Synthesis of caffeic acid sulfonamide derivatives and their protective effect against H2O2 induced oxidative damage in A549 cells

Article abstract of DOI:10.1039/d0ra00227e

Exogenous antioxidants are considered as important therapeutic tools for oxidative stress associated disorders as they can regulate the redox state, which is associated with cell and organ function. Inspired by natural polyphenols, six new caffeic acid sulfonamide derivatives were synthesized by coupling sulfonamides to the backbone of caffeic acid with good yields. Their structure and lipophilicity were characterized by 1H nuclear magnetic resonance (NMR), ¹³C{¹H} NMR, infrared spectroscopy (IR) and oil-water partition coefficient assay. Their free radical scavenging activity and antioxidant activity were assessed by DPPH assay and hydrogen peroxide (H₂O₂) induced oxidative stress in human lung carcinoma A549 cells. The oil-water partition coefficient results indicate that the conjugation of sulfonamides increases the lipophilicity of caffeic acid. The CASMD, CASDZ and CASN results show higher free radical scavenging effects compared with vitamin C. The derivatives do not show any inhibitory effect on the proliferation of A549 cells up to a concentration of 200 μM, except CASDZ which significantly inhibits the growth of A549 cells at a concentration of 200 μM. In addition, the obtained derivatives markedly attenuate H₂O₂ induced decrease of cell viability, inhibit the production of ROS and MDA, and promote the activities of superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px). Besides, treatment of H₂O₂ stimulated A549 cells with caffeic acid sulfonamide derivatives further increases mRNA expression of NF-E2-related factor 2 (Nrf2) and its target genes, including heme oxygenase-1 (HO-1), NAD(P)H quinone dehydrogenase 1 (NQO1) and thioredoxin reductase 1 (TXNRD1). These results suggest that these new caffeic acid sulfonamide derivatives have higher lipophilicity and better antioxidant activities than the parent caffeic acid, and they might be able to control the antioxidant response in cells via the Nrf2 pathway.

Full text of DOI:10.1039/d0ra00227e

RSC Advances
View Article Online
View Journal | View Issue
PAPER
Synthesis of caffeic acid sulfonamide derivatives
and their protective effect against H2O2 induced
oxidative damage in A549 cells†
ad
Cite this: RSC Adv., 2020, 10, 9924
Xiaoyu Peng,
Tingjun Hu,a Yuxue Zhang,a Anran Zhao,b Bharathi Natarajan,c
a
a
a
a
*
*
Jiata Wei, Hao Yan, Hailan Chen and Cuiwu Lin
Exogenous antioxidants are considered as important therapeutic tools for oxidative stress associated
disorders as they can regulate the redox state, which is associated with cell and organ function. Inspired
by natural polyphenols, six new caffeic acid sulfonamide derivatives were synthesized by coupling
sulfonamides to the backbone of caffeic acid with good yields. Their structure and lipophilicity were
characterized by 1H nuclear magnetic resonance (NMR), 13C{1H} NMR, infrared spectroscopy (IR) and
oil–water partition coefficient assay. Their free radical scavenging activity and antioxidant activity were
assessed by DPPH assay and hydrogen peroxide (H2O2) induced oxidative stress in human lung
carcinoma A549 cells. The oil–water partition coefficient results indicate that the conjugation of
sulfonamides increases the lipophilicity of caffeic acid. The CASMD, CASDZ and CASN results show
higher free radical scavenging effects compared with vitamin C. The derivatives do not show any
inhibitory effect on the proliferation of A549 cells up to a concentration of 200 mM, except CASDZ which
significantly inhibits the growth of A549 cells at a concentration of 200 mM. In addition, the obtained
derivatives markedly attenuate H2O2 induced decrease of cell viability, inhibit the production of ROS and
MDA, and promote the activities of superoxide dismutase (SOD), catalase (CAT) and glutathione
peroxidase (GSH-Px). Besides, treatment of H2O2 stimulated A549 cells with caffeic acid sulfonamide
derivatives further increases mRNA expression of NF-E2-related factor 2 (Nrf2) and its target genes,
including heme oxygenase-1 (HO-1), NAD(P)H quinone dehydrogenase 1 (NQO1) and thioredoxin
reductase 1 (TXNRD1). These results suggest that these new caffeic acid sulfonamide derivatives have
higher lipophilicity and better antioxidant activities than the parent caffeic acid, and they might be able
to control the antioxidant response in cells via the Nrf2 pathway.
Received 9th January 2020
Accepted 27th February 2020
DOI: 10.1039/d0ra00227e
rsc.li/rsc-advances
elimination of reactive oxidants in the body.1 Excessive oxidants
can oxidize cell membranes, enzymes, proteins, DNA and other
1. Introduction
substances; induce cell apoptosis or necrosis and cause damage
to cells, tissues and organs.2,3 Perturbation of reactive oxidants
equilibrium is considered an important factor that promotes
the pathological development of diseases, such as cancer,
arteriosclerosis, diabetes, hypertension, and Alzheimer's
disease.4,5 In addition, the free radical senility theory proposes
that aging is also caused by the accumulation of free radicals in
cells and excessive oxidative damage in tissues.6,7 Numerous
studies have shown that dietary supplements of antioxidants
enhance the body's defence and help maintain oxidative
dynamic equilibrium.8–10 Therefore, the development of free
radical scavenging functional foods and drugs has been
increasingly emphasized.
Reactive oxidants produced in normal cells in a controlled
manner have many important physiological functions, such as
ghting against infected pathogens, regulation of cell division
or autophagy, controlling stress response and inammation
reaction. Nevertheless, bacterial or viral infections, heavy metal
exposure, the use of cancer drugs or antibiotics, and excessive
exercise can induce uncontrolled production of oxidants and
disrupt the dynamic equilibrium between the production and
aGuangxi University, Nanning 530004, Guangxi, China. E-mail: hlchen319@163.com;
lincuiwu@gxu.edu.cn
bThe First Affiliated Hospital of Guangxi Medical University, Nanning 530021,
Guangxi, China
Caffeic acid and its derivatives, such as caffeic acid amides,
caffeic acid esters, caffeic acid sugars and caffeic acid glycoside
derivatives, are frequently found in various fruits and vegeta-
bles.11,12 Previous studies have suggested that caffeic acid and
its derivatives are promising natural antioxidants and their
cCollege of Medicine, Jiaxing University, Jiaxing 314001, Zhejiang, China
dChina Academy of Science and Technology Development Guangxi Branch, Nanning
530022, Guangxi, China
† Electronic supplementary information (ESI) available. See DOI:
10.1039/d0ra00227e
9924 | RSC Adv., 2020, 10, 9924–9933
This journal is © The Royal Society of Chemistry 2020

View Article Online
Paper
RSC Advances
antioxidant activity is mainly based on free radical scavenging, S12†), 1H nuclear magnetic resonance (NMR) (Fig. S13–S18†)
metal ion chelation, and inhibiting the oxidation of lipid per- and 13C{1H} NMR (Fig. S19–S24†) spectrometry, the structures
oxidation, catalase and low-density lipoprotein.13–15 Studies on of these six derivatives were conrmed and named as ACASMD,
the structure–activity relationships of a series of synthetic caf- CASMD, ACASDZ, CASDZ, ACASN and CASN according to their
feic acid amides and caffeic acid esters found that the antioxi- molecule composition. Their characteristic information are
dant activity of caffeic acid derivatives increased with the listed below.
number of hydroxyl groups or catechol moieties.13 The presence
of other hydrogen donor groups such as –NH or –SH can further phenylamino)-3-oxoprop-1-enyl)-1,2-phenylene diacetate, white
ACASMD. (Z)-4-(3-(4-(N-(5-Methoxypyrimidin-2yl)sulfamoyl)
ꢀ
1
enhance their antioxidant activity.13 Isolation of caffeic acid and powder, ESI-MS: 525 [M ꢀ H] ; mp: 266–267 C; H-NMR (300
its derivatives from the plant kingdom to full the social MHz, dimethyl sulfoxide (DMSO)-d6): d 11.43 (s, 1H, SO2–NH),
requirement of food and medical antioxidant is inefficient and 10.62 (s, 1H, –CO–NH), 8.30 (s, 2H, N–CH), 7.84 (d, J ¼ 12.4 Hz,
costly, thus great efforts have been focused on chemical 4H, 4ꢂ Ar–H), 7.65 (d, J ¼ 15.47 Hz, 1H, CO–CH), 7.57 (d, J ¼
ꢁ
synthesis of antioxidants with negligible toxicity.
8.42 Hz, 2H, Ar–H), 7.35 (d, J ¼ 8.41 Hz, 1H, Ar–H), 6.80 (d, J ¼
Hydrogen peroxide (H2O2) is an important active oxygen 15.7 Hz, 1H, Ar–CH), 3.79 (s, 3H, OCH3), 2.31 (d, J ¼ 2.5 Hz, 6H,
molecule with relatively stable properties and is oen used as –CO–CH3). 13C{1H} NMR (75 MHz, DMSO) d 168.69, 164.24,
a model chemical to induce oxidative stress injury in vitro. In 151.45, 150.09, 145.09, 143.57, 142.81, 139.90, 134.93, 133.82,
order to explore new antioxidants and systematically evaluate 129.26, 126.69, 124.74, 123.26, 119.11, 56.71, 20.81. IR
their antioxidant activity, sulfonamides were coupled to the (KBr, cmꢀ1): 3058.72 (w, nN–H), 1771.47 (s, nC]O), 1683.65 (s,
backbone of caffeic acid for the synthesis of new caffeic acid nRCH]CHR), 1635.01 (s, nAr), 1589.28 (s, nAr), 1506.06 (s, nAr).
derivatives. The regulatory effect of obtained caffeic acid
CASMD. (Z)-3-(3,4-Dihydroxyphenyl)-N-(4-(N-(5-methoxypy-
derivatives on the H2O2 induced oxidative stress were evaluated rimidin-2-yl)sulfamoyl)phenyl)acrylamide, light yellow powder,
by cell survival rate, reactive oxygen species (ROS) and malon- ESI-MS: 441 [M ꢀ H]ꢀ; mp: 274–276 ꢁC; 1H-NMR (300 MHz,
dialdehyde (MDA) production, antioxidant enzyme activities DMSO-d6): d 11.40 (s, 1H, SO2–NH), 10.46 (s, 1H, –CO–NH), 9.55
and the messenger RNA (mRNA) levels of NF-E2-related factor 2 (s, 1H, Ar–OH), 9.25 (s, 1H, Ar–OH), 8.30 (s, 2H, N–CH), 7.96–
(Nrf2) pathway associated genes.
7.84 (d, J ¼ 8.9 Hz, 4H, 4ꢂ Ar–H), 7.49 (d, J ¼ 15.5 Hz, 1H, CO–
CH), 7.04 (d, J ¼ 1.7 Hz, 2H, Ar–H), 6.78 (d, J ¼ 8.1 Hz, 1H, Ar–H),
6.53 (d, J ¼ 15.5 Hz, 1H, Ar–CH), 3.47 (s, 3H, –CO–CH3). 13C{1H}
NMR (75 MHz, DMSO) d 165.03, 151.45, 150.08, 145.10, 143.77,
142.35, 134.49, 129.24, 126.44, 121.65, 118.92, 114.51, 56.70,
49.07. IR (KBr, cmꢀ1): 3592.84 (s, nO–H), 3454.57 (s, nN–H),
1687.38 (s, nC]O), 1607.9 (m, nRCH¼CHR), 1588.33 (s, nAr), 1538.48
(s, nAr), 1514.31 (w, nAr).
2. Results
2.1 Synthesis and characterization
Six new caffeic acid sulfonamide derivatives were obtained by
coupling sulfanilamide (SN), sulfamethoxydiazine (SMD) and
sulfadiazine (SDZ) to the backbone of caffeic acid with three
step reactions according to the synthetic scheme in Fig. 1. Aer
the fully characterized by melting points (mp) test, electrospray
ionization mass spectrometry (EIS-MS) (Fig. S1–S6†), Fourier
transfer-infrared spectrometry (FT-IR) spectrometry (Fig. S7–
ACASDZ. (Z)-4-(3-Oxo-3-(4-(N-pyrimidin-2ylsulfamoyl)pheny-
lamino) prop-1-enyl)-1,2-pheꢀnylene diacetate, light yellow
1
ꢁ
powder, ESI-MS: 495 [M ꢀ H] ; mp: 230–232 C; H-NMR (300
MHz, DMSO-d6): d 11.75 (s, 1H, SO2–NH), 10.63 (s, 1H, –CO–
Fig. 1 Synthesis route of caffeic acid sulfonamide derivatives.
This journal is © The Royal Society of Chemistry 2020
RSC Adv., 2020, 10, 9924–9933 | 9925

View Article Online
RSC Advances
Paper
NH), 8.50 (d, J ¼ 4.9 Hz, 2H, N–CH), 8.01–7.87 (d, J ¼ 8.9 Hz, 4H,
4ꢂ Ar–H), 7.66 (d, J ¼ 15.67 Hz, 1H, CO–CH), 7.60–7.57 (d, J ¼
8.9 Hz, 2H, Ar–H), 7.37 (d, J ¼ 4.9 Hz, 1H, Ar–H), 7.03 (t, J ¼
4.9 Hz, 1H, CH–CH), 6.86 (d, J ¼ 15.7 Hz, 1H, Ar–CH), 2.45 (d, J
¼ 2.9 Hz, 6H, –CO–CH3). 13C{1H} NMR (75 MHz, DMSO)
d 168.68, 164.27, 158.80, 157.40, 143.57, 142.82, 139.93, 134.71,
133.82, 129.44, 126.68, 124.72, 123.24, 123.14, 119.10, 116.23,
20.77. IR data (KBr pellets, cmꢀ1): 3043 (m, nN–H), 1771 (s, nC]O),
1683 (s, nC]O), 1635 (m, nRCH]CHR), 1590 (s, nAr), 1527 (m, nAr),
1505 (m, nAr).
Fig. 2 UV spectrum of caffeic acid sulfonamide derivatives (A) and
standard curves prepared by measuring the absorbance at peak
wavelength of series concentration of these derivatives in n-octanol
saturated PBS (B).
CASDZ.
(Z)-3-(3,4-Dihydroxyphenyl)-N-(4-(N-pyrimidin-2-
ylsulfamoyl) ꢀphenyl)acrylamide, light yellow powder, ESI-MS:
1
ꢁ
411 [M ꢀ H] ; mp: 289–291 C; H-NMR (300 MHz, DMSO-d6):
d 10.48 (s, 1H, –CO–NH), 8.50 (s, 2H, Ar–OH), 7.94 (d, J ¼ 7.4 Hz,
2H, N–CH), 7.87 (d, J ¼ 8.9 Hz, 4H, 4ꢂ Ar–H), 7.43 (d, J ¼
15.5 Hz, 1H, CO–CH), 7.04 (d, J ¼ 4.8 Hz, 2H, Ar–H), 6.93 (d, J ¼
4.5 Hz, 1H, Ar–H), 6.80 (d, J ¼ 18.1 Hz, 1H, CH–CH), 6.53 (d, J ¼
15.5 Hz, 1H, Ar–CH). 13C{1H} NMR (75 MHz, DMSO) d 165.01,
158.81, 157.43, 148.49, 146.10, 143.86, 142.33, 134.30, 129.38,
126.43, 121.63, 118.86, 118.17, 116.30, 114.50. IR (KBr, cmꢀ1):
3486.34 (s, nO–H), 3386.56 (s, nN–H), 1664.28 (m, nC]O), 1593.05
(s, nAr), 1559.25 (s, nAr), 1534.83 (s, nAr).
340 and 324 nm for ACASMD, CASMD, ACASDZ, CASDZ, ACASN,
CASN and caffeic acid, respectively.
Standard curves were prepared by measuring the UV absor-
bance of series concentrations of caffeic acid sulfonamide
derivatives in the n-octanol saturated PBS at predened
maximum wavelength (Fig. 2B). A good linear relationship
between the UV absorbance and their concentrations at a range
of 0.312 mM to 5 mM for caffeic acid and a range of 1.25 mM to 20
mM for caffeic acid sulfonamide derivatives were obtained. The
oil–water distribution coefficient was analyzed according to the
standard curves and shown in Table 1. It was found that the
conjugation of sulfonamides to the backbone of caffeic acid
signicantly increased its lipophilicity. ACASMD exhibited the
strongest lipophilicity with an oil–water distribution coefficient
(log P) of 1.3109, followed by CASMD, ACASDZ and CASDZ
showing coefficients higher than 0.5. Additional acetyl group
increased the lipophilicity, as the lipophilicity of ACASMD,
ACASDZ and ACASN was larger than respective derivatives
without acetyl group protection. However, the parent caffeic
acid exhibits a negative coefficient of ꢀ1.4171.
ACASN.
(Z)-4-(3-Oxo-3-(4-sulfamoylphenylamino)prop-1-
enyl)-1,2-phenylene diacetate, white powder, ESI-MS: 417 [M ꢀ
H]ꢀ; melting point (mp): 242–244 ꢁC; 1H-NMR (300 MHz,
DMSO-d6): d 10.59 (s, 1H, –CO–NH), 7.88–7.79 (d, J ¼ 9.0 Hz, 4H,
4ꢂ Ar–H), 7.66 (d, J ¼ 15.7 Hz, 1H, Ar–CH), 7.62 (d, J ¼ 8.13 Hz,
2H, Ar–H), 7.58 (d, J ¼ 8.1 Hz, 1H, Ar–H), 7.38 (d, J ¼ 8.1 Hz, s,
2H, SO2–NH2), 6.86 (d, J ¼ 15.7 Hz, 1H, CO–CH), 2.32 (d, J ¼
2.9 Hz, 6H, –CO–CH3). 13C{1H} NMR (75 MHz, DMSO) d 168.70,
164.17, 143.54, 142.82, 139.76, 133.88, 126.65, 124.75, 123.37,
123.15, 20.82. IR (KBr, cmꢀ1): 3328.82 (s, nN–H) (s), 3208.64 (s,
nC]O), 1776.91 (s, nC]O), 1677.25 (m, nRCH]CHR), 1628.14 (s, nAr),
1536.42 (s, nAr), 1502.11 (s, nAr).
CASN.
(Z)-3-(3,4-Dihydroxyphenyl)-N-(4-sulfamoylphenyl)
acrylamide, yellow powder, ESI-MS: 333 [M ꢀ H]ꢀ; mp: 298–
300 ꢁC; 1H-NMR (300 MHz, DMSO-d6): d 10.42 (s, 1H, –CO–NH),
9.53 (s, 1H, Ar–OH), 9.24 (s, 1H, Ar–OH), 7.87–7.77 (d, J ¼ 8.9 Hz,
4H, Ar–H), 7.49 (d, J ¼ 15.5 Hz, 1H, Ar–CH), 7.26 (s, 2H, SO2–
NH2), 6.04 (2H, Ar–H), 6.78 (d, J ¼ 8.1 Hz, 1H, Ar–H), 6.54 (d, J ¼
15.6 Hz, 1H, –CO–CH). 13C{1H} NMR (75 MHz, DMSO) d 164.94,
148.44, 146.10, 142.86, 142.17, 138.55, 126.48, 121.60, 118.29,
116.30, 114.48. IR (KBr, cmꢀ1): 3333.94 (s, nO–H), 3326.56 (s, nN–
H), 1670.83 (s, nC]O), 1576.84 (s, nAr).
2.3 DPPH scavenging capacity
The radical scavenging capacity of caffeic acid sulfonamide
derivatives was evaluated by 1,1-diphenyl-2-picrylhydrazyl
radical 2,2-diphenyl-1-(2,4,6-trinitrophenyl)hydrazyl (DPPH)
assay and results are shown in Fig. 3 and Table 2. The radical
scavenging rate increased with the increase in concentration of
caffeic acid derivatives, exhibiting a dose-dependent manner
2.2 Lipophilicity of caffeic acid sulfonamide derivatives
Table 1 Standard curves and distribution coefficients of caffeic acid
sulfonamide derivatives
The ultraviolet (UV) spectrum of caffeic acid sulfonamide
derivatives in n-octanol saturated PBS (0.3 mM) is shown in
Fig. 2A. Two absorption peaks were observed from the spec-
trums of CASMD, CASDZ and CASN, while only one peak was
observed from the spectrums of ACASMD, ACASDZ and ACASN.
Protection of two hydroxyl groups on the benzene ring with
acetyl groups resulted in the disappearance of the absorption
peak at ꢃ340 nm but the increase of peak values at the wave-
length of ꢃ316 nm. The maximum absorption wavelengths of
tested compounds were determined as 316, 338, 316, 342, 316,
Compound name
Slope
Y-Intercept
R2
log P
1.3109
0.7835
0.7023
0.5910
0.1985
0.09379
ꢀ1.4171
ACASMD
CASMD
ACASDZ
CASDZ
ACASN
CASN
0.06901
0.08401
0.08415
0.06723
0.07105
0.06554
0.03432
0.2571
0.1343
0.2577
0.1587
0.2304
0.1469
0.1773
0.9997
0.999
0.9993
0.9991
0.999
0.9994
0.9994
Caffeic acid
9926 | RSC Adv., 2020, 10, 9924–9933
This journal is © The Royal Society of Chemistry 2020

View Article Online
Paper
RSC Advances
Fig.
3 Radical scavenging capacity of caffeic acid sulfonamide
derivatives, caffeic acid and vitamin C using DPPH assay.
(Fig. 3). Table 2 shows that the IC50 of these compounds are
ranging from 39.37 mM to 798.00 mM. CASMD exhibited the
lowest IC50 among tested chemicals, showing a value of 39.37
mM, which was lower than caffeic acid and vitamin C. The IC50
of CASMD, CASDZ and CASN was much lower than that of
respective compounds with additional acetyl groups.
2.4 In vitro cytotoxicity of caffeic acid sulfonamide
derivatives against A549 cells
The cytotoxicity of caffeic acid sulfonamide derivatives against
human lung carcinoma cell line (A549) cells was evaluated using
3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazoliumbromide
(MTT) assay and results are shown in Fig. 4. The viability of A549
cells was not signicantly decreased when they were adminis-
trated with ACASMD, CASMD, ACASDZ, CASDZ, ACASN and CASN
at the concentration of #200 mM or treated with CASMD at the
concentration of #100 mM (Fig. 4B).
Fig. 4 Cytotoxicity against A549 cells. (A) ACASMD, (B) CASMD, (C)
ACASDZ, D) CASDZ, (E) ACASN, (F) CASN, (G) caffeic acid, (H) vitamin
C. *, ** and *** indicate statistically different from control in a signifi-
cant level of P < 0.05, P < 0.01, P < 0.001. (n ¼ 4).
2.5 Effect of caffeic acid sulfonamide derivatives on H2O2
induced oxidative stress in A549 cells
2.5.1 Caffeic acid sulfonamide derivatives reduce H2O2
induced cell death. H2O2 treatment induced a decrease in the
viability of A549 cells in a dose-dependent manner (data not markedly attenuated the H2O2-induced decrease in cell viability
shown). 4 h exposure of cell to 800 mM H2O2 resulted in 40% (p < 0.05). However, caffeic acid and vitamin C at a concentra-
decrease of the cell viability compared to control and this tion range of 3.125–100 mM could not prevent 800 mM H2O2
concentration was utilized for further experiments. The viability induced decrease in cell viability. Among the test concentra-
of cells treated with H2O2 and caffeic acid sulfonamide deriva- tions, 6.25 mM of all caffeic acid sulfonamide derivatives
tives are shown in Fig. 5. 4 h treatment with 800 mM H2O2 exhibited promising effect on the inhibitory of H2O2-induced
resulted in around 40% drop of cell viability, while pretreatment decrease in cell viability and this concentration was used for the
with CASMD (#200 mM), CASDZ (#200 mM), CASN (#200 mM), following experiments.
ACASMD (#100 mM), ACASDZ (#50 mM) and ACASN (#50 mM)
2.5.2 Caffeic acid sulfonamide derivatives inhibit ROS
generation. The levels of ROS in A549 cells were analyzed using
dichloro-dihydro-uorescein diacetate (DCF-DA) labels. From
Fig. 6, bright green color and less cells was observed comparing
to control group, which is consistent with the result of cell
viability. The ow cytometry results indicated that H2O2-treat-
ment induced the generation of ROS, showing a signicantly
higher level of ROS content comparing to that of control. Caffeic
acid sulfonamide derivatives treatment strongly inhibited H2O2
induced increase of ROS levels (Fig. 6 and 7A).
Table 2 Radical scavenging capacity of caffeic acid sulfonamide
derivatives
Compound name
IC50
R2
ACASMD
CASMD
ACASDZ
CASDZ
ACASN
CASN
798.00
39.37
259.7
45.55
223.4
50.30
40.91
91.04
0.9986
0.9895
0.9915
0.9917
0.9957
0.9983
0.9955
0.9930
2.5.3 Caffeic acid sulfonamide derivatives decrease MDA
production. The contents of MDA within the A549 cells were
also examined. It was found that the levels of MDA were
signicantly elevated in H2O2-exposed cells, while caffeic acid
Caffeic acid
Vitamin C
This journal is © The Royal Society of Chemistry 2020
RSC Adv., 2020, 10, 9924–9933 | 9927

View Article Online
RSC Advances
Paper
Fig. 6 Optical and fluorescent microscopic images of A549 cells
pretreated with 6.25 mM of caffeic acid sulfonamide derivatives for 24 h
and then administrated with 800 mM of H2O2 for 4 h.
mechanisms accounting for the protective effects of caffeic acid
sulfonamide derivatives against H2O2-induced oxidative stress.
It was found that H2O2 activates the transcription of Nrf2 and
Nrf2 target genes, including heme oxygenase-1 (HO-1), NAD(P)
H quinone dehydrogenase 1 (NQO1) and thioredoxin reductase
1 (TXNRD1), and caffeic acid sulfonamide derivatives pretreat-
ment further upregulated the mRNA expression of these genes
in H2O2 treated A549 cells (Fig. 9).
Fig. 5 Viability of A549 cells pretreated with series concentration of
caffeic acid sulfonamide derivatives for 24 h and then administrated
with 800 mM of H2O2 for 4 h. (A) ACASMD, (B) CASMD, (C) ACASDZ, (D)
CASDZ, (E) ACASN, (F) CASN, (G) caffeic acid, (H) vitamin C. * and #
indicate statistical difference from control and H2O2 group, respec-
tively (P < 0.05); ** and ## indicate statistical difference from control
and H2O2 group, respectively (P < 0.01); *** and ### indicate statis-
tical difference from control and H2O2 group, respectively (P < 0.001).
(n ¼ 4).
3. Discussion
sulfonamide derivatives at a concentration of 6.25 mM markedly
decreased the generation of MDA (Fig. 7B).
Under pathological conditions, production of ROS is far more
than their clearance by endogenic antioxidase, leading to
oxidative stress. Excess ROS will induce oxidative damage to
2.5.4 Caffeic acid sulfonamide derivatives increase activi-
ties of anti-oxidative enzymes. The effects of caffeic acid
sulfonamide derivatives on the activities of endogenous anti-
oxidant enzymes are shown in Fig. 8. It can be seen that the
enzyme activities of superoxide dismutase (SOD), catalase (CAT)
and glutathione peroxidase (GSH-Px) were signicantly
decreased aer administrated with 800 mM H2O2 comparing to
those of control. Caffeic acid sulfonamide derivatives pretreat-
ment was able to enhance their activities, and except ACASDZ,
all tested compounds signicantly increase the activities of SOD
(P < 0.05 or P < 0.001). In addition, CASN strongly upregulated
the activities of CAT (P < 0.05), while CASMD dramatically
enhanced the activity of GSH-Px (P < 0.05).
Fig. 7 Effect of caffeic acid sulfonamide derivatives on the production
of ROS (A) and MDA (B) in A549 cells pretreated with 6.25 mM of caffeic
acid sulfonamide derivatives for 24 h and then administrated with 800
mM of H2O2 for 4 h. * and # indicate statistical difference from control
and H2O2 group, respectively (P < 0.05); ** and ## indicate statistical
difference from control and H2O2 group, respectively (P < 0.01); ***
and ### indicate statistical difference from control and H2O2 group,
respectively (P < 0.001). (n ¼ 3).
2.5.5 Caffeic acid sulfonamide derivatives upregulate crit-
ical gene expressions. The mRNA expression of Nrf2 and Nrf2
target genes were further examined by reversed quantitative real
time polymerase chain reaction (qRT-PCR) using primer
sequences listed in Table 3 in order to nd out the potential
9928 | RSC Adv., 2020, 10, 9924–9933
This journal is © The Royal Society of Chemistry 2020

View Article Online
Paper
RSC Advances
Fig. 9 Relative mRNA expression levels of Nrf2 (A), HO-1 (B), NQO1 (C)
and TXNRD1 (D) in A549 cells pretreated with 6.25 mM of caffeic acid
sulfonamide derivatives for 24 h and then administrated with 800 mM
of H2O2 for 4 h. * and # indicate statistical difference from control and
H2O2 group, respectively (P < 0.05); ** and ## indicate statistical
difference from control and H2O2 group, respectively (P < 0.01); ***
and ### indicate statistical difference from control and H2O2 group,
respectively (P < 0.001). (n ¼ 3).
Fig. 8 Effect of caffeic acid sulfonamide derivatives on the activities of
endogenous antioxidant enzymes in A549 cells pretreated with 6.25
mM of caffeic acid sulfonamide derivatives for 24 h and then admin-
istrated with 800 mM of H2O2 for 4 h. (A) SOD, (B) CAT and (C) GSH-Px.
* and # indicate statistical difference from control and H2O2 group,
respectively (P < 0.05); ** and ## indicate statistical difference from
control and H2O2 group, respectively (P < 0.01); *** and ### indicate
statistical difference from control and H2O2 group, respectively (P <
0.001). (n ¼ 3).
DPPHc assay is the simplest method to measure the ability of
antioxidants to intercept free radicals. In this study, the DPPHc
scavenging ability of caffeic acid sulfonamide derivatives
decreased in the following order according to their hydrogen-
donating ability: CASMD > caffeic acid > CASDZ > CASN >
vitamin C > ACASN > ACASDZ > ACASMD. Increasing the
number of hydroxyl or catechol groups can enhance the radical
scavenging activity of chemicals, as the scavenging activity of
CSAN, CASMD and CASDZ were much stronger than those of
respective compounds with additional acetyl group (ACSAN,
ACASMD and ACASDZ), this result is consistent with previous
reports.13
H2O2 can directly oxidize the proteins and lipids in cell
membrane. It is also capable of diffusing throughout the
mitochondria and across cell membranes and produce many
types of cellular injury, thus it has been considered as one of the
most important stimulators for the establishment of oxidative
stress cell models.21,22 Exogenous antioxidants can tackle the
oxidative damage to protect cell and organ functions.23 In this
study, oxidative stress was established in A549 cells using H2O2
stimulation to evaluate the antioxidative activities of synthe-
sized caffeic acid sulfonamide derivatives. It was found that the
proliferation of A549 cells was signicantly inhibited by H2O2,
but the inhibition of H2O2 on the survival rate of A549 cells was
signicantly reduced by the treatment of caffeic acid
nucleic acid, protein and biomembrane of cells and cause cell
injury and cell death. Free radicals, such as ROS, have been
implicated in the pathogenesis of inammation, cardiovascular
diseases, cancer and ageing.16 Caffeic acid, an important
phenolic acid extensively distributed in various plants, has the
functions of anti-inammation, anti-oxidation, promoting
blood circulation and stopping bleeding, and delaying senility.
Good antioxidative activities, potent analgesic activity, antimi-
crobial activities have been reported from many synthesized
caffeic acid amide analogues and ester analogues.17–19 In this
study, six new caffeic acid sulfonamide derivatives were
synthesized by coupling sulfonamides including SN, SMD and
SDZ, to the backbone of caffeic acid with or without the
protection of hydroxyl groups with acetyl groups. The obtained
derivatives exhibited stronger hydrophilicity than the parent
form, which might help their penetration across biomembranes
and thus easier to be absorbed into the circulation system and
to function in target cells. This result is consistent with Ates's
study on amide derivative of N-acetylcyteine (NACA).20
Table 3 Sequence of the primers for qRT-PCR
Gene
Forward primer (50 / 30)
Reverse primer (50 / 30)
Nrf2
GAGACAGGTGAATTTCTCCCAAT
AAGAAAGGATGGGAGGTGGT
GGAACTAGATGGGGTCTCGG
AAGACTGCGTTCCTGCTCAAC
GATCATTGCTCCTCCTGAGC
GGGAATGTGGGCAACCTGGG
GCTTCTTTTGTTCAGCCACA
TCTTGCAGGGCTTGTCCTAA
AAAGCCCTACAGCAACTGTCG
ACTCCGCTTGCTGATCCAC
NQO1
TXNRD1
HO-1
b-Actin
This journal is © The Royal Society of Chemistry 2020
RSC Adv., 2020, 10, 9924–9933 | 9929

View Article Online
RSC Advances
Paper
sulfonamide derivatives, suggesting that caffeic acid sulfon- and expression of genes associated with cellular antioxidative
amide derivatives was able to alleviate H2O2 induced cell capacity.27 Nrf2-mediated antioxidative response pathway
damage.
controls the expression of antioxidative response element-
Pathogen infection and exposure to xenobiotics, drugs, dependent genes, including HO-1, NQO1 and TXNRD1, three
heavy metals and ionizing radiation usually generate large important antioxidation and detoxication enzymes.28 This
amount of ROS, and these radicals induced oxidative stress may pathway has been considered as the primary cellular defence
profoundly affect the survival and evolution of all living mechanism against the cytotoxic effects of oxidative stress, and
organisms.1 Upon oxidative stress, oxygen radicals attack the knockout of Nrf2 genes induce higher susceptibility to
unsaturated fat in biolms, triggering lipid peroxidation reac- chemical toxicity and disease conditions associated with
tions and producing lipid peroxidation products such as MDA oxidative pathology.29,30 Activation of Nrf2 pathway and
and keto groups. Lipid peroxidation not only converts reactive increased mRNA levels of HO-1, NQO1 and TXNRD1 are
oxygen species into reactive chemicals, which are not free frequently reported under oxidative stress conditions.31,32 Anti-
radical like decomposition products, but also intensify cell oxidant treatment signicantly increased the cell viability, SOD
damages via chain or branched chain reactions. Antioxidants activity and GSH level, which may function via the modulation
can protect against free radicals, and free radical-induced lipid of Nrf2 pathway.33–35 In this study, the mRNA expressions of
peroxidation and DNA damage.24 In this study, H2O2 stimula- Nrf2 and associated antioxidation and detoxication enzymes
tion induced oxidative stress in A549 cells, representing with (HO-1, NQO1 and TXNRD1) were upregulated upon H2O2
signicantly increased ROS levels and MDA production. Caffeic stimulation, while their expression were further upregulated by
acid sulfonamide derivatives treatment inhibited the produc- caffeic acid sulfonamide derivative pretreatment.
tion of ROS and MDA, suggesting that they were potential
candidates to protect cells from free radicals.
4. Materials and methods
Reactive oxidants are counterbalanced by intricate antioxi-
4.1 Chemicals
dants including reduced glutathione (GSH), vitamins C and E,
and urate, and endogenous antioxidant enzymes such as SOD,
CAT and GSH-Px.16 SOD catalyze the disproportionation reac-
tion of peroxo-anion to scavenge free radicals. CAT, which
accounts for about 40% of the total catalase system, catalyze the
decomposition of hydrogen peroxide to produce water and
oxygen. GSH-Px, an important peroxide enzyme that widely
exists in the body, catalyze the reaction of GSH with peroxide to
produce nontoxic hydroxyl compounds and oxidized gluta-
thione (GSSG).16 The activity of antioxidant enzymes in the body
is a direct reection of the level of dynamic equilibrium regu-
lation in cells under oxidative stress. When the stimulation of
external oxidative stress source is stronger than the self-
Caffeic acid, DPPH and MTT were obtained from Sigma-Aldrich,
USA. SN, SMD and SDZ were purchased from Shenzhen Remote
Technology Development Co. High glucose Dulbecco's Modi-
ed Eagle's Medium (DMEM), fetal bovine serum (FBS), peni-
cillin sodium and streptomycin (PS) were purchased from
Gibco, USA. Other chemicals and reagents were supplied by
Xilong Scientic Co. All chemicals were commercially available
and used as received.
4.2 Synthesis and characterization of caffeic acid
sulfonamide derivatives
regulated range, damage of cells and tissues by oxidative Caffeic acid sulfonamide derivatives were prepared by coupling
stress will occur. In order to resist the injury from ROS and SN, SMD or SDZ to the backbone of caffeic acid according to the
restore the redox balance, endogenous antioxidant enzymes synthetic scheme in Fig. 1. Firstly, the hydroxyl groups on caf-
(SOD, CAT and GSH-Px) are consumed in large quantities. As feic acid were protected by acyl groups by reacting with acetic
a result, the oxidative defence system is haywire. Hence, when anhydride and sulfoxide chloride (SOCl2) to obtain the inter-
A549 cells were stimulated by H2O2, the whole antioxidant mediate of (E)-4-(3-chloro-3-oxoprop-1-en-1-yl)-1-2-phenlene
defence system was severely damaged, and corresponding diacetate (CPD). Briey, 17.9 g of caffeic acid and 4 mL of
activities of SOD, CAT and GSH-Px in A549 cells signicantly pyridine were added into 80 mL acetic anhydride and stirred at
reduced. However, the activities of antioxidant enzymes were room temperature for 24 h. The mixture was then concentrated
considerably increased aer 24 hours incubation with caffeic by rotary evaporation to obtain primrose yellow oily product
acid sulfonamide derivatives, indicating that these compounds which were then mixed with 100 mL distilled water and placed
could reduce the consumption of endogenous antioxidant in room temperature for 12 h to produce large amount of white
enzymes by H2O2 and alleviate the injury of oxidative stress. precipitate. The precipitate was vacuum ltered and ꢃ21.2 g
This above observation was consistent with the previous nding diacetyl caffeic acid was obtained. The diacetyl caffeic acid (5.0
that antioxidants attenuate H2O2-induced cell damage by g) was reacted with 10 mL of SOCl2 by reuxing at 60 ꢁC for 5 h.
reducing lipid peroxidation products and elevating the level of Excess SOCl2 was removed by distillation at 50 ꢁC under
GSH-Px and SOD activities.25 Further, the antioxidative ability of reduced pressure and the intermediate of (E)-4-(3-chloro-3-
rats was signicantly improved aer oral administration of oxoprop-1-en-1-yl)-1-2-phenlene diacetate (CPD) was obtained.
grape seed polyphenol, which was superior to vitamin C and Obtained CPD was dissolved in 25 mL of tetrahydrofuran (THF)
other common antioxidants.26
and excess SN, SMD or SDZ and 5 mL of pyridine was added to
Besides radical scavenging, oxidative stress and antioxidant the above mixture. The mixture was stirred in ice-bath for 2
action also includes the modulation of cell signaling pathway hours and then at room temperature for another 24 hours.
9930 | RSC Adv., 2020, 10, 9924–9933
This journal is © The Royal Society of Chemistry 2020

View Article Online
Paper
RSC Advances
Upon completion, excess THF and pyridine was removed by and 100 U mLꢀ1 streptomycin, and maintained in a humidied
ꢁ
vacuum evaporation. The obtained crude product was washed atmosphere at 37 C with 5% CO2.
by distilled water and puried by recrystallization in a THF–
The cytotoxicity of synthesized compounds against A549
methanol system. Finally, one kind of light yellow powder and cells were tested using MTT assay. Briey, cells were seeded in
two kinds of white powders denoted as ACASMD, ACASN and 96-well plates with 5 ꢂ 103 cells per well and incubated over-
ACASDZ were obtained. Acetyl groups protecting hydroxyl night. Then cells were administrated with series concentrations
groups on the benzene ring of ACASN, ACASMD and ACASDZ (5 of caffeic acid sulfonamide derivatives ranging from 6.25–200
g) were removed by reacting with hydrochloric acid (6 mL, 38%) mM. 48 h later, 100 mL of MTT (0.5 mg mLꢀ1 in DMEM) was
in THF (20 mL) at 55 ꢁC for 4 hours to obtain CASN, CASMD and added into each well and incubated for another 4 h. The
CASDZ. The purity of nal products was higher than 99.0% with supernatant was carefully removed, and the purple crystals were
the yield of 58%–89%.
dissolved in 100 mL DMSO. The absorbance at 490 nm were
The melting points of obtained caffeic acid sulfonamide measured using a multi-functional microplate reader and cell
derivatives were measured by XT-4 micro melting apparatus. viability was calculated as percentage of (ODtest ꢀ ODblank)/
1
EIS-MS was recorded by Shimadzu LC-MS 2010A. H-NMR and (ODcontrol ꢀ ODblank).
13C{1H} NMRꢁspectrums were recorded using a Bruker Advance
III 300 at 25 C with frequencies of 400 and 125 MHz, respec-
tively. FT-IR spectrums were obtained by a Nicolet 380 spec-
trophotometer. The UV absorption spectrums were determined
4.6 Effect of caffeic acid sulfonamide derivatives on H2O2
induced oxidative stress
on an UV-2600 (Shimadzu, Japan).
A549 cells were divided into control group (cells without drug
and H2O2 treatment), H2O2 group (cells exposed to 800 mM H2O2
for 4 h) and tested groups (cells pretreated with caffeic acid
sulfonamide derivatives for 24 h and then exposed to 800 mM
H2O2 for 4 h). Cells were subjected to different treatments and
then serial analysis were carried out, including cell viability, cell
morphology, oxidative product production, anti-oxidative
enzyme activities, and mRNA expressions of oxidative reaction
associated genes.
4.3 Determination of the lipophilicity of caffeic acid
sulfonamide derivatives
The lipophilicity of caffeic acid derivatives was calculated by n-
octanol–water distribution coefficients. Briey, series concen-
trations of caffeic acid sulfonamide derivatives in PBS (10 mM,
pH 7.4) saturated n-octanol were prepared and their UV absor-
bance were measured at the pre-determined wavelength to plot
the standard curves. 8 mL of caffeic acid sulfonamide derivatives
(5 mM in DMSO) was mixed with 2 mL of n-octanol saturated PBS
and PBS saturated n-octanol. The mixture was thoroughly
mixed. The obtained emulsion was centrifuged at 4000 rpm for
5 min to separate the aqueous and organic phases. The UV
absorption of caffeic acid sulfonamide derivatives in the
aqueous and organic phases were measured and their concen-
trations were calculated using obtained standard curves. log P
was dened as the logarithm of the ratio between the concen-
tration of the compound in the organic and aqueous phases,
and calculated as log(Corganic/Caqueous).36
4.6.1 Cell viability. Viability of A549 cells treated with/
without H2O2 and caffeic acid sulfonamide derivatives was
measured following the same procedure as 4.5.
4.6.2 ROS generation. Aer cell treatment in 24-well plates,
the supernatant was discarded and cells were carefully washed
with PBS (pH 7.2). Then cells were harvested, transferred to
a 2.0 mL centrifuge tube, and centrifuged at 1500 rpm for 5 min.
The precipitate was washed with serum-free DMEM twice and
incubated witꢁh 10 mM of DCFH-DA (Sigma, USA) in serum free
DMEM at 37 C for 30 min in dark. Cells were further washed
with serum-free DMEM twice and resuspended in serum-free
DMEM for ow cytometry detection on a FACSAria II ow
cytometer (BD, USA). In addition, cells cultured in 48-well plates
labeled with DCFH-DA were imaged with an inverted micro-
scope (Nikion, Japan).
4.6.3 MDA production. Aer H2O2 and caffeic acid sulfon-
amide derivatives treatment, cells were harvested and ultra-
sonicated on ice to release MDA from the cells. Aer
centrifugation at 3000 rpm for 10 min at 4 ꢁC, the MDA levels in
the supernatant were tested using commercial assay kits (Jian-
cheng Bioengineering Institute, China).
4.4 Quenching of DPPH radical
All tested chemicals were dissolved in DMSO and diluted with
ethanol. To evaluate their DPPH scavenging capacity, 3.94 mg
DPPH was dissolved in 100 mL of anhydrous ethanol and 2 mL
of this solution was mixed with series concentrations of caffeic
acid derivatives. Vitamin C was used as control. The mixture
was kept at room temperature in dark for 30 min and the
absorbance was measured at 519 nm using UV spectropho-
tometer. The DPPH scavenging activity was calculated as
4.6.4 Intracellular anti-oxidative enzyme activities. Cells
treated in accordance with the experimental design in 6-well
plates were harvested and disrupted ultrasonically on ice. Aer
centrifugation at 3000 rpm for 10 min at 4 ꢁC, the supernatants
were used for the measurement of SOD, GSH-Px and CAT levels
percentage of (Acontrol ꢀ Asample)/Acontrol
.
4.5 In vitro cytotoxicity assay
Human lung carcinoma A549 cells were purchased from the cell using commercial assay kits (Jiancheng Bioengineering Insti-
bank of the Chinese Academy of Science (Shanghai, China). tute, China) according to the manufacturer's instructions.
Cells were cultured in completed DMEM medium supple-
4.6.5 Quantitative real time polymerase chain reaction
mented with 10% fetal bovine serum, 100 U mLꢀ1 of penicillin analysis of gene activation. Total RNA was extracted from
This journal is © The Royal Society of Chemistry 2020
RSC Adv., 2020, 10, 9924–9933 | 9931

View Article Online
RSC Advances
Paper
treated A549 cells using Total RNA Extraction Reagent (Vazyme,
China) and was reverse transcribed into cDNA using the
HiScript III RT SuperMix for qPCR kit (Vazyme, China) following
the manufacturer's instructions. A SYBR-Green I PCR kit
(Vazyme, China) was used to amplify cDNA using the following
conditions: initial denaturation at 95 ꢁC for 30 s, followedꢁby 35
2 Y. C. Shi and T.-M. Pan, Appl. Microbiol. Biotechnol., 2012, 94,
47–55.
3 V. Sosa, T. Moline, R. Somoza, R. Paciucci, H. Kondoh and
L. L. ME, Ageing Res. Rev., 2013, 12, 376–390.
4 M. O. Parat, T. T. T. Nguyen, P. N. Shaw and
A. K. Hewavitharana, Mol. Nutr. Food Res., 2013, 57(1), 153–
164.
5 C. Y. Chang, C.-Y. Shen, C.-K. Kang, Y.-P. Sher,
W. H.-H. Sheu, C.-C. Chang and T.-H. Lee, Toxicol. Appl.
Pharmacol., 2014, 279, 351–363.
ꢁ
ꢁ
amplication cycles at 95 C for 10 s, 55 C for 10 s, 72 C for
15 s, and a nal extension at 72 ꢁC for 10 min. b-Actin was used
as an internal reference gene. Relative values for mRNA levels
were calculated using the following formula: fold change ¼
2ꢀDDCq. The primers used for each gene were listed in Table 3.
6 V. K. Koltover, Curr. Aging Sci., 2017, 10, 12–17.
7 M. V. Clement and L. Luo, Proteomics, 2019, e1800400, DOI:
10.1002/pmic.201800400.
4.7 Statistical analysis
8 Q. Song, Y. Zhao, Q. Li, X. Han and J. Duan, Biomed.
Pharmacother., 2019, 122, 109690.
9 Y. Fu, L. Jiang, W. Zhao, X.-N. Meng, S. Huang, J. Yang, T. Hu
and H. Chen, Sci. Rep., 2017, 7, 8676.
Data were presented as means ꢄ SD. Statistical signicance was
determined using one way analysis of variance (ANOVA) fol-
lowed by LSD post hoc test.
10 H. Chen, J. Yang, Y. Fu, X. Meng, W. Zhao and T. Hu, BMC
Complementary Altern. Med., 2017, 17, 244.
5. Conclusions
11 A. Colonnello, G. Aguilera-Portillo, L. C. Rubio-Lopez,
B. Robles-Banuelos, E. Rangel-Lopez, S. Cortez-Nunez,
Y. Evaristo-Priego, A. Silva-Palacios, S. Galvan-Arzate,
R. Garcia-Contreras, I. Tunez, P. Chen, M. Ashner and
A. Santamaria, Neurotoxic. Res., 2019, 37, 326–337.
12 K. D. Pantoja Pulido, A. J. Colmenares Dulcey and J. H. Isaza
Martinez, Food Chem. Toxicol., 2017, 109, 1079–1085.
13 S. Son and B. A. Lewis, J. Agric. Food Chem., 2002, 50, 468–
472.
14 C. C. Hung, W. Tsai, L. Y. Kuo and Y. Kuo, Bioorg. Med.
Chem., 2005, 13, 1791–1797.
15 Y. Li, Y. Zhu, R. Liang and C. Yang, Int. J. Cosmet. Sci., 2017,
39, 402–410.
In conclusion, six new caffeic acid sulfonamide derivatives have
been synthesized with simple reactions and high yield under
mild conditions. They were fully characterized by various
physicochemical and spectroscopic methods. The results of oil–
water partition coefficient and DPPH scavenging assays indicate
that these derivatives have high lipophilicity and strong radical
scavenging activities. In vitro studies using H2O2 induced
oxidative stress cell models suggest that the caffeic acid
sulfonamide derivatives are able to protect cells from H2O2
induced oxidative stress possibly by regulating the Nrf2
pathway. However, further conrmation of the Nrf2 trans-
location from the cytoplasm to the cell nucleus by western blot
would convince the regulation of Nrf2 signaling pathway. In vivo
studies on the protective effect of the derivatives with strong
antioxidative capability screened from this in vitro study are
required to evaluate their potential biomedical applications on
the treatment of oxidative stress associated disease.
16 S. Reuter, S. C. Gupta, M. M. Chaturvedi and B. B. Aggarwal,
Free Radicals Biol. Med., 2010, 49, 1603–1616.
17 P. Rajan, I. Vedernikova, P. Cos, D. Vanden Berghe,
K. Augustyns and A. Haemers, Bioorg. Med. Chem. Lett.,
2001, 11, 215–217.
18 Y. Jung, T. Kang, J. Yoon, B. Joe, H. Lim, C. Seong, W. Park,
J. Kong, J. Cho and N. Park, Bioorg. Med. Chem. Lett., 2002,
12, 2599–2602.
19 J. Fu, K. Cheng, Z.-m. Zhang, R.-q. Fang and H.-l. Zhu, Eur. J.
Med. Chem., 2010, 45, 2638–2643.
Funding
This work was supported by the Guangxi Natural Science
Foundation [grant number 2016GXNSFBA380053]; and the
National Natural Science Foundation of China [grant number
21362001].
20 B. Ates, L. Abraham and N. Ercal, Free Radical Res., 2008, 42,
372–377.
21 D. Chavarria, C. Fernandes, B. Aguiar, T. Silva, J. Garrido,
F. Remiao, P. J. Oliveira, E. Uriarte and F. Borges,
Molecules, 2019, 24, 1–16.
Conflicts of interest
The authors declare no competing nancial interest.
22 W. Jin, X. Zhu, F. Yao, X. Xu, X. Chen, Z. Luo, D. Zhao, X. Li,
X. Leng and L. Sun, Biomed. Pharmacother., 2020, 121,
109676.
Acknowledgements
23 B. E. Bilgic, S. Ayla, G. Tunali, K. Sofuoglu, A. A. Ozdemir,
G. Tanriverdi, S. Ozdemir, B. C. Soner, B. Ozturk,
S. Karahuseyinoglu, E. G. Aslan and I. Seckin, Acta
Histochem., 2018, 120, 117–121.
24 D. Bagchi, M. Bagchi, S. Stohs, D. Das, S. Ray, C. Kuszynski,
S. Joshi and H. Pruess, Toxicology, 2000, 148, 187–197.
25 H. Hong and G. Liu, Planta Med., 2004, 70, 427–431.
We thank Dr Palanisamy Kannan for the language help on the
preparation of this manuscript.
References
1 J. W. Hamilton and K. E. Wetterhahn, Mol. Carcinog., 1989, 2,
274–286.
9932 | RSC Adv., 2020, 10, 9924–9933
This journal is © The Royal Society of Chemistry 2020

View Article Online
Paper
RSC Advances
26 T. Koga, K. Moro, K. Nakamori, J. Yamakoshi, H. Hosoyama, 31 G. Szklarz, Annu. Rev. Pharmacol. Toxicol., 2013, 53, 401.
S. Kataoka and T. Ariga, J. Agric. Food Chem., 1999, 47, 1892– 32 P. K. Leong, P. Y. Chiu, N. Chen, H. Leung and K. M. Ko, Free
1897.
Radical Res., 2011, 45, 483–495.
27 F. Nadia, V. Giuseppa, S. Antonella, C. Santa, L. G. Enrico, 33 W. Ying, Z. Li, Y. qing, L. Mai and T. Mei, Appl. Physiol., Nutr.,
C. Pietro, D. P. Angela and N. Michele, J. Evidence-Based
Complementary Altern. Med., 2015, 1–14.
28 K. Eri, S. Takafumi and Y. Masayuki, Oxid. Med. Cell.
Longevity, 2013, 2013, 1–7.
Metab., 2018, 44, 1–6.
34 E. Jiang, H. Li, C. Yu, C. Yu, S. Jing, H. Sun, C. Wang, X. Fan,
J. Chen and S. Wang, Neuroreport, 2016, 26, 360–366.
35 R. Jia, H. Zhang, Z. Yang, H. Zhao, F. Liu, H. Wang, M. Miao,
Q. Wang and Y. Liu, Int. Immunopharmacol., 2017, 53, 11–16.
29 Q. Ma and X. He, Pharmacol. Rev., 2012, 64, 1055–1081.
30 H. Motohashi and M. Yamamoto, Trends Mol. Med., 2004, 10, 36 D. E. K. Li, ADME to Toxicity Optimization, 2016, DOI:
549–557.
10.1080/02103702.1987.10822155 xviii-xix.
This journal is © The Royal Society of Chemistry 2020
RSC Adv., 2020, 10, 9924–9933 | 9933