Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs

Article abstract of DOI:10.1016/j.chembiol.2018.05.015

Potential RNA drug targets for small molecules are found throughout the human transcriptome, yet small molecules known to elicit a pharmacological response by directly targeting RNA are limited to antibacterials. Herein, we describe AbsorbArray, a small molecule microarray-based approach that allows for unmodified compounds, including FDA-approved drugs, to be probed for binding to RNA motif libraries in a massively parallel format. Several drug classes bind RNA including kinase and topoisomerase inhibitors. The latter avidly bound the motif found in the Dicer site of oncogenic microRNA (miR)-21 and inhibited its processing both in vitro and in cells. The most potent compound de-repressed a downstream protein target and inhibited a miR-21-mediated invasive phenotype. The compound's activity was ablated upon overexpression of pre-miR-21. Target validation via chemical crosslinking and isolation by pull-down showed direct engagement of pre-miR-21 by the small molecule in cells, demonstrating that RNAs should indeed be considered druggable. RNA is an emerging target for small molecules, but has it been an established one all along? Velagapudi et al. profiled the binding of medicines to thousands of RNA motifs, showing that broad drug classes bind RNA. Indeed, approved anti-cancer drugs target an oncogenic non-coding RNA, affecting its phenotype.

Full text of DOI:10.1016/j.chembiol.2018.05.015

Article
Approved Anti-cancer Drugs Target Oncogenic Non-
coding RNAs
Graphical Abstract
Authors
Sai Pradeep Velagapudi,
Matthew G. Costales,
Balayeshwanth R. Vummidi, ...,
Arnab K. Chatterjee,
Jessica L. Childs-Disney,
Matthew D. Disney
Correspondence
disney@scripps.edu
In Brief
RNA is an emerging target for small
molecules, but has it been an established
one all along? Velagapudi et al. profiled
the binding of medicines to thousands of
RNA motifs, showing that broad drug
classes bind RNA. Indeed, approved anti-
cancer drugs target an oncogenic non-
coding RNA, affecting its phenotype.
Highlights
d
Broad classes of small molecule medicines bind RNA
d
Sequence-based design shows that approved medicines
target oncogenic microRNA-21
d
d
The medicines target microRNA-21 in cells, reversing
phenotype in cancer cells
Oncogenic non-coding RNAs could be an established drug
target all along
Velagapudi et al., 2018, Cell Chemical Biology 25, 1–9
September 20, 2018 ª 2018 Elsevier Ltd.
https://doi.org/10.1016/j.chembiol.2018.05.015

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
Cell Chemical Biology
Article
Approved Anti-cancer Drugs
Target Oncogenic Non-coding RNAs
Sai Pradeep Velagapudi,1 Matthew G. Costales,1 Balayeshwanth R. Vummidi,1 Yoshio Nakai,1 Alicia J. Angelbello,1
Tuan Tran,1 Hafeez S. Haniff,1 Yasumasa Matsumoto,1 Zi Fu Wang,1 Arnab K. Chatterjee,2 Jessica L. Childs-Disney,1
and Matthew D. Disney1,3,
*
1Department of Chemistry, The Scripps Research Institute, 130 Scripps Way, Jupiter, FL 33458, USA
2California Institute for Biomedical Research (CALIBR), 11119 North Torrey Pines Road, Suite 100, La Jolla, CA 92037, USA
3Lead Contact
*Correspondence: disney@scripps.edu
https://doi.org/10.1016/j.chembiol.2018.05.015
SUMMARY
directly delivered to the CNS, however, side effects have been
observed, ranging from stimulating an immune response to
Potential RNA drug targets for small molecules are thrombocytopenia (Frazier, 2015).
Small molecules could be a preferred modality for targeting
found throughout the human transcriptome, yet
small molecules known to elicit a pharmacological
response by directly targeting RNA are limited to
antibacterials. Herein, we describe AbsorbArray, a
small molecule microarray-based approach that
allows for unmodified compounds, including FDA-
approved drugs, to be probed for binding to RNA
motif libraries in a massively parallel format. Several
drug classes bind RNA including kinase and topo-
isomerase inhibitors. The latter avidly bound the
RNA; however, these compounds have been generally limited
to antibiotics that target the three-dimensional structure of the
ribosome (Blount and Breaker, 2006; Poehlsgaard and Douth-
waite, 2005; Tenson and Mankin, 2006) or riboswitches (Blount
and Breaker, 2006). Indeed, compounds targeting nucleic acids,
including antisense, are known to bind to proteins as well (Ivanov
et al., 1998; Liang et al., 2015). Compounds have been identified
to target RNA by using various methods including screening,
structure-based design, and sequence-based design, cement-
ing RNA as a potentially broad small molecule drug target. One
motif found in the Dicer site of oncogenic microRNA class of non-coding RNAs that has been extensively targeted
by small molecules are viral RNAs. The first viral RNA regulatory
elements shown to be bound and interfered with by small mole-
(miR)-21 and inhibited its processing both in vitro and
in cells. The most potent compound de-repressed a
downstream protein target and inhibited a miR-21-
mediated invasive phenotype. The compound’s ac-
tivity was ablated upon overexpression of pre-miR-
21. Target validation via chemical crosslinking and
isolation by pull-down showed direct engagement
of pre-miR-21 by the small molecule in cells, demon-
cules were the HIV transactivation response (Mei et al., 1995)
and Rev response element (Zapp et al., 1993). Other viral
RNAs, such as the hepatitis C virus internal ribosomal entry
site and influenza A, have been focus of several targeting studies
(Dibrov et al., 2014; Lee et al., 2014). Recently, several small mol-
ecules have been designed to target nucleotide repeat expan-
sions including fragile X-associated tremor ataxia syndrome
strating that RNAs should indeed be considered
druggable.
(CGG) (Yang et al., 2016), myotonic dystrophy type 1 ( CUG)
(Gareiss et al., 2008; Jahromi et al., 2013; Pushechnikov et al.,
2009), myotonic dystrophy type 2 (CCUG) (Childs-Disney et al.,
2014), Huntington’s disease (CAG) (Kumar et al., 2012), and fron-
totemporal dementia and amyotrophic lateral sclerosis (G4C2)
(Su et al., 2014). A salient question is if small molecules that
INTRODUCTION
RNA plays important roles in nearly every cellular process and its target non-coding RNAs can be identified and developed into
dysregulation can contribute to disease (Calin and Croce, 2006; medicines or chemical probes.
Cooper et al., 2009). The Encyclopedia of DNA Elements
A way to evaluate the druggability of RNA is to study if known
(ENCODE) project and subsequent analyses showed that only drugs bind it and affect physiologically important pathways.
1%–2% of our genome encodes for protein, yet ca. 80% of it Perhaps non-coding human RNAs are targeted with approved
is transcribed into RNA (ENCODE Project Consortium, 2012) drugs in their clinical settings, but these interactions have gone
Although the amount of functional non-coding RNAs is contro- unidentified. The focus of this work is to study the potential of
versial, it is clear that they carry out essential cellular functions.
RNA as a small molecule drug target using known drug classes.
The development of therapeutics that target RNA has mostly Unmodified drugs were probed for binding RNA motifs using a
centered on using oligonucleotides. They are invaluable tools non-covalent small-molecule microarray (AbsorbArray) in a
that have been advanced to multiple clinical trials. For example, massively parallel library-versus-library screening approach
in late 2016 an antisense agent was approved to treat spinal dubbed two-dimensional combinatorial screening (2DCS)
muscular atrophy, a devastating and heretofore incurable dis- (Childs-Disney et al., 2007; Disney et al., 2008). Indeed, various
ease (Morrow, 2017). When antisense oligonucleotides are not drug classes including kinase inhibitors, pre-mRNA splicing
Cell Chemical Biology 25, 1–9, September 20, 2018 ª 2018 Elsevier Ltd.
1

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
Figure 1. The Development of AbsorbArray and the RNA Motif Libraries Used to Study Small Molecule Binding
(A) Representative image of an AbsorbArray chip after spotting mitoxantrone before and after washing.
(B) Plot of the signal from mitoxantrone before and after washing.
(C) Secondary structures of the nucleic acids used in this study.
(D) Representative image of an AbsorbArray-enabled 2DCS screen (85.5 3 127.8 3 1.1 mm; width 3 height 3 thickness).
(E) Structures of various small molecules that are found to bind RNA in this AbsorbArray-enabled 2DCS experiment.
See also Figure S1 and Table S1.
modulators, and topoisomerase inhibitors bound RNA avidly. By probed for binding to radiolabeled RNA motif libraries (Figures
mining Inforna, a sequence-based lead identification strategy for 1C and 1D). To validate the platform, we probed the binding of
RNA (Velagapudi et al., 2014), it was found that topoisomerase the following compounds to RNA motifs via AbsorbArray and
inhibitors bound the Dicer site of the microRNA (miR)-21 precur- 2DCS (Disney et al., 2008): the NIH Clinical Collection (NIH-CC),
sor (pre-miR-21). In cells, these compounds reduced mature a library of 727 pharmacologically active compounds used in hu-
miR-21 levels and modulated a miR-21-mediated invasive man clinical trials; kinase inhibitors known to modulate RNA
phenotype, as miR-21 is oncogenic. Importantly, chemical biology but not known to directly engage RNA (SYNlibrary95,
crosslinking and isolation by pull-down (Chem-CLIP) (Guan Synkinase; n = 95); an RNA-focused library (n = 201) (Rzuczek
and Disney, 2013; Rzuczek et al., 2017; Yang et al., 2015) studies et al., 2015); and three compounds that modulate the alternative
revealed physical interactions between pre-miR-21 and the splicing of survival motor neuron 2 (Naryshkin et al., 2014; Pala-
small molecule.
cino et al., 2015). As many of the compounds in these studies
have been used in clinical trials, they provide a potentially rich
source of drugs that can be re-purposed to target RNA.
In brief, the array was hybridized with a 32P-labeled RNA li-
RESULTS
Development of AbsorbArray
brary displaying randomized nucleotides in the pattern of a 3 3
To develop an approach that allowed for unmodified compound 2 nucleotide internal loop (3 3 2 ILL; Figure 1C). The 1,024 mem-
libraries to be probed for binding to a library of RNA motifs, we ber 3 3 2 ILL was chosen as it contains asymmetric ILLs and
looked to advances in small molecule microarrays. Small bulges present in various cellular RNAs that are of high impor-
molecule microarrays have been invaluable tools to identify tance, as described previously via a transcriptome-wide RNA
compounds that bind biomolecules; however, compounds are structural analysis (Liu et al., 2016). Incubation was completed
immobilized by adding functional groups that allow for covalent in the presence of excess oligonucleotides that include tRNA,
attachment (Hergenrother et al., 2000; MacBeath et al., 1999; DNA, and mimics of the regions common to all library members
MacBeath and Schreiber, 2000). Such modifications could affect (Figure 1C), ensuring interaction of the small molecules with the
molecular recognition of the parent compound’s natural targets. randomized region (Figure 1D). These studies defined a series
Herein, we describe an approach named AbsorbArray (Figure 1) of compounds and compound classes as RNA binders (Fig-
that allows small molecules to be non-covalently adhered onto a ure 1D), including topoisomerase inhibitors, kinase inhibitors,
surface and probed for binding to a library of RNA motifs and splicing modulators (Figure 1E). Importantly, several unique
found in non-coding RNAs. By testing various conditions, we small molecules (hits derived from the RNA-focused library) were
found that small molecules can be absorbed onto hydrated discovered using this platform (Figure 1E).
agarose-coated microarray surfaces that are subsequently dried
(Figure S1).
The RNA motifs from 3 3 2 ILL that bound each compound
were harvested from the array surface and sequenced. To score
the relative affinities of the selected RNA motifs, an approach
called high-throughput structure-activity relationships through
sequencing (HiT-StARTS) was applied (Velagapudi et al.,
Identification of Small Molecules that Bind RNA Motifs
via AbsorbArray and 2DCS
AbsorbArray allows for unmodified small molecules to be re- 2017). In HiT-StARTS, the frequency of each RNA bound to a
tained on a surface after washing (Figures 1A and 1B) and then small molecule is compared with its frequency in the starting
2
Cell Chemical Biology 25, 1–9, September 20, 2018

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
Table 1. Global Analysis of Selected RNA Motif-Small Molecule Interactions and Binding Affinities of Topoisomerase Inhibitors to
the A Bulge in the Dicer Site of pre-miR-21 and the Corresponding Fully Paired RNA
Compound
Range of Zobs for Binders
No. of Binders
Range of Kd Values for Binders (nM)
A Bulge
58 7.6
24 8.1
33 3.3
Base Paired Control
>1000
1
2
3
28–8
37–8
39–8
371
281
213
20–550
6–35
1080 231
>1000
10–26
K
d values are reported in nM. See also Figure S2 and Table S1.
library, as determined by RNA-seq analysis. This pooled et al., 2009; Yan et al., 2008), and has been a focus of various
population comparison quantifies the statistical significance of small molecule targeting efforts, miR-21 was further studied.
enrichment, or the parameter Zobs. HiT-StARTS quickly identifies
Inforna identified that topoisomerase inhibitors 1, 2, and 3 bind
binding and non-binding RNA motifs for a specific small the A bulge in the Dicer site of the miR-21 hairpin precursor
molecule and minimizes false negatives and positives. Binding (Figure 2A). Compounds 1 and 3 were previously observed to
assays were completed between selected RNA motif-small stabilize single-stranded regions of RNA by nuclear magnetic
molecule pairs, revealing high affinity and selective binding resonance (NMR) spectroscopy (Marcheschi et al., 2009; Zheng
when Zobs > 8 (Table 1), as observed previously (Velagapudi et al., 2009), supporting the hypothesis that these compounds
et al., 2017) and highlighting the predictive value of HiT-StARTS. can bind to the A bulge. We therefore measured the affinity of
Fitness scores are assigned for RNA binders by normalizing each compound to the A bulge of miR-21 (Figure S2), affording
Zobs values to the highest Zobs for a given selection, with the Kd values of 58 7.6, 24 8.1, and 33 3.3 nM for 1, 2, and 3,
best score assigned a value of 100 (Velagapudi et al., 2014).
respectively (Table 1; Figure S2B). Notably, binding was not
saturable for compounds 1 and 3 to a fully base paired RNA up
to 5,000 nM; binding of 2 to the fully paired RNA was 28-fold
weaker than to the A bulge, with a Kd of 1,080 231 nM (Table 1;
Inforna Identifies Oncogenic miRNA Targets from
AbsorbArray
The RNA motifs identified by 2DCS of the NIH-CC were mined Figure S2C). Interestingly, 3 also binds the U bulge adjacent to
against the RNA motifs in all human miRNA precursors (Velaga- the Dicer site with high affinity, as predicted by Inforna, with a
pudi et al., 2014) to identify potential oncogenic miRNA targets. dissociation constant of 46 7.1 nM. Increased avidity of 3 is
Several compounds were predicted to bind Drosha or Dicer pro- observed to an RNA that contains both the A and U bulges
cessing sites (Table S1). To further refine the RNA targets, we (Kd = 22 8.3 nM) (Figure S2). Despite the dynamics of RNA
compared the relative expression profiles of the potential miRNA structure, both the A and U bulge regions in the miR-21 hairpin
hits (Table S1) from publicly available databases using miRmine precursor have been observed by NMR spectroscopy (Chirayil
(Panwar et al., 2017). miR-21 was found to be expressed at 30- et al., 2014). Additional binding analyses, using microscale ther-
to 4,000-fold higher expression compared with other potential mophoresis (Moon et al., 2018; Seidel et al., 2013), indicated the
miRNA targets. As the oncomiR is upregulated in most cancers binding affinity of 3 to a miR-21 hairpin containing both the A and
(Volinia et al., 2006), contributes to various cancer phenotypes U bulge (miR-21 Hairpin, Figure S2D) and a miR-21 hairpin con-
(Chan et al., 2005; du Rieu et al., 2010; Meng et al., 2007; Seike taining only the A bulge (miR-21 A Bulge, Figure S2E) as 500 and
Figure 2. Inhibition of Dicer Processing of
pre-miR-21 In Vitro and in Cells
(A) Secondary structure of the miR-21 hairpin
precursor.
(B) Representative gel image of the inhibition of
Dicer processing of pre-miR-21 by 3.
(C) Effect of 1, 2, and 3 on mature levels in triple
negative breast cancer cell line MDA-MB-231.
(D) Effect of 1, 2, and 3 on pre-miR-21 levels
in triple negative breast cancer cell line MDA-
MB-231.
(E) Effect of 3, an LNA oligonucleotide targeting
miR-21 (LNA-21; Exiqon, 4100689-101), and a
control LNA (Scramble; Exiqon, 199006-102) on
PTEN using a luciferase reporter assay.
*p < 0.05, **p < 0.01, as determined by a two-
tailed Student t test. Data represent means SEM
of biological triplicates. See also Figures S2
and S3.
Cell Chemical Biology 25, 1–9, September 20, 2018
3

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
Figure 3. Effect of 3 on DNA Damage
(A) Representative confocal microscopy images
of the effect of 3 on DNA damage in MDA-MB-
231 cells by staining for g-H2AX foci. Scale bar,
20 mm.
(B) Quantification of DNA damage upon treatment
of MDA-MB-231 cells with 3. *p < 0.05, **p < 0.01,
as determined by a two-tailed Student t test.
Data represent mean
SD of fluorescence in-
tensity across eight images. See also Figure S4.
300 nM, respectively. Notably, no binding was observed to a suppressor phosphatase and tensin homolog deleted on chro-
miR-21 base pair control without the A and U bulges (miR-21 mosome 10 (PTEN) (Li et al., 1997), using a previously validated
Base Pair, Figure S2F). As 3 showed high affinity for both the A luciferase reporter (O’Donnell et al., 2005) (Figure 2E).
and U bulges found in miR-21, compound 3 was tested for inhi-
The most widely accepted mode of action for 3 is DNA interca-
bition of pre-miR-21 Dicer processing in vitro. A dose response lation, leading to crosslinks and strand breaks (Lown et al.,
was observed with a half maximal inhibitory concentration 1984). We therefore studied if the concentration required to
(IC50) of ꢀ3 mM (Figure 2B). We next completed a mutational reduce mature miR-21 levels also causes DNA damage. DNA
analysis to study the effect of small molecule binding to both damage was assessed by imaging g-H2AX foci that form in
bulges. Removing the A bulge at the Dicer site (pre-miR-21 response to DNA double-strand breaks (Pilch et al., 2003; Roga-
A22 mutant) signficantly ablates compound activity while kou et al., 1999). These studies showed that both DNA damage
removing the U bulge (pre-miR-21 U27 mutant) does not and a reduction of miR-21 levels were observed at the active
(Figure S3). These studies also show that 3 does not globally concentration of 1 mM (Figures 3 and S4A). We also tested the
(non-selectively) inhibit Dicer enzyme activity (Figure S3). Thus, effect of 3 on topoisomerase II activity in vitro and found an inhib-
this class of compounds, known to affect cellular processes by itory effect of 3 at 1 mM (Figures S4B–S4D).
targeting DNA (Binaschi et al., 1995), might also elicit anti-cancer
effects by affecting the biogenesis of miR-21.
Compound 3 Inhibits an miR-21-Mediated Invasive
Phenotype
As previous studies have shown that miR-21 contributes to
Activity of Lead Compounds
Compounds 1, 2, and 3 are readily taken up into cells and localize a migratory and invasive phenotype (Huang et al., 2009; Zhu
in both the cytoplasm and nucleus (Feofanov et al., 1997; Shaul et al., 2008), we next studied if inhibition of miR-21 by 3 was
et al., 2013). Therefore, the efficacy of the topoisomerase inhibi- sufficient to induce a reversal of phenotype in MDA-MB-231 cells
tors for inhibiting biogenesis of miR-21 was tested in the triple- by using a Boyden chamber assay. Dose-dependent inhibition of
negative breast cancer cell line MDA-MB-231 by measuring invasive phenotype was observed (Figures 4A and 4B). Impor-
mature and pre-miR-21 levels by qRT-PCR. Indeed, all three tantly, the activity of 3 against an invasive phenotype is ablated
compounds reduced levels of the mature miR-21 (Figure 2C) by overexpression of pre-miR-21 (Figure 4C), indicating that
and increased levels of pre-miR-21 (Figure 2D). The IC50 values the effect is via a miR-21-mediated circuit.
for 1, 2, and 3 for reducing mature miR-21 levels are approxi-
mately 5, 10, and 1 mM, respectively. As 3 most significantly Compound 3 Binds pre-miR-21 in Cells as Determined
increased pre-miR-21 levels (Figure 2D), it was further character- by Chem-CLIP
ized for de-repressing a downstream protein target. Indeed, To further evaluate whether 3 directly engages pre-miR-21 in
3 de-repressed the downstream effect of miR-21 on the tumor cells, we used Chem-CLIP, a small molecule-RNA profiling
Figure 4. Evaluation of Phenotypic Ef-
fects of 3
(A) Representative images of reduced invasion
observed in MDA-MB-231 cells after miR-21 inhi-
bition through 3 treatment (1 mM). Cells allowed to
invade through Matrigel basement membrane
matrix for 16 hr at 37ꢁC using a Boyden chamber
assay. Cells that invaded the matrix were fixed with
1% paraformaldehyde and stained with 0.1%
crystal violet for visualization. Scale bar, 200 mm.
(B) Quantification of cell invasion shown in (A) (two
biological replicates, four fields of view).
(C) Effect on invasion upon treatment with 3 (10 mM)
when pre-miR-21 is overexpressed via transfection
of a miR-21 plasmid in MDA-MB-231 cells.
**p < 0.01, as determined by a two-tailed Student
t test.
4
Cell Chemical Biology 25, 1–9, September 20, 2018

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
Figure 5. Chem-CLIP Target Validation
Studies of 3 in MDA-MB-231 Cells
(A) Structures of 10, 3-CA-Biotin, which is
comprised of the RNA-binding module 3, a biotin
purification module and a crosslinking chlorambucil
(CA) module, and control compound 11 (Control
CA-Biotin), which lacks the RNA-binding module.
(B) Chem-CLIP of pre-miR-21 using 1 mM of 10 in
MDA-MB-231 cells and Competitive-Chem-CLIP
(C-Chem-CLIP) of pre-miR-21 in MDA-MB-231
cells by using increasing concentrations of 3 to
compete with 10 for binding (1 mM). *p < 0.05, **p <
0.01, as determined by
a two-tailed Student
t test. Data represent means SEM of biological
triplicates.
See also Figure S5.
approach (Guan and Disney, 2013; Su et al., 2014). A Chem-CLIP (only a singular binding site is present in pre-let-7e and pre-
probe was synthesized by appending a biotin and a chlorambucil miR-25) and its comparatively much higher expression level.
crosslinking module onto 3 to afford compound 10 (Figure 5A).
Compound 10 crosslinks with its cellular RNA targets, and the re- DISCUSSION
sulting small-molecule-RNA conjugates are harvested by biotin
capture. Both in vitro and in cells, 10 reacted with pre-miR-21 This study has shown that various drug classes have the capac-
(Figures 5B, S5A, and S5B). Importantly, co-addition of parent ity to bind RNA, including topoisomerase inhibitors that affect
3 and 10 in cells (competitive Chem-CLIP) decreased the extent a key non-coding, oncogenic miRNA. It has been suggested
of pull-down of pre-miR-21 in a dose-dependent manner (Fig- previously that topoisomerase inhibitors including doxorubicin
ure 5B), thus proving that 3 binds its RNA target in cells. have non-topoisomerase II inhibitory activity that results in
Chem-CLIP was also performed on 11 (Figure 5A), which lacks apoptosis in cancer cells (Swift et al., 2006). Thus, our studies
the RNA-binding module; no enrichment of miR-21 was may be another example of compounds whose activity can be
observed in the pulled down fractions, whether in vitro or in cells, traced to affecting multiple pathways. Other classes of small
as expected (Figures S5A and S5C). Enrichment levels of miR-21 molecules have been shown to target RNA in addition to their
were normalized to levels of mature miR-21 after treatment with previously known target. For example, the target of the antibac-
10 or 11 (Figure S5D).
terial roseoflavin, the flavin mononucleotide riboswitch, was not
uncovered until the discovery of riboswitches (Lee et al., 2009).
Aggressive activity in re-purposing known drugs has revealed
Selectivity of 3
The selectivity of 3 for inhibiting miR-21 was measured by using many additional targets across all types of biomolecules. It is
RT-qPCR, in particular by studying its effect on miRNAs that likely that many drugs affect multiple pathways, some known
contain the same motifs in pre-miR-21’s Dicer site, or RNA iso- and others unknown, to provide a therapeutic effect.
forms. Previous studies have identified that the expression levels
Extensive effort has been made to identify compounds that
of miRNAs will most likely be affected if the small molecule binds target miR-21 (Shortridge and Varani, 2015). Although several
in a biologically important site, such as Dicer or Drosha process- compounds have been shown to bind miR-21 in vitro (Connelly
ing sites (Velagapudi et al., 2014). Therefore, we queried a et al., 2017), only a few inhibit miR-21 levels in cells (Gumireddy
database of miRNA secondary structures to identify precursor et al., 2008; Naro et al., 2015; Shortridge et al., 2017). Most of the
miRNAs that contain the same A and/or U bulges found at or compounds identified were either transcriptional inhibitors or did
adjacent to pre-miR-21’s Dicer processing sites (Figure 6A). not affect phenotype. Other studies showed that the aminogly-
Despite the presence of the A and/or U bulges in processing coside antibiotic streptomycin inhibited Dicer processing of
sites of other pre-miRNAs, only levels of miR-21 were affected pre-miR-21 and had a modest effect on apoptosis (about 25%)
(Figure 6B).
in MCF7 cells (Bose et al., 2012). As the RNA-targeting small
To determine if 3 does not inhibit levels of the other miRNAs molecule field emerges, careful consideration must be paid to
studied because it does not bind the target in cells, we completed the effect of compound on phenotype and its correlation with
Chem-CLIP studies for the RNA isoforms (Figure 6C). Binding is target modulation. In this study, it was found that 3 inhibited
observed to only two miRNAs, let-7e and miR-25; however, bind- levels of mature miR-21, concomitantly increased levels of
ing is not sufficient to reduce their mature levels. The binding site pre-miR-21, and reversed the invasive phenotype caused by
for 3 is located in the Dicer site of both pre-miRNAs (Liu et al., elevated expression of miR-21 in triple-negative breast cancer
2016); however, the lack of activity of 3 against let-7e and cells. These effects are ablated upon overexpression of pre-
miR-25 could be traced to the fact that both let-7e and miR-25 miR-21, giving further support to 3’s mechanism of action. An
are expressed at much lower levels compared with miR-21 additional and important implication of these studies is that
(7% and 3%, respectively, compared with miR-21). Collectively, known drugs have potential to bind RNA. In vitro phamacology
these results suggest that the enhanced anti-miR-21 activity studies on lead drug candidates only focuses at present on their
of 3 is due to the presence of two binding sites in pre-miR-21 libailies to affect key protiens. Perhaps, additional studies should
Cell Chemical Biology 25, 1–9, September 20, 2018
5

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
Figure 6. Selectivity Studies of 3
(A) Pre-miRNAs that contain the same A (blue box) and/or U bulge (green box) found in the Dicer site of pre-miR-21.
(B) Selectivity of 3 for miR-21 over other miRNAs with the same target A and/or U bulge, as determined by measuring mature miRNA levels by RT-qPCR. The
numbers in parentheses after the miRNA name indicate relative expression levels as compared with miR-21.
(C) Pull-down of other miRNAs that contain A and/or U bulges by 10. The numbers in parentheses after the miRNA name indicate relative expression level as
compared with miR-21.
*p < 0.05 as determined by a two-tailed Student t test; ND indicates mature miRNA levels were not detectable (Ct > 32). Data represent means SEM of biological
triplicates.
be completed to understand the effect of lead molecules on the lization. AbsorbArray was applied to the NIH Clinical Collec-
transcriptome as an additionl safety screen.
tion, a library of RNA-focused small molecules, RNA splicing
The utility of these compounds to study miR-21 biology as modulators, and a library of kinase inhibitors. Indeed, these
chemical probes, however, is likely limited due to the multiple ef- drugs, in particular topoisomerase inhibitors, kinase inhibi-
fects that the molecules have in cells. Other small molecules that tors, and RNA splicing modulators bind to RNAs. 2DCS
have perhaps better selectivity are more useful chemical probes and HiT-StARTS identified privileged motifs for each
and include compounds targeting the ribosome and ribos- small molecule, and overlap was identified with oncogenic
witches (Carter et al., 2000; Poehlsgaard and Douthwaite, 2005). miR-21. One topoisomerase inhibitor, 3, selectively inhibited
Of further interest is the observation that kinase inhibitors are a miR-21 biogenesis, de-repressed a downstream protein,
key compound class that target RNA. These compounds have and reversed an invasive phenotype in MDA-MB-231 cells.
garnered much attention as clinical candidates, and many others These studies suggest that many known drugs have affinity
are in pre-clinical development. It is also perhaps not surprising for RNA, and that RNA may indeed be one of their cellular
that these molecules target RNA given their penchant for having targets. Further, they lay the foundation for the rational re-
hydrogen bond donors and acceptors and the ability to stack purposing of known drugs.
with RNA bases. Thus, these molecules could be medicinally
optimized to drug RNA and reach a clinical endpoint.
STAR+METHODS
SIGNIFICANCE
Detailed methods are provided in the online version of this paper
and include the following:
Herein, we have developed a microarray-based method
dubbed AbsorbArray to identify the preferred RNA motifs
for unmodified small molecules. That is, the compounds
do not require installation of a functional group for immobi-
d KEY RESOURCE TABLE
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
d METHOD DETAILS
6
Cell Chemical Biology 25, 1–9, September 20, 2018

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
B General Nucleic Acids Methods
B Compound Libraries
Calin, G.A., and Croce, C.M. (2006). MicroRNA-cancer connection: the begin-
ning of a new tale. Cancer Res. 66, 7390–7394.
Carter, A.P., Clemons, W.M., Brodersen, D.E., Morgan-Warren, R.J.,
Wimberly, B.T., and Ramakrishnan, V. (2000). Functional insights from the
structure of the 30S ribosomal subunit and its interactions with antibiotics.
Nature 407, 340–348.
B Construction of AbsorbArray-assisted Small Molecule
Microarrays
B RNA Selection
B Reverse Transcription and PCR Amplification to Install
Barcodes for RNA-Seq
Chan, J.A., Krichevsky, A.M., and Kosik, K.S. (2005). MicroRNA-21 is an anti-
apoptotic factor in human glioblastoma cells. Cancer Res. 65, 6029–6033.
B In Vitro Dicer Processing Assay
B RNA Isolation and RT-qPCR
Childs-Disney, J.L., Wu, M., Pushechnikov, A., Aminova, O., and Disney, M.D.
(2007). A small molecule microarray platform to select RNA internal loop-ligand
interactions. ACS Chem. Biol. 2, 745–754.
B PTEN Luciferase Assay
B Imaging for DNA Damage
Childs-Disney, J.L., Yildirim, I., Park, H., Lohman, J.R., Guan, L., Tran, T.,
Sarkar, P., Schatz, G.C., and Disney, M.D. (2014). Structure of the myotonic
dystrophy type 2 RNA and designed small molecules that reduce toxicity.
ACS Chem. Biol. 9, 538–550.
B Boyden Chamber Invasion Assay
B In Vitro Chem-CLIP and C-Chem-CLIP
B Cellular Chem-CLIP and C-Chem-CLIP
B In Vitro Topoisomerase Inhibition Assay
B Fluorescent Binding Affinity Measurements
B Microscale Thermophoresis (MST) Binding Mea-
surements
Chirayil, S., Wu, Q., Amezcua, C., and Luebke, K.J. (2014). NMR characteriza-
tion of an oligonucleotide model of the miR-21 pre-element. PLoS One 9,
e108231.
Connelly, C.M., Boer, R.E., Moon, M.H., Gareiss, P., and Schneekloth, J.S., Jr.
(2017). Discovery of inhibitors of microRNA-21 processing using small mole-
cule microarrays. ACS Chem. Biol. 12, 435–443.
B Chemical Synthesis
d QUANTIFICATION AND STATISTICAL ANALYSIS
d DATA AND SOFTWARE AVAILABILITY
Cooper, T.A., Wan, L., and Dreyfuss, G. (2009). RNA and disease. Cell 136,
777–793.
}
´
´
´
Cserep, G.B., Baranyai, Z., Komaromy, D., Horvati, K., Bosze, S., and Kele, P.
(2014). Fluorogenic tagging of peptides via Cys residues using thiol-specific vi-
nyl sulfone affinity tags. Tetrahedron 70, 5961–5965.
SUPPLEMENTAL INFORMATION
Supplemental Information includes six figures and two tables and can
be found with this article online at https://doi.org/10.1016/j.chembiol.2018.
05.015.
Dibrov, S.M., Parsons, J., Carnevali, M., Zhou, S., Rynearson, K.D., Ding, K.,
Garcia Sega, E., Brunn, N.D., Boerneke, M.A., Castaldi, M.P., et al. (2014).
Hepatitis C virus translation inhibitors targeting the internal ribosomal entry
site. J. Med. Chem. 57, 1694–1707.
ACKNOWLEDGMENTS
Disney, M.D., Labuda, L.P., Paul, D.J., Poplawski, S.G., Pushechnikov, A.,
Tran, T., Velagapudi, S.P., Wu, M., and Childs-Disney, J.L. (2008). Two-dimen-
sional combinatorial screening identifies specific aminoglycoside-RNA inter-
nal loop partners. J. Am. Chem. Soc. 130, 11185–11194.
This work was funded by the Scheller Graduate Student Fellowship to M.G.C.,
a Swiss National Science Foundation Early Postdoc Mobility Fellowship to
B.R.V., and the National Institutes of Health (5R01GM097455) to M.D.D.
ENCODE Project Consortium (2012). An integrated encyclopedia of DNA ele-
ments in the human genome. Nature 489, 57–74.
AUTHOR CONTRIBUTIONS
Feofanov, A., Sharonov, S., Kudelina, I., Fleury, F., and Nabiev, I. (1997).
Localization and molecular interactions of mitoxantrone within living K562 cells
as probed by confocal spectral imaging analysis. Biophys. J. 73, 3317–3327.
M.D.D. directed the study, conceived of the ideas and designed experiments.
S.P.V. designed and performed experiments. M.G.C. performed cellular ex-
periments. T.T., B.R.V., Y.N., and H.S.H. performed 2DCS experiments.
A.J.A. performed gH2AX imaging for DNA damage. Y.M. made compounds
10 and 11. A.K.C. provided RNA splicing modulator library. J.L.C.-D. per-
formed in vitro Dicer experiment and wrote the paper, assisted by others.
Z.F.W. performed MST binding assays.
Frazier, K.S. (2015). Antisense oligonucleotide therapies: the promise and the
challenges from a toxicologic pathologist’s perspective. Toxicol. Pathol.
43, 78–89.
Gareiss, P.C., Sobczak, K., McNaughton, B.R., Palde, P.B., Thornton, C.A.,
and Miller, B.L. (2008). Dynamic combinatorial selection of molecules capable
of inhibiting the (CUG) repeat RNA-MBNL1 interaction in vitro: discovery of
lead compounds targeting myotonic dystrophy (DM1). J. Am. Chem. Soc.
130, 16254–16261.
DECLARATION OF INTERESTS
A patent application has been submitted on the Inforna software: Disney & Ve-
lagapudi, U.S. Patent Application 14/911,032.
Guan, L., and Disney, M.D. (2013). Covalent small molecule-RNA complex for-
mation enables cellular profiling of small molecule-RNA interactions. Angew.
Chem. Int. Ed. 52, 10010–10013.
Received: January 18, 2018
Revised: April 3, 2018
Gumireddy, K., Young, D.D., Xiong, X., Hogenesch, J.B., Huang, Q., and
Deiters, A. (2008). Small molecule inhibitors of microRNA miR-21 function.
Angew. Chem. Int. Ed. 47, 7482–7484.
Accepted: May 18, 2018
Published: June 28, 2018
Hajihassan, Z., and Rabbani-Chadegani, A. (2011). The effect of mitoxantrone
as an anticancer drug on hepatocytes nuclei and chromatin: selective release
of histone proteins. Indian J. Pharmacol. 43, 187–191.
REFERENCES
Binaschi, M., Zunino, F., and Capranico, G. (1995). Mechanism of action of
Hampf, M., and Gossen, M. (2006). A protocol for combined Photinus
and Renilla luciferase quantification compatible with protein assays. Anal.
Biochem. 356, 94–99.
DNA topoisomerase inhibitors. Stem Cells 13, 369–379.
Blount, K.F., and Breaker, R.R. (2006). Riboswitches as antibacterial drug tar-
gets. Nat. Biotechnol. 24, 1558–1564.
Hergenrother, P.J., Depew, K.M., and Schreiber, S.L. (2000). Small-molecule
microarrays: covalent attachment and screening of alcohol-containing small
molecules on glass slides. J. Am. Chem. Soc. 122, 7849–7850.
Bose, D., Jayaraj, G., Suryawanshi, H., Agarwala, P., Pore, S.K., Banerjee, R.,
and Maiti, S. (2012). The tuberculosis drug streptomycin as a potential cancer
therapeutic: inhibition of miR-21 function by directly targeting its precursor.
Angew. Chem. Int. Ed. 51, 1019–1023.
Huang, T.H., Wu, F., Loeb, G.B., Hsu, R., Heidersbach, A., Brincat, A.,
Horiuchi, D., Lebbink, R.J., Mo, Y.Y., Goga, A., et al. (2009). Up-regulation of
Cell Chemical Biology 25, 1–9, September 20, 2018
7

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
miR-21 by HER2/neu signaling promotes cell invasion. J. Biol. Chem. 284,
Naro, Y., Thomas, M., Stephens, M.D., Connelly, C.M., and Deiters, A. (2015).
Aryl amide small-molecule inhibitors of microRNA miR-21 function. Bioorg.
Med. Chem. Lett. 25, 4793–4796.
18515–18524.
Ivanov, A.I., Christodoulou, J., Parkinson, J.A., Barnham, K.J., Tucker, A.,
Woodrow, J., and Sadler, P.J. (1998). Cisplatin binding sites on human albu-
min. J. Biol. Chem. 273, 14721–14730.
Naryshkin, N.A., Weetall, M., Dakka, A., Narasimhan, J., Zhao, X., Feng, Z.,
Ling, K.K., Karp, G.M., Qi, H., Woll, M.G., et al. (2014). Motor neuron disease.
SMN2 splicing modifiers improve motor function and longevity in mice with
spinal muscular atrophy. Science 345, 688–693.
Jahromi, A.H., Nguyen, L., Fu, Y., Miller, K.A., Baranger, A.M., and
Zimmerman, S.C. (2013). A novel CUGexp$MBNL1 inhibitor with therapeutic
potential for myotonic dystrophy type 1. ACS Chem. Biol. 8, 1037–1043.
O’Donnell, K.A., Wentzel, E.A., Zeller, K.I., Dang, C.V., and Mendell, J.T.
(2005). c-Myc-regulated microRNAs modulate E2F1 expression. Nature 435,
839–843.
Kumar, A., Parkesh, R., Sznajder, L.J., Childs-Disney, J.L., Sobczak, K., and
Disney, M.D. (2012). Chemical correction of pre-mRNA splicing defects asso-
ciated with sequestration of muscleblind-like 1 protein by expanded r(CAG)-
containing transcripts. ACS Chem. Biol. 7, 496–505.
Palacino, J., Swalley, S.E., Song, C., Cheung, A.K., Shu, L., Zhang, X., Van
Hoosear, M., Shin, Y., Chin, D.N., Keller, C.G., et al. (2015). SMN2 splice mod-
ulators enhance U1-pre-mRNA association and rescue SMA mice. Nat. Chem.
Biol. 11, 511–517.
Lee, E.R., Blount, K.F., and Breaker, R.R. (2009). Roseoflavin is a natural anti-
bacterial compound that binds to FMN riboswitches and regulates gene
expression. RNA Biol. 6, 187–194.
Panwar, B., Omenn, G.S., and Guan, Y. (2017). miRmine: a database of human
miRNA expression profiles. Bioinformatics 33, 1554–1560.
Lee, M.K., Bottini, A., Kim, M., Bardaro, M.F., Jr., Zhang, Z., Pellecchia, M.,
Choi, B.S., and Varani, G. (2014). A novel small-molecule binds to the influenza
A virus RNA promoter and inhibits viral replication. Chem. Commun. (Camb.)
50, 368–370.
Pilch, D.R., Sedelnikova, O.A., Redon, C., Celeste, A., Nussenzweig, A., and
Bonner, W.M. (2003). Characteristics of g-H2AX foci at DNA double-strand
breaks sites. Biochem. Cell Biol. 81, 123–129.
Poehlsgaard, J., and Douthwaite, S. (2005). The bacterial ribosome as a target
Li, J., Yen, C., Liaw, D., Podsypanina, K., Bose, S., Wang, S.I., Puc, J.,
Miliaresis, C., Rodgers, L., McCombie, R., et al. (1997). PTEN, a putative pro-
tein tyrosine phosphatase gene mutated in human brain, breast, and prostate
cancer. Science 275, 1943–1947.
for antibiotics. Nat. Rev. Microbiol. 3, 870–881.
Pushechnikov, A., Lee, M.M., Childs-Disney, J.L., Sobczak, K., French, J.M.,
Thornton, C.A., and Disney, M.D. (2009). Rational design of ligands targeting
triplet repeating transcripts that cause RNA dominant disease: application to
myotonic muscular dystrophy type 1 and spinocerebellar ataxia type 3.
J. Am. Chem. Soc. 131, 9767–9779.
Liang, X.-h., Sun, H., Shen, W., and Crooke, S.T. (2015). Identification and
characterization of intracellular proteins that bind oligonucleotides with phos-
phorothioate linkages. Nucleic Acids Res. 43, 2927–2945.
du Rieu, M.C., Torrisani, J., Selves, J., Al Saati, T., Souque, A., Dufresne, M.,
Tsongalis, G.J., Suriawinata, A.A., Carrere, N., Buscail, L., et al. (2010).
MicroRNA-21 is induced early in pancreatic ductal adenocarcinoma precursor
lesions. Clin. Chem. 56, 603–612.
Liu, Y., Peacey, E., Dickson, J., Donahue, C.P., Zheng, S., Varani, G., and
Wolfe, M.S. (2009). Mitoxantrone analogues as ligands for a stem-loop struc-
ture of tau pre-mRNA. J. Med. Chem. 52, 6523–6526.
Liu, B., Childs-Disney, J.L., Znosko, B.M., Wang, D., Fallahi, M., Gallo, S.M.,
and Disney, M.D. (2016). Analysis of secondary structural elements in human
microRNA hairpin precursors. BMC Bioinformatics 17, 112.
Rogakou, E.P., Boon, C., Redon, C., and Bonner, W.M. (1999). Megabase
chromatin domains involved in DNA double-strand breaks in vivo. J. Cell
Biol. 146, 905–916.
Lown, J.W., Hanstock, C.C., Bradley, R.D., and Scraba, D.G. (1984).
Interactions of the antitumor agents mitoxantrone and bisantrene with
deoxyribonucleic acids studied by electron microscopy. Mol. Pharmacol. 25,
178–184.
Rzuczek, S.G., Southern, M.R., and Disney, M.D. (2015). Studying a drug-like,
RNA-focused small molecule library identifies compounds that inhibit RNA
toxicity in myotonic dystrophy. ACS Chem. Biol. 10, 2706–2715.
Rzuczek, S.G., Colgan, L.A., Nakai, Y., Cameron, M.D., Furling, D., Yasuda, R.,
and Disney, M.D. (2017). Precise small-molecule recognition of a toxic CUG
RNA repeat expansion. Nat. Chem. Biol. 13, 188–193.
MacBeath, G., and Schreiber, S.L. (2000). Printing proteins as microarrays for
high-throughput function determination. Science 289, 1760–1763.
MacBeath, G., Koehler, A.N., and Schreiber, S.L. (1999). Printing small mole-
cules as microarrays and detecting protein-ligand interactions en masse.
J. Am. Chem. Soc. 121, 7967–7968.
Seidel, S.A.I., Dijkman, P.M., Lea, W.A., van den Bogaart, G., Jerabek-
Willemsen, M., Lazic, A., Joseph, J.S., Srinivasan, P., Baaske, P., Simeonov,
A., et al. (2013). Microscale thermophoresis quantifies biomolecular interac-
tions under previously challenging conditions. Methods 59, 301–315.
Mansour, O.C., Evison, B.J., Sleebs, B.E., Watson, K.G., Nudelman, A.,
Rephaeli, A., Buck, D.P., Collins, J.G., Bilardi, R.A., Phillips, D.R., et al.
(2010). New anthracenedione derivatives with improved biological activity by
virtue of stable drug-DNA adduct formation. J. Med. Chem. 53, 6851–6866.
Seike, M., Goto, A., Okano, T., Bowman, E.D., Schetter, A.J., Horikawa, I.,
Mathe, E.A., Jen, J., Yang, P., Sugimura, H., et al. (2009). MiR-21 is an
EGFR-regulated anti-apoptotic factor in lung cancer in never-smokers. Proc.
Natl. Acad. Sci. USA 106, 12085–12090.
Marcheschi, R.J., Mouzakis, K.D., and Butcher, S.E. (2009). Selection and
characterization of small molecules that bind the HIV-1 frameshift site RNA.
ACS Chem. Biol. 4, 844–854.
Shaul, P., Frenkel, M., Goldstein, E.B., Mittelman, L., Grunwald, A., Ebenstein,
Y., Tsarfaty, I., and Fridman, M. (2013). The structure of anthracycline deriva-
tives determines their subcellular localization and cytotoxic activity. ACS Med.
Chem. Lett. 4, 323–328.
McConnell, A.J., Serpell, C.J., Thompson, A.L., Allan, D.R., and Beer, P.D.
(2010). Calix[4]arene-based rotaxane host systems for anion recognition.
Chemistry 16, 1256–1264.
Shortridge, M.D., and Varani, G. (2015). Structure based approaches for tar-
geting non-coding RNAs with small molecules. Curr. Opin. Struct. Biol.
30, 79–88.
Mei, H.-Y., Galan, A.A., Halim, N.S., Mack, D.P., Moreland, D.W., Sanders,
K.B., Hoa, N.T., and Czarnik, A.W. (1995). Inhibition of an HIV-1 Tat-derived
peptide binding to TAR RNA by aminoglycoside antibiotics. Bioorg. Med.
Chem. Lett. 5, 2755–2760.
Shortridge, M.D., Walker, M.J., Pavelitz, T., Chen, Y., Yang, W., and Varani, G.
(2017). A macrocyclic peptide ligand binds the oncogenic microRNA-21 pre-
cursor and suppresses dicer processing. ACS Chem. Biol. 12, 1611–1620.
Meng, F., Henson, R., Wehbe-Janek, H., Ghoshal, K., Jacob, S.T., and Patel,
T. (2007). MicroRNA-21 regulates expression of the PTEN tumor suppressor
gene in human hepatocellular cancer. Gastroenterology 133, 647–658.
Su, Z., Zhang, Y., Gendron, T.F., Bauer, P.O., Chew, J., Yang, W.Y., Fostvedt,
E., Jansen-West, K., Belzil, V.V., Desaro, P., et al. (2014). Discovery of a
biomarker and lead small molecules to target r(GGGGCC)-associated defects
in c9FTD/ALS. Neuron 84, 239.
Moon, M.H., Hilimire, T.A., Sanders, A.M., and Schneekloth, J.S., Jr.
(2018). Measuring RNA-ligand interactions with microscale thermophore-
sis. Biochemistry. https://doi.org/10.1021/acs.biochem.7b01141.
Swift, L.P., Rephaeli, A., Nudelman, A., Phillips, D.R., and Cutts, S.M. (2006).
Doxorubicin-DNA adducts induce a non-topoisomerase II-mediated form of
cell death. Cancer Res. 66, 4863–4871.
Morrow, T. (2017). New therapy for spinal muscular atrophy offers modest
bang for pharamaceutical buck. Manag. Care 26, 36–37.
8
Cell Chemical Biology 25, 1–9, September 20, 2018

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
Tenson, T., and Mankin, A. (2006). Antibiotics and the ribosome. Mol.
Yang, W.Y., Wilson, H.D., Velagapudi, S.P., and Disney, M.D. (2015). Inhibition
of non-ATG translational events in cells via covalent small molecules targeting
RNA. J. Am. Chem. Soc. 137, 5336–5345.
Microbiol. 59, 1664–1677.
Velagapudi, S.P., Gallo, S.M., and Disney, M.D. (2014). Sequence-based
design of bioactive small molecules that target precursor microRNAs. Nat.
Chem. Biol. 10, 291–297.
Yang, W.Y., He, F., Strack, R.L., Oh, S.Y., Frazer, M., Jaffrey, S.R., Todd, P.K.,
and Disney, M.D. (2016). Small molecule recognition and tools to study mod-
ulation of r(CGG)(exp) in fragile X-associated tremor ataxia syndrome. ACS
Chem. Biol. 11, 2456–2465.
Velagapudi, S.P., Luo, Y., Tran, T., Haniff, H.S., Nakai, Y., Fallahi, M., Martinez,
G.J., Childs-Disney, J.L., and Disney, M.D. (2017). Defining RNA-small mole-
cule affinity landscapes enables design of a small molecule inhibitor of an
oncogenic noncoding RNA. ACS Cent. Sci. 3, 205–216.
Zapp, M.L., Stern, S., and Green, M.R. (1993). Small molecules that selectively
block RNA binding of HIV-1 Rev protein inhibit Rev function and viral produc-
tion. Cell 74, 969–978.
Volinia, S., Calin, G.A., Liu, C.G., Ambs, S., Cimmino, A., Petrocca, F., Visone,
R., Iorio, M., Roldo, C., Ferracin, M., et al. (2006). A microRNA expression
signature of human solid tumors defines cancer gene targets. Proc. Natl.
Acad. Sci. USA 103, 2257–2261.
Zheng, S., Chen, Y., Donahue, C.P., Wolfe, M.S., and Varani, G. (2009).
Structural basis for stabilization of the Tau pre-mRNA splicing regulatory
element by novantrone (mitoxantrone). Chem. Biol. 16, 557–566.
Yan, L.X., Huang, X.F., Shao, Q., Huang, M.Y., Deng, L., Wu, Q.L., Zeng, Y.X.,
and Shao, J.Y. (2008). MicroRNA miR-21 overexpression in human breast can-
cer is associated with advanced clinical stage, lymph node metastasis and pa-
tient poor prognosis. RNA 14, 2348–2360.
Zhu, S., Wu, H., Wu, F., Nie, D., Sheng, S., and Mo, Y.Y. (2008). MicroRNA-21
targets tumor suppressor genes in invasion and metastasis. Cell Res. 18,
350–359.
Cell Chemical Biology 25, 1–9, September 20, 2018
9

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
STAR+METHODS
KEY RESOURCE TABLE
REAGENT or RESOURCE
Antibodies
SOURCE
IDENTIFIER
anti-phospho-Histone-H2A.X (Ser139)
EMD Millipore
Thermo Fisher
clone JBW301; RRID: AB_568825
Catalog #:35502; RRID: AB_844397
Goat anti-Mouse IgG Secondary Antibody,
DyLight 488
Chemicals, Peptides, and Recombinant Proteins
1
Cayman Chemicals
Catalog# 15007
Catalog# RS023
Catalog# RM11
NA
2
Biotang, Inc.
3
Biotang, Inc.
NIH Clinical Collection (NIH-CC)
SYNLibrary-95
Scripps Molecular Screening Center
Synkinase
Catalog# SYN-2103
N/A
pre-mRNA splicing regulators
RNA-focused compound library
Critical Commercial Assays
Topoisomerase II Drug Screening Kit
Oligonucleotides
California Institute for Biomedical Research
Scripps Molecular Screening Center
N/A
TopoGEN, Inc.
Catalog# TG1009
Primers used for RT-qPCR, see Table S2
This paper
N/A
hsa-miR-21-5p, miRCURY LNA Power
microRNA inhibitor
Exiqon (now a part of Qiagen)
Catalog# 4100689-101
Negative control A, miRCURY LNA Power
microRNA inhibitor control
Exiqon (now a part of Qiagen)
Catalog# 199006-102
Recombinant DNA
pGL3-PTEN-3’UTR
pcDNA3-miR21
Addgene
Addgene
Promega
Plasmid # 21326
Plasmid # 21114
Plasmid # E223A
pRL Renilla Luciferase Control
Software and Algorithms
Olympus Fluoview software version 3.0
QuantityOne
Olympus
N/A
N/A
N/A
BioRad
Graphpad Prism 7
GraphPad Prism Software, Inc.
Disney Laboratory
Inforna
https://disney.florida.scripps.edu/
software/
EXPERIMENTAL MODEL AND SUBJECT DETAILS
All cells were grown at 37ꢁC and 5% CO2. MDA-MB-231 (ATCC: HTB-26) cells were cultured in Roswell Park Memorial Institute
(RPMI) 1640 medium supplemented with 1% penicillin/streptomycin, 1% glutagro (Corning) and 10% fetal bovine serum (FBS) (com-
plete growth medium). Cells were directly purchased from ATCC but were not authenticated.
METHOD DETAILS
General Nucleic Acids Methods
All DNA oligonucleotides were purchased from Integrated DNA Technologies, Inc. (IDT) and used without further purification. The
RNA competitor oligonucleotides and pre-miR-21 constructs for MST were purchased from Dharmacon and de-protected according
to the manufacturer’s standard procedure. Competitor oligonucleotides were used to ensure that RNA-small molecule interactions
were confined to the randomized region of 332 nucleotide internal loop pattern). All aqueous solutions were made with nanopure
water. The RNA library was transcribed by in vitro transcription from the corresponding DNA template.
e1 Cell Chemical Biology 25, 1–9.e1–e7, September 20, 2018

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
Compound Libraries
The 727-member NIH Clinical Collection (NIH-CC) was obtained from Scripps Molecular Screening Center. The NIH-CC is a small
molecule library comprised of drugs that have been in Phase I or II clinical trials. Thus, compounds were selected for drug-likeness,
bioavailability, and stability. The 95-member Kinase library (SYNLibrary-95, catalog # SYN-2103) was purchased from Synkinase.
SYNLibrary-95 contains a kinase inhibitor library that recognizes 57 targets. Three pre-mRNA splicing regulators were obtained
from the California Institute for Biomedical Research (Calibr). The 201-member RNA-focused compound library was obtained
from Scripps Molecular Screening Center. These compounds were previously identified by performing chemical similarity search
based on molecules that possess bis-benzimidazole or similar cores (Rzuczek et al., 2015). Hit compounds were re-purchased in
larger quantities for testing. Compound 1 was purchased from Cayman Chemicals, while 2 and 3 were purchased from Biotang, Inc.
Construction of AbsorbArray-assisted Small Molecule Microarrays
Microarrays were constructed by pouring 15 mL of 1% molten agarose solution onto a glass slide [85.5 x 127.8 x 1.1 mm width x
height x thickness)]. The agarose was then air dried for 1 h at room temperature to form a thick gel surface. A 200 nL aliquot of com-
pound (10 mM in DMSO) was then pinned into the agarose gel from a 384-well plate (Greiner; catalog #781201-906) using a Biomek
NXP Laboratory Automation Workstation equipped with a 100 nL 384-pin floating head with diameter 0.787 mm and inter-pin dis-
tance of 4.5 mm. The compound-spotted slides were allowed to air dry completely to form a thin, invisible agarose layer. After drying,
slides were washed three times with 13 PBST (13 PBS+0.1% Tween) followed by washing three times for 5 min with nanopure water
and air dried completely. 2DCS of the final hit compounds were completed on microscopic slides [Fisher Scientific, 12550016; 75 x
25 x 1 mm (width x height x thickness); see Figure S1]. Quantification of compound spotting before and after washing was analyzed
using QuantityOne software (BioRad).
RNA Selection
2DCS selections were completed as previously described (Disney et al., 2008). All oligonucleotides, including 5’-end 32P-labeled
RNA library [prepared as described previously (Disney et al., 2008)], competitor chase oligonucleotides (Figure 2D) and tRNA,
were folded separately in 13 Hybridization Buffer (HB, 8 mM Na2HPO4, pH 7.0, 185 mM NaCl, and 1 mM EDTA) by heating at
90ꢁC for 2 min followed by cooling to room temperature on the bench top. The 5’-end 32P-labeled folded RNAs (ꢀ50,000 counts
by Geiger counter) were mixed together and MgCl2 and bovine serum albumin (BSA) were added at 1 mM and 40 mg/mL final con-
centrations, respectively, in a total volume of 3000 mL. Prior to hybridization, microarrays were pre-equilibrated with 3000 mL of 13 HB
supplemented with 1 mM MgCl2 and 40 mg/mL BSA (13 HB2) for 10 min at room temperature to prevent non-specific binding. After
the slides were pre-equilibrated, HB2 was removed and the mixture of folded RNAs was applied to the microarray surface and distrib-
uted evenly across the array surface with a custom-cut piece of Parafilm (solution height ꢀ2-3 mm). The slide was hybridized for
approximately 45 min at room temperature. After incubation, the Parafilm was removed, and the slide was washed by submersion
in 30 mL of HB for 5 s with gentle agitation three times. Excess buffer was removed completely from the slide, and the slide was dried
at room temperature for 30 min. While compounds may diffuse from their initial spot, significant interspot diffusion of the RNA-ligand
complexes was not observed. Although diffusion rates differ depending on the physical/chemical properties of each compound,
washing of the plates before and after hybridization will remove complexes that have diffused out of the spotted area. The microarray
was exposed to a phosphorimager screen and imaged using a Molecular Devices Typhoon phosphorimager. The resulting image
was used as a template to harvest bound RNAs from the microarray surface. To harvest bound RNAs, 1 mL of nanopure water
was added to each spot. After 30 s, the buffer was absorbed and the agarose gel at that spot was excised using a toothpick.
Reverse Transcription and PCR Amplification to Install Barcodes for RNA-Seq
The excised agarose was placed into a thin-walled PCR tube with 18 mL of water, 2 mL of 10x RQ1 DNase I buffer and 2 units of RQ1
RNase-free DNase (Promega). The solution was incubated at 37ꢁC for 2 h and then quenched by addition of 2 mL of 10x DNase stop
solution (Promega). Samples were incubated at 65ꢁC for 10 min to completely inactivate the DNase and then subjected to RT-PCR
amplification to install a unique barcode. Reverse transcription reactions were completed in 13 RT buffer, 1 mM dNTPs, 5 mM RT
primer (5’-CCTCTCTATGGGCAGTCGGTGATCCTTGCGG ATCCAAT), 200 mg/mL BSA, 4 units of AMV reverse transcriptase, and
20 mL of DNase-treated selected RNAs. Samples were incubated at 60ꢁC for 1 h. A 20 mL aliquot of the RT reaction was added to
6 mL of 103 PCR Buffer, 4 mL of 100 mM forward primer including barcode (5’- CCATCTC ATCCCTGCGTGTCTCCGACTCAG-
XXXXXXXXXXGATGGGAGAGGGTTTAAT where X represents unique barcode, GAT is the barcode adapter), 2 mL of 100 mM reverse
primer, 0.6 mL of 250 mM MgCl2, and 2 mL of Taq DNA polymerase. Two-step PCR was performed at 95ꢁC for 1 min and 72ꢁC for
1 min. Aliquots of the RT-PCR product were checked every two cycles starting at cycle 10 on a non-denaturing 8% polyacrylamide
gel stained with SYBR Green to ensure that background spots (excised from the array where compound was not delivered) were not
amplified. RT-PCR products encoding selected RNAs were purified on a non-denaturing 8% polyacrylamide gel. Purity was as-
sessed using a Bioanalyzer and samples were mixed in equal amounts and sequenced using an Ion Proton deep sequencer using
PI chips (60-80 million reads).
Cell Chemical Biology 25, 1–9.e1–e7, September 20, 2018 e2

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
In Vitro Dicer Processing Assay
The miR-21 precursor (pre-miR-21) was 5’-end labeled with [g-32P] ATP and T4 polynucleotide kinase as previously described (Ve-
lagapudi et al., 2014). The RNA was then folded in 13 Reaction Buffer (Genlantis) by heating at 60ꢁC for 5 min and slowly cooling to
room temperature, where it was then supplemented with 1 mM ATP and 2.5 mM MgCl2. Compound was added to the reaction
mixture and the samples were allowed to incubate at room temperature for 15 min. Recombinant human Dicer enzyme (Genlantis)
was added to a final concentration of 0.01 U/mL and the samples were incubated for an additional 30 min at 37ꢁC. Reactions were
stopped by adding in 23 Gel Loading Buffer (8 M urea, 50 mM EDTA, 0.05% (w/v) bromophenol blue, 0.05% (w/v) xylene cyanol). To
generate sequencing markers, pre-miR-21 was digested with RNase T1 (0.125 U/mL) in T1 Buffer (25 mM sodium citrate, pH 5, 7 M
urea, and 1 mM EDTA) for 20 min at room temperature. An RNA hydrolysis ladder was prepared by incubating RNA in 13 RNA
Hydrolysis Buffer (50 mM NaHCO3, 1 mM EDTA, pH 9.4) at 95ꢁC for 5 min. Cleavage products were resolved on a denaturing
15% polyacrylamide gel, which was imaged using a Molecular Dynamics Typhoon phosphorimager and quantified with Bio-Rad’s
QuantityOne software.
RNA Isolation and RT-qPCR
MDA-MB-231 cells were cultured as described above and grown to 80% confluency in 24-well plates. Cells were treated with com-
pound of interest for 24-48 h. Total RNA was then extracted with a Quick-RNA MiniPrep Kit (Zymo Research) per the manufacturer’s
protocol. Approximately 200 ng of total RNA was used for reverse transcription reactions (RT), which were completed by using a
miScript II RT Kit (Qiagen) per the manufacturer’s protocol. RT-qPCR was completed using a 7900HT Fast Real Time PCR System
(Applied Biosystems), using Power SYBR Green Master Mix (Life Technologies). Primers for RT-qPCR were purchased from IDT or
Eurofins (see Table S2) and used without further purification. Expression levels of RNAs were normalized to U6 small nuclear RNA or
18S rRNA.
PTEN Luciferase Assay
MDA-MB-231 cells were grown in 48-well plates to ꢀ60% confluency in complete growth medium. The cells were transiently co-
transfected with 200 ng of a plasmid encoding the 3’ untranslated region (UTR) of PTEN fused to luciferase (O’Donnell et al.,
2005) and 40 ng of a plasmid encoding Renilla luciferase using Lipofectamine 2000 per the manufacturer’s protocol. At 5 h post-
transfection, compounds were added in complete growth medium, and the cells were incubated for 48 h. Luciferase assays were
completed based on a previously described protocol (Hampf and Gossen, 2006). Cells were lysed in 40 mL 13 Lysis Buffer
(100 mM potassium phosphate buffer, pH 7.8, 0.2% Tween 20) for 10 min at room temperature. Next, 150 mL of 13 Firefly Luciferase
Buffer (200 mM Tris–HCl, pH 8, 15 mM magnesium sulfate, 0.1 mM EDTA, 25 mM dithiothreitol, 1 mM ATP, 200 mM coenzyme A, and
200 mM luciferin) and incubated for 2 min at room temperature. Luminescence signal was measured on a Biotek Flx800 plate reader.
To measure Renilla luciferase activity, 150 mL of 13 Renilla Luciferase Buffer (25 mM sodium pyrophosphate, 10 mM sodium acetate,
15 mM EDTA, 500 mM sodium sulfate, 500 mM sodium chloride, 50 mM of 4-(6-Methyl-2-benzothiazolyl)benzeneamine (CAS# 92-
36-4), and 4 mM benzyl-coelenterazine, pH 5.0) was added and incubated for 2 min at room temperature. Luminescence signal was
measured on a Biotek Flx800 plate reader.
Imaging for DNA Damage
The g-H2AX immunofluorescence assay was used to assess DNA double strand breaks in cells (Pilch et al., 2003; Rogakou et al.,
1999). MDA-MB-231 cells were grown to ꢀ80% confluence in a Mat-Tek 96-well glass bottom plate in growth medium. Cells
were treated with 3 in complete growth medium for 24 hr. Cells were washed with 13 DPBS then fixed with 4% paraformaldehyde
in 13 DPBS at 37ꢁC and 5% CO2 for 10 min. Cells were washed 5 times with 13 DPBS and three times with 0.1% Triton X-100
in 13 DPBS for 5 min at 37ꢁC and 5% CO2. Cells were then washed with 30% formamide in 23 SSC buffer for 10 min at room
temperature and 23 SSC for 30 min at 37ꢁC and 5% CO2. Cells were incubated with a 1:500 dilution of anti-phospho-Histone-
H2A.X (Ser139) (clone JBW301, EMD Millipore) in 23 SSC for 1 h at 37ꢁC and 5% CO2 then washed three times with 0.1% Triton
X-100 in 13 DPBS for 5 min at 37ꢁC and 5% CO2. Cells were incubated with a 1:200 dilution of goat anti-mouse IgG-DyLight
488 conjugate (Thermo Fisher) in 23 SSC for 1 h at 37ꢁC and 5% CO2 and then washed three times with 0.1% Triton X-100 in
13 DPBS for 5 min at 37ꢁC and 5% CO2. Cells were washed three times with 13 DPBS and then stained using a 1 mg/mL solution
of DAPI in 13 DPBS for 5 min at 37ꢁC and 5% CO2. Cells were washed five times in 13 DPBS and then imaged in 13 DPBS using an
Olympus FluoView 1000 confocal microscope at 403 magnification. Anti-g-H2AX fluorescence intensity was quantified
using Olympus Fluoview software version 3.0. Average Anti-g-H2AX fluorescence intensity measurements represent the average
fluorescence intensity across eight images.
Boyden Chamber Invasion Assay
Matrigel (Corning) was thawed overnight at 4ꢁC., diluted to 3 mg/mL of basement protein, and then dispensed into 24 well tissue
culture inserts with 8 mm pore sizes (100 L; m Greiner). The inserts containing Matrigel were incubated at 37ꢁC for 15 min and then
placed back into 4ꢁC overnight. The following day, 50000 MDA-MB-231 cells in growth medium lacking FBS with or without 3
were added to the inserts and allowed to migrate towards complete growth medium in the bottom wells for 16 h. The medium
e3 Cell Chemical Biology 25, 1–9.e1–e7, September 20, 2018

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
was vacuum aspirated from both hanging cell culture inserts and bottom wells, which were then washed twice with 13 PBS with
gentle shaking. Excess liquid and non-invading cells inside the insert were removed with cotton swabs. 400 mL of 4% paraformal-
dehyde in 13 PBS was added to bottom wells and incubated for 20 min at room temperature. The wells and inserts were then washed
twice with 13 PBS and treated with 400 mL of 0.1% crystal violet solution in 13 PBS for 20 min at room temperature. After staining,
the wells and inserts were washed twice with water, once with 13 PBS, and then dried with cotton swabs. After air-drying, the inserts
were analyzed by microscopy using a Leica DMI3000 B upright fluorescent microscope. Invading cells from four different fields of
view from each captured image were counted. Alternatively, MDA-MB-231 cells were transfected with a plasmid containing pre-
miR-21 (Addgene) using Lipofectamine 2000 according to the manufacturer’s protocol, and the experiment was performed as
described above.
In Vitro Chem-CLIP and C-Chem-CLIP
Approximately 50000 counts of 32P 5’-end labeled pre-miR-21 were added to inactivated DMEM growth medium and folded at 95ꢁC
for 45 s, then cooled on ice for 5 min. Compound 10 or 11 was added to the folded RNA and incubated at 37ꢁC overnight. For
C-Chem-CLIP, nucleic acids were pre-treated with dilutions of 3 for 15 min at room temperature before Chem-CLIP probes were
added. Streptavidin-agarose beads (Sigma-Aldrich, S1638; R15 mg/mL binding capacity) were washed three times with 13 PBS
and resuspended in 13 PBS. Beads were added to the samples and incubated for 1 h at room temperature. Samples were centri-
fuged and the supernatant was transferred to a new tube. Beads were washed three times with 13 PBS with 0.1% (v/v) Tween-20 and
centrifuged, with each wash being added to the supernatant tube. Radioactivity in the beads and the supernatant/wash tubes were
quantified using a Beckman Coulter LS6500 Liquid Scintillation Counter.
Cellular Chem-CLIP and C-Chem-CLIP
MDA-MB-231 cells were grown to ꢀ70% confluency as monolayers in 100 mm dishes and treated with 1 mM of 10 or 11 for 8 h. Total
RNA was extracted using a Quick-RNA MiniPrep Kit (Zymo Research) per the manufacturer’s protocol. Approximately 30 mg of total
RNA was then incubated with 100 mL of streptavidin-agarose beads (Sigma-Aldrich) and shaken for 1 h at room temperature. The
solution was removed and beads washed six times with 300 mL of 13 PBS. The RNA bound to beads was released by heating at
65ꢁC for 20 min in 13 Elution Buffer (95% formamide, 10 mM EDTA, pH 8.2). Eluted RNA was then purified with a Quick-RNA
MiniPrep Kit (Zymo Research) and used for subsequent RT-qPCR analysis as described above.
Normalized miRNA Enrichment of the measured RNA before and after pulldown was measured using Equation 1:
t before pulldown ꢂ DCt after pulldownÞ
Normalized miRNA Enrichment : 2ꢂðDC
(Equation 1)
where ‘‘DCt before pulldown’’ is the difference between the Ct values for the RNA of interest and a housekeeping gene (U6 small
nuclear RNA) in total RNA isolated from cell lysate RNA (no pulldown) and ‘‘DCt after pulldown’’ is the difference between the Ct values
for the RNA of interest and the same housekeeping gene after pulldown. Data were normalized to the levels of mature miR-21
measured after treatment with Chem-CLIP probe at the appropriate concentration.
In Vitro Topoisomerase Inhibition Assay
Topoisomerase II inhibitory activity was measured using a Topoisomerase II Drug Screening Kit (TopoGEN, Inc.) per the manufac-
turer’s protocol. Dilutions of 1, 2, and 3 in water were added to 300 ng of DNA in 13 Complete Buffer (50 mM Tris-HCl, pH 8, 150 mM
NaCl, 10 mM MgCl2, 0.5 mM dithiothreitol, 30 mg/mL BSA, and 2 mM ATP), followed by addition of 7.5 U of Topoisomerase II enzyme.
Samples were incubated at 37ꢁC for 30 min, and the reaction was stopped by adding 2 mL of 10% sodium dodecyl sulfate (SDS).
Proteinase K (50 mg/mL) was added, and the samples were incubated at 37ꢁC for 15 min. Topoisomers were separated on 1%
agarose gels with or without 0.5 mg/mL ethidium bromide. Gels prepared with ethidium bromide were run in 13 TAE running buffer
supplemented with 0.5 mg/mL ethidium bromide. Gels run without ethidium bromide were post stained with 0.5 mg/mL ethidium bro-
mide. Both gels were destained in 13 TAE for 15 min and DNA products were visualized using a Bio-Rad Gel Doc XR+ imaging sys-
tem (Figure S4).
Fluorescent Binding Affinity Measurements
Dissociation constants were determined using an in-solution fluorescence-based assay. The RNA of interest was folded in 13 Assay
Buffer (8 mM Na2HPO4, pH 7.0, 190 mM NaCl, 1 mM EDTA and 40 mg/mL BSA) by heating at 60ꢁC for 5 min and slowly cooling to
room temperature. Small molecules were added to a final concentration of 250 nM for 3, or 2000 nM for 1 and 2. Serial dilutions (1:2)
were then completed in 13 Assay Buffer supplemented with 250 nM of 3, or 2000 nM of 1 and 2. The solutions were incubated for
30 min at room temperature and then transferred to a 96-well plate and fluorescence intensity was measured. The change in fluo-
rescence intensity as a function of RNA concentration was fit to Equation 2:
ꢀ
where Bmax, is maximum specific binding; [RNA], is RNA concentration; h, is Hill slope.
ꢁ
h
h
fðxÞ = Bmax
3
½RNAꢃ OKdh + ½RNAꢃ
Equation (2)
Cell Chemical Biology 25, 1–9.e1–e7, September 20, 2018 e4

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
Microscale Thermophoresis (MST) Binding Measurements
MST measurements were performed on a Monolith NT.115 system (NanoTemper Technologies) using the intrinsic fluorescent signal
from compound 3. The samples were prepared in MST buffer containing 50 mM Tris-HCl, pH 7.4, 150 mM NaCl,5 mM MgCl2 and 0.05
(v/v) % Tween-20. The concentration of compound was kept constant at 150 nM. The following RNA constructs were ordered from
GE Healthcare Dharmacon for use in MST studies: miR-21 hairpin (A+U Bulge): GUUGACUGUUGAAUCUCAUGGCAAC; miR-21
A bulge: GUUGACUGUUGAAUCUCAAUGGCAAC; miR-21 Base Paired Control: GUUGACUGUUGAAUCUCAAUGGUCAAC. RNA
was titrated in 1:1 dilutions beginning at 20 mM and then samples were filled into in premium-coated capillaries. The measurement
was performed at 40% LED and 20 to 80% MST power, with a Laser-On time of 30 s and Laser-Off time of 5 s, detecting fluorescence
at Ex: 605–645 nm, Em: 680–685 nm. The data were analyzed by thermophoresis analysis, and fitted by the quadratic binding equa-
tion in MST analysis software (NanoTemper Technologies). The dissociation constant was then determined using a single-site model
to fit the curve.
Chemical Synthesis
Abbreviations
Boc, tert-butyloxycarbonyl; oxyma, Ethyl (hydroxyimino)cyanoacetate; DCM, dichloromethane; DMAP, 4-Dimethylaminopyridine;
DMF, N,N-dimethylformamide; DIC, N,N’-Diisopropylcarbodiimide; DIEA, N,N-Diisopropylethylamine; MS(ESI), mass spectrometry
(electrospray ionization); HATU, 1-[Bis(dimethylamino)methylene-]1H-1,2,3-trizaolo[4,5-b]pyridinium 3-oxide hexafluorophosphate;
HOAt, 1-hydroxy-7-azabenzotriazole; HPLC, high performance liquid chromatography; MeOH, methanol; NMR, nuclear magnetic
resonance; TEA, Triethylamine; TFA, trifluoroacetic acid; Ts, p-toluenesulfonyl.
Synthesis of N1-(2-(prop-2-yn-1-yloxy)ethyl)ethane-1,2-diamine (3a)
Both 2-(prop-2-yn-1-yloxy)ethan-1-ol (3aa) and 2-(prop-2-yn-1-yloxy)ethyl 4-methylbenzenesulfonate (3ab) were prepared ac-
´
´
cording to Cserep et al. and McConnell et al. (Cserep et al., 2014; McConnell et al., 2010). To a solution of 2-(prop-2-yn-1-yloxy)ethyl
4-methylbenzenesulfonate. (3ab) (5400 mg, 21 mmol) in MeOH (30 mL) was added dropwise ethylenediamine (20 mL, 300 mmol) at
0ꢁC. After the addition of ethylenediamine, the reaction mixture was stirred overnight. Then, 10% K2CO3 was added to the reaction
mixture, which was extracted with DCM. The combined organic layers were dried over Na2SO4 and concentrated in vacuo. The res-
idue was purified by distillation (85ꢁC/ < 1 mmHg) to afford 1.6 g of 3a (53% yield), a colorless oil. 1H NMR(400 MHz, CDCl3)d4.17-4.16
(m, 2H), 3.65 (t, J = 5.1 Hz, 2H), 2.85-2.80 (m, 4H), 2.69 (t, J = 7.8, 2H), 2.44-2.43 (m, 1H) 1.34 (br s, 3H). 13C NMR(100 MHz, CDCl3)
d41.8, 49.1, 52.5, 58.4, 69.5, 74.4, 79.7. MS m/z (ESI); calculated for C7H15N2O (M + H)+ 143.1; found 143.3
Synthesis of Mitoxantrone Derivative 3b
The compounds 1,4-difluoro-5,8-dihydroxyanthracene-9,10-dione (3ba) and 1-fluoro-5,8-dihydroxy-4-((2-((2-hydroxyethyl)
amino)ethyl)amino)anthracene-9,10-dione (3bb) were prepared according to Liu et al. and Mansour et al. (Liu et al., 2009; Mansour
et al., 2010). To a solution of 3bb (50 mg, 0.14 mmol) in pyridine (4 mL) was added 3a (36 mg, 0.25 mmol). Then the mixture was stirred
at 100ꢁC under argon for 2 h. The reaction mixture was cooled to room temperature. Boc2O (283 mg, 1.3 mmol) was added, and the
reaction mixture was stirred overnight. The reaction mixture was evaporated and the residue was purified by silica gel column chro-
matography (15-60% ethyl acetate in hexane) to afford 50 mg of 3b (43% yield) as a dark blue powder. 1H NMR(CD3OD, 700 MHz)
d 7.51-7.49 (m, 1H), 7.46-7.40 (m, 2H), 7.38-7.27 (m, 1H), 4.21-4.19 (m, 2H), 3.68-3.62 (m, 8H), 3.50-3.47 (m, 6H), 3.38-3.36 (m, 2H),
2.88 (s, 1H), 1.58 (s, 18H), 1.48 (s, 9H), 1.40-1.39 (m, 9H). 13C NMR(175 MHz, CD3OD)d 181.9, 157.3, 157.2, 157.1, 152.8, 149.3,
147.3, 147.2, 147.1, 129.2, 128.7, 125.2, 125.0, 124.9, 124.8, 111.1, 111.0, 84.6, 81.6, 81.5, 81.4, 81.3, 80.7, 76.2, 69.8, 69.6,
61.5, 61.3, 59.2, 52.1, 51.3, 41.8, 41.3, 28.8, 28.7, 28.2. HRMS m/z (ESI): calculated for C45H63N4O14 (M + H)+ 883.4341, found
883.4375.
e5 Cell Chemical Biology 25, 1–9.e1–e7, September 20, 2018

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
Synthesis of the Peptoid Backbone (3c)
Rink amide resin (400 mg, 0.23 mmol) was swollen in DMF at room temperature for 10 min and then deprotected with a solution of
20% piperidine in DMF (5 mL, 2 x 20 min). The resin was washed with DMF (3 x 5 mL). To the resin were added 1.1 mL of 1.0 M bromo-
acetic acid in DMF, DIC (0.3 mL, 1.2 mmol) and oxyma (163 mg, 1.1 mmol), and the mixture was shaken at room temperature for 2 h.
The resin was washed with DCM (5 x 6 mL) and DMF (5 x 6 mL). Then to the resin was added a solution of N-(2-aminoethyl) bio-
tinamide (384 mg, 1.0 mmol) in DMF (2 mL) and DIEA (0.2 mL, 1.2 mmol), and the mixture was shaken at room temperature for
1.5 h. The resin was washed with DCM (5 x 6 mL) and DMF (5 x 6 mL). Then to the resin were added 1.1 mL of 1.0 M bromoacetic
acid in DMF, DIC (0.3 mL, 1.2 mmol) and oxyma (163 mg, 1.1 mmol) and the mixture was shaken at room temperature for 2 h. The
resin was washed with DCM (5 x 6 mL) and DMF (5 x 6 mL). Then to the resin were added DMF (2 mL) and 3-azidopropan-1-amine
(230 mg, 2.3 mmol). The mixture was shaken at room temperature overnight. The mixture was washed with DCM (5 x 6 mL) and
DMF (5 x 6 mL). Then to the resin were added 1.1 mL of 1.0 M bromoacetic acid in DMF, DIC (0.3 mL, 1.2 mmol) and oxyma
(163 mg, 1.1 mmol), and the mixture was shaken at room temperature for 2 h. The resin was washed with DCM (5 x 6 mL) and
DMF (5 x 6 mL). Then to the resin were added DMF (2 mL), N-Boc-ethylenediamine (184 mg, 1.2 mmol) and DIEA (0.2 mL,
1.2 mmol), and the mixture was shaken at room temperature for 1 h. The beads were washed with DCM (5 x 6 mL) and DMF
(5 x 6 mL) followed by addition of DMF (4 mL), acetic anhydride (0.12 mL 1.3 mmol) and DIEA (0.4 mL, 2.3 mmol). The mixture
was shaken at room temperature for 1 h followed by washing the resin with DCM (5 x 6 mL) and DMF (5 x 6 mL). Then to the resin
was added 30% TFA in DCM (2 mL), and the mixture was shaken at room temperature for 30 min. The mixture was filtered, and the
filtrate was evaporated. The crude product was purified by preparative HPLC (linear gradient of 0% to 100% CH3OH in H2O with
0.1% (v/v) TFA over 60 min) to afford compound 3c as a colorless oil (8 mg, 4.8% yield). HRMS m/z (ESI): calculated for
C25H44N11O6S (M + H)+ 626.3197, found 626.3216.
Synthesis of 3-CA-Biotin (10)
Cell Chemical Biology 25, 1–9.e1–e7, September 20, 2018 e6

Please cite this article in press as: Velagapudi et al., Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs, Cell Chemical Biology (2018),
https://doi.org/10.1016/j.chembiol.2018.05.015
To a solution of 3b (57 mg, 0.065 mmol) and 3c (51 mg, 0.082 mmol) in DMSO (0.6 mL) were added Cu(I)-catalyst (7.5 mg,
0.0048 mmol) and DIEA (0.5 mL, 2.9 mmol). The reaction mixture was stirred at 60ꢁC overnight. Then saturated NaHCO3 was added,
the aqueous layer was extracted with DCM, and the organic layer was evaporated. The residue was purified by silica gel column chro-
matography (0-5% MeOH with 1% NH3 aq in DCM) to afford 70 mg of 3d (partially purified).
To a solution of 3d (24 mg, 0.016 mmol) in DCM were added chlorambucil (42 mg, 0.14 mmol), HOAt (19 mg, 0.14 mmol), HATU
(53 mg, 0.14 mmol) and DIEA (40 uL, 0.23 mmol). The reaction mixture was stirred at room temperature overnight and then evapo-
rated. To the residue was added 4N HCl dioxane (3 mL) and the mixture was stirred at room temperature for 2 h followed by evap-
oration of the suspension. The residue was diluted with water (3 mL) and the aqueous layer was washed with DCM and ethyl acetate.
The aqueous layer was directly purified by preparative HPLC with a linear gradient of 0-100% acetonitrile in H2O with 0.1% TFA over
60 min. Fractions containing the compound were concentrated in vacuo and the residue was dissolved in 200 mL of DMSO. The con-
centration of the DMSO stock solution (1.69 mM, 200 mL, 2.1% yield) was determined with 10 mM Tris-HCl, pH 7.4 and molecular
extinction coefficient of mitoxantrone hydrochloride (19200 M-1 cm-1 at 608 nm) (Hajihassan and Rabbani-Chadegani, 2011). Purity
was analyzed on an analytical HPLC with a linear gradient of 0-100% acetonitrile in water with 0.1% TFA (see Figure S6). HRMS m/z
(ESI): calculated for C64H91Cl2N16O13S (M + H)+ 1393.6049, found 1393.6036.
QUANTIFICATION AND STATISTICAL ANALYSIS
All plots show means with error bars representing S.E.M., unless dictated otherwise. Experiments were completed at least in tripli-
cate. Data were plotted using Graphpad’s Prism 7.
DATA AND SOFTWARE AVAILABILITY
The Inforna software is free for academic use with a software license agreement. Please see: https://disney.florida.scripps.edu/
software/.
e7 Cell Chemical Biology 25, 1–9.e1–e7, September 20, 2018