBTC to study its potentiation
effects on activation of (␣4␤2)2␣4, (␣4␤2)2␤2, (␣4␤4)2␣4, and
(␣4␤4)2␤4 by various concentrations of ACh (Fig. 2). Br-PBTC
has a greater effect on ␤2* than ␤4* nAChRs with the same
stoichiometry. It increased maximum ACh efficacy of the
(␣4␤2)2␣4 by 6.8 Ϯ 2.2-fold, larger than the 1.7 Ϯ 0.1-fold
increase on (␣4␤4)2␣4 nAChRs. Br-BPTC increased activation
of (␣4␤2)2␤2 but showed no effect on (␣4␤4)2␤4. However,
Br-PBTC did potentiate the activation of the (␣2␤4)2␤4 stoi-
chiometry as evidenced by its action on our ␣2␤4 cell line,
which only expresses this stoichiometry (13). Therefore, Br-
PBTC potentiates activation of both (␣␤)2␣ and (␣␤)2␤ stoichi-
ometries but has a weaker effect on ␤4-containing than ␤2-con-
taining nAChRs.
FIGURE 1. Chemical structure and nAChR subtype selectivity of the PAM
Br-PBTC. A, structural comparison of Br-PBTC and 17␤-estradiol. B, concen-
tration/response curves of Br-PBTC for potentiating activation of nAChR sub-
types expressed in HEK cell lines. Various concentrations of Br-PBTC were
pre-appliedfor15minbeforeacuteapplicationofAChatEC20 concentrations
(i.e. ␣4␤2, 0.4 ␮M; ␣4␤4, 1 ␮M; ␣3␤2, 4 ␮M; ␣3␤4, 5 ␮M; ␣2␤2, 0.4 ␮M; ␣2␤4, 0.8
␮M). Potentiation effects were calculated by increased peak responses by
Br-PBTC relative to responses evoked by ACh. Results are the mean Ϯ S.E.
(error bars).
Br-PBTC increased the maximum ACh efficacy of the two
stoichiometries of ␣4␤2 greatly in oocytes (Fig. 2). We investi-
Results
Br-PBTC Selectively Affects ␣2 and ␣4 Subunits—To investi- gated whether Br-PBTC potentiates activation of nAChRs with
gate the subtype selectivity of compound Br-PBTC (Fig. 1A), we defined stoichiometries expressed in HEK cell lines. The
tested its ability to potentiate ACh activation of various sub- defined stoichiometries were obtained by expressing a ␤2-␣4
types of nAChRs stably expressed in HEK cells (Fig. 1B). Br- concatemer with a free ␣4 or ␤2 subunit (Fig. 3A). These cell
PBTC increased the activation by EC20 ACh of ␣2- and ␣4-con- lines also allowed us to study the effect of Br-PBTC on long
taining nAChRs by 119–560% (Table 1). EC50 values for term desensitized nAChRs, which is described in later sections.
Br-PBTC ranged from 0.261 to 0.660 ␮M (Table 1), equal to the Br-PBTC enhanced activation by EC40–50 ACh of both stoichi-
most potent nAChR PAMs (6, 7). At Ͼ3 ␮M, Br-PBTC inhibited ometries. It is 2.5-fold more efficacious at activation of the
its own potentiation effect, perhaps because it behaved as an (␣4␤2)2␣4 stoichiometry by EC40–50 ACh (Fig. 3A). But its
open channel blocker like some other nAChR PAMs and ACh potentiation efficacies evaluated by ACh at EC100 are similar
itself (26). Br-PBTC did not alter activation by ACh of ␣3␤2 or between the two stoichiometries (Fig. 3, B and C). The poten-
␣3␤4 nAChRs (Fig. 1B). We also evaluated the effect of Br- cies of Br-PBTC are similar for the two stoichiometries, at
PBTC (up to 3 ␮M) on activation on homomeric ␣7 nAChRs ϳ200 nM (Table 1). (␣4␤2)2␤2 nAChRs have two high ACh
expressed in Xenopus oocytes. The maximum increased peak sensitivity sites each at ␣4/␤2 interfaces. (␣4␤2)2␣4 nAChRs
response by Br-PBTC was 33.9 Ϯ 33.8%. Because the potentia- have these two high sensitivity sites and a third low ACh sensi-
tion is small with large error and only appeared at 1 ␮M Br- tivity site at the ␣4/␣4 interface (27, 28). The different potenti-
PBTC, we do not think that Br-PBTC potentiates activation of ation effects evaluated by medium and maximal concentrations
␣7 nAChRs. Br-PBTC did not activate these heteromeric or of ACh could result from different effects of Br-PBTC on sen-
homomeric nAChR subtypes by itself (data not shown). There- sitivity of nAChRs. The ACh concentration/response curve of
fore, Br-PBTC is an ␣2 and ␣4 nAChR subtype-selective PAM. (␣4␤2)2␣4 nAChRs in the absence of Br-PBTC contains two
Br-PBTC potentiated activation of ␤2-containing nAChRs components representing the high affinity ␣4/␤2 agonist sites
more than ␤4-containing nAChRs. The relatively higher effi- (EC501 ϭ 0.220 Ϯ 0.056 ␮M) and the low affinity ␣4/␣4 site
cacy of Br-PBTC on ␣2␤2 and ␣4␤2 nAChRs could result from (EC502 ϭ 18.1 Ϯ 5.7 ␮M) in this nAChR subtype. In the pres-
NOVEMBER 27, 2015•VOLUME 290•NUMBER 48
JOURNAL OF BIOLOGICAL CHEMISTRY 28837

Allosteric Potentiation from ␣4 C-tail
cells. Br-PBTC increased the sensitivity of (␣4␤2)2␣4 to ACh by
37-fold but had a minimal effect on the sensitivities of
(␣4␤2)2␣3 and (␣4␤2)2␤2 (Table 2). This suggests that three ␣4
subunits are required for Br-PBTC to increase agonist sensitiv-
ity of nAChRs.
In summary, Br-PBTC is an ␣2/␣4 subtype-selective PAM. It
increases potencies of nAChRs with three ␣4 subunits and effi-
cacies of nAChRs with two or three ␣4 subunits. Its potentia-
tion effect is larger on ␤2-containing than ␤4-containing
nAChRs. The following pharmacology study mainly focused on
␣4␤2* nAChRs, which are the most prevalent nAChRs in brain.
Br-PBTC Potentiates Activation from the Extracellular C-ter-
minal Domain of ␣4 Subunits—Because Br-PBTC has no effect
on ␣3* nAChRs, we expressed various chimeras of ␣3 and ␣4
subunits in Xenopus oocytes to identify the Br-PBTC potentia-
tion site in the ␣4 subunit. Fig. 4 illustrates the chimeras of ␣3
and ␣4 used. Because Br-PBTC potentiates activation of ACh
more strongly at intermediate agonist concentrations, we used
ACh at EC30–40 to test the PAM effects of Br-PBTC on ␣3␤2,
␣4␤2, and their chimeras (Fig. 5A). Br-PBTC could not activate
nAChRs by itself but increased ACh activation of ␣4␤2
nAChRs expressed in oocytes by 385 Ϯ 61% (Fig. 5). Similar to
the HEK cell results, Br-BPTC did not potentiate ␣3␤2 nAChRs
expressed in oocytes. Chimeras ␣4(1–207)/␣3(208–446) and
␣4(1–297)/␣3(298–446), which have the ␣3 cytoplasmic, M4, and
C-tails, abolished potentiation by Br-PBTC. Chimeras retain-
ing ␣4 sequences in these domains, ␣3(1–207)/␣4(208–594) and
␣3(1–297)/␣4(298–594), exhibited Br-PBTC potentiation. In the
chimera ␣3(1–440)/␣4(561–594), Br-PBTC PAM effects resem-
FIGURE 2. Br-PBTC potentiates both ␤2- and ␤4- containing nAChRs but
with a greater effect on ␤2* nAChRs. Free ␣4 subunits were expressed with
␤2 or ␤4 subunit in oocytes at ratios of 5:1 or 1:5. This enables expression of
one desired stoichiometry at a time. A, Br-PBTC (3 ␮M) potentiates activation
of both (␣4␤2)2␣4 and (␣4␤4)2␣4 nAChRs by various concentrations of ACh.
B, Br-PBTC (3 ␮M) potentiates activation of (␣4␤2)2␤2 but not that of
(␣4␤4)2␤4 nAChRs.
ence of Br-PBTC, the ACh concentration/response curve bled wild type ␣4 subunit (Fig. 5). These data suggest that Br-
became monophasic with EC50 ϭ 0.0481 Ϯ 0.0043 ␮M (Fig. 3B PBTC potentiates from the region M4 to the C terminus and is
and Table 2). Therefore, Br-PBTC has a much higher effect on likely to bind in or close to this region. The C-tail of human ␣4
activation of (␣4␤2)2␣4 nAChRs by EC40–50 ACh than by EC100 binds to endogenous steroids such as 17␤-estradiol (14, 29). To
ACh. Conversely, Br-PBTC had little effect on the potency of test whether Br-PBTC binds to the ␣4 subunit C-tail, we
(␣4␤2)2␤2 nAChRs, EC50 (without Br-PBTC) ϭ 0.992 Ϯ 0.193 mutated the last four amino acids of human ␣4 subunit (AGMI)
␮M, and EC50 (with Br-PBTC) ϭ 0.429 Ϯ 0.079 ␮M (Table 2). to alanine-alanine-cysteine, noted as ␣4AAC. This AAC
Therefore, Br-PBTC has a lower efficacy on activation of sequence corresponds to the C-tail of the rat ␣4 subunit and when
(␣4␤2)2␤2 than (␣4␤2)2␣4 nAChRs when evaluated by substituted for the last four amino acids of human ␣4 abolished
EC40–50 ACh.
potentiation by 17␤-estradiol (14). This mutant decreased poten-
Two effects might account for the difference of potency tiation by Br-PBTC to 70 Ϯ 18% (p Ͻ 0.01 compared with wild
changes by Br-PBTC on the two stoichiometries; 1) Br-PBTC type; Fig. 5). Attenuation instead of elimination of the Br-PBTC
requires the three ␣4 subunits to affect agonist affinity, or 2) PAM effect by this C-tail mutant suggests that Br-PBTC binds to
Br-PBTC increases agonist affinity to the low ACh affinity ␣/␣ the C-tail but closer to the M4 domain than does 17␤-estradiol.
site but does not affect the high ACh affinity ␣/␤ sites. To test Both the AAC mutation and an additional tryptophan to leucine
these hypotheses, we expressed ␤2-␣4-␤2-␣4 concatemers mutation before the AGMI sequence are required to abolish
with ␣3 subunits in oocytes to obtain (␣4␤2)2␣3, which has two potentiation by an ethynyl derivative of 17␤-estradiol (14). This
␣4␤2 binding sites like (␣4␤2)2␤2 and an additional low ACh tryptophan may help retain the PAM effect of Br-BPTC via cat-
affinity ␣3␣4 site very similar to the ␣4/␣4 agonist site (13). In ion-␲ interaction between the tryptophan side chain and the sec-
parallel, we also expressed (␣4␤2)2␣4 and (␣4␤2)2␤2 in ondary amine of Br-PBTC.
oocytes. The Br-PBTC potentiation effects on ACh efficacy
Br-PBTC Potentiates nAChRs through a Single ␣4 Subunit—
were greater in oocytes than in HEK cells (Table 2). This could PAM efficacy of 17␤-estradiol increases with more free ␣4
be because the Br-PBTC potentiated activation by the high con- C-tails in a nAChR (15). Because Br-PBTC also binds to this
centration of ACh reached the detection limit of the membrane C-tail site, we investigated the effect of the number of ␣4 sub-
potential dye that is used to assay HEK cells or because the units on the potentiation profile of Br-PBTC. Br-PBTC does
different lipid environment between HEK cells and oocyte not affect functions of ␣3* nAChRs; thus, we expressed the free
affected conformational change induced by Br-PBTC. How- ␣3 subunit with various concatemers of ␣4 and ␤2 subunits in
ever, Br-PBTC potentiation effects on ACh potencies of Xenopus oocytes to decrease the numbers of Br-PBTC potenti-
(␣4␤2)2␣4 and (␣4␤2)2␤2 were similar on oocytes and HEK ation sites in a nAChR (Fig. 6A). Another benefit of using ␣3 to
28838 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 290•NUMBER 48•NOVEMBER 27, 2015

Allosteric Potentiation from ␣4 C-tail
FIGURE 3. Br-PBTC potentiates activation of both stoichiometries of ␣4␤2 nAChRs. Concatemeric nAChRs of defined stoichiometries were expressed in
HEK cell lines. A, illustration of these nAChRs expressed from ␤2-␣4 concatemers in combination with free ␣4 or ␤2 subunits. ACh indicates ACh binding sites
at subunit interfaces. PAM indicates PAM binding sites near ␣4 C-tails. B, concentration/response curves for Br-PBTC potentiation of EC40–50 ACh. Various
concentrations of Br-PBTC were pre-applied to HEK cells for 15 min before acute application of ACh at EC40–50 (3 ␮M for (␣4␤2)2␣4 and 0.4 ␮M for (␣4␤2)2␤2
nAChRs). C, potentiation by 3 ␮M Br-PBTC of ACh activation of (␣4␤2)2␣4 and (␣4␤2)2␤2 nAChRs. Results are the mean Ϯ S.E. (error bars).
TABLE 2
Effect of 3 ␮M Br-PBTC on potencies and efficacies of ACh to activate nAChRs
ACh concentration/response curves were determined on oocytes or HEK cell lines expressing defined stoichiometries. The maximum efficacy was defined as 100% for ACh
without PAMs. In oocytes, defined stoichiometries were obtained by injecting ␤2-␣4-␤2-␣4 concatemers with a free subunit. Each data point was collected from more than
four oocytes or more than three wells of cells. The (␣4␤2)2␣4 cell line exhibits a two-component concentration/response curve due to a high sensitivity component
reflecting its two ␣4/␤2 ACh binding sites and a low affinity component reflecting activation in combination with the low sensitivity ␣4/␣4 site. The concentration/response
data for (␣4␤2)2␣4 obtained from oocytes were too noisy to fit a biphasic curve, so were approximated with a monophasic curve.
nAChR subtypes
Drug
ACh EC50
nHill
Imax
␮M
%
Assays in HEK cell lines
(␣4␤2)2␣4
ACh alone
High affinity
Low affinity
0.220 Ϯ 0.056
18.1 Ϯ 5.7
1.91 Ϯ 0.62
1.11 Ϯ 0.42
1.51 Ϯ 0.18
0.735 Ϯ 0.080
0.790 Ϯ 0.094
100
ϩBr-PBTC
ACh alone
ϩBr-PBTC
0.0481 Ϯ 0.0043
0.992 Ϯ 0.193
0.429 Ϯ 0.079
134 Ϯ 2
100
(␣4␤2)2␤2
143 Ϯ 5
Assays in oocytes
(␣4␤2)2␣4
ACh alonea
ϩBr-PBTC
ACh alonea
ϩBr-PBTC
ACh alonea
ϩBr-PBTC
108 Ϯ 45
0.762 Ϯ 0.126
0.478 Ϯ 0.080
0.959 Ϯ 0.114
0.988 Ϯ 0.063
0.977 Ϯ 0.141
0.597 Ϯ 0.053
100
2.89 Ϯ 1.38
1.02 Ϯ 0.10
2.02 Ϯ 0.16
101 Ϯ 20
418 Ϯ 31
100
(␣4␤2)2␤2
(␣4␤2)2␣3
712 Ϯ 120
100
37.8 Ϯ 8.6
352 Ϯ 15
a Data reported previously (13).
replace the ␣4 subunit is that then these nAChRs have the same Therefore, a low affinity ACh site is likely to be present at the
numbers of agonist binding sites. They all have at least one high ␣3/␣3 interface.
ACh affinity ␣4/␤2 site. A low affinity ACh site can be formed at
We tested the effect of 3 ␮M Br-PBTC on peak currents
␣4/␣4 and ␣3/␣4 interfaces (13, 27, 28). (␣3␤4)2␣3 nAChRs evoked by ACh, a feature shared by both type I and type II
showed lower ACh sensitivity than (␣3␤4)2␣4 nAChRs (30). PAMs (Fig. 6B). This concentration is enough to evoke a max-
NOVEMBER 27, 2015•VOLUME 290•NUMBER 48
JOURNAL OF BIOLOGICAL CHEMISTRY 28839

Allosteric Potentiation from ␣4 C-tail
FIGURE 4. Schematic illustration of human nAChR ␣3 and ␣4 subunit chimeras. The ␣3 sequences are gray, and the ␣4 sequences are black. ␣4AAC is an ␣4
subunitwithitslastfouraminoacidsreplacedwithalanine-alanine-cysteine. ThesewerechosenbecausethismutationinhibitsthePAMeffectof17␤-estradiol.
This modified C-tail is annotated as a gray squiggly line.
imal PAM effect for nAChRs containing two or three ␣4 sub-
units (Fig. 3A). Br-PBTC potentiated activation of (␣4␤2)2␣4
nAChRs expressed from the ␤2-␣4-␤2-␣4 concatemer and free
␣4 similarly to those expressed from only free subunits (Figs. 5A
and 6). This is different from estrogens, which do not potentiate
concatemers in which the ␣4 subunit C-tail is linked to another
subunit such as ␣4-␤2 (29, 31). Therefore, the concatemer
linker has no effect on potentiation by Br-PBTC. Br-PBTC
increased activation of nAChRs by both medium (100 ␮M) and
maximal (3000 ␮M) concentrations of ACh as long as there was
more than one ␣4 subunit (Fig. 6B). This is consistent with the
property of 17-␤ estradiol, another known C-tail binding PAM
(15). Moreover, the potentiation effect of (␣4␤2)2␣3 nAChRs
with two ␣4 subunits was larger, and the effect on (␣4␤2)2␣4
with three ␣4 subunits was the largest. These data suggest that
higher PAM occupancy increases the efficiency of channel
opening.
Br-PBTC can increase channel activation by a maximal con-
centrationofACh. Thisissimilartowhatwasobservedwith␣4␤2
nAChRs expressed in HEK cells (Fig. 3B). At higher concentra-
tions of agonists, nAChRs desensitize more rapidly. The potentia-
tion by Br-PBTC on 3000 ␮M ACh could be due to increasing
channel conductance or increased open state probability or desta-
bilizing or slowing entry into the desensitized state.
Br-PBTC Can Reactivate Both Short Term and Long Term
Desensitized nAChRs—To investigate whether Br-PBTC affects
channel desensitization, we applied 1000 ␮M ACh for 6 min to
FIGURE 5. Summary of potentiation effects of Br-PBTC on ␣3/␣4
nAChR chimeras expressed in oocytes. Br-PBTC (3 ␮M) was co-applied
with EC30–40 ACh to each oocyte. Each data point was collected from more
oocytes expressing ␣4* nAChRs to desensitize nAChRs before
acute application of Br-PBTC (3 ␮M) with ACh (1000 ␮M) (Fig.
than four oocytes. A, bar graph comparison of the PAM effects of Br-PBTC.
7). Representative response kinetics are shown in Fig. 7B. Most
B, representative response kinetics for wild type ␣3␤2, ␣4␤2, ␣4AAC␤2,
of the nAChRs were desensitized after 6 min of incubation with
and ␣3(1–440)/␣4(561–594)␤2 nAChRs. Results are the mean Ϯ S.E. (error
bars).
ACh. Br-PBTC reactivated both (␣4␤2)2␣4 and (␣4␤2)2␣3, but
28840 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 290•NUMBER 48•NOVEMBER 27, 2015

Allosteric Potentiation from ␣4 C-tail
FIGURE 6. Br-PBTC PAM effect increases with the number of ␣4 subunits in a nAChR. Each data point was collected from more than five oocytes. A,
illustration of nAChRs constructs used that contain different numbers of ␣4 subunits. B, potentiation by Br-PBTC (3 ␮M) increases with the number of ␣4
subunits in a nAChR. Br-PBTC was co-applied with 100 or 3000 ␮M ACh. Results are the mean Ϯ S.E. (error bars).
This method is not as sensitive to the kinetics of channel func-
tion as the two-electrode voltage clamp method performed on
oocytes. Therefore, we did not observe a higher PAM effect on
desensitized (␣4␤2)2␣4 than (␣4␤2)2␤2 (Fig. 8), as we expected
from oocyte experiments (Fig. 7). Another factor contributing
to this discrepancy is that because (␣4␤2)2␤2 desensitizes
slower than (␣4␤2)2␣4, more (␣4␤2)2␤2 nAChRs were still in
the open state (represented by the portion blocked by DH␤E
applied alone in Fig. 8) when Br-PBTC was applied. This was
not the case for the experiments we performed on ␣4* nAChRs
expressed in oocytes (Fig. 7).
Unlike ACh, which is quickly hydrolyzed by esterase, nico-
tine can persist in brains for hours (32). This causes long term
desensitization of nAChRs in smokers. Because Br-PBTC can
reactivate short term desensitized nAChRs with more than two
FIGURE7. Br-PBTCreactivatesshorttermdesensitizednAChRsexpressed
in oocytes. To desensitize nAChRs, ACh (1000 ␮M) was applied to oocytes for
6 min before its co-application with Br-PBTC (3 ␮M). Each data point was
collected from more than five oocytes. A, Br-PBTC requires two or more ␣4
subunits to reactivate short term desensitized nAChRs. The efficacy of reacti-
vation increases with more ␣4 subunits in a nAChR. B, response kinetics from
representative oocytes. Results are the mean Ϯ S.E. (error bars).
␣4 subunits (Figs. 7 and 8), we studied its effect on nAChRs
expressed in HEK cells after 6 h of exposure to 0.5 ␮M nicotine
(Fig. 9). This concentration of nicotine is found in smokers (32).
After 6 h with nicotine, nAChRs were all desensitized because
application of DH␤E to these nAChRs showed no blockage of
activation (black traces in Fig. 9, A and B). Interestingly, Br-
PBTC (4 ␮M) efficiently reactivated nicotine long term desen-
sitized (␣4␤2)2␣4 nAChRs but only weakly reactivated desen-
sitized (␣4␤2)2␤2 nAChRs (Fig. 9, A and B). The desensitized
(␣4␤2)2␤2 could be less sensitive to reactivation by Br-PBTC.
it had little effect on (␣4␤2)(␣3␤2)␣3 nAChRs. This suggests
that this type II effect requires binding to two or more ␣4 sub-
units. This type II property of Br-PBTC was also observed in
mammalian HEK cells that express (␣4␤2)2␣4 or (␣4␤2)2␤2
nAChRs (Fig. 8). Br-PBTC reactivated nAChRs desensitized by
either ACh or nicotine for 6 min. We use a membrane potential Therefore, we determined the dependence on Br-BPTC con-
fluorescent indicator to assay nAChR responses in HEK cells. centration of reactivation of desensitized nAChRs (Fig. 9C).
NOVEMBER 27, 2015•VOLUME 290•NUMBER 48
JOURNAL OF BIOLOGICAL CHEMISTRY 28841

Allosteric Potentiation from ␣4 C-tail
FIGURE 9. Br-PBTC reactivates long term desensitized nAChRs. HEK cell
lines expressing fixed stoichiometries were used (i.e. ␤2-␣4 concatemers plus
free ␣4 or ␤2 subunits). Nicotine (0.5 ␮M) or DH␤E (0.3 ␮M) was preincubated
with cell culture wells for 6 h before recording. Br-PBTC (4 ␮M) and/or DH␤E (1
␮M) were added at 20 s. Response kinetics are displayed for Br-PBTC applied
to nicotine (red) or DH␤E (green) treated nAChRs. Nicotine completely desen-
sitized (␣4␤2)2␣4 nAChRs after 6 h as the addition of DH␤E showed no effect
(black). A, Br-PBTC reactivated long term desensitized (␣4␤2)2␣4. Co-applica-
tion of DH␤E with Br-PBTC blocked reactivation of nicotine desensitized
(␣4␤2)2␣4 nAChRs by Br-PBTC (gray). B, Br-PBTC (4 ␮M) did not reactivate long
term desensitized (␣4␤2)2␤2 efficaciously. C, effects on desensitized nAChRs
by various concentrations of Br-PBTC. Nicotine (0.5 ␮M) was incubated with
nAChRs for 6 h before acute application of Br-PBTC. The evoked responses by
Br-PBTC were normalized to maximum ACh responses of nAChRs. Br-PBTC
greatly reactivated long term desensitized (␣4␤2)2␣4 nAChRs but showed
very little effecton (␣4␤2)2␤2nAChRs. Results arethemean Ϯ S.E. (error bars).
FIGURE 8. Br-PBTC reactivates short term desensitized (␣4␤2)2␣4 and
(␣4␤2)2␤2 nAChRs expressed in HEK cells. Saturating concentrations of
agonists were added to desensitize nAChRs. Because of the low ACh affinity
site at the ␣4/␣4 interface, higher concentrations of agonists were used for
(␣4␤2)2␣4 than (␣4␤2)2␤2. Br-PBTC (3 ␮M) and DH␤E (1 ␮M) were added sep-
arately or together to nAChRs 6 min after addition of agonist. The antagonist
DH␤Epreventsactivation. A, ACh(300␮M)andnicotine(100␮M)desensitized
(␣4␤2)2␣4 nAChRs. B, ACh (100 ␮M) and nicotine (10 ␮M) desensitized
(␣4␤2)2␤2 nAChRs. Results are the mean Ϯ S.E. (error bars).
The maximum reactivation efficacy of Br-PBTC relative to
maximal ACh responses is 92.5 Ϯ 2.7% for (␣4␤2)2␣4 but only
27.6 Ϯ 6.5% for (␣4␤2)2␤2. These data suggest that Br-PBTC
reactivates long term desensitized (␣4␤2)2␣4 nAChRs more
efficiently. Thus both activation and reactivation are more effi-
cient with three ACh binding sites. This potentiation of Br-
PBTC is specific to agonist-desensitized nAChRs. Br-PBTC
could not reactivate antagonist-inactivated nAChRs (green
traces in Fig. 9).
nM) completely blocked activation by ACh and potentiation by
Br-PBTC (Fig. 10B). This is consistent with the idea that acti-
vation is a cooperative event involving conformational change
in the whole nAChR, and antagonist inhibition of any one ACh
site is sufficient to prevent activation (35, 36). Blockage by com-
petitive antagonists also applies to potentiation of Br-PBTC on
other ␣4* nAChRs. The competitive antagonist DH␤E selective
for ␤2 nAChRs blocked activation of HEK cell lines expressing
(␣4␤2)2␤2 and (␣4␤2)2␣4 nAChRs in the presence of Br-PBTC
(Fig. 11). DH␤E also inhibited reactivation of both short term
and long term desensitized nAChRs by Br-PBTC (gray traces in
Figs. 8 and 9).
Competitive Antagonists Block Potentiation by Br-PBTC—
Competitive antagonists block activation by agonists because
they bind to the same sites as agonists but do not activate
nAChRs. We investigated whether competitive antagonists
affect potentiation of the allosteric ligand Br-BPTC. One of the
important native nAChR subtypes that contain only one poten-
tial Br-PBTC site is (␣6␤2)(␣4␤2)␤3 (33). This is the subtype
that regulates nicotine addiction because knock-out of ␣4, ␣6,
Discussion
Developing subtype-selective therapeutics is challenging for
or ␤2 abolished nicotine self-administration in rodents (34). nAChRs. Efforts have been made to develop allosteric modula-
Br-PBTC did not potentiate activation of (␣6␤2)2␤3 expressed tors binding to non-conserved regions to achieve subtype selec-
in oocytes (data not shown), but it increased ACh (3 ␮M) acti- tivity (6, 7). Only the human ␣2 and ␣4 subunits share similar
vation of (␣6␤2)(␣4␤2)␤3 by 99.0 Ϯ 13.6% (representative sequences at the C-tail. Other human subunits differ in length
kinetics shown in Fig. 10A). This is consistent with the finding and the amino acid sequences in this region. This makes the
in Fig. 5 that only one ␣4 subunit is required for Br-PBTC C-tail a promising target for selective PAMs. Here we showed
potentiation. One feature of (␣6␤2)(␣4␤2)␤3 is that the com- that, besides steroids, non-steroid structures could act from the
petitive antagonist ␣-conotoxin MII selectively blocks its acti- ␣4 C-tail as PAMs and exhibit submicromolar affinity. Engi-
vation from the ␣6/␤2 interface. This antagonist site is far away neering the ␣4 C-tail onto ␤2 subunits enabled estrogens to
from the ␣4 C-tail where Br-PBTC acts. ␣-Conotoxin MII (50 potentiate through this mutant ␤2 subunit (15). A suitable
28842 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 290•NUMBER 48•NOVEMBER 27, 2015

Allosteric Potentiation from ␣4 C-tail
lar domain to opening of the transmembrane channel pore (37,
38). Ivermectin, a compound acting directly on these structural
elements, is a PAM on ␣7 (6) and an allosteric agonist on glu-
tamate-gated chloride channels where its binding site has been
localized in receptor crystals near this region (38). A lipid mol-
ecule binds competitively to the same region as ivermectin (39).
Both ivermectin and this lipid induce channel pore opening but
through slightly different conformation changes. These suggest
that the transmembrane domains are quite flexible. The subtle-
ties involved in channel opening are small (39); thus, pulling or
pushing a bit on the extracellular end of M4 might be enough to
mediate action of a PAM.
Although Br-PBTC acts from ␣ subunits, ␤ subunits also play
a role. Br-PBTC has greater effects on nAChRs with ␤2 sub-
units over those with ␤4 subunits (Fig. 2). It is not clear whether
this is because of the greater sensitivity to activation of ␤2*
nAChRs or because ␤ subunits directly contribute to the Br-
PBTC PAM effect.
It is not evident how a PAM binding to an ␣4 C-tail affects
activation or desensitization. Estrogens do not potentiate ␣4
subunits whose C-terminal end is linked into another subunit
FIGURE 10. Effect of Br-PBTC and ␣-conotoxin MII on (␣4␤2)(␣6␤2)␤3
nAChRs expressed in oocytes. A, illustration of expressing (␣4␤2)(␣6␤2)␤3
from a pentameric concatemer. These nAChRs have only one C-tail PAM site
for Br-PBTC. It is part of a concatemer linking ␣4 with ␤2. B, acting through the
single ␣4 subunit, Br-PBTC potentiated activation of (␣4␤2)(␣6␤2)␤3 by ACh. such as the concatemer ␣4-␤2 (29). However, Br-PBTC poten-
Acting through the single ␣6␤2 ACh binding site, antagonism by 50 nM cono-
toxin MII blocked both activation and potentiation. Responses to ACh (3 ␮M)
are shown in black, and responses to ACh with Br-PBTC (3 ␮M) are shown in
gray.
tiated the C-tail-linked ␣4 subunit equally efficiently as the free
subunit (Figs. 5 and 6). This allowed us to express various con-
catemers with a free ␣3 subunit to reduce binding sites for Br-
PBTC (Fig. 6). We cannot rule out the possibility that Br-BPTC
PAM to bind the C-tail of ␤2 and interact with the end of its M4
might produce a ␤2-selective effect. Perhaps in this way PAMs
could be found that would be selective for any subunit. These
ligands might behave similarly to type II PAMs like Br-PBTC,
but they might also be negative allosteric modulators or allos-
teric agonists, depending on their structures. There is not clear
guidance for how to design or select such ligands, but 17␤-
estradiol and Br-PBTC illustrate examples of structurally dif-
ferent compounds with similar PAM properties. Suitable selec-
tion approaches using stoichiometry-specific nAChR cell lines
might allow for the discovery of PAMs, negative allosteric mod-
ulators, and allosteric agonists for many nAChR subunits that
would be useful tools for studying nAChRs and as drugs both in
vitro and in vivo.
can bind to the ␣3 C-tail but cannot potentiate nAChR activa-
tion. Occupancy by agonists affects nAChR activation and
desensitization (11, 12). Using an ␣3 subunit to replace ␣4
maintained the number of agonist sites among nAChRs. There-
fore, Br-PBTC is a better tool than estrogens to study the rela-
tionship between occupancy and potentiation of PAMs acting
at the C-tail. Moreover, given the activity of estrogens at
nuclear receptors, Br-PBTC would be a better ligand to study
effects of nAChRs in vivo. That Br-PBTC potentiated linked ␣4
C-tails in concatemers indicates that a free tip of the C-tail is
not required for potentiation from this site. The linker in the
␣4-␤2 concatemer might have prevented the entrance of estro-
gens into the C-tail site.
A previous study used concatemers to achieve different num-
bers of ␣4 subunits with free C-tails and showed that more ␣4
subunits increased potentiation efficacy by estrogens (15).
Using Br-PBTC, we confirmed and extended this C-tail poten-
tiation mechanism. Upon agonist binding, nAChRs go through
various conformational changes from the resting state (R) to the
open state (O) and or desensitized state (D) (Fig. 12A). There
are different types of desensitized states (6, 40, 41). Some have
lower energy barriers and are favored soon after ligand binding,
i.e. short term desensitization (DS). Some have lower energy
levels and are preferred after long term incubation with ago-
nists (DL). When an antagonist binds, nAChRs go into an inac-
tive state (I) or are forced to remain in a resting state that pre-
vents activation. When a PAM binds to the C-tail of ␣4, it
increases the probability of channel opening (42). The increase
of channel open probability only requires one C-tail site, and its
extent is proportionate to the number of C-tail PAM sites in a
nAChR (Figs. 6B and 12B) (15). PAMs reactivate short term
desensitized nAChRs from the C-tail also in an occupancy-de-
The C-tail PAM site is stereoselective. Neither the enan-
tiomer of Br-PBTC5 nor estrogens (14) potentiate ␣4* nAChRs.
Stereoselectivity suggests that the PAM and the C-tail of the ␣4
subunit interact with protein rather than membrane lipid. PAM
bound to the short ␣4 C-tail must interact stereospecifically
with a nearby region, probably on the same subunit, which is
capable of influencing the channel gate. There are prolines at
the extracellular end of the M4 transmembrane domains. These
prolines may contribute to a stereoselective site that interacts
with the PAM bound to the C-tail to mediate the PAM effects.
Several other important subunit structural elements are close
to this stereoselective site: the end of ␤10 strand to M1, the
cys-loop, M2-M3 loop, ␤1-␤2 loop, and ␤8-␤9 loop. Movement
of these structural elements contributes to passing the confor-
mational changes from binding of the agonist in the extracellu-
5 Z. Jin, J. Wang, J. Lindstrom, P. J. Kenny, and T. M. Kamenecka, unpublished
observations.
NOVEMBER 27, 2015•VOLUME 290•NUMBER 48
JOURNAL OF BIOLOGICAL CHEMISTRY 28843

Allosteric Potentiation from ␣4 C-tail
FIGURE 11. The competitive antagonist Dh␤E blocks Br-PBTC potentiated activation. HEK cell lines expressing fixed (␣4␤2)2␣4 or (␣4␤2)2␤2 stoichiom-
etries were used. Br-PBTC (3 ␮M) was pre-applied to cells for 15 min before application of agonists with or without DH␤E (1 ␮M). Peak responses were
normalized to evoked responses by an agonist alone. Medium concentration of an agonist was used: for (␣4␤2)2␣4, 4 ␮M ACh or 0.4 ␮M nicotine; for (␣4␤2)2␤2,
0.4 ␮M ACh or 0.1 ␮M nicotine. Results are the mean Ϯ S.E. (error bars).
12B). Occupying three C-tail sites is required to efficiently reac-
tivate long term desensitized nAChRs (Figs. 9 and 11B). The DL
state is favored over time because it has the lowest energy level.
Br-PBTC likely needs to bind to three ␣4 subunits to initiate
sufficient conformational change to compensate for the energy
loss from leaving the DL state. The cooperative effect of Br-
PBTC binding to three sites also enables Br-PBTC to increase
agonist sensitivity of (␣4␤2)2␣4 nAChRs. PAMs at the ␣4 C-tail
cannot activate antagonist-bound nAChRs, and antagonists
block their potentiation (Figs. 8–11). This is consistent with the
concerted conformational change model for activation, i.e. any
one ACh site being held in a resting conformation through an
antagonist blocking closing of its C-loop prevents activation
(43).
␣4␤2* nAChRs are the most prevalent subtypes in brain (44).
PAMs promoting activation of these nAChRs could be benefi-
cial in improving cognition, movement, learning, and memory
and reducing pain or aggressive behaviors, thus beneficial for
analgesia, autism, Parkinson, or Alzheimer diseases (2, 3, 7, 45,
46). ␣4␤2* PAMs are also promising in treating nicotine addic-
tion. Sustained levels of nicotine, which usually keep high affin-
ity nAChRs desensitized, are found in chronic smokers (32). An
␣4␤2 type II PAM, desformylflustrabromine (dFBr), reduced
nicotine self-administration in rats (47). dFBr potentiates
nAChR functions through binding to the principal face of ␤2
subunits homologous to the ACh site at the principal face of ␣
subunits (48). This is similar to how morantel potentiates ␣3␤2
nAChRs (49) but different from Br-PBTC. Although differing
FIGURE 12. Proposed potentiation mechanism for C-tail PAMs. A, states of
nAChRs bound with an agonist or antagonist. Upon agonist binding, nAChRs go
through various conformation changes from the resting state (R) to the open
in binding, Br-PBTC may also benefit smokers like desformyl-
flustrabromine because potentiation of (␣6␤2)(␣4␤2)␤3
state (O) and non-conductive short term (DS) or long term (DL) desensitized
nAChRs might achieve sufficient reward from lower concen-
states. When an antagonist binds to nAChRs, nAChRs go into an inactive state (I)
trations of nicotine (34) and because potentiation of (␣4␤2)2␣5
or is held in a resting state that prevents further activation by agonists. nAChRs
may pass through various transitional states, which are not displayed in the fig-
ure. B, hypothetical PAM effects on probability of nAChR states. * indicates that
the position can be occupied either by an ␣ or a ␤ subunit. An agonist site can
nAChRs might increase aversion to high concentrations of nic-
otine (50).
form at the ␣/␣ and ␣/␤ subunit interface but not the ␤/␣ subunit interface.
The unique potentiation profile of Br-PBTC makes it a good
Therefore, a question mark for agonist binding is annotated at those undefined
research tool for differentiating nAChR subtypes. The nAChR
interfaces. Higher PAM occupancy increases the probability of nAChRs being in
subtype expression pattern differs between brain areas (5, 33).
the open state and decreases the probability in the DS or DL states. Therefore,
␣4-selective PAMs showed the greatest potentiation effect on (␣4␤2)2␣4
nAChRs with three ␣4 subunits.
The ␣6-selective antagonist ␣-conotoxin MII helps distinguish
␣6 and non-␣6 nAChRs. Br-PBTC selectively potentiates
␣6␣4* nAChRs. This differentiates them from ␣6(non␣4)
nAChRs. In combination with ␣-conotoxin MII, Br-PBTC can
pendent manner but require occupying two or more C-tail sites
(Figs. 7). This suggests that Br-PBTC increases exit rates from
the DS state to the O state, thus destabilizing the DS state (Fig. further distinguish ␣4␣6* from ␣4(non␣6) nAChRs. Because
28844 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 290•NUMBER 48•NOVEMBER 27, 2015

Allosteric Potentiation from ␣4 C-tail
(␣4␤2)2␣4 nicotinic ACh receptor contributes to desensitization. Br. J.
Pharmacol. 170, 304–316
Br-PBTC selectively reactivates long term desensitized
(␣4␤2)2␣4 nAChRs, it can be used in vivo to distinguish this
subtype from other nAChR subtypes, such as (␣4␤2)2␣5,
(␣4␤2)2␤2, (␣4␤2)2␤3 etc.
12. Rayes, D., De Rosa, M. J., Sine, S. M., and Bouzat, C. (2009) Number and
locations of agonist binding sites required to activate homomeric Cys-
loop receptors. J. Neurosci. 29, 6022–6032
In summary, using the novel type II PAM Br-PBTC, we
learned more about potentiation from the C-tail PAM site. We
found that activation and reactivation increase with higher
PAM occupancy at the C-tail site. It remains to be determined
in vivo how chronic exposure to ACh or agonist drugs in the
presence of Br-PBTC will influence smoldering activation of
nAChRs largely desensitized by agonists. It also remains to be
determined how ligands bound to the ␣4 C-tail interact with
the channel to influence its opening, whether negative allosteric
modulators or allosteric agonists can act from this site, whether
similar sites can be found on other subunits, and whether
ligands for them will prove to be useful drugs.
13. Wang, J., Kuryatov, A., Sriram, A., Jin, Z., Kamenecka, T. M., Kenny, P. J.,
and Lindstrom, J. (2015) An accessory agonist binding site promotes ac-
tivation of ␣4␤2* nicotinic acetylcholine receptors. J. Biol. Chem. 290,
13907–13918
14. Paradiso, K., Zhang, J., and Steinbach, J. H. (2001) The C terminus of the
human nicotinic ␣4␤2 receptor forms a binding site required for potenti-
ation by an estrogenic steroid. J. Neurosci. 21, 6561–6568
15. Jin, X., and Steinbach, J. H. (2011) A portable site: a binding element for
17␤-estradiol can be placed on any subunit of a nicotinic ␣4␤2 receptor.
J. Neurosci. 31, 5045–5054
16. Wang, F., Gerzanich, V., Wells, G. B., Anand, R., Peng, X., Keyser, K., and
Lindstrom, J. (1996) Assembly of human neuronal nicotinic receptor ␣5
subunits with ␣3, ␤2, and ␤4 subunits. J. Biol. Chem. 271, 17656–17665
17. Wang, F., Nelson, M. E., Kuryatov, A., Olale, F., Cooper, J., Keyser, K., and
Lindstrom, J. (1998) Chronic nicotine treatment up-regulates human
␣3␤2 but not ␣3␤4 acetylcholine receptors stably transfected in human
embryonic kidney cells. J. Biol. Chem. 273, 28721–28732
Author Contributions—J. W. and J. L. designed the study and wrote
the paper. J. W. and A. K. designed and constructed plasmids and cell
lines. J. W. and J. N. performed the FlexStation and electrophysiol-
ogy assays. Z. J. and T. M. K. provided the chemical tools. P. J. K.
contributed to discussions of the in vivo use of the PAM. P. J. K., J. L.,
and T. M. K. acquired funding to support this study. All authors ana-
lyzed data, revised, and approved the final version of the manuscript.
18. Gerzanich, V., Kuryatov, A., Anand, R., and Lindstrom, J. (1997) “Orphan”
␣6 nicotinic AChR subunit can form a functional heteromeric acetylcho-
line receptor. Mol. Pharmacol. 51, 320–327
19. Kuryatov, A., Gerzanich, V., Nelson, M., Olale, F., and Lindstrom, J. (1997)
Mutation causing autosomal dominant nocturnal frontal lobe epilepsy
alters Ca2ϩ permeability, conductance, and gating of human ␣4␤2 nico-
tinic acetylcholine receptors. J. Neurosci. 17, 9035–9047
Acknowledgments—We thank Dr. Julian R. A. Wooltorton for advice
on Fig. 12. We thank Aarati Sriram for technical assistance.
20. Ley, C. K., Kuryatov, A., Wang, J., and Lindstrom, J. M. (2014) Efficient
expression of functional (␣6␤2)2␤3 AChRs in Xenopus oocytes from free
subunits using slightly modified ␣6 subunits. PLoS ONE 9, e103244
21. Kuryatov, A., Olale, F. A., Choi, C., and Lindstrom, J. (2000) Acetylcholine
receptor extracellular domain determines sensitivity to nicotine-induced
inactivation. Eur. J. Pharmacol. 393, 11–21
References
1. De Biasi, M., and Dani, J. A. (2011) Reward, addiction, withdrawal to
nicotine. Annu. Rev. Neurosci. 34, 105–130
22. Kuryatov, A., Berrettini, W., and Lindstrom, J. (2011) Acetylcholine recep-
tor (AChR) ␣5 subunit variant associated with risk for nicotine depen-
dence and lung cancer reduces (␣4␤2)2␣5 AChR function. Mol. Pharma-
col. 79, 119–125
2. Lewis, A. S., and Picciotto, M. R. (2013) High-affinity nicotinic acetylcho-
line receptor expression and trafficking abnormalities in psychiatric ill-
ness. Psychopharmacology 229, 477–485
23. Kuryatov, A., and Lindstrom, J. (2011) Expression of functional human
␣6␤2␤3* AChRs in Xenopus oocytes achieved through subunit chimeras
and concatemers. Mol. Pharmacol. 79, 126–140
3. Picciotto, M. R., Lewis, A. S., van Schalkwyk, G. I., and Mineur, Y. S. (2015)
Mood and anxiety regulation by nicotinic acetylcholine receptors: a po-
tential pathway to modulate aggression and related behavioral states. Neu-
ropharmacology 96, 235–243
24. Nelson, M. E., Kuryatov, A., Choi, C. H., Zhou, Y., and Lindstrom, J. (2003)
Alternate stoichiometries of ␣4␤2 nicotinic acetylcholine receptors. Mol.
Pharmacol. 63, 332–341
4. Hurst R., Rollema H., and Bertrand D. (2013) Nicotinic acetylcholine re-
ceptors: from basic science to therapeutics. Pharmacol. Ther. 137, 22–54
5. Zoli, M., Pistillo, F., and Gotti, C. (2015) Diversity of native nicotinic re-
ceptor subtypes in mammalian brain. Neuropharmacology 96, 302–311
6. Williams, D. K., Wang, J., and Papke, R. L. (2011) Positive allosteric mod-
ulators as an approach to nicotinic acetylcholine receptor-targeted ther-
apeutics: advantages and limitations. Biochem. Pharmacol. 82, 915–930
7. Grupe, M., Grunnet, M., Bastlund, J. F., and Jensen, A. A. (2015) Targeting
␣4␤2 nicotinic acetylcholine receptors in central nervous system disor-
ders: perspectives on positive allosteric modulation as a therapeutic ap-
proach. Basic Clin. Pharmacol. Toxicol. 116, 187–200
25. Kuryatov, A., Luo, J., Cooper, J., and Lindstrom, J. (2005) Nicotine acts as
a pharmacological chaperone to up-regulate human ␣4␤2 acetylcholine
receptors. Mol. Pharmacol. 68, 1839–1851
26. Weltzin, M. M., and Schulte, M. K. (2010) Pharmacological characteriza-
tion of the allosteric modulator desformylflustrabromine and its interac-
tion with ␣4␤2 neuronal nicotinic acetylcholine receptor orthosteric li-
gands. J. Pharmacol. Exp. Ther. 334, 917–926
27. Mazzaferro, S., Benallegue, N., Carbone, A., Gasparri, F., Vijayan, R., Big-
gin, P. C., Moroni, M., and Bermudez, I. (2011) Additional acetylcholine
(ACh) binding site at ␣4/␣4 interface of (␣4␤2)2␣4 nicotinic receptor
influences agonist sensitivity. J. Biol. Chem. 286, 31043–31054
8. Gill, J. K., Savolainen, M., Young, G. T., Zwart, R., Sher, E., and Millar, N. S.
(2011) Agonist activation of ␣7 nicotinic acetylcholine receptors via an
allosteric transmembrane site. Proc. Natl. Acad. Sci. U.S.A. 108, 28. Harpsøe, K., Ahring, P. K., Christensen, J. K., Jensen, M. L., Peters, D., and
5867–5872
Balle, T. (2011) Unraveling the high- and low-sensitivity agonist responses
9. Grønlien, J. H., Håkerud, M., Ween, H., Thorin-Hagene, K., Briggs, C. A.,
of nicotinic acetylcholine receptors. J. Neurosci. 31, 10759–10766
Gopalakrishnan, M., and Malysz, J. (2007) Distinct profiles of ␣7 nAChR 29. Zhou, Y., Nelson, M. E., Kuryatov, A., Choi, C., Cooper, J., and Lindstrom,
positive allosteric modulation revealed by structurally diverse chemo-
types. Mol. Pharmacol. 72, 715–724
J. (2003) Human ␣4␤2 acetylcholine receptors formed from linked sub-
units. J. Neurosci. 23, 9004–9015
10. Gill-Thind, J. K., Dhankher, P., D’Oyley, J. M., Sheppard, T. D., and Millar, 30. Krashia, P., Moroni, M., Broadbent, S., Hofmann, G., Kracun, S., Beato, M.,
N. S. (2015) Structurally similar allosteric modulators of ␣7 nicotinic ac-
etylcholine receptors exhibit five distinct pharmacological effects. J. Biol.
Chem. 290, 3552–3562
Groot-Kormelink, P. J., and Sivilotti, L. G., (2010) Human ␣3␤4 neuronal
nicotinic receptors show different stoichiometry if they are expressed in
Xenopus oocytes or mammalian HEK293 cells. PLoS ONE 5, e13611
11. Benallegue, N., Mazzaferro, S., Alcaino, C., and Bermudez, I. (2013) The 31. Jin, X., Bermudez, I., Steinbach, J. H. (2014) The nicotinic ␣5 subunit can
additional ACh binding site at the ␣4(ϩ)/␣4(Ϫ) interface of the
replace either an acetylcholine-binding or nonbinding subunit in the
NOVEMBER 27, 2015•VOLUME 290•NUMBER 48
JOURNAL OF BIOLOGICAL CHEMISTRY 28845

Allosteric Potentiation from ␣4 C-tail
␣4␤2* neuronal nicotinic receptor. Mol. Pharmacol. 85, 11–17
32. Picciotto, M. R., Addy, N. A., Mineur, Y. S., and Brunzell, D. H. (2008) It’s
not “either/or”: activation and desensitization of nicotinic acetylcholine
receptors both contribute to behaviors related to nicotine addiction and
mood. Prog. Neurobiol. 84, 329–342
42. Curtis, L., Buisson, B., Bertrand, S., and Bertrand, D. (2002) Potentiation of
human ␣4␤2 neuronal nicotinic acetylcholine receptor by estradiol. Mol.
Pharmacol. 61, 127–135
43. Changeux, J. P. (2013) 50 years of allosteric interactions: the twists and
turns of the models. Nat. Rev. Mol. Cell Biol. 14, 819–829
44. Gaimarri, A., Moretti, M., Riganti, L., Zanardi, A., Clementi, F., and Gotti,
C. (2007) Regulation of neuronal nicotinic receptor traffic and expression.
Brain Res. Rev. 55, 134–143
33. Wang, J., Kuryatov, A., and Lindstrom, J. (2015) Expression of cloned ␣6*
nicotinic acetylcholine receptors. Neuropharmacology 96, 194–204
34. Pons, S., Fattore, L., Cossu, G., Tolu, S., Porcu, E., McIntosh, J. M., Chan-
geux, J. P., Maskos, U., and Fratta, W. (2008) Crucial role of ␣4 and ␣6
nicotinic acetylcholine receptor subunits from ventral tegmental area in
systematic nicotinic self- administration. J. Neurosci. 28, 12318–12327
35. Unwin, N., and Fujiyoshi, Y. (2012) Gating movement of acetylcholine
receptor caught by plunge-freezing. J. Mol. Biol. 422, 617–634
36. Fletcher, G. H., and Steinbach, J. H. (1996) Ability of nondepolarizing
neuromuscular blocking drugs to act as partial agonists at fetal and adult
mouse muscle nicotinic receptors. Mol. Pharmacol. 49, 938–947
37. Lee, W. Y., and Sine, S. M. (2005) Principal pathway coupling agonist
binding to channel gating in nicotinic receptors. Nature 438, 243–247
38. Hibbs, R. E., and Gouaux, E. (2011) Principles of activation and perme-
ation in an anion-selective Cys-loop receptor. Nature 474, 54–60
39. Althoff, T., Hibbs, R. E., Banerjee, S., and Gouaux, E. (2014) x-ray struc-
tures of GluCl in apo states reveal a gating mechanism of Cys-loop recep-
tors. Nature 512, 333–337
45. Srinivasan, R., Henderson, B. J., Lester, H. A., and Richards, C. I. (2014)
Pharmacological chaperoning of nAChRs: a therapeutic target for Parkin-
son’s disease. Pharmacol. Res. 83, 20–29
46. Dineley, K. T., Pandya, A. A., and Yakel, J. L. (2015) Nicotinic ACh recep-
tors as therapeutic targets in CNS disorders. Trends Pharmacol. Sci. 36,
96–108
47. Liu, X. (2013) Positive allosteric modulation of ␣4␤2 nicotinic acetylcho-
line receptors as a new approach to smoking reduction: evidence from a
rat model of nicotine self-administration. Psychopharmacology 230,
203–213
48. Weltzin, M. M., and Schulte, M. K. (2015) Desformylflustrabromine mod-
ulates ␣4␤2 nAChR high- and low- sensitivity isoforms at allosteric clefts
containing the ␤2 subunit. J. Pharmacol. Exp. Ther. 354, 184–194
49. Seo, S., Henry, J. T., Lewis, A. H., Wang, N., and Levandoski, M. M. (2009)
The positive allosteric modulator morantel binds at noncanonical subunit
interfaces of neuronal nicotinic acetylcholine receptors. J. Neurosci. 29,
8734–8742
40. Boyd, N. D. (1987) Two distinct kinetic phases of desensitization of ace-
tylcholine receptors of clonal rat PC12 cells. J. Physiol. 389, 45–67
41. Yu, K. D., Liu, Q., Wu, J., and Lukas, R. J. (2009) Kinetics of desensitization
and recovery from desensitization for human ␣4␤2-nicotinic acetylcho-
line receptors stably expressed in SH-EP1 cells. Acta Pharmacol. Sin. 30,
805–817
50. Fowler C. D., Lu, Q., Johnson, P. M., Marks, M. J., and Kenny, P. J. (2011)
Habenular ␣5 nicotinic receptor subunit signalling controls nicotine in-
take. Nature 471, 597–601
28846 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 290•NUMBER 48•NOVEMBER 27, 2015

Neurobiology:
A Novel α2/α4 Subtype-selective Positive
Allosteric Modulator of Nicotinic
Acetylcholine Receptors Acting from the
C-tail of an α Subunit
Jingyi Wang, Alexander Kuryatov, Zhuang
Jin, Jack Norleans, Theodore M. Kamenecka,
Paul J. Kenny and Jon Lindstrom
J. Biol. Chem. 2015, 290:28834-28846.
doi: 10.1074/jbc.M115.676551 originally published online October 2, 2015
Access the most updated version of this article at doi: 10.1074/jbc.M115.676551
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
This article cites 50 references, 25 of which can be accessed free at
http://www.jbc.org/content/290/48/28834.full.html#ref-list-1