Aza-derivatives of resveratrol are potent macrophage migration inhibitory factor inhibitors

Article abstract of DOI:10.1007/s10637-011-9749-7

Summary: Resveratrol (3, 4′, 5-trihydroxy-trans-stilbene), a natural phytoalexin found in grapes and wine, has anti-proliferative activity on human-derived cancer cells. In our study, we used a conventional condensation reaction between aldehydes and amin

Full text of DOI:10.1007/s10637-011-9749-7

Invest New Drugs (2012) 30:1878–1886
DOI 10.1007/s10637-011-9749-7
PRECLINICAL STUDIES
Aza-derivatives of resveratrol are potent macrophage
migration inhibitory factor inhibitors
Yoshihiko Fujita & Rafiqul Islam & Kazuko Sakai & Hiroyasu Kaneda & Kanae Kudo &
Daisuke Tamura & Keiichi Aomatsu & Tomoyuki Nagai & Hidekazu Kimura &
Kazuko Matsumoto & Marco A. de Velasco & Tokuzo Arao & Tadashi Okawara &
Kazuto Nishio
Received: 28 July 2011 /Accepted: 31 August 2011 /Published online: 13 September 2011
#
Springer Science+Business Media, LLC 2011
Summary Resveratrol (3, 4′, 5-trihydroxy-trans-stilbene),
a natural phytoalexin found in grapes and wine, has anti-
proliferative activity on human-derived cancer cells. In our
study, we used a conventional condensation reaction
between aldehydes and amines to provide a number of
aza-resveratrol (3, 4′, 5-trihydroxy-trans- aza-stilbene)
derivatives in an attempt to screen for compounds with
resveratrol’s action but with increased potency. Aza-
resveratrol and its hydroxylated derivative (3, 4, 4′, 5-
tetrahydroxy-trans- aza-stilbene) showed a more enhanced
anti-proliferative effect than resveratrol in an MCF-7 breast
carcinoma cell line. To identify the cellular targets of the
aza derivatives of resveratrol, we conjugated the latter aza-
stilbene compound with epoxy-activated agarose and per-
formed affinity purification. Macrophage migration inhibitory
factor (MIF), a proinflammatory cytokine, was identified as a
major target protein in MCF-7 cell lysates using a matrix-
assisted laser desorption/ionization time-of-flight mass spec-
trometer (MALDI-TOF MS). The aza-resveratrol and its
hydroxylated derivative, but not resveratrol, were also found
to be potent inhibitors of MIF tautomerase activity, which
may be associated with their inhibitory effects on MIF
bioactivity for cell growth.
.
.
Keywords Resveratrol Cancer Macrophage migration
.
inhibitory factor (MIF) Tautomerase, CD74
Introduction
Macrophage migration inhibitory factor (MIF) is a pleio-
tropic cytokine/growth factor that is known to contribute to
inflammatory and autoimmune diseases. MIF is expressed
under physiological conditions in a wide variety of tissues
and cell types and is secreted as a consequence of the
systemic stress response [1, 2]. Moreover, MIF has recently
been implicated in multiple aspects of tumor growth
including the control of cell proliferation and the promotion
of angiogenesis [3, 4]. High levels of MIF expression have
been found in human tumors including melanomas, breast
carcinomas, prostate cancer, and adenocarcinoma of the
lung [5, 6]. Secretion of MIF by tumor cells has been
proposed to enhance tumor cell proliferation by autocrine
amplification, as observed with other growth factors
expressed by cancer cells [7–10]. Recent studies have
shown that MIF signal transduction is initiated by binding
to the transmembrane protein, CD74 [11, 12]. Inhibition of
MIF-CD74 binding has been shown to attenuate tumor
growth and angiogenesis [3]. It has also been suggested
that, in addition to its extracellular role, MIF may have
additional regulatory functions within the cell [13]. In this
context, MIF has been shown to physically bind to p53
intracellularly, thereby protecting tumor cells from apoptosis
Electronic supplementary material The online version of this article
(
doi:10.1007/s10637-011-9749-7) contains supplementary material,
which is available to authorized users.
:
:
:
:
:
Y. Fujita K. Sakai H. Kaneda K. Kudo D. Tamura
:
:
:
:
K. Aomatsu T. Nagai H. Kimura K. Matsumoto
:
:
M. A. de Velasco T. Arao K. Nishio (*)
Department of Genome Biology,
Kinki University School of Medicine,
Osaka-Sayama,
5
89-8511, Osaka, Japan
e-mail: knishio@med.kindai.ac.jp
[
14]. MIF possesses the unusual ability to catalyze the
:
R. Islam T. Okawara
tautomerization of the nonphysiological substrates D- and
L-dopachrome methyl ester into their corresponding indole
Institute of Health Science, Kumamoto Health Science University,
Kumamoto 861-5598, Japan

Invest New Drugs (2012) 30:1878–1886
1879
derivatives, although the physiological role of the catalytic
activity of MIF remains unknown [15]. Several small
molecule tautomerase inhibitors of MIF have been reported
Materials and methods
Materials
[
16–21]; some of these inhibitors—including the best
characterized one, ISO-1[S,R-3-(4-hydroxyphenyl)-4,5-
dihydro-5-isoxazole acetic acid methyl ester] [22, 23],
inhibited the cytokine/growth factor activity of MIF at
least marginally [24]. Recently, covalent inhibitors such as
Biochemical and molecular biology grade chemicals and
reagents were purchased from various commercial vendors,
including epoxy-activated agarose resin (12 atom linker,
33 μmol of epoxy group/mL of packed gel) and resveratrol
(compound 1), both of which were purchased from Sigma
Chemical (St. Louis, MO).
4
-iodo-6 phenylpyrimidine (4-IPP) and phenethyl isothio-
cyanate have been reported to effectively deactivate MIF
by structural modification [25, 26]. Since covalent
inhibitors are often not optimal as lead candidates, drug-
like molecules that bind reversibly to MIF have also been
sought.
Synthesis of aza-resveratrol derivatives
(E)-5{(4-hydroxyphenylimino)methyl}benzene-1,3-diol
(Aza-resveratrol) (compound 2) was prepared as follows.
To a solution of triethylamine (101 mg, 1.0 mmol) in
ethanol (15 mL), 4-Aminophenol hydrochloride (145.6 mg,
1.0 mmol) was added and the mixture was stirred at room
temperature for 5 min. Next, 3,5-dihydroxybenzaldehyde
(138 mg, 1 mmol) and acetic acid (1 drop) were added. The
resulting solution was refluxed for 8 h. The solvent was
then removed under reduced pressure and cold water
(4 mL) was added to the residue. After 3–4 min, the solid
mass was separated and collected by filtration followed by
washing with water (3 mL) to produce compound 2 as an
off-white powder; the yield was 167 mg (73%). The
product was then recrystallized from a mixture of ethanol-
Resveratrol is a polyphenolic compound that is found in
grape skin and is classified as a phytoalexin, a class of
antibiotics of plant origin [27–29]. This compound has been
shown to have a wide spectrum of biological activity [30]
including growth-inhibitory activity in several human
cancer cell lines of diverse origin and in animal models of
carcinogenesis [31–33]. However, its activity at a molecular
level is not fully understood. The identification of the major
molecular targets of resveratrol should provide an insight
into the mechanisms of action. The main problem with
resveratrol is that this molecule exerts an effect at high
micromolar concentrations [34]; therefore, identifying its
cellular targets is difficult.
Several types of resveratrol analogues have been
synthesized to study the relation between structure and
function [35–37]. However, preparation of analogues that
retain the intramolecular stilbenic C=C double bond
requires several steps and is therefore time-consuming.
Pagliai et al. used the concept of click chemistry for the
rapid synthesis of a series of resveratrol analogues and
screened for compounds with an anti-proliferative effect
using a panel of cell lines [38]. In the present study, we
synthesized a series of resveratrol analogues using a
conventional condensation reaction between aldehydes
and amines. Two aza-resveratrol derivatives thus produced
showed anti-proliferative activities that were more potent
than that of their parent compound, resveratrol. We
performed affinity purification using agarose beads con-
jugated with one of the resveratrol derivatives to isolate
the molecular target of the compound(s) from cell lysates
and identified an affinity-captured 12.5-kDa polypeptide
as MIF. We demonstrated that the two aza-resveratrol
derivatives, but not the parental resveratrol, bind to MIF
and antagonize MIF binding to its cellular receptor, CD74,
which most likely attenuate the cytokine/growth factor
activity of MIF for cell proliferation. Such inhibitors may
lead to the development of drugs for the treatment of
cancer and, possibly, inflammatory and autoimmune
diseases.
toluene. The melting point was 223°C (decomposed).
1
H-NMR (DMSO-d ): δ 6.31 (1H, s, CH), 6.76 (4H, s,
6
CH), 7.14 (2H, s, CH), 8.38 (1H, s, CH), 9.43 (3H, br s, OH).
(E)-5{(4-hydroxyphenylimino)methyl}benzene-1,2,3-triol
(compound 3) was prepared as follows. To a solution of
triethylamine (101 mg, 1.0 mmol) in ethanol (15 mL), 4-
Aminophenol hydrochloride (145.6 mg, 1.0 mmol) was
added and the mixture was stirred at room temperature for
5 min. Next, 3,4,5-trihydroxybenzaldehyde monohydrate
(172 mg, 1 mmol) and acetic acid (1 drop) were added.
The resulting solution was refluxed overnight. The solvent
was then removed under reduced pressure and cold water
(4 mL) was added to the residue. After 3–4 min, the solid
mass was separated and collected by filtration followed by
washing with water (3 mL) to produce compound 3 as an
orange powder; the yield was 172 mg (70%). The product
was then recrystallized from a mixture of ethanol-toluene.
The melting point was 234°C.
1
H-NMR (DMSO-d ): δ 6.75 (2H, d, J=8.1 Hz, CH), 6.86
6
(2H, s, CH), 7.11 (2H, d, J=8.4 Hz, CH), 8.27 (1H, s, CH),
8.73 (1H, br s, OH), 9.16 (2H, s, OH), 9.41 (1H, s, OH).
Cell lines and cultures
The DLD-1 colon carcinoma, MCF-7 breast carcinoma,
A375 melanoma, MiaPaCa-2 pancreatic carcinoma, T24

1
880
Invest New Drugs (2012) 30:1878–1886
bladder carcinoma, and A549 non-small cell lung carcinoma
cell lines were cultured in DMEM medium (Sigma)
supplemented with 10% heat-inactivated fetal bovine
serum (Invitrogen, Carlsbad, CA), and the cell lines were
buffer (62.5 mM Tris–HCl [pH6.8], 10% glycerol, 2%
SDS, 0.025% bromophenol blue, and 700 mM β-
mercaptoethanol). The beads were pelleted, and the result-
ing supernatant was resolved using sodium dodecyl sulfate
polyacrylamide gel electrophoresis (SDS-PAGE). The total
protein was silver-stained. The lowest band corresponding
to an apparent molecular mass of 12.5 kDa was excised
from the gel and digested, and the resulting peptide
fragments were analyzed using a matrix-assisted laser
desorption/ionization time-of-flight mass spectrometer
(MALDI-TOF MS) (Voyager-DE STR;Applied Biosystems,
Foster City, CA).
maintained in a 5% CO -humidified atmosphere at 37°C.
2
MTT cell proliferation assay
Drug cytotoxicity was assessed in vitro using the 3-(4, 5-
dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
3
(
MTT) assay. In 96-well plates, 2×10 cells per well were
plated in 200 μL of culture medium containing increasing
drug concentrations. After 72 h of culture, 20 μL of MTT
(
5 mg/mL in PBS, obtained from Sigma) were added to
Immunoblot analysis
each well and the plates were incubated for 2 h. The
resulting formazan product was dissolved with DMSO, and
the absorbance at a wavelength of 490 nm (A490) was read
using a SPECTRAmax Microscope Spectrophotometer
The immunoblot analysis for MIF protein detection was
performed essentially as described previously [40] using anti-
MIF antibody (Santa Cruz Biotechnology, Santa Cruz, CA).
(
Molecular Devices, Sunnyvale, CA).
Immunofluorescence staining
Preparation of immobilized affinity column for compound 3
To detect the cell surface expression of CD74, cells grown to
subconfluence on cover slips were treated with a medium
containing monoclonal anti-CD74 antibody (Santa Cruz
Biotechnology) at a concentration of 5 μg/mL and incubated
for 10–20 min at 37°C. After washing three times with the
medium, the cells were incubated at 37°C for another 10–
20 min in a medium containing 10 μg/mL of Alexa Fluor 488
goat anti-mouse IgG (Molecular Probes, Eugene, OR). After
washing three times with HBSS (pH7.3), the cells were fixed
in 4% formaldehyde for 30 min at room temperature (RT),
rinsed in PBS, and mounted on slide glasses using
Vectashield (Vector Laboratories, Burlingame, CA). The cells
were observed using a confocal microscope (LSM5 Pascal;
Zeiss, Oberkochen, Germany).
Immobilized affinity beads were prepared according to Wang
et al. [39]. Briefly, epoxy-activated agarose (0.33 g) was
suspended in 1 mL of ice-cold water for 5 min and washed
extensively; then, 4.9 mg of compound 3 (dissolved in
0.5 mL of 0.1-M NaOH) was added, followed by overnight
incubation at room temperature to allow for the chemical
coupling of compound 3 to the agarose beads. To stop the
reaction, 1 mL of 1-M sodium acetate buffer (pH5.0)
containing 1 mM dithiothreitol (DTT) was added to the
mixture to neutralize the unreacted epoxy groups. The
compound 3-immobilized beads were washed successively
with 0.1-M sodium acetate (pH5.0) containing 1 mM of DTT
and a series of 70%, 30%, 10%, and 0% graded ethanol.
Controls consisted of mock-treated beads (prepared using an
identical procedure except that no ligand was added).
Expression and purification of recombinant MIF (rMIF)
Identification of intracellular targets of compound 3
The MIF cDNA was generated by PCR using the primers
5
′ – CCGGGCATGCCGATGTTCATCGTAAACAC – 3′
MCF-7 cells were collected and lysed in a buffer containing
and 5′ – GGGAGATCTGGCGAAGGTGGAGTTGTTC –
3′ and excised with Sph I and Bgl II. The resulting cDNA
fragment was cloned into the Sph I and Bgl II site of an
expression vector, pQE-70 (Qiagen, Hilden, Germany).
His-tagged MIF was expressed in E. coli XL-1 blue and
purified using a metal affinity column (Talon; Invitrogen)
according to the manufacturer’s instructions. About 180 mg
of purified MIF was obtained from 1 l of culture.
1
0 mM HEPES (pH7.5), 90 mM KCl, 1.5 mM Mg(OAc)2,
1
mM DTT, 0.5% NP-40, 5% glycerol, 0.5 mM phenyl-
TM
methylsulphonyl fluoride and Complete
protease inhib-
itors (Roche Diagnostics, Basel, Switzerland). Cell-free
extracts were obtained by centrifugation for 10 min in a
refrigerated microcentrifuge. Fifty microliters of compound
3
-immobilized affinity beads (3AB) and mock-treated
beads (MB) were incubated with 1 mL of cell lysate
containing 3.0 – 5.0 mg of protein for 16 h at 4°C with
constant rotation. After incubation, the beads were thor-
oughly washed with lysis buffer. The bound protein was
eluted by boiling the beads in the presence of SDS reducing
Dopachrome tautomerase assay
L-dopachrome methyl ester was prepared at 2.4 mM
through the oxidation of L-3,4-dihydroxyophenylalanine

Invest New Drugs (2012) 30:1878–1886
1881
methyl ester (4.8 mM) with an equi-volume of sodium
periodate (16 mM). The activity was determined at room
temperature by adding dopachrome methyl ester (60 μL) to
a 96-well plate containing 50 nM of rMIF in 140 μL of
assay was performed (Fig. 2). Aza-resveratrol (compound
2) inhibited the growth of MCF-7 to a greater degree than
resveratrol (compound 1) (Fig. 2a). The IC50 value at 72 h
posttreatment with compound 1 was more than 100 μM,
whereas it was only 28 μM after treatment with compound
2. This difference suggests that the conversion from a
stilbene structure (with C=C) to an aza derivative (with C=N)
enhanced the anti-proliferation effect in this cell line. The
addition of the hydroxyl group at position 4 of compound
2 (compound 3) further increased the anti-proliferation
effect on MCF-7 (Fig. 2a). Similar sensitivity to each
compound was observed by MiaPaCa-2 pancreatic cancer
cells and to a lesser extent T24 bladder carcinoma and
A375 melanoma cells, whereas DLD-1 colon cancer and
A549 lung cancer cells were considerably more resistant
to all compounds (Fig. 2b). To explore the molecular
mechanism by which the aza-derivatives of resveratrol
exerted their anti-proliferative activities (against a subset
of the cancer cell lines), we attempted to identify the
cellular targets of aza-compound 3.
5
0 mM potassium phosphate buffer (pH6.0) with 0.5 mM
EDTA; the decrease in absorbance at 475 nm was then
measured for 5 min. The compounds intended for the
testing of the inhibitory effect were dissolved in DMSO and
added to the plate with MIF prior to the addition of the
dopachrome.
MIF – CD74 binding analysis
A375 cells were seeded in a 96-well plate (~8,000 cells/
well) and cultured overnight. The cells were then incubated
with 80 μM of FITC-rMIF conjugates in 100 μL of HBSS
(
pH7.3) in the presence or absence of rMIF (4 μM),
compound 2 (50 μM), compound 3 (10 and 50 μM) and
ISO-1 (50 μM) and observed using a fluorescence
microscope (IX 71; Olympus, Japan). The conjugation of
TM
MIF to FITC was performed using the SureLINK FITC
Labeling Kit (Socochim, Lausanne, Switzerland) according
to the manufacturer’s protocol.
a
Results
1
Chemistry
An attempt was made to develop a reaction that enabled
the quick preparation of a number of resveratrol
analogues for studies of their structures and functions.
We took advantage of a conventional condensation
reaction using aldehydes and amines to quickly obtain a
variety of aza-derivatives of resveratrol. Figure 1 shows
resveratrol (compound 1) and the two analogues (com-
pounds 2 and 3) that were synthesized and used in this
study.
2
3
b
Cell line
Origin
IC50 (µmol/L)
1
2
3
MCF7
MiaPaca-2
T24
Breast Cancer
Pancreatic Cancer
Bladder Cancer
Melanoma
>100
99.8
>100
>100
94.4
86.2
28.2
47.1
65.9
40.8
73.2
75.9
6.4
8.3
Anti-proliferative effect of aza-compounds
24.3
27.2
65.4
62.1
A375
DLD-1
A549
Colon Cancer
Lung Cancer
To evaluate the effect of resveratrol and its aza-derivatives
on the cell viability of several cancer cell lines, an MTT
Fig. 2 Antiproliferative activity of resveratrol (1) and its aza-
derivative compounds 2 and 3. a Growth inhibition of MCF-7 cells
after treatment with resveratrol (compound 1) and its derivatives,
HO
HO
HO
OH
(
compounds 2 and 3), for 72 h. Exponentially dividing cells were
OH
OH
HO
OH
treated with 0, 1.23, 3.7, 11.1, 33.3, or 100 μM of the compounds.
Cell viability was determined using the MTT assay. The percentage of
growth was calculated, with 100% representing control cells treated
with 0.1% DMSO alone. The results are the mean±SDs from three
separate experiments. b IC50s of compounds 1, 2 and 3 for
proliferation of several cells calculated using the MTT assay as
done in a. Numbers represent average IC50 from two independent
experiments
N
2
N
HO
HO
1
3
Fig. 1 Structures of resveratrol (1) and its aza-derivative compounds
and 3
2

1
882
Invest New Drugs (2012) 30:1878–1886
Identification of high-affinity binding protein molecules
of aza-compounds
Tautomerase activity
MIF possesses the ability to catalyze the tautomerization of
DL-dopachrome methyl esters into their corresponding
indole derivatives [15]. If both aza-compounds 2 and 3
bind to MIF, they may share a function with small
molecules so far identified as tautomerase inhibitors of
MIF [16–19]. We tested if resveratrol (compound 1) and its
aza-derivatives (compounds 2 and 3) could inhibit the
enzymatic activity of MIF (Fig. 4). The two aza-compounds
inhibited the tautomerase activity of rMIF in a dose-
dependent manner with IC50 values of 18.7 and 8.9 μM
for compounds 2 and 3, respectively. However, resveratrol
showed no inhibitory effect (Fig. 4). These results suggest
that antagonists of MIF’s enzymatic reaction may be
correlated with the elevated inhibitory potential of these
compounds in MCF-7 cells.
Polyphenols are advantageous in that they are able to
couple with agarose beads even without any molecular
modification, such as aminoalkylation. We simply reacted
compound 3 with epoxy-activated agarose beads for
immobilization. The chemical coupling of the resveratrol
analogue occurred at one or more of the 4 available
hydroxyl groups (3, 4, 5, 4′), resulting in compound 3-
immobilized affinity beads (3AB). Lysates from the MCF-7
cells were then incubated with the 3AB. Proteins that bound
to 3AB were eluted, separated by SDS-PAGE and visualized
using silver staining. A prominent band with an apparent
molecular mass of 12.5 kDa showed a specific retention on
3AB. This band could not be detected in mock-treated
control beads (CB), indicating that the interaction was not
caused by nonspecific binding to the agarose beads (Fig. 3a).
The band was excised from the gel and analyzed using
MALDI-TOF MS, resulting in the identification of the 12.5-
kDa as macrophage migration inhibitory factor (MIF)
MIF-CD74 binding assay
Compounds 3 (or 2) were capable of exerting an anti-
proliferative effect by targeting MIF and possibly inhibiting
the binding of MIF to its cell surface receptor, CD74. We
examined this possibility by monitoring cell surface
binding of MIF-CD74 using rMIF labeled with FITC
(FITC-rMIF), which would enable us to stain CD74-
expressing cells fluorescently. We first used MCF-7 cells
to detect rMIF-CD74 binding, but sufficient fluorescence
intensity was not obtained, possibly because the detectable
level of CD74 in this cell line was too low for this purpose.
We performed immunofluorescence analysis to screen for
an appropriate cell line (Fig. 5a). The A375 melanoma cell
line was thus chosen as a cell line to be monitored for
(
Fig. 3b). For confirmation, the eluates were resolved using
SDS-PAGE and immunoblotted with an anti-MIF antibody.
MIF was clearly shown to bind with the 3AB and not with
the mock-treated CB (Fig. 3c). Specific affinity between MIF
and 3AB was shown by the pretreatment of the lysate with
compound 3, which disrupted the MIF binding to the 3AB.
We also found that compound 2 (aza-resveratrol) inhibited
the subsequent binding of MIF to the 3AB. To our surprise,
compound 1 (resveratrol) had no effect on their binding.
These results led us to conclude that the slight structural
difference between compound 1 (with C=C) and 2 (with
C=N) was responsible for their affinity with MIF.
Fig. 3 Molecular identification and characterization of the affinity-
captured protein. a Affinity beads immobilized with compound 3
Matched peptides identified using MALDI-TOF MS were shown in
bold. c Immunoblot detection of MIF binding to 3AB. MCF-7 cell
lysate (lane 1), an eluate recovered from CB (lane 2), an eluate from
3AB (lane 3), an eluate from 3AB when the lysate was preincubated
for 30 min with 50 μM of compound 3 (lane 4), compound 2 (lane 5)
or compound 1 (lane 6) is shown
(3AB) or control beads (CB) were incubated with a MCF-7 cell lysate.
Protein bound to the columns was eluted and resolved using SDS-
PAGE. The highlighted protein band of 12.5-kDa was excised from
the gel and identified using MALDI-TOF MS as the cytokine MIF. b

Invest New Drugs (2012) 30:1878–1886
1883
indicating the specific binding of MIF to its cell surface
receptor (Fig. 5B 1 and 2). Aza-compound 3 at 50 μM, but
not at 5 μM, inhibited the binding. Compound 2 at 50 μM
also inhibited the binding, but Iso-1 at 50 μM had no effect
on MIF-CD74 binding (Fig. 5B 3–6).
1
2
3
Discussion
One informative approach to investigating the mechanisms
of the diverse functions of resveratrol is to identify its
molecular targets. We started with the synthesis of
resveratrol analogues and screening of these compounds
for the ability to inhibit cell growth at a lower IC50 value
than that of resveratrol. Such compounds with increased
activities are likely to be more strongly associated with
resveratrol’s molecular targets. To prepare resveratrol
analogues, we used a conventional condensation reaction
between aldehydes and amines. This reaction is suitable for
combinatorial chemistry and has the great advantage of
enabling the quick preparation of a number of aza-
derivatives of resveratrol. As a preliminary study, we
prepared aza-resveratrol 2, in which the C=C double bond
of resveratrol was replaced by C=N, together with its 4′-
hydroxylated derivative 3, and compared their anti-prolif-
erative effects with that of resveratrol 1 on MCF-7, a breast
cancer cell line that has frequently been used to study the
effect of resveratrol [41–46]. Both aza-resveratrol derivatives
(2 and 3) inhibited cell proliferation more potently than
Fig. 4 Two aza compounds inhibit dopachrome tautomerase activity.
The indicated concentrations of resveratrol (compound 1) and its aza-
derivatives (compounds 2 and 3) were preincubated with 50 nM rMIF
in 50 mM potassium phosphate buffer followed by the addition of L-
dopachrome methyl ester at a final concentration of 0.72 mM.
Spectrophotometric measurements were made at λ=475 nm by
monitoring the rate of decolorization of L-dopachrome in comparison
to a standard curve
FITC-rMIF binding activity, as it expressed the largest
amount of cell surface CD74 of all the cell lines that were
analyzed. In contrast to the receptor (CD74), abundant
ligand protein (MIF) was uniformly expressed in all these
cell lines (Suppl. Fig. 1), as has been observed in many
cancer types (5, 6). As expected, FITC-MIF fluorescently
stained A375 cells. Preincubation of the A375 cells with
excess unlabeled rMIF inhibited the binding of FITC-MIF,
a
b
MCF-7
A375
1
2
MiaPaCa-2
T24
3
4
6
A549
DLD-1
5
Fig. 5 Fluorescence analysis of FITC-MIF binding to CD74-
expressing cells. a Immunofluorescence analysis of cell surface
expression of CD74 for MCF-7, A375, MiaPaCa-2, T24, A549 and
DLD-1 cells. Cells were treated with5 μg/mL of monoclonal anti-
CD74 antibody and incubated for 10–20 min at 37°C. After washing
three times with HBSS (pH 7.3), the cells were treated with 10 μg/mL
of Alexa Fluor 488 goat anti-mouse IgG, which were then fixed in 4%
formaldehyde. Scale bar, 10 μm. b Fluorescence microscopy images
of A375 cells pretreated with (1) none, (2) rMIF (50 μg/mL), (3)
compound 3 (5 μM), (4) compound 3 (50 μM), (5) compound 2
(50 μM) and (6) ISO-1 (50 μM) prior to the addition of FITC-MIF
(2 μg/mL) are shown. Scale bar, 100 μm

1
884
Invest New Drugs (2012) 30:1878–1886
compound 1, with derivative 3 exhibiting the most potent
IC50 value of less than 10 μM. Hydroxylation at specific
positions of resveratrol has been demonstrated to show
enhanced radical scavenging activity, resulting in the growth
inhibition of HL-60 leukemic cells due to the formation of
antioxidant-derived prooxidants [47]. More polyhydroxy-
lated aza-resveratrol derivatives need to be synthesized to
clarify how the antioxidative properties of these compounds
contribute to the anti-proliferation effect on cancer cells.
When conjugated to epoxy-activated agarose beads,
derivative 3 permitted the identification of MIF as the most
prominent cellular binding protein of the aza-resveratrol
derivatives. We initially expected MIF to be a target of
resveratrol itself as well. However, the preincubation of cell
lysates with resveratrol 1 allowed the ability of cellular MIF
to bind to the affinity beads to be retained, while
preincubation with compounds 2 or 3 abolished its binding
to the beads, suggesting that MIF could only interact with
the aza-resveratrol derivatives (Fig. 3c). Wang et al.
recently isolated a resveratrol-targeting protein using
immobilized resveratrol affinity beads and identified this
protein as dihydronicotinamide riboside quinone reductase
compounds were below 5 μM (24). Iso-1 ((S,R)-3-(4-
hydroxyphenyl)-4,5-dihydro-5-isoxazole acetic acid methyl
ester), a well-characterized MIF tautomerase inhibitor, was
only marginally active in MIF-CD74 binding. They
demonstrated that most MIF-CD74 binding antagonists
provide some tautomerase inhibition and ascribed this action
to the notion that the interaction of MIF with CD74 occurs in
the vicinity of the tautomerase active site [24]. Because
50 μM of our aza-polyphenols 2 and 3 inhibited the binding
of fluorescently labeled rMIF to CD74 expressed on the cell
surface, they appeared to have already gained the MIF-CD74
binding antagonism that causes their anti-proliferation effect
on MCF-7 cells. Notably, Iso-1 at 50 μM failed to block MIF
binding to CD74 in our system (Fig. 5).
The expression level of CD74 may not be necessary for
compounds 2 and 3 to exert their anti-proliferation effect,
since A375 cells (which have a higher level of CD74
expression on their cell surfaces than MCF-7) are less
susceptible to the anti-proliferation effect of compounds 2
and 3 (Figs. 2 and 5). The molecular mechanism by which
the unequal sensitivity to these MIF inhibitors occur among
the cell lines remains to be elucidated (Fig. 2b).
2
(NQO2) [39]. This protein was not detected using our
In summary, we have identified a unique family of small
compound tautomerase inhibitors of MIF that act as
antagonists of MIF-CD74 binding to inhibit MIF-
dependent tumor cell growth. We propose that mono-
hydroxylated aza-resveratrol (compound 3) represents a
unique class of anti-MIF therapeutic agents, although
further studies are needed to elucidate the antitumor
efficacy of this novel lead compound.
compound 3-immobilized affinity beads (data not shown),
which again explains the different biochemical properties
between resveratrol and its aza-derivatives. In silico
modeling of resveratrol 1 and the two aza-resveratrol
derivatives 2 and 3 at the tautomerase active site of MIF
revealed no obvious conformational changes arising from a
change in only one atom (C to N) at the double bond
moiety of resveratrol. Some interaction may occur between
the protein and the N atom of aza-resveratrol to lead this
compound specifically into the binding pocket of MIF. In
accordance with this finding, compounds 2 and 3, but not 1,
exerted an inhibitory effect on the tautomerase activity of
MIF (Fig. 4).
Acknowledgements We thank Eiko Honda for performing the
MALDI-TOF MASS spectrometry, Yoshitaka Horiuchi for the micro-
scopic analysis and Tomoko Kitayama for cell experiments.
Disclosure of potential conflicts of interest No potential conflicts
of interests were disclosed.
Several small-molecule tautomerase inhibitors of MIF
have been identified so far, and these molecules have
shown some inhibitory effects on MIF-dependent cell
migration and glucocorticoid regulation [1, 48], although
none have inhibited cell proliferation as effectively as
compound 3. MIF signal transduction is initiated by the
binding of MIF to the transmembrane protein CD74 [11,
Funding This work was supported by funds for the Comprehensive
3
rd term of the 10-Year Strategy for Cancer Control, a Grant-in-Aid
for Scientific Research from the Ministry of Education, Culture,
Sports, Science and Technology of Japan (19209018).
1
2]. Accordingly, a small molecule would not inhibit the
References
biological activity of MIF with regard to cell growth unless
it was capable of impairing MIF-CD74 binding, even if it
functions as a tautomerase inhibitor of MIF. Recently,
Cournia et al. performed a virtual screening by docking
compounds from a virtual library into the MIF tautomerase
active site, and among the compounds with positive results,
several compounds that also inhibit MIF-CD74 binding
were experimentally identified. According to their elaborate
MIF-CD74 binding assay, the IC50 values of some of these
1
. Calandra T, Bernhagen J, Metz CN, Spiegel LA, Bacher M,
Donnelly T, Cerami A, Bucala R (1995) MIF as a glucocorticoid-
induced modulator of cytokine production. Nature 377:68–71
2. Bernhagen J, Calandra T, Mitchell RA, Martin SB, Tracey KJ,
Voelter W, Manogue KR, Cerami A, Bucala R (1993) MIF is a
pituitary-derived cytokine that potentiates lethal endotoxaemia.
Nature 365:756–759
3
. Meyer-Siegler KL, Iczkowski KA, Leng L, Bucala R, Vera PL
(2006) Inhibition of macrophage migration inhibitory factor or its

Invest New Drugs (2012) 30:1878–1886
1885
receptor (CD74) attenuates growth and invasion of DU-145
prostate cancer cells. J Immunol 177:8730–8739
DJ, Al-Abed Y (2002) Inhibition of MIF bioactivity by rational
design of pharmacological inhibitors of MIF tautomerase activity.
J Med Chem 45:2410–2416
4
. Hagemann T, Robinson SC, Thompson RG, Charles K, Kulbe H,
Balkwill FR (2007) Ovarian cancer cell-derived migration
inhibitory factor enhances tumor growth, progression, and
angiogenesis. Mol Cancer Ther 6:1993–2002
. Meyer-Siegler K (2000) Increased stability of macrophage
migration inhibitory factor (MIF) in DU-145 prostate cancer cells.
J Interferon Cytokine Res 20:769–778
. del Vecchio MT, Tripodi SA, Arcuri F, Pergola L, Hako L, Vatti R,
Cintorino M (2000) Macrophage migration inhibitory factor in
prostatic adenocarcinoma: correlation with tumor grading and
combination endocrine treatment-related changes. Prostate 45:51–57
. Hudson JD, Shoaibi MA, Maestro R, Carnero A, Hannon GJ,
Beach DH (1999) A proinflammatory cytokine inhibits p53 tumor
suppressor activity. J Exp Med 190:1375–1382
. Fingerle-Rowson G, Petrenko O, Metz CN, Forsthuber TG,
Mitchell R, Huss R, Moll U, Muller W, Bucala R (2003) The
p53-dependent effects of macrophage migration inhibitory factor
revealed by gene targeting. Proc Natl Acad Sci USA 100:9354–
20. Crichlow GV, Cheng KF, Dabideen D, Ochani M, Aljabari B,
Pavlov VA, Miller EJ, Lolis E, Al-Abed Y (2007) Alternative
chemical modifications reverse the binding orientation of a
pharmacophore scaffold in the active site of macrophage migra-
tion inhibitory factor. J Biol Chem 282:23089–23095
21. Dabideen DR, Cheng KF, Aljabari B, Miller EJ, Pavlov VA,
Al-Abed Y (2007) Phenolic hydrazones are potent inhibitors
of macrophage migration inhibitory factor proinflammatory
activity and survival improving agents in sepsis. J Med Chem
5:1993–1997
22. Al-Abed Y, Dabideen D, Aljabari B, Valster A, Messmer D,
Ochani M, Tanovic M, Ochani K, Bacher M, Nicoletti F, Metz C,
Pavlov VA, Miller EJ, Tracey KJ (2005) ISO-1 binding to the
tautomerase active site of MIF inhibits its pro-inflammatory
activity and increases survival in severe sepsis. J Biol Chem
280:36541–36544
5
6
7
8
23. Cheng KF, Al-Abed Y (2006) Critical modifications of the ISO-1
scaffold improve its potent inhibition of macrophage migration
inhibitory factor (MIF) tautomerase activity. Bioorg Med Chem
Lett 16:3376–3379
9
359
9
. Mitchell RA, Liao H, Chesney J, Fingerle-Rowson G, Baugh J,
David J, Bucala R (2002) Macrophage migration inhibitory factor
(
MIF) sustains macrophage proinflammatory function by inhibiting
24. Cournia Z, Leng L, Gandavadi S, Du X, Bucala R, Jorgensen WL
(2009) Discovery of human macrophage migration inhibitory
factor (MIF)-CD74 antagonists via virtual screening. J Med Chem
52:416–424
25. Winner M, Meier J, Zierow S, Rendon BE, Crichlow GV, Riggs R,
Bucala R, Leng L, Smith N, Lolis E, Trent JO, Mitchell RA
(2008) A novel, macrophage migration inhibitory factor suicide
substrate inhibits motility and growth of lung cancer cells. Cancer
Res 68:7253–7257
26. Brown KK, Blaikie FH, Smith RA, Tyndall JD, Lue H, Bernhagen
J, Winterbourn CC, Hampton MB (2009) Direct modification of
the proinflammatory cytokine macrophage migration inhibitory
factor by dietary isothiocyanates. J Biol Chem 284:32425–32433
27. Langcake P, Pryce RJ (1977) A new class of phytoalexins from
grapevines. Experientia 33:151–152
28. Hain R, Bieseler B, Kindl H, Schroder G, Stocker R (1990)
Expression of a stilbene synthase gene in Nicotiana tabacum
results in synthesis of the phytoalexin resveratrol. Plant Mol Biol
15:325–335
p53: regulatory role in the innate immune response. Proc Natl Acad
Sci USA 99:345–350
0. Nguyen MT, Lue H, Kleemann R, Thiele M, Tolle G, Finkelmeier
D, Wagner E, Braun A, Bernhagen J (2003) The cytokine
macrophage migration inhibitory factor reduces pro-oxidative
stress-induced apoptosis. J Immunol 170:3337–3347
1. Leng L, Metz CN, Fang Y, Xu J, Donnelly S, Baugh J, Delohery T,
Chen Y, Mitchell RA, Bucala R (2003) MIF signal transduction
initiated by binding to CD74. J Exp Med 197:1467–1476
2. Shi X, Leng L, Wang T, Wang W, Du X, Li J, McDonald C, Chen
Z, Murphy JW, Lolis E, Noble P, Knudson W, Bucala R (2006)
CD44 is the signaling component of the macrophage migration
inhibitory factor-CD74 receptor complex. Immunity 25:595–606
3. Nguyen MT, Beck J, Lue H, Funfzig H, Kleemann R, Koolwijk P,
Kapurniotu A, Bernhagen J (2003) A 16-residue peptide fragment
of macrophage migration inhibitory factor, MIF-(50–65), exhibits
redox activity and has MIF-like biological functions. J Biol Chem
1
1
1
1
2
78:33654–33671
4. Jung H, Seong HA, Ha H (2008) Critical role of cysteine residue
1 of macrophage migration inhibitory factor (MIF) in MIF-
1
1
29. Soleas GJ, Diamandis EP, Goldberg DM (1997) Resveratrol: a
molecule whose time has come? And gone? Clin Biochem 30:91–
113
30. Goldberg DM, Tsang E, Karumanchiri A, Diamandis E, Soleas G,
Ng E (1996) Method to assay the concentrations of phenolic
constituents of biological interest in wines. Anal Chem 68:1688–
1694
8
induced inhibition of p53 activity. J Biol Chem 283:20383–20396
5. Lubetsky JB, Dios A, Han J, Aljabari B, Ruzsicska B, Mitchell R,
Lolis E, Al-Abed Y (2002) The tautomerase active site of
macrophage migration inhibitory factor is a potential target for
discovery of novel anti-inflammatory agents. J Biol Chem
2
77:24976–24982
31. Mahyar-Roemer M, Katsen A, Mestres P, Roemer K (2001)
Resveratrol induces colon tumor cell apoptosis independently of
p53 and precede by epithelial differentiation, mitochondrial
proliferation and membrane potential collapse. Int J Cancer
94:615–622
1
1
6. Senter PD, Al-Abed Y, Metz CN, Benigni F, Mitchell RA,
Chesney J, Han J, Gartner CG, Nelson SD, Todaro GJ, Bucala
R (2002) Inhibition of macrophage migration inhibitory factor
(
MIF) tautomerase and biological activities by acetaminophen
metabolites. Proc Natl Acad Sci USA 99:144–149
32. Tinhofer I, Bernhard D, Senfter M, Anether G, Loeffler M,
Kroemer G, Kofler R, Csordas A, Greil R (2001) Resveratrol, a
tumor-suppressive compound from grapes, induces apoptosis via a
novel mitochondrial pathway controlled by Bcl-2. Faseb J
15:1613–1615
33. Jang M, Cai L, Udeani GO, Slowing KV, Thomas CF, Beecher
CW, Fong HH, Farnsworth NR, Kinghorn AD, Mehta RG, Moon
RC, Pezzuto JM (1997) Cancer chemopreventive activity of
resveratrol, a natural product derived from grapes. Science
275:218–220
7. Orita M, Yamamoto S, Katayama N, Aoki M, Takayama K,
Yamagiwa Y, Seki N, Suzuki H, Kurihara H, Sakashita H,
Takeuchi M, Fujita S, Yamada T, Tanaka A (2001) Coumarin and
chromen-4-one analogues as tautomerase inhibitors of macro-
phage migration inhibitory factor: discovery and X-ray crystal-
lography. J Med Chem 44:540–547
8. Zhang X, Bucala R (1999) Inhibition of macrophage migration
inhibitory factor (MIF) tautomerase activity by dopachrome
analogs. Bioorg Med Chem Lett 9:3193–3198
1
1
9. Dios A, Mitchell RA, Aljabari B, Lubetsky J, O’Connor K, Liao
H, Senter PD, Manogue KR, Lolis E, Metz C, Bucala R, Callaway
34. Pervaiz S (2003) Resveratrol: from grapevines to mammalian
biology. Faseb J 17:1975–1985

1
3
886
Invest New Drugs (2012) 30:1878–1886
5. Stivala LA, Savio M, Carafoli F, Perucca P, Bianchi L, Maga G,
Forti L, Pagnoni UM, Albini A, Prosperi E, Vannini V (2001)
Specific structural determinants are responsible for the antioxidant
activity and the cell cycle effects of resveratrol. J Biol Chem
42. Li Y, Liu J, Liu X, Xing K, Wang Y, Li F, Yao L (2006)
Resveratrol-induced cell inhibition of growth and apoptosis in
MCF7 human breast cancer cells are associated with modulation
of phosphorylated Akt and caspase-9. Appl Biochem Biotechnol
135:181–192
2
76:22586–22594
3
6. Matsuoka A, Takeshita K, Furuta A, Ozaki M, Fukuhara K,
Miyata N (2002) The 4′-hydroxy group is responsible for the in
vitro cytogenetic activity of resveratrol. Mutat Res 521:29–35
7. Murias M, Handler N, Erker T, Pleban K, Ecker G, Saiko P,
Szekeres T, Jager W (2004) Resveratrol analogues as selective
cyclooxygenase-2 inhibitors: synthesis and structure-activity
relationship. Bioorg Med Chem 12:5571–5578
43. Pozo-Guisado E, Alvarez-Barrientos A, Mulero-Navarro S,
Santiago-Josefat B, Fernandez-Salguero PM (2002) The antipro-
liferative activity of resveratrol results in apoptosis in MCF-7 but
not in MDA-MB-231 human breast cancer cells: cell-specific
alteration of the cell cycle. Biochem Pharmacol 64:1375–1386
44. Tang HY, Shih A, Cao HJ, Davis FB, Davis PJ, Lin HY (2006)
Resveratrol-induced cyclooxygenase-2 facilitates p53-dependent
apoptosis in human breast cancer cells. Mol Cancer Ther 5:2034–
2042
45. Gehm BD, McAndrews JM, Chien PY, Jameson JL (1997)
Resveratrol, a polyphenolic compound found in grapes and wine,
is an agonist for the estrogen receptor. Proc Natl Acad Sci USA
94:14138–14143
46. Joe AK, Liu H, Suzui M, Vural ME, Xiao D, Weinstein IB (2002)
Resveratrol induces growth inhibition, S-phase arrest, apoptosis,
and changes in biomarker expression in several human cancer cell
lines. Clin Cancer Res 8:893–903
47. Murias M, Jager W, Handler N, Erker T, Horvath Z, Szekeres T,
Nohl H, Gille L (2005) Antioxidant, prooxidant and cytotoxic
activity of hydroxylated resveratrol analogues: structure-activity
relationship. Biochem Pharmacol 69:903–912
3
3
3
4
8. Pagliai F, Pirali T, Del Grosso E, Di Brisco R, Tron GC, Sorba G,
Genazzani AA (2006) Rapid synthesis of triazole-modified
resveratrol analogues via click chemistry. J Med Chem 49:467–
4
70
9. Wang Z, Hsieh TC, Zhang Z, Ma Y, Wu JM (2004) Identification
and purification of resveratrol targeting proteins using immobi-
lized resveratrol affinity chromatography. Biochem Biophys Res
Commun 323:743–749
0. Tanaka K, Arao T, Maegawa M, Matsumoto K, Kaneda H, Kudo
K, Fujita Y, Yokote H, Yanagihara K, Yamada Y, Okamoto I,
Nakagawa K, Nishio K (2009) SRPX2 is overexpressed in gastric
cancer and promotes cellular migration and adhesion. Int J Cancer
1
24:1072–1080
1. Pozo-Guisado E, Lorenzo-Benayas MJ, Fernandez-Salguero PM
2004) Resveratrol modulates the phosphoinositide 3-kinase
4
(
48. Leech M, Metz C, Bucala R, Morand EF (2000) Regulation of
macrophage migration inhibitory factor by endogenous glucocorti-
coids in rat adjuvant-induced arthritis. Arthritis Rheum 43:827–833
pathway through an estrogen receptor alpha-dependent mechanism:
relevance in cell proliferation. Int J Cancer 109:167–173