Discovery of natural alkaloid bouchardatine as a novel inhibitor of adipogenesis/lipogenesis in 3T3-L1 adipocytes

Article abstract of DOI:10.1016/j.bmc.2015.05.057

Bouchardatine (1), a naturally occurring β-indoloquinazoline alkaloid, was synthesized. For the first time, the lipid-lowering effect and mechanism of 1 was investigated in 3T3-L1 adipocytes. Our study showed that 1 could significantly reduce lipid accumulation without cytotoxicity and mainly inhibited early differentiation of adipocyte through proliferation inhibition and cell cycle arrested in dose-dependent manner. Furthermore, the inhibition of early differentiation was reflected by down-regulation of key regulators of adipogenesis/lipogenesis, including CCAAT enhancer binding proteins (C/EBPβ, C/EBPδ, C/EBPα), peroxisome proliferator-activated receptors γ (PPARγ) and sterol-regulatory element binding protein-1c (SREBP-1c), in both of mRNA and protein levels. Subsequently decreasing the protein levels of acetyl CoA carboxylase (ACC), fatty acid synthase (FAS), and stearyl coenzyme A desaturated enzyme 1 (SCD-1), the rate-limited metabolic enzymes of fatty acid synthesis, were also observed. Further studies revealed that 1 persistently activated adenosine 5′-monophosphate (AMP)-activated protein kinase (AMPK) during differentiation, suggesting that the AMPK may be an upstream mechanism for the effect of 1 on adipogenesis and lipogenesis. Our data suggest that 1 can be a candidate for the development of new therapeutic drugs against obesity and related metabolic disorders.

Full text of DOI:10.1016/j.bmc.2015.05.057

Bioorganic & Medicinal Chemistry xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Discovery of natural alkaloid bouchardatine as a novel inhibitor
of adipogenesis/lipogenesis in 3T3-L1 adipocytes
Yong Rao a, Hong Liu a, Lin Gao a, Hong Yu a, Jia-Heng Tan a, Tian-Miao Ou a, Shi-Liang Huang a,
Lian-Quan Gu a, Ji-Ming Ye b, Zhi-Shu Huang a,
⇑
a School of Pharmaceutical Sciences, Yat-sen Sun University, Guangzhou 510006, PR China
b Molecular Pharmacology for Diabetes Group, Health Innovations Research Institute and School of Health Sciences, RMIT University, Melbourne, VIC, Australia
a r t i c l e i n f o
a b s t r a c t
Article history:
Bouchardatine (1), a naturally occurring b-indoloquinazoline alkaloid, was synthesized. For the first time,
the lipid-lowering effect and mechanism of 1 was investigated in 3T3-L1 adipocytes. Our study showed
that 1 could significantly reduce lipid accumulation without cytotoxicity and mainly inhibited early dif-
ferentiation of adipocyte through proliferation inhibition and cell cycle arrested in dose-dependent man-
ner. Furthermore, the inhibition of early differentiation was reflected by down-regulation of key
regulators of adipogenesis/lipogenesis, including CCAAT enhancer binding proteins (C/EBPb, C/EBPd,
Received 24 March 2015
Revised 27 May 2015
Accepted 28 May 2015
Available online xxxx
Keywords:
C/EBPa), peroxisome proliferator-activated receptors c (PPARc) and sterol-regulatory element binding
Bouchardatine
3T3-L1 adipocytes
Lipid lowering
Adipogenesis/lipogenesis
Anti-obesity
protein-1c (SREBP-1c), in both of mRNA and protein levels. Subsequently decreasing the protein levels
of acetyl CoA carboxylase (ACC), fatty acid synthase (FAS), and stearyl coenzyme A desaturated enzyme
1 (SCD-1), the rate-limited metabolic enzymes of fatty acid synthesis, were also observed. Further studies
revealed that 1 persistently activated adenosine 50-monophosphate (AMP)-activated protein kinase
(AMPK) during differentiation, suggesting that the AMPK may be an upstream mechanism for the effect
of 1 on adipogenesis and lipogenesis. Our data suggest that 1 can be a candidate for the development of
new therapeutic drugs against obesity and related metabolic disorders.
Ó 2015 Elsevier Ltd. All rights reserved.
1. Introduction
of adipogenesis by modulating the expression of their target genes
in a coordinated manner.8–12 Moreover, AMPK is one of the most
Obesity has become one of the most common metabolic syn-
dromes, that pose a considerable threat to human health. Obesity
is a serious chronic metabolic health problem that is closely related
to type 2 diabetes, hypertension, cardiovascular diseases, and can-
cer.1–3 In vivo studies have demonstrated that the development of
obesity is characterized by the increase in number and size of
mature adipocytes, which originated from pre-adipocytes and
fibroblasts.4,5
The 3T3-L1 cell line is a well-established model for in vitro
studies on the metabolism of fatty acids and obesity.6 3T3-L1
cell-based screening for beneficial compounds with lipid-lowering
effect has been showed to be an efficacious tool for identification of
anti-obesity compounds.7 Meanwhile, differentiation of pre-adipo-
cytes into mature adipocytes is accompanied by sequential expres-
sion and activation of transcription factors governing the
well-characterized and important targets for the prevention and
treatment of obesity.13–16 The AMPK complex is a heterotrimer
composed of catalytic
a subunit and regulatory b, c subunits.
Each of these three subunits plays a difference important role in
both the stability and activity AMPK.17 It is in the catalytic domain
of
a subunit where AMPK becomes activated when phosphoryla-
tion takes place at threonine-172 by an upstream AMPK kinase
(AMPKK). And AMPK b plays a pivotal role in phosphorylated
AMPK at threonine-172 and a phosphorylation at Ser108 of the b
subunit seems to be required for the activation of AMPK enzyme.18
Once AMPK activated, its functions as a cellular energy sensor and
has been shown to be positively correlated with glucose and lipid
homeostasis in adipocytes.19
Bouchardatia neurococca is known to provide bioactive com-
pounds, including alkaloids, b-indoloquinazoline, furoquinoline,
terpenoids, and sesquiterpene, with valuable biomedical and phar-
maceutical potential.20 Bouchardatine (1, Fig. 1), a b-indoloquinazo-
line alkaloid isolated from B. neurococca (Rutaecae), exhibits a
variety of biological effects, such as anti-cancer, anti-inflammatory,
and anti-tuberculosis effects.21,22 In the present study, we evaluated,
expression of adipocyte-specific markers, such as C/EBPa, PPAR
and SREBP-1. These factors have important function in regulation
⇑
Corresponding author. Tel./fax: +86 20 39943056.
E-mail address: ceshzs@mail.sysu.edu.cn (Z.-S. Huang).
http://dx.doi.org/10.1016/j.bmc.2015.05.057
0968-0896/Ó 2015 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Rao, Y.; et al. Bioorg. Med. Chem. (2015), http://dx.doi.org/10.1016/j.bmc.2015.05.057

2
Y. Rao et al. / Bioorg. Med. Chem. xxx (2015) xxx–xxx
Figure 1. Chemical structure of bouchardatine (1).
for the first time, the inhibitory effects of 1, which was synthesized
using a method in the literature (Scheme 1) on adipogenesis and
lipogenesis in 3T3-L1 cell. In addition, we investigated the molecular
mechanisms of 1 by analyzing the expression of adipogenic factors
at mRNA and protein levels.
Red O staining and TG analysis. As shown in Figure 2B, 1 decreased
lipid accumulation in 3T3-L1 adipocytes in a dose-dependent man-
ner, as evidenced by the decrease in cell size and the number of
lipid droplets in mature adipocytes as depicted in the microscopy
image (Fig. 2C). As for cell size, after 3T3-L1 differentiated into
mature adipocytes, cells morphology was changed from a fibrob-
lastic shape to a spherical shape caused by TG accumulation, like
a ‘finger ring’ in cells. After 1 treatment, we can see the diameter
of finger ring was smaller compared with control group, especially
at higher concentrations. Most notably, almost 50% lipid decrease
2. Results and discussion
2.1. Chemistry
was observed at the concentration of 25 lM after 1 treatment.
The synthetic route of 1 was shown in Scheme 1. The key
intermediate 2-(4-oxo-3,4-dihydroquinazolin-2-yl)-1H-indole-3-
carbaldehyde (d) was prepared according to the literature
procedure.23,24 Anthranilamide was coupled with triethyl ortho-
propionate to yield compound a at 155 °C, then it was converted
into the brominated compound b using bromine in acid condition.
The reaction of compound b with 3.5 equiv phenylhydrazine
afforded the compound c, followed by the condensation reaction
with PPA (polyphosphoric acid) at 150 °C producing the intermedi-
ate d by classical Fischer reaction. The intermediate d reacted with
ammonium acetate and DMSO-water to give the target compound
1.
Moreover, we also examined the lipid-lowering effect of 1 in
HepG-2 cells. The substance 1 also blocked lipid accumulation in
HepG-2 induction by 0.5 mM oleic acid sodium in a dose-depen-
dent manner without cytotoxic effect compared with the control
group (Fig. 2D and E).
2.3. Effect of 1 on lipid accumulation at the early stages of
differentiation
Several stages are involved in adipogenesis/lipogenesis of pre-
adipocytes differentiation into mature adipocytes. To determine
whether 1 reduced lipid accumulation by suppressing adipogene-
sis and/or lipogenesis, we treated 3T3-L1 cells with 1 (25 lM) for
2.2. Effect of 1 on lipid accumulation in 3T3-L1 adipocytes
various periods, namely, days 0 to 3, 3 to 6, 6 to 9, 0 to 6, 3 to 6,
and 0 to 9, which represent different stages of 3T3-L1 adipocyte
differentiation (Fig. 3A). On day 9, the lipid content in cells was
determined by a TG assay, and representative microscopy images
were captured. Our results showed that 1 treatment during days
0 to 3, 3 to 6, and 6 to 9 resulted in ꢀ50%, ꢀ30%, and <10% reduc-
The effects of 1 on cell viability in 3T3-L1 adipocytes were mea-
sured via LDH assay, cell viability was calculated according to the
formula as depicted in Section 4. As shown in Figure 2A, 1 did
not exhibit any cytotoxicity to 3T3-L1 adipocytes, even at day 9
after 3T3-L1 differentiation, and microscopy showed that cells
exhibited no change in morphology (data not shown). To evaluate
the lipid lowering effect of 1, 3T3-L1 preadipocytes were differen-
tiated in the presence or absence of 1 for 9 d (from day 0 to 9). Lipid
accumulation as a major index of adipogenesis/lipogenesis was
quantified at the end of the differentiation period (day 9) by Oil
tion in lipid accumulation at 25 lM, respectively (Fig. 3B).
Moreover, no major difference in TG level was observed among 1
treatment during days 0 to 3, 0 to 6, and 0 to 9. This finding demon-
strated that 1 exerted lipid-lowering effect that mainly acted at the
early stage of adipogenesis. Consistent with these results,
Br
N
NH2
NH2
N
i
ii
iii
NH
NH
O
O
O
a
b
H
N
O
N
O
N
N
HN
HN
OHC
N
O
iv
v
NH
NH
NH
c
1
d
Scheme 1. Synthesis of bouchardatine. Reagents and conditions: (i) triethyl orthopropionate, 155 °C, 14 h; (ii) Br2, HOAc, NaOAc, 60 °C, 4 h; (iii) phenylhydrazine, ethanol,
reflux, 10 h; (iv) PPA, 150 °C, 3 h; (v) NH4OAc, DMSO–H2O (19:1), 150 °C, 20 h.
Please cite this article in press as: Rao, Y.; et al. Bioorg. Med. Chem. (2015), http://dx.doi.org/10.1016/j.bmc.2015.05.057

Y. Rao et al. / Bioorg. Med. Chem. xxx (2015) xxx–xxx
3
Figure 2. Effect of bouchardatine (1) on adipocyte differentiation in 3T3-L1 cells. (A) Cytotoxicity of 1 in 3T3-L1 cells measured by LDH assays. (B) 1 decreased TG content in
3T3-L1 adipocytes by TG assay. UND: undifferentiated group; Control: differentiated group without treatment of 1. (C) 1 decreased TG content in 3T3-L1 adipocytes by Oil
Red O staining, 40ꢁ objective. (D) Cytotoxicity of bouchardatine in HepG-2 cells measured by MTT assays. (E) 1 inhibited TG accumulation in HepG-2 cells by TG assay. Blank:
untreated with oleic acid sodium group; control: treated with oleic acid sodium without treatment of 1. (F) 1 inhibited TG accumulation in HepG-2 cells by Oil Red O staining,
40ꢁ objective. Three independent experiments were used to represent the error bars. *p <0.05, **p <0.01 compared with control group. ##p <0.01 compared with UND/Blank
group.
incubation of 3T3-L1 with 1 for various periods led to reductions of
mature adipocyte number and lipid droplets in a similar trend as
shown in the representative microscopy images (Fig. 3C). These
results suggested that 1 blocked lipid accumulation by inhibiting
the early stage of adipogenesis in 3T3-L1 differentiation.
induced to differentiate, reenter the cell cycle and undergo approx-
imately two rounds of division, till contact inhibition again.5,25 To
investigate whether the lipid-lowering effect of 1 is associated
with MCE, 3T3-L1 cells were treated with 1 for various times in
the early stage of adipogenesis, and cell numbers were analyzed.
Results showed that 1 treatment inhibited the proliferation activity
of 3T3-L1 adipocytes in a time- and dose-dependent manner
(Fig. 4A). Meanwhile, as shown in Figure 4B, undifferentiated cells
were arrested in the G0/G1 phase prior to induction of the adipo-
cyte differentiation (ꢀ80% were in the G0/G1 phase, ꢀ2% were in
the S phase, and others were in G2/M phase). After induction by
differentiation medium, the cell cycle ordinarily progresses from
2.4. Effect of 1 on cell proliferation and cell cycle progression
during the early stage of differentiation
Differentiation of 3T3-L1 preadipocytes into mature adipocytes
is initiated by mitotic clonal expansion (MCE), a prerequisite for
differentiation, in which G0/G1-growth-arrested preadipocytes,
Please cite this article in press as: Rao, Y.; et al. Bioorg. Med. Chem. (2015), http://dx.doi.org/10.1016/j.bmc.2015.05.057

4
Y. Rao et al. / Bioorg. Med. Chem. xxx (2015) xxx–xxx
Figure 3. Effect of bouchardatine (1) on various periods of 3T3-L1 adipocyte differentiation. (A) Schematic diagram of 1 administrated during 3T3-L1 differentiation. (B) 1
decreased TG content in 3T3-L1 adipocytes by TG assay. (C) 1 decreased TG content in 3T3-L1 adipocytes by Oil Red O staining, with 40ꢁ objective. Three independent
experiments were used to represent the error bars. UND: undifferentiated group; control: differentiated group without treatment of 1. *p <0.05, **p <0.01 compared with
control group. ##p< 0.01 compared with UND group.
the G0/G1 phase to S and G2/M phase at 24 h (ꢀ50% in the G0/G1
phase, ꢀ18% in the S phase). However, cell cycle was arrested in
G0/G1 phase in a dose-dependent manner after 1 treatment for
24 h. Notably, compared with the control, 1 delayed cell cycle from
the S phase to the G2/M phase at 24 h, with increasing proportion
of G0/G1 phase. In the control group, 18% of cells were in the S
critical regulators for adipogenesis.8–12 C/EBPb and C/EBPd have
been reported to induce the expression of PPAR and C/EBP , which
are associated with mature adipocyte formation and lipogenesis. To
investigate the roles of 1 in the regulation of these adipogenic factor
expression levels during the adipogenesis of 3T3-L1 cells, we deter-
c
a
mined the mRNA expression of both C/EBP family and PPAR
presence or absence of 1. As shown in Figure 5A, the mRNA level of
C/EBPb and C/EBP were significantly reduced in a dose-dependent
c in the
phase, whereas 5% of cells in the group treated with 1 (25 lM)
were in the same phase. By contrast, G0/G1 phase and G2/M phase
cells accounted for 40% and 57% of 1-treated cells, which corre-
spond to 42% and 29% in the control group, respectively. The above
results demonstrated that 1 inhibited cell proliferation and cell
cycle progression during the early stage of differentiation.
c
manner within 72 h of differentiation after the 1 administration.
Meanwhile, a marked decrease was also observed in the mRNA
levels of C/EBPa, PPARc, and SREBP-1c compared with control
group. In additional, it was also found that compound 1 decreased
the expression of these adipogenic factors in a time dependent
manner (Fig. 5B). The protein levels of these adipogenic factors con-
sistently exhibited a similar trend of reduction at mRNA level
(Fig. 5C). These results indicated that 1 inhibited lipid accumulation
during adipogenesis by suppressing adipogenic factor expression.
2.5. Effect of 1 on the expression of adipogenic factors during
adipocyte differentiation
Adipogenesis is regulated through a complex process that
includes coordinated alternations in gene expression. Transcrip-
C/EBPa and PPARc are the main upstream regulators of the lipo-
tion factors C/EBPb, C/EBPd, C/EBPa, PPARc, and SREBP-1c are
genic process, which regulates fatty acid synthesis by activating
Figure 4. Effect of bouchardatine (1) on MCE and cell cycle progression of 3T3-L1 adipocytes. (A) 1 blocked 3T3-L1 adipocytes proliferation in the early stage of differentiation
by cell counted. (B) 1 inhibited cell cycle progress of 3T3-L1 adipocytes proliferation in the early stage of differentiation by Flow-Cytometry. Three independent experiments
were used to represent the error bars. UND: undifferentiated group; control: differentiated group without treatment of 1. Three independent experiments were used to
present the error bar. *p <0.05, **p <0.01 compared with control group. ##p <0.01 compared with UND group.
Please cite this article in press as: Rao, Y.; et al. Bioorg. Med. Chem. (2015), http://dx.doi.org/10.1016/j.bmc.2015.05.057

Y. Rao et al. / Bioorg. Med. Chem. xxx (2015) xxx–xxx
5
Figure 5. Effect of bouchardatine (1) on the expression of adipogenic factors in 3T3-L1 cells. (A) 1 decreased the expression of adipogenic factors in 3T3-L1 adipocytes at day 3
by RT-PCR assay. (B) 1 decreased the expression of adipogenic factors in a time dependent manner. *p <0.05, **p <0.01 compared with 1 h control group. (C) 1 decreased the
expression of adipogenic factors at day 3 by Western blot assay. (D) 1 decreased the expression of lipid metabolic enzymes at day 9 by Western blot assay. Optical density
analysis was performed to quantify the level of RNA and protein expression, with b-actin and GAPDH viewed as loading control, respectively. UND: undifferentiated group;
control: differentiated group without treatment of 1. Three independent experiments were used to present the error bar. *p <0.05, **p <0.01, ***p <0.001 compared with control
group. ##p <0.01 compared with UND group.
rate-limited metabolic enzymes such as FAS, ACC, and SCD-1.
Given the fact that 1 decreased the TG level in adipocytes, we
detected these metabolic enzymes at protein level. As shown in
Figure 5D, the protein levels of ACC, FAS, and SCD-1 were signifi-
cantly decreased compared with the control group after 1 admin-
istration. These results suggested that 1 exerted an efficacious
lipid-lowering effect by decreasing the expression of adipogenic
and lipogenic markers that are crucial for fatty acid synthesis.
2.6. Effect of 1 on the AMPK signaling pathway
Several studies have linked the AMPK pathway with adipogen-
esis/lipogenesis.26–28 This pathway is inactivated during adipogen-
esis/lipogenesis, which is shown by lower phosphorylation level of
AMPK. To investigate whether the activation of AMPK is involved
in the lipid-lowering effect of 1, we examined the AMPK pathway
in 3T3-L1 adipocytes after 1 treatment for 9 day. As shown in
Please cite this article in press as: Rao, Y.; et al. Bioorg. Med. Chem. (2015), http://dx.doi.org/10.1016/j.bmc.2015.05.057

6
Y. Rao et al. / Bioorg. Med. Chem. xxx (2015) xxx–xxx
Figure 6. Effect of bouchardatine (1) on the expression of AMPK pathway related protein in 3T3-L1 cells. (A) 1 activated the AMPK signaling pathway in a dose dependent
manner in 3T3-L1 adipocytes. (B) 1 activated the AMPK signaling pathway in a time dependent manner in 3T3-L1 adipocytes. (C) AICAR and 1 decreased TG content in 3T3-L1
adipocytes by TG assay. (D) AICAR and 1 activated AMPK signaling pathway in 3T3-L1 adipocytes at day 9. (E) AICAR and 1 decreased the expression of adipogenic markers in
3T3-L1 adipocytes at day 3. Optical density analysis was performed to quantify the level of mRNA and protein expression with actin and GAPDH, Tubulin viewed as loading
control. UND: undifferentiated group; Control: differentiated group without treatment of 1. Three independent experiments were used to present the error bar. *p <0.05,
**p <0.01, ***p <0.001 compared with control group. ##p <0.01 compared with UND group.
Table 1
Primers sequences used for PCR
Gene
PPAR
C/EBP
C/EBP b
C/EBP
SREBP-1c
AMPK
AMPK
b-Actin
Forward primer(50-30)
Reversed primer(50-30)
Tm
c
TGCTGTTATGGGTGAAACTCTG
AGACATCAGCGCCTACTCG
TTATAAACCTCCCGCTCGGC
AGCCCAACTTGGACGCCAG
CAGCTCAGAGCCGTGGTGA
CCATGCGCAGACTCAGTTCC
GAACACCAATTGACAGGCCA
CTGAATCTGCACCAAGCATGA
GAAATCAACTGTGGTAAAGGGC
CTCTTGTGTTGATCACCAGCG
CTCAGCTTGTCCACCGTCTT
TCGTCGTACATGGCAGGAGT
TGTGTGCACTTCGTAGGGTC
ACAGCCACTTTATGTCCGGT
TCTTCAACCCGCCCATGTTT
TAAAACGCAGCTCAGTAACAGTCC
57
56
54
54
a
c
54
a
a
1
2
55.5
55.5
57
Figure 6A, 1 administration significantly elevating the phosphory-
lation level of AMPK in Thr172 in a dose-dependent manner indi-
for 9 days (Fig. 6A). To elucidate the decrease of total AMPK protein
after 1 exposure, we analyzed the transcriptional and translational
a
cated the activation of AMPK pathway. It was also observed an
increase of the phosphorylation level of AMPK b in Ser108.
Meanwhile, given that ACC was the main regulator involved in
fatty acid synthesis, as well as the downstream target of the
AMPK pathway, the expression level of ACC was also evaluated.
Evidently increased in phosphorylated level of inactive ACC and
decreased in protein level of ACC were observed after 1 administra-
tion. At the same time, a markedly decrease was also observed in
level of AMPK
(25 M) exposure. As shown in Figure 6B, 1 administration
resulted in an increment in the expression of p-AMPK within
4 h, whereas no major effect was observed in the expression of
total AMPK , which was accorded with the result of transcriptional
level of AMPK (Fig. S1). Meanwhile, as shown in Figure 5B, it was
also found a significant down-regulation of the adipogenic factors
expression with 1 treatment for a short time (1 h and 4 h).
However, after incubated with 1 for 24 h a decrease was observed
a in a time dependent manner after bouchardatine
l
a
a
a
the expression of protein AMPKa and AMPKb after 1 treatment
Please cite this article in press as: Rao, Y.; et al. Bioorg. Med. Chem. (2015), http://dx.doi.org/10.1016/j.bmc.2015.05.057

Y. Rao et al. / Bioorg. Med. Chem. xxx (2015) xxx–xxx
7
in the mRNA level of AMPK
a
(Fig. S1), which indicated that com-
4.1.1.2. 2-(1-Bromoethyl)quinazolin-4(3H)-one (b).
A solu-
pound 1 could reduce the synthesis of AMPK when drug treated
for a longer time. These results suggested that 1 inhibiting adipo-
genesis/lipogenesis in 3T3-L1 adipocytes was mainly via activating
tion of Br2 (0.50 mL, 9.8 mmol) in 10 mL acetic acid was dropped
to a hot solution of intermediate a (1.5 g, 8.6 mmol) and sodium
acetate (0.7 g, 8.6 mmol) in 90 mL acetic acid. The mixture was
stirred at 60 °C for 4 h, the color of the reaction solution become
white from brown slowly. And the residue was formed after pour-
ing into ice water, filtrated and desiccated in vacuum as white
solid, 88% yield. 1H NMR (400 MHz, DMSO-d6) d 12.46 (s, 1H),
8.16–8.09 (m, 1H), 7.87–7.80 (m, 1H), 7.69 (d, J = 8.1 Hz, 1H),
7.55 (t, J = 7.5 Hz, 1H), 5.10 (q, J = 6.8 Hz, 1H), 2.01 (d, J = 6.8 Hz,
3H); MS (ESI+APCI) m/z: 255.0 [M+H]+, 253.0 [MꢂH]ꢂ.
the AMPK signaling pathway by increasing p-AMPKa level at early
stage.
To dissect the relationship between the AMPK signaling path-
way activation and adipogenesis/lipogenesis inhibition mediated
by compound 1, we characterized this assay using AMPK activator
AICAR as a positive control. As shown in Figure 6C, after AICAR
(0.2 mM) or 1 (25 lM) respectively administrated, a markedly
reduction of TG content was observed compared with differenti-
ated group in 3T3-L1 adipocytes (Fig. S2A), which was accorded
with the results that AICAR or 1 activated AMPK signaling pathway
(Fig. 6D and Fig. S2B) and down-regulated the expression of adi-
pogenic markers (Fig. 6E and Fig. S2C).These results suggested that
the lipid-lowering effect of 1 was closely related with activation of
AMPK signaling pathway.
4.1.1.3. 2-(1-(2-Phenylhydrazono)ethyl)quinazolin-4(3H)-one
(c).
A solution of intermediate b (14.9 g, 58.7 mmol) and
phenylhydrazine (20.2 mL, 0.21 mol) in 450 mL ethanol was
refluxed for 10 h. The residue was formed after cooling the mixture
to room temperature, filtrated and washed with ethanol. The
resulting crude product was purified by recrystallization from
ethanol to give the desired product c as orange solid, 76% yield.
1H NMR (400 MHz, DMSO-d6) d 11.50 (s, 1H), 9.88 (s, 1H), 8.13
(d, J = 7.9 Hz, 1H), 7.81 (t, J = 7.6 Hz, 1H), 7.68 (d, J = 8.1 Hz, 1H),
7.60 (d, J = 7.8 Hz, 2H), 7.49 (t, J = 7.5 Hz, 1H), 7.28 (t, J = 7.9 Hz,
2H), 6.89 (t, J = 7.3 Hz, 1H), 2.35 (s, 3H); MS (ESI+APCI) m/z:
279.2 [M+H]+, 277.2 [MꢂH]ꢂ.
3. Conclusion
In this study, we demonstrated for the first time that bouchar-
datine (1) potently reduces lipid accumulation in 3T3-L1 adipo-
cytes. The effect of natural product 1 on adipocyte differentiation
and the underlying mechanisms involved in 3T3-L1 adipocytes
were evaluated. Results obtained indicated that 1 inhibited 3T3-
L1 adipocyte differentiation by activating the AMPK pathway and
decreasing the expression of the key regulators of adipogene-
sis/lipogenesis, thus decreasing the TG level in 3T3-L1 adipocytes.
These findings suggest that 1 may present a novel class of natural
products for using in the prevention and treatment of obesity. In
addition, the activation of the AMPK pathway may represent a
potential strategy for the treatment of obesity, which is consistent
with recent studies.14,29,30
4.1.1.4. 2-(1H-Indol-2-yl)quinazolin-4(3H)-one (d).
The
mixture of intermediate c (12.4 g, 44.5 mmol) in 60 mL PPA was
heated at 150 °C for 3 h. After cooling to room temperature, the
mixture was diluted with ice-water, and then adjusted pH to 7.0
with KOH. The residue was filtrated, washed with water, and des-
iccated in vacuum to give the desired product d as deep green
solid, 82% yield. 1H NMR (400 MHz, DMSO-d6) d 11.71 (s, 1H),
8.13 (d, J = 7.8 Hz, 1H), 7.80 (t, J = 7.5 Hz, 1H), 7.70 (d, J = 8.0 Hz,
1H), 7.63 (d, J = 7.9 Hz, 1H), 7.58 (s, 1H), 7.53 (d, J = 8.2 Hz, 1H),
7.45 (t, J = 7.5 Hz, 1H), 7.21 (t, J = 7.6 Hz, 1H), 7.05 (t, J = 7.5 Hz,
1H); MS (ESI+APCI) m/z: 262.1 [M+H]+, 260.1 [MꢂH]ꢂ.
4. Experimental section
4.1. General methods for chemistry
4.1.1.5. 2-(4-Oxo-3,4-dihydroquinazolin-2-yl)-1H-indole-3-car-
baldehyde (1).
The mixture of intermediate d (2.6 g,
1H and 13C NMR spectra were recorded using TMS as the inter-
nal standard in CDCl3 or DMSO-d6 with a Bruker BioSpin GmbH
spectrometer at 400 MHz and 100 MHz, respectively. The mass
spectra (MS) were recorded on a Shimadzu LCMS-2010A instru-
ment with an ESI or ACPI mass-selective detector. Flash column
chromatography was performed with silica gel (200–300 mesh)
purchased from Qingdao Haiyang Chemical Co. Ltd. The purity of
synthesized compounds was confirmed to be higher than 95%
through analytical HPLC performed with a dual pump Shimadzu
LC-20AB system equipped with an Ultimate XB-C18 column
10 mmol) and NH4OAc (3.1 g, 40 mmol) in DMSO/H2O
(75 mL/4 mL) was heated at 150 °C under N2 for 20 h. After cooling
to room temperature, the mixture was diluted with ice-water. The
residue was filtrated, washed with water, and desiccated in vac-
uum to give the crude product, and then it was purified as orange
solid by column chromatography with dichloromethane, 51% yield
1H NMR (400 MHz, DMSO-d6) d 13.62 (s, 1H), 13.11 (s, 1H), 10.49
(s, 1H), 8.28 (d, J = 8.0 Hz, 1H), 8.22 (d, J = 7.9 Hz, 1H), 7.92 (t,
J = 6.9 Hz, 1H), 7.86 (d, J = 7.8 Hz, 1H), 7.70 (d, J = 8.1 Hz, 1H),
7.61 (t, J = 6.9 Hz, 1H), 7.43 (t, J = 8.1 Hz, 1H), 7.35 (t, J = 7.5 Hz,
1H). 13C NMR (100 MHz, DMSO-d6) d 187.5, 166.7, 161.2, 148.3,
145.3, 135.8, 135.7, 134.9, 134.5, 129.4, 127.3, 125.3, 123.2,
121.8, 120.1, 115.1, 113.2. MS (ESI+APCI) m/z: 290.1 [M+H]+,
288.0 [MꢂH]ꢂ. HPLC analysis was used to confirm P98% purity
of compounds. The NMR and MS data were according with the lit-
erature report.2,3
(4.6 ꢁ 250 mm, 5
lM, Agilent) and eluted with methanol–water
(35:65 to 50:50) at a flow rate of lower than 0.5 mL minꢂ1. All
chemicals were purchased from commercial sources unless other-
wise specified. All the solvents were of analytical reagent grade
and were used without further purification.
4.1.1. Synthesis of 1
4.1.1.1. 2-Ethylquinazolin-4(3H)-one (a).
The solution of
4.2. Pharmacology
anthranilamide (1.36 g, 10 mmol) and triethyl orthopropionate
(10 mL) was refluxed for 14 h, cooled to 0 °C. The crude product
was filtrated and washed with ethanol, and the filtrate was con-
centrated to crude oil, and then the crude oil was recrystallized
with ethanol. The residue were combined and desiccated in vac-
uum as a white acicular solid, 89% yield. 1H NMR (400 MHz,
CDCl3) d 11.39 (s, 1H), 8.31 (d, J = 7.9 Hz, 1H), 7.83–7.67 (m, 2H),
7.48 (t, J = 7.4 Hz, 1H), 2.85 (q, J = 7.5 Hz, 2H), 1.46 (t, J = 7.6 Hz,
3H); MS (ESI+APCI) m/z: 175.2 [M+H]+.
4.2.1. Materials
Penicillin/streptomycin (p/s), 3-(4, 5-dimethylthiazol-2-yl)-2,
5-diphenyltetrazolium bromide (MTT, 10,227), and dimethyl sul-
foxide (DMSO) were purchased from MP (USA). Oil Red
(O0625), dexamethasone (D4902), 3-isobutyl-1-methylxanthine
(I5879), insulin (I2258), and oleic acid (O1008) were purchased
from Sigma (USA). DMEM (#11,965-092) and fetal bovine serum
(FBS) were obtained from BI (USA). Cell cycle analysis kit
O
Please cite this article in press as: Rao, Y.; et al. Bioorg. Med. Chem. (2015), http://dx.doi.org/10.1016/j.bmc.2015.05.057

8
Y. Rao et al. / Bioorg. Med. Chem. xxx (2015) xxx–xxx
(CCS012) and cell apoptosis analysis kits (AP101) were obtained
from Multiscience (China). RNA TRIzol Plus reagents (AA1408)
and the cDNA synthesis kit were from TaKaRa (China). Protein lysis
buffer (P0013C) and proteinase inhibitors (ST506) were from
Beyotime (China), and the BCA protein assay kit was from Pierce
the stained cells were destained with isopropanol, and the OD of
destained isopropanol was measured by spectrophotometry at
510 nm wavelength.
4.2.5. TG assay
(23,227, USA). 5-Aminoimidazole-4-carboxamide 1-b-
noside (AICAR, Beyotime, S1515). The primary anti-body used in
this experiment are AMPK /p-AMPK , AMPKb/p-AMPKb, ACC/p-
ACC (1:1000, #9957, CST), SCD-1 (1:1000, # 2974, CST), PPAR
(1:1000, #2443, CST), FAS (1:1000, #3180, CST), C/EBP (SC-367,
1:250, Santa), SREBP-1c (1:250, SC-61, Santa), Tubulin/GAPDH
(1:1000, CST). Triglyceride (TG) analysis kit (F001) was purchased
from Jiancheng Bio (China). PCR primers were synthesized by IGE
Biotech (China).
D
-ribofura-
Cells were lysed with distilled water containing 0.2% triton X-
100 (MP, 0219485483) for 1 h at room temperature and then ultra-
sonicated for 15 min. Lysates were collected and centrifuged at
4 °C and 3000g for 15 min. Triglyceride content was determined
in cell lysates using a colorimetric assay and is expressed as ‘mil-
limole TG per gram of cellular protein (mM TG/g protein)’ as
described.
a
a
c
a
4.2.6. RNA extraction and RT-PCR
Total RNA was extracted from 3T3-L1 adipocytes using RNAiso
Plus on day 9 according to the manufacturer’s instructions. cDNA
4.2.2. Cell cultures and differentiation
3T3-L1 fibroblast and HepG-2 cells (ATCC, USA) were purchased
from the American Type Culture Collection. Cells were maintained
in DMEM supplemented with 10% fetal bovine serum and 1% peni-
cillin and streptomycin in a humidified atmosphere containing 5%
CO2 in air at 37 °C. To induce adipogenesis, after two days post-
confluence (day 0), 3T3-L1 cells were incubated in a differentiation
was synthesized using Oligo (dT) (Takara, 3806) from 1
lg of total
RNA in a 20 L reaction volume. cDNA was used for the amplifica-
l
tion of the specific target gene by PCR. b-Actin was used for loading
control. The thermal cycle conditions were as follows: after heating
at 95 °C for 10 min, PCR amplification was conducted with
35 cycles of 95 °C for 30 s, the respective annealing temperature
for 45 s (Table 1), 72 °C for 1 min, followed by terminal extension
at 72 °C for 10 min. Primers used for PCR are shown in Table 1.
PCR products were separated on 1.2% (m/v) agarose gels and ana-
culture medium containing 500
(IBMX), 100 ng/mL dexamethasone, 2
1% p/s for 3 d (day 3). Then, the medium was replaced with 10%
FBS/DMEM containing 2 g/mL insulin for another 3 d (day 6).
l
M 3-isobutyl-1-methylxanthine
lg/mL insulin, 10% FBS, and
l
lyzed by Alpha Imaging System. The expression levels of C/EBP
a,
Lastly, cells were also incubated with basic culture medium for
another 3 d. Test compounds were prepared in stock solutions
and stored at ꢂ20 °C in aliquots. Compounds were added on day
0 in differentiation induction medium for 3 d and replaced with
another aliquot in post-differentiation medium for another 3 d.
Finally, the differentiation control group supplemented with the
C/EBPb, C/EBPd, PPAR , and SREBP-1c were normalized to that of
b-actin. Data were analyzed using Image J software.
c
4.2.7. Western blot analysis
Cultured cells were washed with cold PBS, lysed with lysis buf-
fer [1 ꢁ RIPA, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM
same volume of DMSO served as
experiments.
a
vehicle control for all
Na3VO4, 1 mM NaF, 1 lg/mL aprotinin, 1 lg/mL pepstatin, and
1 l
g/mL leupeptin]27 and incubated on ice for 0.5 h. Then, lysates
were centrifuged at 4 °C and 12,000g to remove debris. The protein
concentrations of the lysates were determined using a BCA protein
assay kit. Cell lysates were resolved by electrophoresis on 12%
polyacrylamide gels containing sodium dodecyl sulfate and trans-
ferred to polyvinylidene difluoride membranes. The membranes
were blocked by 0.1% Tween 20 in tris-buffered saline containing
5% albumin bovine serum for 45 min to 60 min at room tempera-
ture. After incubation overnight at 4 °C with the primary antibody,
the membranes were incubated with horseradish peroxidase-con-
jugated secondary antibody (1:5000, A0208/A0258, Beyotime) for
45 min to 60 min at room temperature. Target proteins were
detected with ChemiDoc™ XRS Imaging System (Bio-Rad) and
quantified with the Image Lab™ 3.0 software (Bio-Rad, USA).
4.2.3. Cell viability and cytotoxicity assay
To determine the cytotoxicity and effects of 1 on viability, 3T3-
L1 adipocyte and HpeG-2 cells were seeded at a density of 7 ꢁ 103
cells/well in a 96-well plate. After 24 h, cells were treated with 1 at
indicated concentration (1, 10, 25, 50, and 100 lM), whereas the
control group was administered with same volume of DMSO as
1. After each indicated time period, MTT dye solution
(0.5 mg/mL) was added to each well, and the plate was incubated
for 4 h at 37 °C. Then, each well was added with 150 lL DMSO
solution to resolve formazan and measured by absorbance at
490 nm with a micro plate reader (Biotek, USA). Each assay was
carried out in triplicate. Moreover, the cytotoxic effects of 1 were
measured using a lactate dehydrogenase (LDH) cytotoxicity detec-
tion kit (Beyotime, C0017, China). LDH activities in media and cell
lysates were measured to evaluate cytotoxicity, according to the
manufacture’s protocol (LDH released into the medium/maximal
LDH releaseꢁ100).
4.2.8. Statistical analysis
Results are expressed as mean standard deviation (SD). Data
were analyzed by one-way ANOVA analysis, and p <0.05 was con-
sidered significant.
Cell viability (%) = 100 ꢂ [OD (compd) ꢂ OD (blank)]/[OD
(maximum) ꢂ OD (blank)]*100.
Acknowledgements
Compd: bouchardatine treatment group; Blank: culture medium
without cells; Maximum: cells without Bouchardatine treatment.
This study was supported by the Natural Science Foundation of
China (8133007, 81273433 to Z.-S. Huang), the International S&T
Cooperation Program of China (2010DFA34630 to L.-Q. Gu), and
Guangdong Provincial Key Laboratory of Construction Foundation
(Grant 2011A060901014).
4.2.4. Oil Red O staining
Oil Red O staining was performed using the procedures with
minor modifications.9 In brief, after differentiation, cells were
washed with phosphate-buffered saline (PBS) and then fixed with
4% formalin in PBS for 60 min at room temperature. The fixed cells
were then washed three times with PBS, stained with filtered Oil
Red O solution for 30 min at room temperature, and then rinsed
for two times with distilled water. Cell morphology was captured
using Olympus BX51 microscope with imaging software. Finally,
Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.bmc.2015.05.057.
Please cite this article in press as: Rao, Y.; et al. Bioorg. Med. Chem. (2015), http://dx.doi.org/10.1016/j.bmc.2015.05.057

Y. Rao et al. / Bioorg. Med. Chem. xxx (2015) xxx–xxx
9
17. Stapleton, D.; Mitchelhill, K. I.; Gao, G.; Widmer, J.; Michell, B. J.; The, T.; House,
C. M.; Fernandez, C. S.; Cox, T.; Witters, L. A.; Kemp, B. E. J. Biol. Chem. 1996, 271,
611.
18. (a) Hawley, S. A.; Davison, M.; Woods, A.; Davies, S. P.; Beri, R. K.; Carling, D.;
Hardie, D. G. J. Biol. Chem. 1996, 271, 27879; (b) Dzamko, N.; van Denderen, B.
J.; Hevener, A. L.; Jorgensen, S. B.; Honeyman, J.; Galic, S.; Chen, Z. P.; Watt, M.
J.; Campbell, D. J.; Steinberg, G. R.; Kemp, B. E. J. Biol. Chem. 2010, 285, 115; (c)
Warden, S. M.; Richardson, C.; O’Donnell, J., Jr; Stapleton, D.; Kemp, B. E.;
Witters, L. A. Biochem. J. 2001, 354, 275.
19. Steinberg, G. R. Mol. Cell. Endocrinol. 2013, 366, 125.
20. Wattanapiromsakul, C.; Forster, P. I.; Waterman, P. G. Phytochemistry 2003, 64,
609.
21. Zhao, N.; Li, Z.-L.; Li, D.-H.; Sun, Y.-T.; Shan, D.-T.; Bai, J.; Pei, Y.-H.; Jing, Y.-K.;
Hua, H.-M. Phytochemistry 2015, 109, 133.
22. Mulakayala, N.; Kandagatla, B.; Ismail; Rapolu, R. K.; Rao, P.; Mulakayala, C.;
Kumar, C. S.; Iqbal, J.; Oruganti, S. Bioorg. Med. Chem. Lett. 2012, 22, 5063.
23. Istvan Hermecz, J. K.; Podanyi, B.; Szasz, G. Heterocycles 1994, 37, 903.
24. Naik, N. H.; Urmode, T. D.; Sikder, A. K.; Kusurkar, R. S. Aust. J. Chem. 2013, 66,
1112.
25. Mitterberger, M. C.; Zwerschke, W. J. Gerontol. A-Biol. 2013, 68, 1356.
26. Sashidhara, K. V.; Singh, S. P.; Varshney, S.; Beg, M.; Gaikwad, A. N. Eur. J. Med.
Chem. 2014, 86, 570.
27. Lee, J. O.; Lee, S. K.; Kim, J. H.; Kim, N.; You, G. Y.; Moon, J. W.; Kim, S. J.; Park, S.
H.; Kim, H. S. J. Biol. Chem. 2012, 287, 44121.
28. Chen, S.; Li, Z.; Li, W.; Shan, Z.; Zhu, W. Can. J. Physiol. Pharmacol. 2011, 89, 793.
29. Xu, X. J.; Valentine, R. J.; Ruderman, N. B. Curr. Obesity Rep. 2014, 3, 248.
30. Ix, J. H.; Sharma, K. J. Am. Soc. Nephrol. 2010, 21, 406.
References and notes
1. http://www.who.int/mediacentre/factsheets/fs311/en/index.html.
2. Padwal, R. S. Can. J. Cardiol. 2014, 30, 467.
3. Pinhas-Hamiel, O.; Livne, M.; Harari, G.; Achiron, A. Eur. J. Neurol. 2015. http://
dx.doi.org/10.1111/ene.12738.
4. Camp, H. S.; Ren, D.; Leff, T. Trends Mol. Med. 2002, 8, 442.
5. Poulos, S. P.; Dodson, M. V.; Hausman, G. J. Exp. Biol. Med. 2010, 235, 1185.
6. Tang, Q. Q.; Lane, M. D. Annu. Rev. Biochem. 2012, 81, 715.
7. Zeng, X. Y.; Zhou, X.; Xu, J.; Chan, S. M.; Xue, C. L.; Molero, J. C.; Ye, J. M. Biochem.
Pharmacol. 2012, 84, 830.
8. Lay, S. L.; Lefrere, I.; Trautwein, C.; Dugail, I.; Krief, S. J. Biol. Chem. 2002, 277,
35625.
9. Watanabe, M.; Inukai, K.; Katagiri, H.; Awata, T.; Oka, Y.; Katayama, S. Biochem.
Biophys. Res. Commun. 2003, 300, 429.
10. Chen, Y. C.; Zeng, X. Y.; He, Y.; Liu, H.; Wang, B.; Zhou, H.; Chen, J. W.; Liu, P. Q.;
Gu, L. Q.; Ye, J. M.; Huang, Z. S. ACS Chem. Biol. 2013, 8, 2301.
11. Ilavenil, S.; Arasu, M. V.; Lee, J. C.; Kim da, H.; Vijayakumar, M.; Lee, K. D.; Choi,
K. C. BMC Biotechnol. 2014, 14, 54.
12. Kimura, H.; Fujimori, K. Gene 2014, 534, 169.
13. Dagon, Y.; Avraham, Y.; Berry, E. M. Biochem. Biophys. Res. Commun. 2006, 340,
43.
14. Garcia-Prieto, C. F.; Gil-Ortega, M.; Aranguez, I.; Ortiz-Besoain, M.; Somoza, B.;
Fernandez-Alfonso, M. S. Vascul. Pharmacol. 2015, 67–69, 10.
15. Lee, H.; Kang, R.; Bae, S.; Yoon, Y. Int. J. Mol. Med. 2011, 28, 65.
16. Minokoshi, Y.; Kim, Y. B.; Peroni, O. D.; Fryer, L. G.; Müller, C.; Carling, D.; Kahn,
B. B. Nature 2002, 415, 339.
Please cite this article in press as: Rao, Y.; et al. Bioorg. Med. Chem. (2015), http://dx.doi.org/10.1016/j.bmc.2015.05.057