De novo biosynthesis of p-coumaric acid in E. Coli with a trans-Cinnamic Acid 4-Hydroxylase from the Amaryllidaceae Plant Lycoris aurea

Article abstract of DOI:10.3390/molecules23123185

p-Coumaric acid is a commercially available phenolcarboxylic acid with a great number of important applications in the nutraceutical, pharmaceutical, material and chemical industries. p-Coumaric acid has been biosynthesized in some engineered microbes, but the potential of the plant CYP450-involved biosynthetic route has not investigated in Escherichia coli. In the present study, a novel trans-cinnamic acid 4-hydroxylase (C4H) encoding the LauC4H gene was isolated from Lycoris aurea (L’ Hér.) Herb via rapid amplification of cDNA ends. Then, N-terminal 28 amino acids of LauC4H were characterized, for the subcellular localization, at the endoplasmic reticulum membrane in protoplasts of Arabidopsis thaliana. In E. coli, LauC4H without the N-terminal membrane anchor region was functionally expressed when fused with the redox partner of A. thaliana cytochrome P450 enzyme (CYP450), and was verified to catalyze the trans-cinnamic acid to p-coumaric acid transformation by whole-cell bioconversion, HPLC detection and LC-MS analysis as well. Further, with phenylalanine ammonia-lyase 1 of A. thaliana, p-coumaric acid was de novo biosynthesized from glucose as the sole carbon source via the phenylalanine route in the recombinant E. coli cells. By regulating the level of intracellular NADPH, the production of p-coumaric acid was dramatically improved by 9.18-fold, and achieved with a titer of 156.09 μM in shake flasks. The recombinant cells harboring functional LauC4H afforded a promising chassis for biological production of p-coumaric acid, even other derivatives, via a plant CYP450-involved pathway.

Full text of DOI:10.3390/molecules23123185

molecules
Article
De Novo Biosynthesis of p-Coumaric Acid in E. coli
with a trans-Cinnamic Acid 4-Hydroxylase from the
Amaryllidaceae Plant Lycoris aurea
Yikui Li 1,2,†, Jie Li 1,†, Binbin Qian 1, Li Cheng 1, Sheng Xu 1,2 and Ren Wang 1,2,
*
1
Jiangsu Key Laboratory for the Research and Utilization of Plant Resources, Institute of Botany,
Jiangsu Province and Chinese Academy of Sciences, Nanjing 210014, China; liyikui@cnbg.net (Y.L.);
lj734820531@163.com (J.L.); qian_binbin01@163.com (B.Q.); chengli9075@163.com (L.C.);
xusheng@cnbg.net (S.X.)
The Jiangsu Provincial Platform for Conservation and Utilization of Agricultural Germplasm,
Nanjing 210014, China
2
*
†
Correspondence: rwang@cnbg.net or jswangren@aliyun.com; Tel.: +86-25-84347111
These authors contributed equally to this work.
ꢀꢁꢂꢀꢃꢄꢅꢆꢇ
ꢀꢁꢂꢃꢄꢅꢆ
Received: 30 September 2018; Accepted: 29 November 2018; Published: 3 December 2018
Abstract: p-Coumaric acid is a commercially available phenolcarboxylic acid with a great number
of important applications in the nutraceutical, pharmaceutical, material and chemical industries.
p-Coumaric acid has been biosynthesized in some engineered microbes, but the potential of the
plant CYP450-involved biosynthetic route has not investigated in Escherichia coli. In the present
study, a novel trans-cinnamic acid 4-hydroxylase (C4H) encoding the LauC4H gene was isolated from
Lycoris aurea (L’ Hér.) Herb via rapid amplification of cDNA ends. Then, N-terminal 28 amino acids of
LauC4H were characterized, for the subcellular localization, at the endoplasmic reticulum membrane
in protoplasts of Arabidopsis thaliana. In E. coli, LauC4H without the N-terminal membrane anchor
region was functionally expressed when fused with the redox partner of A. thaliana cytochrome
P450 enzyme (CYP450), and was verified to catalyze the trans-cinnamic acid to p-coumaric acid
transformation by whole-cell bioconversion, HPLC detection and LC-MS analysis as well. Further,
with phenylalanine ammonia-lyase 1 of A. thaliana, p-coumaric acid was de novo biosynthesized
from glucose as the sole carbon source via the phenylalanine route in the recombinant E. coli cells.
By regulating the level of intracellular NADPH, the production of p-coumaric acid was dramatically
improved by 9.18-fold, and achieved with a titer of 156.09 µM in shake flasks. The recombinant cells
harboring functional LauC4H afforded a promising chassis for biological production of p-coumaric
acid, even other derivatives, via a plant CYP450-involved pathway.
Keywords: p-coumaric acid; trans-cinnamic acid 4-hydroxylase; Lycoris aurea; Escherichia coli;
synthetic biology
1. Introduction
p-Coumaric acid is a commercially available phenolcarboxylic acid with a great number of
important applications in the nutraceutical, pharmaceutical, material and chemical industries.
p-Coumaric acid possesses potent anti-oxidant, antibacterial and anti-inflammatory properties, and
serves as a conventional precursor for the production of flavors and fragrances used in edible
and daily chemical products. p-Coumaric acid is also a starting material for the preparation of
environmentally degradable thermoplastics with liquid crystalline behavior [
acid has been found to have many novel bioactivities, such as antiproliferative effect [
effect [ ], a nephroprotective role [ ], melanogenesis inhibition [ ], and neuroprotective effects [6
1
]. Recently, p-coumaric
], anxiolytic
].
2
3
4
5
Molecules 2018, 23, 3185; doi:10.3390/molecules23123185
www.mdpi.com/journal/molecules

Molecules 2018, 23, 3185
2 of 19
In addition, p-coumaric acid, as an upstream metabolite in the plant phenylpropanoid pathway, is a
common precursor for biosynthesizing numerous derivatives, such as other phenylpropanoids [
flavonoids [9,10], stilbenes [11] and anthocyanins [12].
7,8],
p-Coumaric acid has been biosynthesized mainly from tyrosine in engineered microbes.
p-Coumaric acid, as a component of lignin, is ubiquitously present in plants at a low concentration [13].
In plants, the biosynthesis of p-coumaric acid involves two biochemical processes: phenylalanine
ammonia-lyase (PAL) firstly catalyzes the conversion of phenylalanine to trans-cinnamic acid, which
is then hydroxylated at the para position under the action of trans-cinnamic acid 4-hydroxylase
(C4H) (Figure 1) [14,15]. However, some PAL enzymes can accept tyrosine as an alternative
substrate (PAL/TAL) and directly form p-coumaric acid from tyrosine without the intermediacy
of trans-cinnamic acid (Figure 1) [16]. Also, there are some aromatic amino acid ammonia-lyase
homolog enzymes specific for tyrosine deamination (TAL) (Figure 1) [17], so introducing a heterologous
PAL/TAL or TAL, p-coumaric acid could be produced via the tyrosine route in recombinant
cells such as Escherichia coli
Pseudomonas putida [23].
[18–20], Saccharomyces cerevisiae [21], Streptomyces lividans [22] and
Figure 1. The biosynthetic routes of p-coumaric acid. The phenylalanine route (PAL-C4H) presents
ubiquitously in plants and the tyrosine route (PAL/TAL and TAL) exists in some microbes.
In virtue of the plant biosynthetic route PAL-C4H, p-coumaric acid has been biosynthesized from
phenylalanine only in engineered S. cerevisiae [18]. The enzyme C4H is a member of the CYP73A
subfamily in cytochrome P450 enzymes (CYP450s) catalyzing a series of oxidation reactions with
a CYP450 reductase as redox partner for supplying electrons from NADPH, and is supposed to
commonly localize at the cytoplasmic side of endoplasmic reticulum (ER) membrane [14]. Given that
prokaryotic microbes such as E. coli do not possess compartmentalized organelle(s), the functional
expression of CYP450s is difficult [24,25]. Vannelli and his co-workers have functionally co-expressed
the C4H and the CYP450 reductase from Helianthus tuberosus with a fungal PAL enzyme in S. cerevisiae
cells, and produced p-coumaric acid from the central metabolite L-phenylalanine via the PAL-C4H
route [18].
Though p-coumaric acid can be produced directly from tyrosine, it was necessary to investigate
the potential of the plant CYP450-involved biosynthetic route from phenylalanine in E. coli which
could to some extent expand the biosynthetic pathway of p-coumaric acid and offer an alternative
approach to produce p-coumaric acid from phenylalanine as well as tyrosine. In the present study,
based on our previous transcriptome data of Lycoris aurea (L’ Hér.) Herb [26], an ornamentally and

Molecules 2018, 23, 3185
3 of 19
medicinally important plant of the Lycoris genus of the Amaryllidaceae family, a novel C4H encoding
gene was isolated from L. aurea, and designated as LauC4H. Then LauC4H was expressed truncatedly
at the N-terminus in protoplasts of A. thaliana to identify the amino acids responsible for the subcellular
localization. Moreover, in E. coli, LauC4H without the N-terminal membrane anchor region was
heterogeneously expressed for functional identification. PAL1 of A. thaliana was further introduced in
the recombinant E. coli for p-coumaric acid de novo biosynthesis from glucose via the phenylalanine
route. By regulating the level of intracellular NADPH, the production of p-coumaric acid was further
increased by 9.18-fold, and a titer of 156.09 µM was achieved in shake flasks.
2. Results and Discussion
2.1. C4H Homology of L. aurea Transcriptome
Previously, de novo transcriptome sequencing has been performed to produce a comprehensive
expressed sequence tag (EST) dataset for L. aurea using high-throughput sequencing technology [26].
The EST dataset of L. aurea provides a platform be critical in the speeding-up identification of a large
number of related genes of secondary metabolite products. Further batch alignment results revealed
that 226 contigs and unigenes were annotated to be responsible for the phenylpropanoid biosynthetic
pathway. Of them, one unigene, namely unigene CL5217, showing high similarity with plant C4Hs
was retrieved. Unigene CL5217 was 1794 bp with a predicted 1518 bp open reading frame (ORF),
and was selected for further molecular cloning and functional characterization for the biosynthesis of
p-coumaric acid.
2.2. Cloning of Full-length C4H Genes in L. aurea
By quantitative real-time polymerase chain reaction (qRT-PCR) and rapid amplification of cDNA
ends (RACE) approaches, a cDNA encoding C4H homology was isolated from L. aurea. Firstly the
0
0
quantitative PCR primer pairs annealing at the 3 -terminus of the predicted ORF and 3 -untranslational
region were designed and used to determine the abundance of the unigene CL5217 in various tissues
of L. aurea. qRT-PCR results revealed that the level of unigene CL5217 was highest in scape (Figure 2).
Figure 2. The abundance of C4H candidate gene (unigene CL5217) in various tissues of L. aurea.
The values and error bars represent the mean
three replicates per sample.
±
standard error from three independent samples in

Molecules 2018, 23, 3185
4 of 19
Then, based on the sequence of unigene CL5217, the predicted ORF was cloned with the cDNA
pool of scape as the template. Four gene variants were obtained with above 99% identity to each
other at the nucleic acid level (Appendix A Figure A1) referring to two protein variants at the amino
acid level (Appendix A Figure A2). Based on the genome size observed by flow cytometry, the plant
material L. aurea used in this study is diploid (2n = 16) [27]. Therefore, a number of C4H paralogs were
expected in the genome of L. aurea. Moreover, the plant used in this study was flowering and the bulb
has been vegetatively propagated. For these reasons, the existence of multiple similar C4H transcripts
was not surprising. This phenomenon was also reported in cloning the coding genes of norbelladine
40-O-methyltransferase and para-para’ C–C phenol coupling CYP450 in the Amaryllidaceae plant
Narcissus sp. aff. pseudonarcissus [28,29]. The deduced LauC4H protein (variant 1) had a predicted
molecular mass of 58.19 kDa and pI of 9.04.
LauC4H possessed all the diagnostic features of the primary structure for CYP450s as well as
the CYP73A subfamily. A hydrophobic membrane-spanning region was predicted in the N-terminus
of LauC4H between amino acid residues 9 and 26 by TMpred online program (Swiss Institute of
Bioinformatics (SIB), Lausanne, Switzerland) and SignalP 3.0 server [30]. Following the N-terminal
transmembrane sequence, a proline-rich region (PPGPLPVP) was present (Figure 3A). A conserved
heme-binding motif (PFGVGRRSCPG) was also found near the C-terminus of LauC4H (Figure 3A).
In addition, the “PERF” consensus sequence and some conserved helices such as I-helix (AAIET),
J-helix (PDIQQKLRNE), K-helix (KETLR) and K’-helix (AWWLANN) were also identified in LauC4H
sequence (Figure 3A). In the homologous tree, plant C4Hs were grouped into two classes as that implied
by the differential N-terminus and C-terminus in the amino acid sequence alignment (Figure 3A,B),
and LauC4H showed higher identity with the C4Hs of Class I than those of Class II (Figure 3B).
Figure 3. Sequence alignment (A) and homology analysis (B) of the full-length amino acid sequence of
LauC4H with other C4Hs reported in A. thaliana (NP_180607), Glycine max (NP_001237317, XP_003544934,
XP_003555891), Nicotiana tabacum (NP_001312254, NP_001312445, NP_001313000, NP_001313097,
XP_016493546, XP_016505655), Oryza sativa Japonica (XP_015623447, XP_015626579, XP_015635394,
XP_015639656), Sorghum bicolor (XP_002452044, XP_002458683, XP_002461939) and Zea mays (NP_001140681,
NP_001140726, NP_001151365, XP_008657127). GenBank accession numbers are indicated in parentheses.
The threshold for shading in panel A was 100%. CYP98A3 (NP_850337) from A. thaliana and CYP96T1
(AMO65741) from Narcissus sp. aff. pseudonarcissus were additionally analyzed in panel B.

Molecules 2018, 23, 3185
5 of 19
2.3. Subcellular Localization of LauC4H
Further, an investigation of the subcellular localization of LauC4H in plant cells was carried
out. LauC4H was firstly predicted to localize in the ER using the WoLF PSORT program [31], and
its N-terminal sequence was considered responsible for anchoring to the membrane using the online
software TMpred (SIB) and SignalP 3.0 [30]. Then, the whole ORF and the truncated sequences encoding
the N-terminal 28 amino acids (LauC4H1–28) and the LauC4H without the N-terminal 28 amino acids
(LauC4H∆2–28), were fused with the enhanced green fluorescence protein (EGFP) gene, respectively. These
fusion transgenes were transiently expressed in protoplasts prepared from the tender leaf of A. thaliana.
Meanwhile, the fusion protein HDEL-mCherry with red fluorescence was used as the ER marker [32].
In Arabidopsis protoplasts containing LauC4H-EGFP and HDEL-mCherry, the green fluorescence was
present overlapping with the red fluorescence of the ER marker (Figure 4), showing a typical fluorescence
pattern of ER localization. A similar pattern was also observed for the LauC4H1–28-EGFP fusion protein
overlapping with the ER marker, though there was a small portion of green fluorescence not overlapped
with the red fluorescence (Figure 4). In Arabidopsis protoplasts containing LauC4H∆2–28-EGFP, the
fluorescence pattern was distinctly different from those of LauC4H-EGFP and LauC4H1–28-EGFP, and
there was scarcely any overlap between the green fluorescence and the red fluorescence of the ER
marker (Figure 4). Thereby, our observation suggested that the N-terminal 28 amino acids spanning
the hydrophobic transmembrane region was responsible for leading LauC4H to localize in ER of plant
cells. Previous studies showed that the CYP450 redox partners from A. thaliana and hybrid poplar were
localized at the ER membrane of Arabidopsis protoplasts [33,34], those supported the notion that the
N-terminus maybe confer LauC4H to co-localize with the redox partner at the ER membrane and guide
the electron transfer in plant cells (Figure 5A).
GFP
mCherry
Merge
Chlorophyll
LauC4H-EGFP
&
AthHDEL-mCherry
LauC4H1-28-EGFP
&
AthHDEL-mCherry
LauC4H∆2-28-EGFP
&
AthHDEL-mCherry
Figure 4. Subcellular localization of LauC4H. “Green” panels show the fluorescence of LauC4H variants
fused with the enhanced green fluorescent protein (EGFP), “mCherry” panels indicate the fluorescence
of endoplasmic reticulum marker (HDEL), and “Chlorophyll” panels indicate the auto-fluorescence of
chloroplast. “Merged” panels represent the combined fluorescence from EGFP and mCherry. Bars = 10 µm.
2.4. Functional Identification of LauC4H
Given that the oxygenation process of CYP450s requires a redox partner as electron supplier,
the A. thaliana CYP450 redox partner ATR2 was employed for the functional exploration of LauC4H in
E. coli. Since there was no internal ER-like membrane in E. coli, both LauC4H and ATR2 were expressed
heterogenously without the N-terminal membrane anchor region, rather than in the full-length
sequence, thus to avoid the so-called incompatibility between the membrane recognition signal

Molecules 2018, 23, 3185
6 of 19
of heterogenous proteins and the prokaryotic host [25]. In detail, the truncated ATR2 (ATR2∆2–74
)
was fused in the N-terminus of truncated LauC4H (LauC4H∆2–28) via a flexible octapeptide linker
for electron supply (Figure 5B). The linker and the following proline-rich region in LauC4H could
orient optimally between ATR2 and LauC4H [25,35]. When the recombinant E. coli cells harboring
the chimeric ATR2∆2–74-LauC4H∆2–28 protein were incubated with the substrate trans-cinnamic acid,
a new product peak with the same retention time of p-coumaric acid was detected by HPLC analysis
(Figure 5C). UV-Vis absorption spectra confirmed that the new product was identical to p-coumaric
acid (Figure 5D).
A
B
C
D
mAU
1600
1400
1200
1000
800
600
400
200
0
p-coumaric acid standard
conversion sample
208
209
309
309
234
235
248
252
190 210 230 250 270 290 310 330 350 370 390 nm
E
F
30,000
30,000
25,000
20,000
15,000
10,000
5,000
0
25,000
20,000
15,000
10,000
5,000
0
Figure 5. Functional identification of LauC4H. (
of LauC4H and A. thaliana cytochrome P450 reductase 2 (ATR2) in plant cells. (
A
) Diagram of endoplasmic reticulum co-localization
) Heterologous fusion
expression of LauC4H and ATR2 via a flexible linker in E. coli without both N-terminal membrane
B
anchor region. (C
) HPLC analysis of reaction products from pET29a-ATR2∆2–74 (1), pET29a (2),
pET29a-ATR2∆2–74LauC4H.1∆2–28 (3) and pET29a-ATR2∆2–74LauC4H.2∆2–28 (4) using trans-cinnamic
acid as the substrate. Standards (5) refer to HPLC analysis result of standard substance mixture of
p-coumaric acid (a) and trans-cinnamic acid (b). (
standard p-coumaric acid. ( ) LC-MS identification of reaction products generated by recombinant
LauC4H.1 (E) and LauC4H.2 (F).
D) UV absorption spectra of the new product and the
E,F

Molecules 2018, 23, 3185
7 of 19
The corresponding product was further examined using a liquid chromatography-mass
spectrometry (LC-MS) in positive ion mode. LC-MS analysis of the targeted peak of the two LauC4H
paralogs displayed the [M + H]+ ions at m/z 165 (Figure 5E,F), corresponding to the calculated
molecular weight of p-coumaric acid (MW = 164.16). In contrast, no any visible peak with the same
retention time of p-coumaric acid was observed in the conversion systems with ATR2∆2–74 only as
well as the empty vector pET29a, even though, with trans-cinnamic acid as the substrate. These
results indicated that the new product synthesized with the chimeric ATR2∆2–74-LauC4H∆2–28 protein
was p-coumaric acid. Thus, the LauC4H is an authentic trans-cinnamic acid 4-hydroxylase able to
participate the conversion of trans-cinnamic acid into p-coumaric acid with the plant CYP450 redox
partner (Figure 1).
2.5. p-Coumaric Acid De Novo Biosynthesis Using LauC4H in E. coli
For the application of LauC4H to de novo biosynthesize p-coumaric acid, the E. coli cells harboring
the functional chimera ATR2∆2–74-LauC4H∆2–28 were cultured in mineral medium added with glucose
as the sole carbon source. However, no p-coumaric acid was detected (Table 1), indicating that
E. coli could not produce trans-cinnamic acid. When A. thaliana phenylalanine ammonia-lyase 1
(AthPAL1) was further introduced to the E. coli cells mentioned above, p-coumaric acid could be
produced and accumulated in the medium of the recombinant cells with ATR2∆2–74-LauC4H∆2–28 and
AthPAL1 (Table 1). Therefore, the plant CYP450-involved p-coumaric acid biosynthesis pathway has
been successfully established in procaryotic E. coli. Moreover, within a duration of 42 h induction
with IPTG, the recombinant E. coli produced 17.22 µM of p-coumaric acid. The expression level
and solubility of the chimeric ATR2∆2–74-LauC4H∆2–28 fusion protein were detected in Ec/LauC4H
and Ec/LauC4H-AthPAL (Figure A3). As shown in Figure A3, the expression level of the chimeric
ATR2∆2–74-LauC4H∆2–28 fusion protein in Ec/LauC4H was more than that in Ec/LauC4H-AthPAL.
However, the level of the soluble ATR2∆2–74-LauC4H∆2–28 fusion protein was comparable between
Ec/LauC4H and Ec/LauC4H-AthPAL. Comparably, E. coli cells only with AthPAL1 or PAL/TAL from
the yeast Rhodotorula glutinis (RglPAL/TAL) [18] were also cultured as controls. In cells only with
AthPAL1, trans-cinnamic acid rather than p-coumaric acid was detected in the medium (Table 1). In cells
only with RglPAL/TAL, both trans-cinnamic acid and p-coumaric acid were accumulated, of which
the concentration was 91.94 µM and 46.09 µM, respectively (Table 1). Notably, there was 342.82 µM of
trans-cinnamic acid detected in the medium of the recombinant cells with ATR2∆2–74-LauC4H∆2–28 and
AthPAL1 (Table 1).
1
Table 1. p-Coumaric acid de novo biosynthesis using LauC4H in E. coli.
Glucose
Utilization (g/L)
trans-Cinnamic
Acid (µM)
p-Coumaric
Acid (µM)
Strain
Biomass (OD600)
ND 2
ND 2
Ec/LauC4H
Ec/AthPAL
Ec/RglPAL(TAl)
5.56 ± 0.72
8.92 ± 0.85
9.73 ± 1.24
7.66 ± 0.83
13.50 ± 0.72
24.50 ± 0.65
25.08 ± 0.75
24.78 ± 1.26
ND 2
241.32 ± 13.24
91.94 ± 6.32
342.82 ± 15.80
46.09 ± 2.96
17.22 ± 1.23
2
Ec/LauC4H-AthPAL
1
The data represent the mean
not detected.
±
the standard error from three independent experiments of each strain. ND,
2.6. p-Coumaric Acid Production Improved by Intracellular NADPH Regulation
The biochemical process of LauC4H catalysis of the conversion of trans-cinnamic acid into
p-coumaric acid needs two electrons per mole of substrate. ATR2 as a CYP450 redox partner is
NADPH-dependent [33,34]. Since we observed that about 20-fold the substrate of LauC4H still existed
in the medium of strain Ec/LauC4H-AthPAL (Table 1), we were assuming that the output of p-coumaric
acid was subjected to the level of intracellular NADPH (Figure 1). For testing this assumption,
we attempted to elevate the level of intracellular NADPH. Using synthetic small regulatory RNA

Molecules 2018, 23, 3185
8 of 19
(srRNA) anti(sthA) [36] to specific repression of the translation of the soluble transhydrogenase SthA
(also referred to as UdhA) [37], the conversion of NADPH to NADH may be down-regulated when
treated with anti(sthA) so that the content of NADPH would be relatively enhanced. As shown in
Figure 6, the introduction of the srRNA anti(sthA) accelerated cell growth and glucose utilization,
and resulted in about 2-fold increase of the p-coumaric acid production. In addition, we also pursued
overexpression of the membrane-bound transhydrogenase PntAB catalyzing the NADH to NADPH
conversion [37]. When the overexpression of five-copy pntAB driven by a T7 promoter took place, the
production of p-coumaric acid was dramatically improved by 7.93-fold up to 136.53 µM (Figure 6C).
Both over-expressed PntAB and srRNA anti(sthA) resulted in a 9.18-fold increase, along with relative
lower biomass and slower glucose consumption. Thus over-expressed PntAB and srRNA anti(sthA)
played a synergetically positive effect on the de novo biosynthetic production of LauC4H-mediated
p-coumaric acid. The expression level and solubility of the chimeric ATR2∆2–74-LauC4H∆2–28 fusion
protein in those p-coumaric acid producers were comparable (Figure A3). Under such circumstance,
there was a considerable amount of trans-cinnamic acid yet in the medium, indicating that the chimera
ATR2∆2–74-LauC4H∆2–28 was involved in a rate-limiting step for the formation of p-coumaric acid
besides NADPH. Subsequently, there should be more approaches to be tested for improving the
output of p-coumaric acid in E. coli. For example, the turnover of LauC4H could be enhanced either by
increasing the expression level of the chimera or by modulating the spatial structure of the chimera
using modularized bioengineering tools in synthetic biology.
A
B
C
D
Figure 6. Regulation of intracellular NADPH to improve the p-coumaric acid production.
(A) cell growth; ( ) glucose utilization; ( ) p-coumaric acid biosynthesis; ( ) trans-cinnamic acid
B
C
D
accumulation. The p-coumaric acid producers were Ec/LauC4H-AthPAL-sRNA (black square),
Ec/LauC4H-AthPAL-anti(sthA) (red circle), Ec/LauC4H-AthPAL-PntAB (magenta triangle), and
Ec/LauC4H-AthPAL-PntAB-anti(sthA) (blue diamond). The error bars represent the standard error of
the mean from three independent experiments of each strain.

Molecules 2018, 23, 3185
9 of 19
3. Materials and Methods
3.1. Plant Materials and Chemicals
The Lycoris aurea plants used in this study were collected from Nanjing Botanical Garden Mem.
Sun Yat-Sen (Nanjing, China), and were about three-year old when the flowers bloom unless otherwise
stated. A. thaliana wild-type (Columbia ecotype) plants used in this study were grown at 22 ◦C for
four weeks after germination. Chemicals and reagents used in this study were purchased from either
Sigma-Aldrich (St. Louis, MO, USA) or Sangon Biotech (Shanghai, China).
3.2. RNA Extraction and Isolation of LauC4H Genes
Total RNA from different tissues of L. aurea were extracted using the RNAprep pure Plant Kit
(TIANGEN, Beijing, China). The cDNA pool was then synthesized by PrimerScriptTM RT reagent Kit
(TaKaRa, Dalian, China). To quantify the unigene CL5217 expression in different tissues, quantitative
real-time polymerase chain reaction (qRT-PCR) was performed using AceQ® qPCR SYBR® Green
Master Mix (High ROX Premixed) (Vazyme Biotech, Nanjing, China) with the gene LauTIP41 as
internal reference [38]. To obtain desired sequences, 50- and 30- rapid-amplification of cDNA ends
(RACE) were carried out using the SMARTerTM RACE cDNA Amplification Kit (Clontech Laboratories,
Inc., Mountain View, CA, USA) according to the manufacturer’s manual. The full-length cDNA were
verified by re-amplification of the open reading frame (ORF) using forward primer LauC4H-ORF-PF
◦
and reverse primer LauC4H-ORF-PR. PCR protocols were as follows: one cy◦cle of 5 min at 98 C;
◦
30 cycles with a denaturing time of 45 s at 95 C, an annealing time of 45 s at 56 C, and an elongation
◦
◦
time of 90 s at 72 C; and a final elongation step of 10 min at 72 C. The PCR products of expected size
were excised from the EtBr-stained 1% (w/v) agarose gels, purified using the DNA Gel Extraction Kit
(BioTeke Corporation, Beijing, China) and ligated into the pMD19-T vector (TaKaRa) for sequencing.
Each of the transcripts was obtained from at least three different monoclones. The primers used in this
experiment are listed in Appendix A Table A1.
3.3. Sequence Aanalysis of LauC4H
The open reading frames (ORFs) in the obtained cDNA sequences were searched and the
correspondingly encoded protein sequences were exported on NCBI ORFfinder webpage (https:
//www.ncbi.nlm.nih.gov/orffinder/) (Bethesda, MD, USA). Then, homology search of the predicted
protein were performed using regular blastp on NCBI BLAST webpage (https://blast.ncbi.nlm.nih.
gov/Blast.cgi) (Bethesda, MD, USA). Molecular mass and isoelectric point of translated proteins were
predicted on the SIB Bioinformatics Resource Portal ExPASy (https://www.expasy.org/) (Lausanne,
Switzerland). The subcellular localization in plant cells was predicted using the WoLF PSORT program
(https://wolfpsort.hgc.jp/) [31]. The prediction of signal sequence and transmembrane sequence was
carried out using the SignalP 3.0 Server (http://www.cbs.dtu.dk/services/SignalP-3.0/) [30] and the
TMpred online program (https://embnet.vital-it.ch/software/TMPRED_form.html) (SIB). Amino
acid sequences of full-length C4Hs were aligned and analyzed by the BioEdit Sequence Alignment
Editor Version 7.1.3.0 [39] and the ClustalW program (SIB), respectively. The homologous tree was
constructed via the software DNAMAN Version 8 (Lynnon Corporation, San Ramon, CA, USA).
3.4. Subcellular Localization Analysis of LauC4H
To determine the subcellular localization of LauC4H, enhanced green fluorescent protein
(EGFP) was in frame fused to the C-terminus of the LauC4H protein sequence under the control
of the dual cauliflower mosaic virus (CaMV) 35S promoter in the pAN580 vector. The plasmid
pAN580 was digested by NcoI (TaKaRa, Dalian, China). The DNA fragments without termination
codon encoding full-length LauC4H, N-terminal 28 amino acids of LauC4H (LauC4H1–28) and
N-terminal truncated LauC4H (LauC4H∆2–28) were prepared with primer pairs pAN580-LauC4H-PF
and EGFP-LauC4H-PR, primer pairs pAN580-LauC4H-PF and EGFP-LauC4H(N28)-PR, and primer

Molecules 2018, 23, 3185
10 of 19
pairs pAN580-LauC4H(
∆
N28)-PF and EGFP-LauC4H-PR, respectively. The DNA fragments were
assembled to linear pAN580 by ClonExpress One Step Cloning Kit (Vazyme Biotech) to create
pDual35S::LauC4H-EGFP, pDual35S::LauC4H1–28-EGFP and pDual35S::LauC4H∆2–28-EGFP. Primers
used to make these constructs were designed according to the product manual and are listed in
Appendix A Table A1. The well-established fluorescent protein marker mCherry-HDEL [32] was
used for the indication of the endoplasmic reticulum (ER). All transient expression constructs were
transformed separately into Arabidopsis protoplasts with the mCherry-HDEL construct according
to the method [40]. The transformed samples were incubated for 16–18 h before examination.
Fluorescent images were observed by a laser scanning confocal microscope using a Zeiss LSM780
camera (Carl Zeiss Microscopy GmbH, Jena, Germany).
3.5. Heterologous Expression of LauC4H in Escherichia coli
Escherichia coli Top10 was used as the host for molecular cloning. For gene expression in E. coli,
Novagen®’s pET29a vector (EMD Millipore Corporation, Darmstadt, Germany) was used and digested
by NdeI and XhoI (TaKaRa). The DNA fragment encoding N-terminal truncated LauC4H (LauC4H∆2–28
)
were amplified with primer pairs 29aNdeI-LauC4H(
encoding the cytochrome P450 redox partner ATR2 without N-terminal 74 amino acids (ATR2∆2–74
was obtained with the primer pairs 29aNdeI-ATR2( N74)-PF and 29aXhoI-ATR2-PR from A. thaliana
∆N28)-PF and 29aXhoI-LauC4H-PR. The DNA
)
∆
cDNA pool as the template. The DNA fragments was assembled to linear pET29a by ClonExpress One
Step Cloning Kit (Vazyme Biotech) to create pET29a-LauC4H∆2–28 and pET29a-ATR2∆2–74. To express
LauC4H functionally in E. coli, the truncated ATR2 with a short flexible octapeptide (GSTSSGSG)
was prepared with the primer pairs 29aNdeI-ATR2(
∆N74)-PF and LauC4H(∆N28)ATR2-PR, and
was in frame fused to the N-terminus of LauC4H∆2–28 into the NdeI site of pET29a-LauC4H∆2–28
by ClonExpress One Step Cloning Kit (Vazyme Biotech) to create pET29a-ATR2∆2–74LauC4H∆2–28
Primers used to make these constructs are listed in Appendix A Table A1. E. coli Rosetta (DE3)
(Vazyme Biotech) was used as the host for protein expression. Freshly transformed E. coli Rosetta
(DE3) cells harboring pET29a-derived plasmids were grown at 37 ◦C and 220 rpm in M9Y minimal
.
−1
medium [41] with 20 g L glucose as carbon source to A600 of 0.6–0.8, and then were induced with 0.1
mM isopropyl-β-D-thiogalactoside (IPTG) at 28 ◦C overnight.
3.6. Bioconversion of LauC4H with trans-Cinnamic Acid
Whole-cell bioconversion strategy was adopted to identify the function of LauC4H. 50 mL
◦
cell cultures were harvested by centrifugation at 8000 rpm and 4 C for 5 min, washed twice and
re-suspended in 40 mL nitrogen-free M9Y mineral medium. The re-suspended cells were added
µ
20 g L−1 glucose and 100 M trans-cinnamic acid, and incubated at 28 ◦C with a stirring rate of 250
rpm for the whole-cell bioconversion. Samples were taken with an interval of 12 h, an equal volume of
methanol was added to terminate the reaction and the samples were then subjected to HPLC analysis.
3.7. p-Coumaric Acid De Novo Biosynthesis in E. coli
To in vivo biosynthesize the substrate of LauC4H in E. coli cells, the AthPAL1 gene encoding
A. thaliana phenylalanine ammonia lyase 1 was overexpressed in pACYC184 vector [42,43] under
a trc promoter induced by IPTG. For gene overexpression, pACYC184 was digested by NcoI and
EcoRI (TaKaRa, Dalian, China) to get the plasmid skeleton with p15A origin of replication and
tetracycline-resistant gene. Primer pairs 184-trc-lacO-PF and BBa_B0034-lacO-PR were annealed and
elongated, and then purified to obtain the DNA fragment trcO-RBS containing the core-trc promoter
(
−
10 box and
−
35 box), lacI binding site and the BioBrick ribosome binding site (RBS) BBa_B0034
chosen from the MIT Registry of Standard Biological Parts (http://parts.igem.org/Main_Page)
(The International Genetically Engineered Machine (iGEM), Cambridge, MA, USA). Primer pairs
BBa_B0034-BBa_B0015-PF and 184-BBa_B0015-PR were annealed and elongated, and then purified to
obtain the DNA fragment BBa_B0015 containing the BioBrick terminator BBa_B0015 also chosen

Molecules 2018, 23, 3185
11 of 19
from the MIT Registry of Standard Biological Parts (iGEM, Cambridge, MA, USA). The three
fragments, plasmid skeleton, trcO-RBS and BBa_B0015 terminator, sharing the overlap one by one,
were assembled together by ClonExpress Ultra One Step Cloning Kit (Vazyme Biotech). The new
plasmid was named as p15A-trcO3415. Then, the AthPAL1 gene was amplified from the A. thaliana
cDNA pool with primers BBa_B0034-AthPAL1-PF and BBa_B0015-AthPAL1-PR and assembled into
the linear p15A-trcO3415 by NdeI restriction endonuclease (TaKaRa) via ClonExpress One Step
Cloning Kit (Vazyme Biotech) to create p15A-trcOAthPAL1. Then p15A-trcOAthPAL1 along with
the plasmid pET29a-ATR2∆2–74LauC4H∆2–28 were transformed into E. coli Rosetta (DE3) cells to
obtain the recombinant strain Ec/LauC4H-AthPAL. The empty vector p15A-trcO3415 along with
the plasmid pET29a-ATR2∆2–74LauC4H∆2–28 were transformed into E. coli Rosetta (DE3) cells to obtain
the recombinant strain Ec/LauC4H. The plasmid p15A-trcOAthPAL1 along with the empty vector
pET29a were transformed into E. coli Rosetta (DE3) cells to obtain the recombinant strain Ec/AthPAL.
The primers involved in this experiment are summarized in Appendix A Table A1.
The DNA sequence encoding the PAL/TAL from the yeast Rhodotorula glutinis [18] was
optimized according to the codon preference of E. coli, and synthesized on the clone vector
pUC57 to obtain pUC57-OptRglPAL/TAL plasmid by Sangon Biotech (Shanghai) Co., Ltd (Shanghai,
China). The RglPAL/TAL gene was amplified from the plasmid pUC57-OptRglPAL/TAL with primers
BBa_B0034-RglPAL/TAL-PF and BBa_B0015-RglPAL/TAL-PR and assembled into the linear p15A-trcO3415
by NdeI restriction endonuclease (TaKaRa) via ClonExpress One Step Cloning Kit (Vazyme Biotech) to create
p15A-trcORglPAL/TAL. Then p15A-trcORglPAL/TAL plasmid along with the empty vector pET29a were
transformed into E. coli Rosetta (DE3) cells to obtain the recombinant strain Ec/RglPAL(TAL). The primers
are summarized in Appendix A Table A1 and the optimized DNA sequence of RglPAL/TAL was shown
in Appendix A Figure A4.
A single clone of the recombinant E. coli strains was incubated in 3 mL LB medium for 24 h.
Then 1 mL of the cell cultures was collected, the supernatant was discarded, and the cell pellet was
◦
transferred into 50 mL fermentation medium and grown at 37 C and 200 rpm. The fermentation
medium contains 100 mM 3-(N-morpholino)propanesulfonic acid (MOPS), 28.71 mM K2HPO4,
25.72 mM KH2PO4, 26.50 mM (NH4)2HPO4, 10.00 mM citric acid, 5.00 mM MgSO4, 1
µ
g L−1 vitamin
B1, 0.5
µ
g L−1 biotin, 166.67 mM glucose, 0.02 mM phenol red, and 10 mL trace element solution.
The trace element solution was prepared in 100 mM HCl with 36.00 mM FeSO4, 7.82 mM ZnSO4,
4.00 mM CuSO4, 2.00 mM MnSO4, 0.60 mM Na2B4O7, 13.60 mM CaCl2, and 0.08 mM (NH4)6MO7O24.
◦
The cells were induced with 0.1 mM IPTG at 30 C when grown to A600 of 0.6–0.8. The pH in the
medium was maintained at about 7.0 by adding ammonium hydroxide aperiodically. Samples were
taken with an interval of 6 h and analyzed by HPLC.
3.8. Intracellular NADPH Regulation
For down-regulation of EcoSthA gene, the synthetic sRNA-based strategy [36] was applied.
The plasmid skeleton with pSC101 origin of replication and spectinomycin-resistant gene was obtained
from pCL1920 [44] as previously described [45]. The PR-MicC fragment including the constitutive PR
promoter and the MicC scaffold was amplified from the wild-type E. coli MG1655 genome with primer
pairs BBa_R0051-MicC-PF and BBa_B0015-MicC-PR. The BBa_B0015 terminator was amplified from the
plasmid p15A-trcO3415 with primer pairs BBa_B0015-PF and BBa_B0015-PR. The PR-MicC-BBa_B0015
fragment was amplified with primer pairs pCL-BBa_R0051-PF and pCL-BBa_B0015-PR from both
of PR-MicC fragment and BBa_B0015 terminator as the template. Then, the plasmid skeleton
and the PR-MicC-BBa_B0015 fragment were assembled by ClonExpress One Step Cloning Kit
(Vazyme Biotech) to construct the new plasmid pSC101-sRNA for synthetic sRNA production.
Subsequently, the N-terminal 24 bp of EcoSthA gene was obtained by annealing and elongation
with primer pairs anti(sthA)-PF and anti(sthA)-PR, and assembled into the linear pSC101-sRNA by
NsiI restriction endonuclease (TaKaRa) via ClonExpress One Step Cloning Kit (Vazyme Biotech) to
create pSC101-anti(sthA).

Molecules 2018, 23, 3185
12 of 19
For appropriate overexpression of NAD(P) transhydrogenase, the two genes EcopntAB
were overexpressed with their native ribosome binding sites under a constitutive T7 promoter
and transcriptionally terminated by the BioBrick terminator BBa_B1006 also chosen from
the MIT Registry of Standard Biological Parts (iGEM, Cambridge, MA, USA). The EcopntAB
DNA fragment was amplified from the wild-type E. coli MG1655 genome with primer
pairs pCL-T7-pntA-PF and pCL-BBa_B1006-pntB-PR, and assembled into the KpnI (TaKaRa)
digested pSC101-sRNA and pSC101-anti(sthA) via ClonExpress One Step Cloning Kit
(Vazyme Biotech) to create pSC101-OE(pntAB) and pSC101-anti(sthA)-OE(pntAB), respectively.
Then pSC101-sRNA, pSC101-anti(sthA), pSC101-OE(pntAB) and pSC101-anti(sthA)-OE(pntAB),
respectively, was transformed into strain Ec/LauC4H-AthPAL cells to obtain the recombinant
strain Ec/LauC4H-AthPAL-sRNA, Ec/LauC4H-AthPAL-anti(sthA), Ec/LauC4H-AthPAL-PntAB, and
Ec/LauC4H-AthPAL-PntAB-anti(sthA).
3.9. Protein Detection
Cells induced for 12 h were harvested by centrifugation at 8000 rpm for 5 min at 4 ◦C, washed
twice with TNG buffer (20 mM Tris-HCl pH 7.9, 0.5 M NaCl, 10% Glycerol), and re-suspended in
the same buffer containing 1 mM phenylmethylsulfonyl fluoride (PMSF). The suspended cells were
◦
sonicated on ice-bath followed by centrifugation at 12,000 rpm for 30 min at 4 C. The supernatant was
transferred out, and the sediment was re-suspended in the PMSF-contained TNG buffer. Proteins were
assessed by SDS-PAGE.
3.10. High Performance Liquid Chromatography (HPLC) Analysis
All samples taken from the cultures were centrifuged at 12,000 rpm for 2 min and the
supernatants were filtered through a 0.22
HPLC (Shimadzu LC-20A, Kyoto, Japan) with a reverse phase Shimadzu InertSustain C18 column
(5
µm polytetrafluorethylene (PTFE) filter and analyzed by
µ
m, 4.6 mm × 250 mm) and a Shimadzu SPD-M20A photodiode array detector. The mobile phase
used was a gradient of solvent A (H2O containing 1.3% acetic acid) and solvent B (100% acetonitrile)
applied as following time procedure: 0–20 min, 10–100% B linear; 20–20.5 min, 100%–10% linear;
20.5–30 min, 10% B isocratic. The flow r◦ate was set at 1.0 mL
·
min−1, and the injection volume was
1
0 µL. The column was maintained at 35 C, and the eluted compounds were monitored at 309 nm for
p-coumaric acid and at 274 nm for trans-cinnamic acid respectively. The concentration of trans-cinnamic
acid and p-coumaric acid were quantified by fitting the peak area with a standard curve (R2 > 0.999) of
the corresponding standard.
4. Conclusions
In the present study, p-coumaric acid was de novo produced via the plant CYP450-involved
biosynthetic route in Escherichia coli. Firstly, a novel CYP73A from the Amaryllidaceae plant
Lycoris aurea was cloned based on the transcriptome data, of which the N-terminal 28 amino acids
were characterized responsible for localizing at the endoplasmic reticulum membrane in protoplasts of
Arabidopsis thaliana. Then, LauC4H was expressed functionally in E. coli when fused with the CYP450
redox partner from A. thaliana, and shown to catalyze the conversion of trans-cinnamic acid into
p-coumaric acid. Further, p-coumaric acid was de novo biosynthesized via introducing a phenylalanine
ammonia-lyase from A. thaliana into the recombinant E. coli cells. The production of p-coumaric acid
was dramatically improved via regulation of the intracellular NADPH level of the constructed cell
factory. The producer reported herein afforded a promising chassis for the biosynthesis of p-coumaric
acid-derived molecules with great application value.
Author Contributions: Conceptualization, Y.L. and R.W.; Data Curation, Y.L. and J.L.; Formal Analysis, Y.L. and
J.L.; Funding Acquisition, Y.L. and R.W.; Investigation, Y.L., J.L., B.Q. and L.C.; Methodology, Y.L., J.L., B.Q.,
L.C. and S.X.; Project Administration, R.W.; Resources, J.L., B.Q. and L.C.; Software, Y.L. and S.X.; Supervision,

Molecules 2018, 23, 3185
13 of 19
Y.L. and R.W.; Validation, J.L. and B.Q.; Visualization, Y.L. and J.L.; Writing-Original Draft Preparation, Y.L.;
Writing-Review & Editing, Y.L., J.L. and R.W. All authors revised and approved the manuscript.
Funding: This work was financially supported by a research grant from the National Natural Science Foundation
of China (NOs. 31600074 and 31770387), a grant from the Natural Science Foundation of Jiangsu Province
(
NO. BK20160599) and a grant from the Jiangsu Key Laboratory for the Research and Utilization of Plant Resources
(NO. JSPKLB201837).
Conflicts of Interest: The authors declare no conflict of interest.
Appendix A
Figure A1. Coding sequence alignment of LauC4H variants. Four unique variants of LauC4H gene are
aligned against the original sequence predicted by the de novo assembled transcriptome. Dots are
identical bases.

Molecules 2018, 23, 3185
14 of 19
Figure A2. Protein sequence alignment of LauC4H variants. Four unique variants of LauC4H protein
are aligned against the original sequence predicted by the de novo assembled transcriptome. Dots are
identical residues.
Strain 1
Strain 2
Strain 3
Strain 4
Strain 5
Strain 6
M
W P I P
S P W P I P
S P W P I P
S P
M
W P I P
S P W P I P
S P W P
I P S P
180 KDa
130 KDa
95 KDa
Figure A3. The expression level and solubility of the chimeric ATR2∆2–74-LauC4H∆2–28 fusion
protein in the p-coumaric acid producers. Strain 1, Ec/LauC4H; Strain 2, Ec/LauC4H-AthPAL;
Strain 3, Ec/LauC4H-AthPAL-sRNA; Strain 4, Ec/LauC4H-AthPAL-PntAB; Strain 5,
Ec/LauC4H-AthPAL-anti(sthA); Strain 6, Ec/LauC4H-AthPAL-PntAB-anti(sthA). KDa, kilodalton;
M, protein marker; WP, whole-cell proteins; IP, insoluble proteins; SP, soluble proteins. The arrows
indicated the chimeric ATR2∆2–74-LauC4H∆2–28 fusion protein.

Molecules 2018, 23, 3185
15 of 19
Figure A4. The codon-optimized DNA sequence of the yeast Rhodotorula glutinis PAL/TAL.

Molecules 2018, 23, 3185
16 of 19
1
Table A1. Oligonucleotides used in this study.
0
0
Name
Sequence (5 to 3 )
RT-PCR
RT-LauC4H-PF
RT-LauC4H-PR
RT-LauTIP41-PF
RT-LauTIP41-PR
cDNA cloning
LauC4H-ORF-PF
LauC4H-ORF-PR
AAGGGAAGCTTGATACCACTGAGAA
GACAAATTAGAACAGTCTAGGCTTGGC
GCAACCATCCAAAGTTTAACTGCT
AATGTGCAAGCAGGGCTAGTAA
ATCCTCCTCCTCCGACGAAATG
AGAGTACATTGCATGGGTAATAAGGAG
GAACTCGACCCCTTGTGTGTGC
GGCTATGACATCCCCGCTGA
0
LauC4H-5 RACE-PR
0
LauC4H-3 RACE-PF
Subcellular localization
pAN580-LauC4H-PF
EGFP-LauC4H-PR
EGFP-LauC4H(N28)-PR
pAN580-LauC4H(∆N28)-PF
Functional expression
29aNdeI-LauC4H(∆N28)-PF
AGGACCGGTCCCGGGGGATCCATGGATCTCATTCTACTAGAAAAGTCACTC
TCCTCGCCCTTGCTCACCATGAACAGTCTAGGCTTGGCCACAATG
TCCTCGCCCTTGCTCACCATCCCGCGGAGTTTGGATATTATGAT
AGGACCGGTCCCGGGGGATCCATGAAGAAGCTTAAGCTCCCCCCGG
AACTTTAAGAAGGAGATATACATATGAAGAAGCTTAAGCTCCCCCCGG
AGTGGTGGTGGTGGTGGTGCTCGAGTTAGAACAGTCTAGGCTTGGCCAC
AATG
29aXhoI-LauC4H-PR
29aNdeI-ATR2(∆N74)-PF
29aXhoI-ATR2-PR
AACTTTAAGAAGGAGATATACATATGTCCGGTTCTGGGAATTCAAAA
AGTGGTGGTGGTGGTGGTGCTCGAGTGAGTGTGTGGCTTCAATAGTTTCG
CCGGGGGGAGCTTAAGCTTCTTCATACCAGAACCAGAAGAGGTAGAACC
CCATACATCTCTAAGATATCTTCCACTCGTTTG
LauC4H(∆N28)ATR2-PR
De novo biosynthesis
184-trc-lacO-PF
GCCTTGCGTATAATATTTGCCCATGGTTGACAATTAATCA
TCCGGCTCGTATAATGTGTGGAATTGTGAGCGG
CATATGTATTTCTCCTCTTTAGATCTGGAATTGTTATCCGCTCA
CAATTCCACACATTATAC
ATCTAAAGAGGAGAAATACATATGCTCGAGTAACCAGGCATCAA
ATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTAT
CTG TTGTTTGTCGGTGAACGCTCTCTACTA
BBa_B0034-lacO-PR
BBa_B0034-BBa_B0015-PF
184-BBa_B0015-PR
GCCCGCCTGATGAATGCTCATCCGGAATTCTATAAACGCAGAAAGGCCC
ACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGTTCACCGACAAA
ATCTAAAGAGGAGAAATACATATGGAGATTAACGGGGCACACAA
TTATTTGATGCCTGGTTACTCGAGACTTTATGGTAAGAAAAAAACAGAGGAC
ATCTAAAGAGGAGAAATACATATGGCGCCGCGTCCGACCAGCCA
TTATTTGATGCCTGGTTACTCGAGTTACGCCAGCATTTTCAGCAGA
BBa_B0034-AthPAL1-PF
BBa_B0015-AthPAL1-PR
BBa_B0034-RglPAL/TAL-PF
BBa_B0015-RglPAL/TAL-PR
NADPH regulation
TATTTTACCTCTGGCGGTGATAATGGTTGCATGCATTTTCTGTTGGGCCATTGC
ATTGC
CGTTTTATTTGATGCCTGGCTCGAGAAAAAAAGCCCGGACGACTGTTC
GCCAGGCATCAAATAAAACG
BBa_R0051-MicC-PF
BBa_B0015-MicC-PR
BBa_B0015-PF
BBa_B0015-PR
TATAAACGCAGAAAGGCCCAC
ACCCGTCTTACTGTCGGGAATTCTAACACCGTGCGTGTT
pCL-BBa_R0051-PF
GACTATTTTACCTCTGGCGGTGAT
pCL-BBa_B0015-PR
anti(sthA)-PF
ACGTTGTAAAACGACGGCCAGTGGTACCTATAAACGCAGAAAGGCCCAC
CCTCTGGCGGTGATAATGGTTGCATCGTAATCGTAGGAATGTGGCAT
ATGCAATGGCCCAACAGAAAATGCCACATTCCTACGATTACGAT
GGGCCTTTCTGCGTTTATAGGTACCAAATTAATACGACTCACTATAG
GGGAATCTAGAGGGAATATCATGCGAATTGGCATACC
TTGTAAAACGACGGCCAGTGGATCCAAAAAAAACCCCGCCCTGTCA
GGGGCGGGGTTTTTTTTTAAGCTTGGGTTACAGAGCTTTCAGGATTGC
anti(sthA)-PR
pCL-T7-pntA-PF
pCL-BBa_B1006-pntB-PR
1
The sequences with single underline and double underline are the homologous arms for one-step cloning and the
flexible linker for the protein fusion, respectively.
References
1.
2.
3.
Kaneko, T.; Thi, T.H.; Shi, D.J.; Akashi, M. Environmentally degradable, high-performance thermoplastics
from phenolic phytomonomers. Nat Mater. 2006, 5, 966–970. [CrossRef] [PubMed]
Jaganathan, S.K.; Supriyanto, E.; Mandal, M. Events associated with apoptotic effect of p-coumaric acid in
HCT-15 colon cancer cells. World J. Gastroenterol. 2013, 19, 7726–7734. [CrossRef] [PubMed]
Scheepens, A.; Bisson, J.-F.; Skinner, M. p-Coumaric acid activates the GABA-A receptor in vitro and is orally
anxiolytic in vivo. Phytother Res. 2014, 28, 207–211. [CrossRef] [PubMed]

Molecules 2018, 23, 3185
17 of 19
4.
5.
6.
7.
8.
Navaneethan, D.; Rasool, M. p-Coumaric acid, a common dietary polyphenol, protects cadmium
chloride-induced nephrotoxicity in rats. Ren. Fail. 2014, 36, 244–251. [CrossRef] [PubMed]
Yoon, H.S.; Lee, N.H.; Hyun, C.G.; Shin, D.B. Differential effects of methoxylated p-coumaric acids on
melanoma in B16/F10 cells. Prev. Nutr. Food Sci. 2015, 20, 73–77. [CrossRef] [PubMed]
Sakamula, R.; Thong-Asa, W. Neuroprotective effect of p-coumaric acid in mice with cerebral ischemia
reperfusion injuries. Metab. Brain Dis. 2018, 33, 765–773. [CrossRef] [PubMed]
Huang, Q.; Lin, Y.; Yan, Y. Caffeic acid production enhancement by engineering a phenylalanine
over-producing Escherichia coli strain. Biotechnol. Bioeng. 2013, 110, 3188–3196. [CrossRef] [PubMed]
Kawaguchi, H.; Katsuyama, Y.; Danyao, D.; Kahar, P.; Nakamura-Tsuruta, S.; Teramura, H.; Wakai, K.;
Yoshihara, K.; Minami, H.; Ogino, C.; et al. Caffeic acid production by simultaneous saccharification and
fermentation of kraft pulp using recombinant Escherichia coli. Appl. Microbiol. Biotechnol. 2017, 101, 5279–5290.
[CrossRef]
9.
Fowler, Z.L.; Koffas, M.A. Biosynthesis and biotechnological production of flavanones: Current state and
perspectives. Appl. Microbiol. Biotechnol. 2009, 83, 799–808. [CrossRef]
10. Zhao, S.; Jones, J.A.; Lachance, D.M.; Bhan, N.; Khalidi, O.; Venkataraman, S.; Wang, Z.; Koffas, M.A.
Improvement of catechin production in Escherichia coli through combinatorial metabolic engineering.
Metab. Eng. 2015, 28, 43–53. [CrossRef]
11. Li, M.; Kildegaard, K.R.; Chen, Y.; Rodriguez, A.; Borodina, I.; Nielsen, J. De novo production of resveratrol
from glucose or ethanol by engineered Saccharomyces cerevisiae. Metab. Eng. 2015, 32, 1–11. [CrossRef]
[PubMed]
12. Zha, J.; Koffas, M.A.G. Production of anthocyanins in metabolically engineered microorganisms: Current
status and perspectives. Synth. Syst. Biotechnol. 2017, 2, 259–266. [CrossRef] [PubMed]
13. Vanholme, R.; Storme, V.; Vanholme, B.; Sundin, L.; Christensen, J.H.; Goeminne, G.; Halpin, C.; Rohde, A.;
Morreel, K.; Boerjan, W. A systems biology view of responses to lignin biosynthesis perturbations in
Arabidopsis. Plant Cell 2012, 24, 3506–3529. [CrossRef] [PubMed]
14. Achnine, L.; Blancaflor, E.B.; Rasmussen, S.; Dixon, R.A. Colocalization of L-phenylalanine ammonia-lyase
and cinnamate 4-hydroxylase for metabolic channeling in phenylpropanoid biosynthesis. Plant Cell 2004, 16,
3098–3109. [CrossRef] [PubMed]
15. Ehlting, J.; Hamberger, B.; Million-Rousseau, R.; Werck-Reichhart, D. Cytochromes P450 in phenolic
metabolism. Phytochem. Rev. 2006, 5, 239–270. [CrossRef]
16. Vannelli, T.; Xue, Z.; Breinig, S.; Qi, W.W.; Sariaslani, F.S. Functional expression in Escherichia coli of the
tyrosine-inducible tyrosine ammonia-lyase enzyme from yeast Trichosporon cutaneum for production of
p-hydroxycinnamic acid. Enzyme Microb. Technol. 2007, 41, 413–422. [CrossRef]
17. Jendresen, C.B.; Stahlhut, S.G.; Li, M.; Gaspar, P.; Siedler, S.; Förster, J.; Maury, J.; Borodina, I.; Nielsen, A.T.
Highly active and specific tyrosine ammonia-lyases from diverse origins enable enhanced production of
aromatic compounds in bacteria and Saccharomyces cerevisiae. Appl. Environm. Microbiol. 2015, 81, 4458–4476.
[CrossRef]
18. Vannelli, T.; Qi, W.W.; Sweigard, J.; Gatenby, A.A.; Sariaslani, F.S. Production of p-hydroxycinnamic acid
from glucose in Saccharomyces cerevisiae and Escherichia coli by expression of heterologous genes from plants
and fungi. Metab. Eng. 2007, 9, 142–151. [CrossRef]
19. Vargas-Tah, A.; Martínez, L.M.; Hernández-Chávez, G.; Rocha, M.; Martínez, A.; Bolívar, F.; Gosset, G.
Production of cinnamic and p-hydroxycinnamic acid from sugar mixtures with engineered Escherichia coli.
Microb. Cell Fact. 2015, 14, 6. [CrossRef]
20. Trotman, R.J.; Camp, C.E.; Ben-Bassat, A.; DiCosimo, R.; Huang, L.; Crum, G.A.; Sariaslani, F.S.; Haynie, S.L.
Calcium alginate bead immobilization of cells containing tyrosine ammonia lyase activity for use in the
production of p-hydroxycinnamic acid. Biotechnol. Prog. 2007, 23, 638–644. [CrossRef]
21. Rodriguez, A.; Kildegaard, K.R.; Li, M.; Borodina, I.; Nielsen, J. Establishment of a yeast platform strain
for production of p-coumaric acid through metabolic engineering of aromatic amino acid biosynthesis.
Metab. Eng. 2015, 31, 181–188. [CrossRef]
22. Kawai, Y.; Noda, S.; Ogino, C.; Takeshima, Y.; Okai, N.; Tanaka, T.; Kondo, A. p-Hydroxycinnamic acid
production directly from cellulose using endoglucanase- and tyrosine ammonia lyase-expressing Streptomyces
lividans. Microb. Cell Fact. 2013, 12, 45. [CrossRef] [PubMed]

Molecules 2018, 23, 3185
18 of 19
23. Nijkamp, K.; Westerhof, R.G.M.; Ballerstedt, H.; Bont, J.A.M.D.; Wery, J. Optimization of the solvent-tolerant
Pseudomonas putida S12 as host for the production of p-coumarate from glucose. Appl. Microb. Biotechnol.
2007, 74, 617. [CrossRef] [PubMed]
24. Leonard, E.; Yan, Y.; Koffas, M.A.G. Functional expression of a P450 flavonoid hydroxylase for the
biosynthesis of plant-specific hydroxylated flavonols in Escherichia coli. Metab. Eng. 2006, 8, 172–181.
[CrossRef] [PubMed]
25. Leonard, E.; Koffas, M.A. Engineering of artificial plant cytochrome P450 enzymes for synthesis of isoflavones
by Escherichia coli. Appl. Environm. Microb. 2007, 73, 7246–7251. [CrossRef]
26. Wang, R.; Xu, S.; Jiang, Y.; Jiang, J.; Li, X.; Liang, L.; He, J.; Peng, F.; Xia, B. De novo sequence assembly and
characterization of Lycoris aurea transcriptome using GS FLX Titanium platform of 454 pyrosequencing.
PLoS ONE 2013, 8, e60449. [CrossRef] [PubMed]
27. Jiang, Y.; Xu, S.; Han, X.; Wang, R.; He, J.; Xia, B.; Wang, R. Investigation of nuclear DNA contents of Lycoris
species (Amaryllidaceae) with different chromosome number by flow cytometry. Pak. J. Botany. 2017, 49,
2197–2200.
28. Kilgore, M.B.; Augustin, M.M.; May, G.D.; Crow, J.A.; Kutchan, T.M. CYP96T1 of Narcissus sp. aff. pseudonarcissus
catalyzes formation of the para-para’ C–C phenol couple in the Amaryllidaceae alkaloids. Front Plant Sci. 2016, 7,
225. [CrossRef]
29. Kilgore, M.B.; Augustin, M.M.; Starks, C.M.; O’Neil-Johnson, M.; May, G.D.; Crow, J.A.; Kutchan, T.M.
0
Cloning and characterization of a norbelladine 4 -O-methyltransferase involved in the biosynthesis of the
Alzheimer’s drug galanthamine in Narcissus sp. aff. pseudonarcissus. PLoS ONE 2014, 9, e103223. [CrossRef]
30. Bendtsen, J.D.; Nielsen, H.; von Heijne, G.; Brunak, S. Improved prediction of signal peptides: SignalP 3.0.
J. Mol. Biol. 2004, 340, 783–795. [CrossRef] [PubMed]
31. Horton, P.; Park, K.J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT:
Protein localization predictor. Nucleic Acids Res. 2007, 35, W585–W587. [CrossRef] [PubMed]
32. Nelson, B.K.; Cai, X.; Nebenführ, A. A multicolored set of in vivo organelle markers for co-localization studies
in Arabidopsis and other plants. Plant J. 2007, 51, 1126–1136. [CrossRef] [PubMed]
33. Urban, P.; Mignotte, C.; Kazmaier, M.; Delorme, F.; Pompon, D. Cloning, yeast expression, and characterization
of the coupling of two distantly related Arabidopsis thaliana NADPH-cytochrome P450 reductases with P450
CYP73A5. J. Biol. Chem. 1997, 272, 19176–19186. [CrossRef] [PubMed]
34. Ro, D.K.; Ehlting, J.; Douglas, C.J. Cloning, functional expression, and subcellular localization of multiple
NADPH-cytochrome P450 reductases from hybrid poplar. Plant Physiol. 2002, 130, 1837–1851. [CrossRef]
[PubMed]
35. Yamazaki, S.; Sato, K.; Suhara, K.; Sakaguchi, M.; Mihara, K.; Omura, T. Importance of the proline-rich region
following signal-anchor sequence in the formation of correct conformation of microsomal cytochrome P-450s.
J. Biochem. 1993, 114, 652–657. [CrossRef] [PubMed]
36. Na, D.; Yoo, S.M.; Chung, H.; Park, H.; Park, J.H.; Lee, S.Y. Metabolic engineering of Escherichia coli using
synthetic small regulatory RNAs. Nat. Biotechnol. 2013, 31, 170–174. [CrossRef] [PubMed]
37. Sauer, U.; Canonaco, F.; Heri, S.; Perrenoud, A.; Fischer, E. The soluble and membrane-bound
transhydrogenases UdhA and PntAB have divergent functions in nadph metabolism of Escherichia coli.
J. Biol. Chem. 2004, 279, 6613. [CrossRef]
38. Ma, R.; Xu, S.; Zhao, Y.; Xia, B.; Wang, R. Selection and validation of appropriate reference genes for
quantitative real-time PCR analysis of gene expression in Lycoris aurea. Front Plant Sci. 2016, 7, 536. [CrossRef]
39. Hall, T.A. Bioedit: A user-friendly biological sequence alignment editor and analysis program for windows
95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98.
40. Chen, S.; Tao, L.; Zeng, L.; Vega-Sanchez, M.E.; Umemura, K.; Wang, G.L. A highly efficient transient protoplast
system for analyzing defence gene expression and protein-protein interactions in rice. Mol. Plant Pathol. 2006, 7,
417–427. [CrossRef]
41. Fasan, R.; Crook, N.C.; Peters, M.W.; Meinhold, P.; Buelter, T.; Landwehr, M.; Cirino, P.C.; Arnold, F.H.
Improved product-per-glucose yields in p450-dependent propane biotransformations using engineered
Escherichia coli. Biotechnol. Bioeng. 2011, 108, 500–510. [CrossRef] [PubMed]
42. Chang, A.C.; Cohen, S.N. Construction and characterization of amplifiable multicopy DNA cloning vehicles
derived from the p15A cryptic miniplasmid. J. Bacteriol. 1978, 134, 1141–1156. [PubMed]
43. Rose, R.E. The nucleotide sequence of pACYC184. Nucleic Acids Res. 1988, 16, 355. [CrossRef]

Molecules 2018, 23, 3185
19 of 19
44. Lerner, C.G.; Inouye, M. Low copy number plasmids for regulated low-level expression of cloned genes
in Escherichia coli with blue/white insert screening capability. Nucleic Acids Res. 1990, 18, 4631. [CrossRef]
[PubMed]
45. Li, Y.; Li, M.; Zhang, X.; Yang, P.; Liang, Q.; Qi, Q. A novel whole-phase succinate fermentation strategy with
high volumetric productivity in engineered Escherichia coli. Biores. Technol. 2013, 149, 333–340. [CrossRef]
[PubMed]
Sample Availability: Samples of the compounds are not available from the authors.
©
2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).