Novel SAHA analogues inhibit HDACs, induce apoptosis and modulate the expression of microRNAs in hepatocellular carcinoma

Article abstract of DOI:10.1007/s10495-016-1278-6

In eukaryotes, transcriptional regulation occurs via chromatin remodeling, mainly through post translational modifications of histones that package DNA into structural units. Histone deacetylases (HDACs) are enzymes that play important role in various biological processes by repressing gene expression. Suberoylanilide hydroxamic acid (SAHA) is a known HDAC inhibitor that showed significant anti cancer activity by relieving gene silencing against hematologic and solid tumors. We have designed and synthesized a series of SAHA analogs C1–C4 and performed biological studies to elucidate its anti-cancer effects. It is observed that SAHA analogs significantly inhibited cell proliferation and induced apoptosis in hepatocellular carcinoma (HCC) cell lines HepG2 and SK-HEP-1. These analogs also showed non-toxic activity towards primary human hepatocytes, which describes its tumor specificity. SAHA analogs exhibited strong HDAC inhibition, which is 2–3 fold higher compared to SAHA. Moreover, these molecules induced hyper acetylation of histone H3 at various positions on the lysine residue. Further, it is observed that SAHA analogs are strong inducers of apoptosis, as they regulated the expression of various proteins involved in both extrinsic and intrinsic pathways. Interestingly, SAHA analogs induced upregulation of tumor suppressor miRNAs by activating its biogenesis pathway. Further, it is confirmed by microRNA (miRNA) prediction tools that these miRNAs are capable of targeting various anti-apoptotic genes. Based on these findings we conclude that SAHA analogs could be strong HDAC inhibitors with promising apoptosis inducing nature in HCC.

Full text of DOI:10.1007/s10495-016-1278-6

Apoptosis
DOI 10.1007/s10495-016-1278-6
Novel SAHA analogues inhibit HDACs, induce apoptosis
and modulate the expression of microRNAs in hepatocellular
carcinoma
Chatla Srinivas1 V. Swathi1,2 C. Priyanka1 T. Anjana Devi1 B. V. Subba Reddy2
•
•
•
•
•
M. Janaki Ramaiah3 Utpal Bhadra4 Manika Pal Bhadra1
•
•
Ó Springer Science+Business Media New York 2016
Abstract In eukaryotes, transcriptional regulation occurs
via chromatin remodeling, mainly through post transla-
tional modifications of histones that package DNA into
structural units. Histone deacetylases (HDACs) are
enzymes that play important role in various biological
processes by repressing gene expression. Suberoylanilide
hydroxamic acid (SAHA) is a known HDAC inhibitor that
showed significant anti cancer activity by relieving gene
silencing against hematologic and solid tumors. We have
designed and synthesized a series of SAHA analogs C1–C4
and performed biological studies to elucidate its anti-can-
cer effects. It is observed that SAHA analogs significantly
inhibited cell proliferation and induced apoptosis in hepa-
tocellular carcinoma (HCC) cell lines HepG2 and SK-HEP-
1. These analogs also showed non-toxic activity towards
primary human hepatocytes, which describes its tumor
specificity. SAHA analogs exhibited strong HDAC inhi-
bition, which is 2–3 fold higher compared to SAHA.
Moreover, these molecules induced hyper acetylation of
histone H3 at various positions on the lysine residue.
Further, it is observed that SAHA analogs are strong
inducers of apoptosis, as they regulated the expression of
various proteins involved in both extrinsic and intrinsic
pathways. Interestingly, SAHA analogs induced upregula-
tion of tumor suppressor miRNAs by activating its bio-
genesis pathway. Further, it is confirmed by microRNA
(miRNA) prediction tools that these miRNAs are capable
of targeting various anti-apoptotic genes. Based on these
findings we conclude that SAHA analogs could be strong
HDAC inhibitors with promising apoptosis inducing nature
in HCC.
Keywords SAHA Á HDAC Á Histones Á microRNA Á
Hepatocellular carcinoma
Electronic supplementary material The online version of this
article (doi:10.1007/s10495-016-1278-6) contains supplementary
material, which is available to authorized users.
& Manika Pal Bhadra
manika@iict.res.in; manikapb@gmail.com
Utpal Bhadra
utpal@ccmb.res.in
Chatla Srinivas
chatlas10@gmail.com
1
Centre for Chemical Biology, CSIR-Indian Institute of
Chemical Technology, Uppal Road, Hyderabad 500007,
India
V. Swathi
swathireddychem19@gmail.com
2
Centre for Semiochemicals, CSIR-Indian Institute of
Chemical Technology, Hyderabad, India
C. Priyanka
priyankacilamkoti@gmail.com
3
School of Chemical and Biotechnology, SASTRA
University, Thanjavur, India
T. Anjana Devi
anjana@iict.res.in
4
Functional Genomics and Gene Silencing Group, CSIR-
Centre for Cellular and Molecular Biology, Hyderabad, India
B. V. Subba Reddy
basireddy@iict.res.in
M. Janaki Ramaiah
janaki7777@gmail.com
123

Apoptosis
In many cancers, notably in hematologic malignancies
HDACs are upregulated. Though, the specificity of HDAC
inhibitors towards tumor cells is poorly understood, these
have emerged as effective anticancer agents. Application
of HDAC inhibitors have additionally been extended
clinically to a variety of non-oncologic diseases like sickle
cell anemia, cystic fibrosis, muscular dystrophy, HIV
infection, neurodegenerative and inflammatory disorders
[18–20]. Recently, HDACIs have attracted researchers due
to their high potency to inhibit a range of solid tumors with
low toxicity [21–23].
Abbreviations
HCC
Hepatocellular carcinoma
SAHA Suberoylanilide hydroxamic acid
HDAC Histone deacetylase
miR
microRNA
PHH
Primary human hepatocytes
Introduction
Hepatocellular carcinoma (HCC) is the most commonly
found primary cancer of the liver. Globally it occupies the
fifth position among all cancers and third position for
leading cause of cancer-related deaths [1–3]. Over 80 % of
new HCC cases occur in Eastern Asia and sub-Saharan
Africa [4–7]. Treatment for the patients at late-stage of
HCC is complicated, causes liver dysfunction and makes
them unfit for potentially curative surgical methods [8, 9].
Presently, regional therapies like transarterial embolization
and percutaneous treatments are used to treat the patients
with non resectable disease. However, their success rate is
restricted due to recurrence or metastasis. For these
patients, systemic therapy is indicated but has been mostly
unsuccessful [10, 11]. Moreover, HCC cells might get rid
of apoptosis due to molecular defects in signaling pathways
which represent a viable strategy to target the disease and
reduce the mortality rate. Consequently, there is a demand
for developing small molecule inhibitors that target sig-
naling pathways in abnormal cellular proliferation and
survival for the treatment of HCC.
Suberoylanilide hydroxamic acid (SAHA) is first of its
kind to inhibit HDACs, which is approved by US food and
drug administration (FDA) for the treatment of cutaneous T
cell lymphoma (CTCL). Recently, it has emerged as an
effective therapeutic anti-cancer agent for a variety of
cancers [24–26]. SAHA is unique due to its apoptosis
inducing nature on different cancers. Clinical investiga-
tions have proved that SAHA exhibited a high therapeutic
potential towards different forms of tumor at specific doses.
SAHA has been reported to activate both intrinsic and
extrinsic pathways of apoptosis in cancer cells [27, 28].
Usually, extrinsic pathways are initiated by death ligands
such as TNF-a, Fas-L and TRAIL by binding to their
corresponding death receptors TNF-R1, Fas and TRAIL-
R1/R2 that lead to the formation of death inducing sig-
naling complex (DISC), where proapoptotic caspase-8 and
caspases-10 get activated [29–31]. When the intrinsic
pathway of apoptosis gets activated, the mitochondrial
membrane potential changes and cytochrome-c is released
from the inner mitrochondrial membrane which in turn
activates the initiator caspase-9. Furthermore, Bcl-2 family
members like Bax, Bcl-2 and Bcl-xL play vital role in the
regulation of intrinsic apoptotic pathway [32]. Based on
these studies, we have designed, synthesized and evaluated
a series of SAHA analogues that affect cell proliferation
and apoptosis in human HCC cell lines HepG2 and SK-
HEP-1. Overall the objective of the current study is to
characterize a potentially new treatment strategy for HCC.
MicroRNAs (miRNAs) are small non-coding RNA
molecules of 22–24 nucleotides in length that regulate the
expression of genes at transcriptional and post-transcrip-
tional level. They bind to its target mRNA and cause its
cleavage or translational repression. They regulate
approximately 30 % of genes involved in various cellular
processes including growth, apoptosis, differentiation etc.
[12–14].
Histone deacetylases (HDACs) are special category of
enzymes that regulate chromatin remodeling and gene
expression. Presently, 18 different mammalian HDACs
categorized into four classes (classes I, II, III and IV) have
been identified that share sequence similarity with Yeast
counterparts. Class I HDACs contain HDAC1, 2, 3 and 8
which are closely related to Yeast RPD3. Class II HDACs
consist of HDAC 4, 5, 6, 7, 9 and 19 that are related to
Yeast HDAC1a. HDAC11 belongs to Class IV and seven
Sirtuins belongs to Class III HDACs that are dependent on
NAD? cofactor for their activity. Formerly, HDAC inhi-
bitors dependent on Zn2? were discovered as inhibitors of
transformed cell growth and inducers of cell death. Later,
these were distinguished as inhibitors of HDAC activity
[15–17].
Materials and methods
Preparation of SAHA and its analogues
Step (a): Suberic acid mono methyl ester (1, 1 g,
0.0053 mol), 1-hydroxybenzotriazole (1.5, 107 mg,
0.007 mol), and aniline (1, 0.494 mg, 0.0053 mol) were
dissolved in DCM (10 mL). 1-Ethyl-3-(3-dimethylamino-
propyl) carbodiimide (1.5, 100 mg, 0.007 mol) was added,
and the mixture was stirred at room temperature for 12 h.
The reaction mixture was diluted with cold water and
extracted with DCM. The organic layer was dried over
123

Apoptosis
sodium sulphate, filtered and the solvent from the filtrate
removed by rotary evaporation. The crude product was
placed on a short pad of silica gel and eluted with petro-
leum ether and ethyl acetate (1:1). The solvent was
removed by rotary evaporation afforded 1.2 g of product
[1], yield 88.7 %.
96-well plate at a density of 1 9 104cells/well and incu-
bated for 24 h, followed by treatment with SAHA analogs
(C1, C2, C3 and C4) at 1, 2, 4, 8 and 16 lM concentrations
and incubated further for 48 h. The old media was replaced
with fresh media to which 10 lL MTT dye was added and
plates were incubated at 37 °C for 2 h. Formazan crystals
so formed were solubilized in 100 lL SDS buffer and the
optical density (OD) was read at 570 nm with multi-mode
plate reader (Varioskan instrument-ThemoScientific).
Step (b): Hydroxylamine hydrochloride (5.84 g,
0.084 mol) in methanol (15 mL) was mixed with KOH
(4.70 g, 0.084 mol) at 40 °C in methanol (25 mL), cooled
to 0 °C, and filtered. The suberanilic acid methyl ester
(1.2 g, 0.004 mol) was then added to the filtrate followed
by addition (over 30 min) of KOH (380 mg, 0.06 mol).
The mixture was stirred at room temperature for 1 h. The
mixture was added to stirring cold water (150 mL), and the
pH was adjusted to seven by adding acetic acid. The pre-
cipitate was filtered off, and the resulting product was dried
in a vacuum oven at 40 °C overnight to yield 1.05 g (yield
90.0 %) of SAHA [2]: mp 158–161 °C.
Cell cycle analysis
HepG2, SK-HEP-1 and PHH cells were seeded in 60 mm
dish at a density of 5 9 105 cells/plate and allowed to grow
for 24 h. SAHA analogs were added to a final concentra-
tion of 1, 2 and 4 lM to the culture media and the cells
were incubated for an additional 48 h. Cells were harvested
with Trypsin–EDTA and fixed with ice-cold 70 % ethanol
at 4 °C for 30 min followed by washes with PBS and
Synthesis scheme of SAHA and its analogs:
(a)
(b)
Cell culture
incubation with 1 mg/ml RNase-A solution (Sigma) at
37 °C for 30 min. Finally, cells were collected by cen-
trifugation at 2000 rpm for 5 min, stained with 250 mL of
Propidium iodide DNA staining solution (10 lg/mL in
PBS) and incubated for 30 min in the dark. 20,000 events/
sample were analyzed and DNA contents were measured
by flow cytometer (DAKO CYTOMATION, Beckman
Coulter, Brea, CA) and histograms were analyzed using
FCS Express Software (De Novo Software).
Human HCC cell lines HepG2 and SK-HEP-1 were pur-
chased from American type culture collection (ATCC).
Both the cell lines were maintained in DMEM (Sigma
Aldrich) supplemented with 10 % Fetal Bovine Serum
(Gibco), 100 U/ml Penicillin and 100 mg/ml Streptomycin
(Invitrogen). Primary human hepatocytes (PHH) was
obtained from LONZA and cultured in CloneticsTM
HCMTM Hepatocyte Culture Medium. All the cell lines
were maintained at 37 °C in an incubator with humidified
atmosphere containing 5 % CO2.
Apoptosis detection assay
2 9 105 HepG2 and SK-HEP-1 cells were plated in each
well of 6-well plate and allowed to grow for 24 h. The cells
were treated with SAHA and its analogs and incubated for
another 48 h. ApoAlertTM Annexin V-FITC Apoptosis Kit
was used to measure apoptotic cells by flow cytometry
according to the manufacturer’s instructions (Clontech
Laboratories, Inc., Cat. 630109). Briefly, cells collected by
trypsinization were washed twice with ice cold Dulbecco’s
Cell viability assay
Cell viability was estimated by MTT cell proliferation
assay, a mitochondrial function assay. The principle of this
assay is the ability of viable cells to reduce MTT dye to
insoluble formazan crystals by mitochondrial dehydroge-
nase. HepG2, SK-HEP-1 and PHH cells were seeded in a
123

Apoptosis
phosphate buffered saline (DPBS) and resuspended in
200 lL of 1X binding buffer containing 5 lL Annexin V
and 10 lL Propidium iodide for 15 min at room tempera-
ture in the dark. Apoptosis of cells was measured on a
Beckman Coulter flow cytometer (Dako Cytomation). At
least 20,000 gated events were acquired from each sample
and results are expressed as the percentage of apoptotic
cells (PI and Annexin V positive) in the gated cell
population.
(Table 1). The products were electrophoresed on agarose
gel (1 %) containing ethidium bromide, visualized under
U.V gel doc system (BIO-RAD). Signal intensity of
respective band was measured by Quantity-One software.
MicroRNA expression profiling
Total RNA was isolated from control and compound
(SAHA or its analogs) treated cells. About 1 lg of DNase-
treated RNA was Poly A tailed using Poly-A-Polymerase.
Oligo dT adapter was used to synthesize cDNA. For per-
forming RT-PCR reaction universal reverse primer and
miRNA specific forward primer was used. The temperature
conditions used were 50 °C for 2 min, 95 °C 10 min, fol-
lowed by 40 cycles of 95 °C 15 s, 55 °C 1 min. The pri-
mers used were obtained from Cancer MicroRNA qPCR
array with Quanti MirTM kit (RA-610A-1, System Bio-
sciences) and the sequence of forward primers was given in
Table 2.
Western blot analysis
Total cell protein from cultured and compound treated
HepG2 and SK-HEP-1 cells was obtained by lysing the
cells in pre-chilled RIPA buffer (Sigma) and centrifuging
at 12,000 rpm for 10 min at 4 °C. The protein in super-
natant was collected and quantified by Bradford method
(BIO-RAD) using Multimode VarioskanFlash instrument
(Thermo-Fischer Scientifics). About 50 lg of protein per
lane was loaded in 10 % SDS–polyacrylamide gel and
electrophoresed. Then protein was transferred from gel to
polyvinylidine difluoride (PVDF) membrane (Millipore)
and the membrane was blocked for 2 h in 1X TBST buffer
containing 5 % non-fat dry milk powder (Santa Cruz
Biotechnology). The membrane was washed with 1X
TBST for 5 min and incubated overnight with primary
antibody at 4 °C. Primary antibodies HDAC1 (06–720),
HDAC2 (05–814), HDAC3 (07–522), HDAC6 (07–732),
HDAC8 (07–505), p53AC (lys373) (06–916) and PARP-
cleaved (04–576) from Millipore; Caspase-3 (IMG-144A),
GAPDH (IMG-6665A), HDAC4 (IMG-338), HDAC5
(IMG-339), PUMA (IMG-5516) and Survivin (IMG-
6082A) from Imgenex; Bax (SC-520), Bcl-XL (SC-8392)
and Cytochrome-C (SC-7159) from Santacruz Biotech-
nology; Bcl-2 (ab32124) and Caspase-9 (ab16969) from
Abcam; BID (2002) and Caspase-8 (9496) from Cell Sig-
naling Technology were purchased. Membrane was
washed with 1X TBST and incubated with corresponding
horseradish peroxidase (HRP) labeled secondary antibody
(1:5000) (Santa Cruz, Biotechnology) at room temperature
for 1 h followed by three washes with 1X TBST. The blots
were visualized using chemiluminescence reagent (Lumi-
nata crescendo, Millipore) under Chemidoc XRS? instru-
ment (BIO-RAD) and images were acquired by Image Lab
software (BIO-RAD).
Fluorescence based microscopic analysis
of apoptosis
Acridine orange and Ethidium bromide (AO/EB) double
staining method was performed to detect viable and
nonviable cells. HepG2 and SK-HEP-1 cells were treated
at 4 lM and incubated for 48 h after which 50 lL of AO/
EB dye mixture (10 lL/mg AO and 10 lL/mg EB in
distilled water) in 1:1 ratio was added to each well of
24-well plate containing 2.5 9 104 cells/well. Immedi-
ately after the incubation period, the cells were observed
under Olympus inverted fluorescent microscope at 1009
magnification.
HDAC enzyme activity assay
The Color-de-Lys system (Colorimetric Histone de
Acetylase Lysyl Substrate/Developer) is a sensitive and
convenient alternative to protocols utilizing radiolabeled,
acetylated histones or peptide/HPLC methods for the
assay of HDACs. Color-de-LysÒ HDAC colorimetric
activity assay kit (Enzo Life Sciences) was used accord-
ing to manufacturer’s instructions to detect the enzymatic
activity of HDACs present in the nuclear extracts isolated
from HepG2 and SK-HEP-1 cells. This assay procedure
has two steps; first, the Color de Lys Substrate that
comprises an acetylated side chain of lysine is incubated
with nuclear extract containing HDAC activity followed
by test samples (SAHA or its analogs). Then the
deacetylation process sensitizes the substrate and in the
second step, the Color de Lys Developer that added to the
substrate causes an increase in yellow color that is
absorbed at 405 nm.
RT-PCR analysis
Total RNA was extracted by Trizol method (Life tech-
nologies) and reverse transcribed into cDNA using super-
script II reverse transcriptase (Life technologies). RT-PCR
was carried out with specific primers for GAPDH, HDAC1,
2, 3, 4, 5, 6, 7 and 8 in Eppendorf PCR thermal cycler
123

Apoptosis
Table 1 List of primers used
for RT-PCR analysis
˚
Annealing temperature (C)
S.No
1
Gene
Sequence
HDAC1
Forward: GGAAATCTATCGCCCTCACA
Reverse: AACAGGCCATCGAATACTGG
Forward: ATAAAGCCACTGCCGAAGAA
Reverse: TCCTCCAGCCCAATTAACAG
Forward: ACGTGGGCAACTTCCACTAC
Reverse: GACTCTTGGTGAAGCCTTGC
Forward: AGTGGCCAGGTTATCAGTGG
Reverse: GGAGAAGAGCCGAGTGTGTC
Forward: CGCAAGGATGGGACTGTTAT
Reverse: GAGCATCTCAGTGGGGATGT
Forward: AAGTAGGCAGAACCCCCAGT
Reverse: GTGCTTCAGCCTCAAGGTTC
Forward: CCCAGCAAACCTTCTACCAA
Reverse: AAGCAGCCAGGTACTCAGGA
Forward: GGTGACGTGTCTGATGTTGG
Reverse: AGCTCCCAGCTGTAAGACCA
Forward: GGGAAGGTGAAGGTCGGAGT
60
60
60
57
60
57
60
60
60
2
3
4
5
6
7
8
9
HDAC2
HDAC3
HDAC4
HDAC5
HDAC6
HDAC7
HDAC8
GAPDH
Caspase 3 assay
Statistical analysis
Caspase-3 activity was determined by using Apoalert cas-
pase-3 fluorescent assay kit (Clontech) according to the
manufacturer’s protocol. It is based on the fluorometric
detection of emitted 7-amino-4-trifluoromethyl coumarin
(AFC) by the cleavage of substrate (DEVD-AFC) by cas-
pase-3, which fluoresces yellow-green (kmax = 505 nm).
HepG2 and SK-HEP-1 cells (2 9 105 cells/ml) were incu-
bated with SAHA and its analogs for 48 h. Cells were har-
vested by trypsinization, washed twice with ice cold DPBS
buffer (pH 7.4) and lysed with lysis buffer supplied in the kit.
Supernatant was collected and protein concentration deter-
mined using Bradford’s reagent. Equal amount of protein
(100 lg) was incubated with the supplied 29 reaction buffer
containing dithiothreitol (DTT) and substrate (5 lL) at
37 °C for 1 h. Caspase-3 activity was determined by mea-
suring changes in absorbance at 505 nm using the Multi-
mode reader (Varioskan flash, Thermofisher Sci.).
Statistical analysis was performed using the graph-pad
software to evaluate the significant difference between the
control and treated samples. All variables were tested in
three independent experiments. The results were reported
as mean SD. * indicates p \ 0.05, ** indicates p \ 0.01
and *** indicates p \ 0.001.
Results
SAHA analogs reduce cell viability and arrest
the HCC cells at Sub-G1 phase of cell cycle
HCC cell lines HepG2 and SK-HEP-1 were treated with
SAHA or its analogs C1, C2, C3 or C4 at different
doses (1–16 lM) for 48 h after which cells were subjected to
MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
Table 2 Sequence of
microRNA forward primers
S.no
MicroRNA
Primer sequence
Annealing temperature (°C)
1
2
3
4
5
6
7
8
9
miR-15a
miR-16
miR-34a
miR-101
miR-125a
miR-195
miR-22
miR-221
U6
TAGCAGCACATAATGGTTTGTG
TAGCAGCACGTAAATATTGGCG
TGGCAGTGTCTTAGCTGGTTGT
TGGCAGTGTCTTAGCTGGTTGT
TCCCTGAGACCCTTTAACCTGTGA
TAGCAGCACAGAAATATTGGC
AAGCTGCCAGTTGAAGAACTGT
ACCTGGCATACAATGTAGATTT
CGCAAGGATGACACGCAAATTC
55
55
55
55
55
55
55
55
55
123

Apoptosis
Fig. 1 Chemical structure and anti-cancer activities of SAHA and its
analogs on Hepatocellular carcinoma cells. a Chemical structure and
IUPAC names of SAHA and its analogs (C1, C2, C3 and C4). b–
d MTT cell proliferation assay shows the cytotoxic effect of SAHA
analogs at 1–4 lM for 48 h in HepG2, SK-HEP-1 and PHHs. e–g Cell
cycle analysis shows the accumulation of cell population in Sub-G1
phase of cell cycle in HepG2 and SK-HEP-1 cells treated with SAHA
analogs at 1–4 lM for 48 h, whereas, no cell death was observed in
PHHs treated at same conditions
c
bromide) assay that measures cytotoxicity. MTT cell pro-
liferation assay showed that the cytotoxic effect caused by
SAHA or its analogs on hepatocarcinoma cell lines was
completely dose dependent. A significant cytotoxic effect
was observed when cells were treated at 4 lM, while the
effect observed at 1 or 2 lM was negligible (Fig. 1b, c).
We also performed MTT assay in PHH by treating the
cells with SAHA or its analogs at 1–16 lM. Interestingly,
we observed a negligible toxicity, indicating the non-toxic
nature of SAHA analogs towards the normal cells
(Fig. 1d). Next, we performed cell cycle analysis after
treating the cells with SAHA or its analogs at 1, 2 and
4 lM. Cells treated at 4 lM showed significant cell death
compared to 2 lM as the cell population accumulated in
Sub-G1 phase of cell cycle in both the cell lines. Notably,
all the analogs (C1–C4) showed 2–3 fold increase in
apoptosis compared to its parent molecule SAHA. In this
experiment, DMSO treated cells represent control that
showed a regular pattern of cell cycle (Fig. 1e, f and
Supplementary Fig. S1–S3). We also repeated the cell
cycle analysis in PHHs treated with SAHA analogs at 1, 2
and 4 lM. We observed that none of the analogs induced
apoptosis in PHH cells, clearly indicating its specificity
towards hepatocarcinoma cells (Fig. 1g).
where the membrane integrity is lost and emits red fluo-
rescence. Depending upon the fluorescence emission
spectra the cells are categorized into four groups: viable,
early apoptotic, late apoptotic and necrotic cells. Micro-
scopic observation showed distinguishable morphological
changes in cells treated with SAHA or its analogs com-
pared to untreated cells; the intensity of color was
increased from yellow to orange when observing from
SAHA to C4 treated cell samples indicating the increase in
the percentage of apoptosis (Fig. 2d, e). These findings
clearly showed that all the analogs induced a substantial
amount of apoptosis in hepatocarcinoma cells compared to
SAHA treated cells.
SAHA analogs activate both extrinsic and intrinsic
apoptotic pathways
SAHA analogs effectively induce apoptosis
in hepatocellular carcinoma cells
Apoptosis is the critical process during cell growth,
development, embryogenesis and cancer, which is exe-
cuted via two major pathways in mammalian cells;
extrinsic or death-receptor pathway and intrinsic or mito-
chondrial pathway. As analogs of SAHA induced apopto-
sis, we extended our work to see the expression of proteins
involved in apoptotic pathways. HCC cell lines HepG2 and
SK-HEP-1 were treated with SAHA or its analogs (C1, C2,
C3 or C4) at 4 lM and the total protein was isolated.
Western blot analysis was performed using specific anti-
bodies against apoptotic and anti-apoptotic proteins. A
remarkable change in expression of various proteins
involved in both extrinsic and intrinsic pathways was
observed. An increase in the expression of Fas ligand (Fas-
L) and its activated death domain (FADD) upon treatment
of cells with SAHA or its analogs was observed. There was
a significant increase in the level of cleaved Caspase8,
which in turn cleaved the Bid into its active form t-Bid that
easily translocated into the mitochondria and changes its
membrane potential. These events clearly suggested the
existence of extrinsic pathway of apoptosis. Further, sig-
nificant upregulation was seen for pro-apoptotic proteins
like Bax, Caspase-3 and Caspase-9, while anti-apoptotic
proteins such as Bcl-2, Bcl-xL and Survivin showed
downregulation. In addition, the release of Cytochrome-C
from mitochondrial membrane confirmed the existence of
To confirm the apoptotic effect caused by these analogs,
we measured the extent of apoptosis by Annexin V-FITC
method by dividing the cell population into live cells, early
apoptotic cells and late apoptotic cells (dead cells). In this
study, DMSO treated cells served as control. It was found
that HepG2 and SK-HEP-1 cells treated for 48 h with
SAHA or its analogs at 4 lM showed an increase in the
percentage of apoptotic or dead cells from 3.93 to 46.21 %
in HepG2 and an increase from 2.4 to 40.36 % in SK-HEP-
1 compared to the control cells (Fig. 2a, b). Further, to
confirm the non-cytotoxic nature of SAHA or its analogs
on normal liver cells, we performed this experiment in
PHHs also. Interestingly, we observed no significant toxic
effect that confirmed the hypothesis of non-toxicity of
SAHA analogs once again (Fig. 2c).
In order to differentiate the live cells from the ones that
have undergone death, we performed Acridine orange/
Ethidium bromide (AO/EB) double staining technique after
treating the cells with SAHA or its analogs at 4 lM. This
method detects viable and nonviable cells as follows:
acridine orange enters both viable and nonviable cells and
emits green fluorescence when bound to double stranded
nucleic acid (DNA) or red fluorescence when bound to
single stranded nucleic acid (RNA), while ethidium bro-
mide exclusively stains nonviable cells by binding to DNA,
123

Apoptosis
123

Apoptosis
Fig. 2 SAHA analogs induced apoptosis in Hepatocellular carcinoma
cells. a–c HepG2, SK-HEP-1 and PHH cells were treated with SAHA
analogs at 4 lM and subjected to Annexin V-FITC analysis. d,
e Acridine orange/Ethidium bromide double staining assay represents
the live (Green), early apoptotic (Yellow) and late apoptotic/dead
(orange/red) cells after giving treatment with SAHA analogs at 4 lM
for 48 h in HepG2 and SK-HEP-1 cells
123

Apoptosis
Fig. 3 Expression of proteins
involved in apoptotic pathways.
HepG2 and SK-HEP-1 cells
were treated with SAHA
analogs at 4 lM and incubated
for 48 h. Isolated protein was
subjected to western blot
analysis and observed the
change in the expression of
different proteins involved in
both extrinsic and intrinsic
pathways of apoptosis
Fig. 4 Expression of caspase
proteins involved in apoptosis.
a Total protein from HepG2 and
SK-HEP-1 cells treated with
SAHA or its analogs at 4 lM
was isolated and western
blotting was performed. The
image shows the significant
upregulation of caspases-8, 9
and 3. b ApoAlert Caspase-3
fluorescent assay shows
elevated levels of caspase-3 in
cells treated with SAHA
analogs. In this assay caspase
inhibitor DEVD-CHO is used as
negative control
SAHA analogs induce caspase dependent apoptosis
intrinsic pathway of apoptosis (Fig. 3). Based on the above
findings, it was clear that the analogs C1, C2, C3 and C4
were potent inducers of both extrinsic and intrinsic path-
ways of apoptosis in hepatocarcinoma cells.
Caspases are endoproteases that hydrolyze the peptide
bonds at cysteine residue in protein molecules and are
123

Apoptosis
Fig. 5 Effect of SAHA analogs
on expression of HDAC
proteins. a SAHA or its analogs
show strong HDAC inhibiting
activity on HepG2 and SK-
HEP-1 cells treated at 4 lM for
48 h, as observed by RT-PCR
analysis. b Western blot
analysis shows the decreased
levels of HDAC proteins as
caused by SAHA or its analogs
at 4 lM. c Color-de-Lys HDAC
colorimetric activity assay
shows the decreased enzymatic
activity of HDACs present in
nuclear extracts of HepG2 and
SK-HEP-1 cells treated with
SAHA analogs at a final conc.
of 4 lM
essential for regulating cell death and inflammation [33].
Caspases-8 and 10 are activators of extrinsic apoptotic
pathway, which are usually present in an inactive form and
are activated by adaptor molecules binding to the
cytoplasmic part of death receptors. These activated cas-
pases in turn activate the executioner caspases-3, 6 and 7
that mediate apoptosis. Once cytochrome-C is released
from the mitochondrial membrane it promotes the
123

Apoptosis
oligomerisation of pro-apoptotic factor apaf-1 that recruits
and activates caspases-9, which successively promotes the
activation of caspases-3 [34]. Since, SAHA analogs (C1–
C4) induced apoptosis; we wanted to know whether these
were capable of inducing apoptosis via caspases. There-
fore, we studied the expression of Caspases-8, 9 and 3 by
western blotting in HepG2 and SK-HEP-1 cells treated
with SAHA or its analogs. The C3 and C4 molecules
showed a significant increase in the levels of cleaved/active
fragments of Caspase-8, 9 and 3 in both the cell lines
(Fig. 4a). Recent studies evidenced that caspase-3 plays a
major role in the execution of apoptosis and is also
responsible for the cleavage of PARP, which is a hallmark
of apoptosis [35, 36]. Therefore, to confirm the levels of
cleaved/active caspase-3, we performed ApoAlert Caspase-
3 fluorescent assay and observed elevated levels of
cleaved/active caspase-3 in HCC cells treated with SAHA
or its analogs. In this assay, we used caspase-3 inhibitor
(DEVD-CHO) as negative control in cells treated with
SAHA separately. We found a similar kind of upregulation
of caspase-3 that correlated with western blotting results
(Fig. 4b). Notably, C3 and C4 molecules showed a 2–3
fold increase in caspase-3 expression compared to SAHA.
We also studied the expression of PARP and observed a
significant upregulation of cleaved/active form of PARP
that evidenced the occurrence of caspase-3 mediated PARP
cleavage. All together, these findings clearly suggested that
apoptosis caused by SAHA or its analogs is caspase
dependent.
Table 3 Inhibition of HDAC enzyme activity by SAHA analogs in
HepG2 nuclear extract
Compounds
Deacetylated lysine/
abs HDAC (lM)
% of HDAC
inhibitiona
SAHA
C1
63.37 4.38
60.13 7.55
50.65 3.53
29.64 3.91
21.71 1.11
37
40
51
71
79
C2
C3
C4
a
HepG2 nuclear extract without any HDAC inhibitor, which shows
100 lM of deacetylated lysine and 0 % HDAC inhibition
Table 4 Inhibition of HDAC enzyme activity by SAHA analogs in
SK-HEP-1 nuclear extract
Compounds
Deacetylated lysine/
abs HDAC (lM)
% of HDAC
inhibitiona
SAHA
C1
44.95 4.68
46.37 9.43
31.71 3.15
31.45 4.63
22.55 6.90
55
54
68
69
78
C2
C3
C4
a
SK-HEP-1 nuclear extract without any HDAC inhibitor, which
shows 100 lM of deacetylated lysine and 0% HDAC inhibition
whether these analogs are potential HDAC inhibitors, we
performed Color-de-Lys HDAC colorimetric enzyme
activity assay and determined the effect of SAHA analogs
on HDAC activity [39]. Interestingly, we observed that all
the analogs of SAHA inhibited HDACs significantly with a
good percentage of inhibition compared to SAHA
(Tables 3, 4). In this assay, we considered nuclear extract
without any inhibitor as control and SAHA as positive
control (Fig. 5c). All the above data clearly demonstrated
that the analogs of SAHA (C1–C4) are strong HDAC
inhibitors even compared to its parent molecule SAHA.
SAHA analogs exhibit strong HDAC inhibition
It has been reported that high expression of different
HDACs are implicated in various cancers including HCC
and SAHA is a well known pan-HDAC inhibitor
[17, 37, 38]. In the present study, we investigated the
HDAC inhibiting activity of analog molecules (C1–C4)
and compared with SAHA. RNA was isolated from cells
treated with SAHA or its analogs at 4 lM for 48 h and
reverse transcribed to cDNA. To study the effect of SAHA
analogs on expression of different HDAC genes, we per-
formed RT-PCR analysis and observed that all analogs
inhibited HDACs of class-I and II significantly; especially
they showed strong inhibition towards HDAC6, 7 and 8
compared to SAHA (Fig. 5a). In addition, to see the effect
on expression of proteins, we performed western blot
analysis and observed a significant decrease in the
expression of HDACs 1, 2, 3, 6, 7 and 8 in HepG2 and SK-
HEP-1 cells treated with SAHA analogs (Fig. 5b). The
amount of decrease in HDAC8 in cells treated with analogs
is 2–3 fold higher in comparison to SAHA treated cells.
Interestingly, there was a strong correlation between
western blot and RT-PCR results. Further, to characterize
SAHA analogs promote acetylation of histone
and non-histone proteins
Previous studies suggested that SAHA acetylates both
histones and non-histone proteins like p53, HSP-90, a-
tubulin etc. [40–43]. To investigate the acetylation property
of our synthesized analogs, we isolated the total histone
proteins from HepG2 and SK-HEP-1 cells treated with
SAHA or its analogs and probed with specific anti-histone
antibodies. Acetylation of histone H3 at lysine 9 (H3K9)
and lysine 14 (H3K14) are often associated with active
transcription of many genes including tumor suppressor
genes [44]. Interestingly, SAHA analogs induced hyper
123

Apoptosis
Fig. 6 Effect of SAHA analogs
on histone and non-histone
proteins. HepG2 and SK-HEP-1
cells were treated with SAHA or
its analogs at 4 lM for 48 h and
histones were isolated. Western
blot image shows the increased
levels of histone H3 protein
acetylated at different positions
on lysine residue and non-
histone protein p53 acetylated at
lysine 373 position. Total
histone H3 and GAPDH were
used as loading controls
acetylation of both H3K9 and H3K14 and the proportion of
acetylation induced was 1–2 fold higher than its parent
molecules SAHA. Since, p53 is a tumor suppressor protein
and triggers apoptosis, we were interested to examine
whether SAHA analogs induced acetylation of p53 or not.
Therefore, we performed western blot analysis by isolating
the proteins from HepG2 and SK-HEP-1 cells treated with
SAHA or its analogs at 4 lM and probed with specific p53
antibody that detects p53 protein acetylated at Lys373
position (Fig. 6). Interestingly, we found a remarkable
increase in the acetylation of p53 in HCC cells treated with
the SAHA or its analogs, which clearly suggests the strong
acetylating property of SAHA analogs.
SAHA and untreated DMSO control. Further, we observed
the downregulation of some oncogenic miRNAs like miR-
22 and miR-221, which commonly upregulated and pro-
mote tumorigenesis in HCC (Fig. 7a). Recently, different
research groups evidenced that small molecules activate
RNA interference and microRNA processing by enhancing
the expression of Drosha, Dicer, TRBP and Ago-1, the key
proteins involved in the microRNA biogenesis pathway
[50–52]. Hence, we were interested to know the existing
mechanism of this microRNA’s upregulation by SAHA
analogs and performed western blot analysis. Interestingly,
we observed an increase in the expression of proteins
Drosha, Dicer-1, TRBP and Ago-1, which clearly suggest
that SAHA analogs modulated the expression of these
miRNAs by activating microRNA processing machinery
(Fig. 7b). Further, to verify the targets of these miRNAs,
we performed computational analysis by using different
microRNA prediction tools like miRanda, TargetScan,
PITA and RNAhybrid and observed that one to many of
these tumor suppressor miRNAs are capable of targeting
different anti-apoptotic genes like BCL-2 (Bcl-2), BCL2L1
(Bcl-xL), BIRC5 (Survivin) and all most all HDAC genes
with good miRSVR scores. Based on these observations it
is clear that SAHA or its analogs are novel microRNA
modulators that upregulated tumor suppressor miRNAs in
HCC.
SAHA analogs modulate microRNA expression
Recent studies evidenced that several miRNAs target dif-
ferent genes involved in tumor progression by acting either
as tumor suppressors or oncogenes in human liver cancer.
Specifically, miR-15a/16 and miR-34a act as tumor sup-
pressors in many cancers including HCC, where they are
frequently downregulated. It is also reported that micro-
RNA-15a/16 and microRNA-34a are functionally similar
as they share common targets like Bcl-2 and control cel-
lular processes like G1 to S transition in cell cycle pro-
gressison and apoptosis [45, 46]. Studies by different
groups suggested that miRNAs-101, 125a and 195 fre-
quently downregulated in HCC; When these miRNAs
ectopically expressed in hepatocarcinoma cells, they con-
trol proliferation, metastasis and other metabolisms nec-
essary for cancer cell development [47–49]. Based on the
above data, we investigated endogenous levels of miRNAs-
15a, 16, 34a, 101, 125a and 195 by performing RT-PCR
analysis in HepG2 and SK-HEP-1 cells treated with SAHA
or its analogs. Interestingly, we observed a significant
increase in the expression of all these tumor suppressor
miRNAs in cells treated with SAHA analogs compared to
Discussion
HDAC inhibitors alone or in combination with other drugs
have been known to show efficacy towards hematological
and solid tumors [53–55]. SAHA shows the characteristic
features of apoptosis induction and growth arrest in cancer
cells but shows no impact on normal cells [56, 57]. In the
present study, we designed, synthesized and biologically
evaluated four novel analogs of SAHA for their anti-cancer
123

Apoptosis
Fig. 7 Effect of SAHA analogs
on microRNA biogenesis.
a HepG2 and SK-HEP-1 cells
were treated with SAHA or its
analogs at 4 lM and incubated
for 48 h. RT-PCR analysis
indicating an upregulation of
different tumor suppressor
miRNA and downregulation of
oncogenic miRNA. b Western
blot analysis shows the effect of
SAHA analogs on expression of
proteins involved in microRNA
biogenesis pathway
activity. To ascertain the cytotoxic effect of these analogs
(C1, C2, C3 and C4), we performed MTT cell proliferation
assay at various concentrations ranging from 1 to 16 lM,
where SAHA was used as the positive control. Interest-
ingly, we found all the four analogs were more cytotoxic
than its parent molecule SAHA towards hepatocarcinoma
cell lines HepG2 and SK-HEP-1, while they show no sig-
nificant effect on normal liver cells (PHH) that indicate its
tumor specific activity. Additionally, cell cycle analysis
showed a significant cell death caused by SAHA analogs at
4 lM, where most of the cells accumulated in Sub-G1
phase. Simultaneously, cell cycle analysis in PHHs treated
with these analogs at various concentrations showed a
negligible or no effect that revealed its non-toxic nature
towards normal cells. Further, Annexin V-FITC studies
confirmed the dispersion of cells into different populations
such as live, early and late apoptosis. Since, SAHA analogs
induced apoptosis in hepatocarcinoma cells, we performed
acridine orange/ethidium bromide double staining assay to
observe the change in morphology of compound treated
cells. In this assay, acridine orange stains both live and
dead cells, while ethidium bromide enters and stains solely
dead cells in which the membrane integrity is lost [58].
HCC cells treated with analogs C1–C4 were spherical in
appearance and exhibit different fluorescence emission
spectra compared to control cells (DMSO treated), which
were green in color with well defined morphological
structures as indicative of live cells. Based on these
123

Apoptosis
findings, we elucidate that these analogs are potent
inducers of apoptosis in hepatocarcinoma cells compared
to well known SAHA molecule.
in the expression of miRNAs-15a, 16, 34a, 101, 125a and
195 in HCC cells treated with SAHA analogs exhibiting a
significant role for the activation of these tumor suppressor
miRNAs. Additionally, we confirmed that SAHA analogs
activated the miRNA biogenesis pathway by increasing the
expression of different miRNA processing proteins such as
Drosha, Dicer-1, TRBP and Ago-1. It is also observed that
these miRNAs are predicted to be targeting transcripts of
oncogenes like BCL2, BCL2L1, BIRC5 and all HDACs
that are also inhibited by SAHA or its analogs (C1–C4). All
these findings such as induction of apoptosis, HDAC
inhibition, acetylation of histones and non-histone proteins,
activation of caspases and tumor suppressor miRNAs
clearly demonstrate the versatile nature of novel analogs of
SAHA towards killing of HCC cells. Finally, based on
these observations, we conclude that these analogs could be
promising anti-cancer agents for Hepatocellular carcinoma.
The anti-tumor activities of SAHA analogs could be better
explained by using a HCC animal model for this study.
But, in near future we evaluate the efficacy of SAHA
analogs on HCC animal models by studying the toxico-
logical and tumor regression studies.
It is obvious that apoptosis can be executed by either
extrinsic or intrinsic apoptotic pathways or by both.
Recently, it is unraveled that SAHA activated both the
pathways of apoptosis as the characteristic cleavage prod-
ucts were observed for different caspases like extrinsic
initiator caspase-8, intrinsic initiator caspase-9 and the
main effector caspase-3 [59]. Hence, in the present study,
we investigated the role of SAHA and its novel analogs in
the activation of apoptotic pathways. Western blot studies
clearly demonstrated that increase in the expression of
cleaved Caspase-8 and cleavage of Bid into t-Bid is due to
the activation of extrinsic pathway of apoptosis. Simulta-
neously, we observed the release of cytochrome-c from the
mitochondrial membrane as observed by cyto-mito frac-
tionation followed by western blotting. Furthermore, an
upregulation of pro-apoptotic protein Bax, cleavage of
Caspase-9 and Caspase-3 and downregulation of anti-
apoptotic proteins Bcl-2, Bcl-xL and Survivin clearly
suggest the occurrence of intrinsic pathway of apoptosis.
Moreover, an upregulation of cleaved PARP, which is a
hallmark of apoptosis, was also clearly evidenced. Studies
by fluorescence based caspase-3 assay showed that all the
analogs produced a significant increase in the levels of
caspase-3 protein compared to SAHA. Based on the above
findings it is clear that SAHA and its analogs are potent
inducers of apoptosis in HCC cells.
Acknowledgments The entire work was supported by CSIR 12th
FYP project-SMILE (CSC-0111). CS and VS thank CSIR for their
fellowship. All the authors thank P. Devender for maintaining the cell
culture facility.
Author’s contributions CS and CP designed and conducted all
experiments. MPB, UB and CS conceived the idea, performed data
analysis and drafted the manuscript. TAD and MJR helped in data
analysis and drafting the manuscript. VS and BVS synthesized the
chemical compounds. All authors read and approved the final
manuscript.
SAHA is well known for its broad spectrum HDAC
inhibition and is approved by US FDA for the treatment of
acute T-cell lymphoma [24, 60]. RT-PCR analysis in
HepG2 and SK-HEP-1 cells treated with SAHA analogs
showed a drastic decrease in the levels of class-I and class-
II HDACs. Additionally, western blot results also strongly
correlated with RT-PCR results and showed the downreg-
ulation of HDACs-4 and five in HepG2 and HDACs-5 and
seven in SK-HEP-1 cells. Further, colorimetric HDAC
assay proved the strong HDAC inhibiting activity of SAHA
analogs. In future, studies like molecular docking and
Immunoprecipitation should be needed to study the binding
interactions between the SAHA analogs and HDAC pro-
teins. Though, SAHA is known for its HDAC inhibition, it
also enhanced the hyper acetylation of histone H3 on lysine
at various positions and non-histone protein p53 on serine
373 postition. All these findings clearly demonstrated that
SAHA analogs are more potent than its parent molecule
SAHA towards HDAC inhibition and histone modification.
Since miRNAs play a major role in the regulation of
cancer by acting as tumor suppressors or oncogenes in
various cancers including HCC, we were interested to
investigate the role of SAHA analogs in the regulation of
miRNAs. Interestingly, we observed a significant increase
Compliance with ethical standards
Competing interests The authors have declared that no competing
interest exists.
References
1. Ferenci P, Fried M, Labrecque D et al (2010) Hepatocellular
carcinoma (HCC): a global perspective. J Clin Gastroenterol
44:239–245
2. Vilarinho S, Taddei T (2015) Therapeutic strategies for hepato-
cellular carcinoma: new advances and challenges. Curr Treat
Options gastroenterol 13:219–234
3. Llovet JM, Villanueva A, Lachenmayer A, Finn RS (2015)
Advances in targeted therapies for hepatocellular carcinoma in
the genomic era. Nat Reviews Clin Oncol 12:436
4. Gish RG (2006) Hepatocellular carcinoma: overcoming chal-
lenges in disease management. Clin Gastroenterol Hepatol
4:252–261
5. Seeff LB, Hoofnagle JH (2006) Epidemiology of hepatocellular
carcinoma in areas of low hepatitis B and hepatitis C endemicity.
Oncogene 25:3771–3777
123

Apoptosis
6. Di Bisceglie AM (2009) Hepatitis B and hepatocellular carci-
noma. Hepatology 49:S56–S60
28. Darvas K, Rosenberger S, Brenner D et al (2010) Histone
deacetylase inhibitor-induced sensitization to TNFalpha/TRAIL-
mediated apoptosis in cervical carcinoma cells is dependent on
HPV oncogene expression. Inter J Cancer 127:1384–1392
29. Krammer PH, Kaminski M, Kiessling M, Gulow K (2007) No life
without death. Adv Cancer Res 97:111–138
30. Walczak H, Haas TL (2008) Biochemical analysis of the native
TRAIL death-inducing signaling complex. Methods Mol Biol
414:221–239
31. Jazirehi AR, Arle D (2013) Epigenetic regulation of the TRAIL/
Apo2L apoptotic pathway by histone deacetylase inhibitors: an
attractive approach to bypass melanoma immunotherapy resis-
tance. Am J Clin Exp Immunol 2:55–74
7. El-Serag HB (2012) Epidemiology of viral hepatitis and hepa-
tocellular carcinoma. Gastroenterology 142(1264–1273):e1261
8. Deshpande R, O’Reilly D, Sherlock D (2011) Improving out-
comes with surgical resection and other ablative therapies in
HCC. Inter J Hepatol 2011:686074
9. Gish RG, Finn RS, Marrero JA (2013) Extending survival with
the use of targeted therapy in the treatment of hepatocellular
carcinoma. Gastroenterol & hepatol 9:1–24
10. Zhu AX, Salem R (2013) Combining transarterial chemoem-
bolization with radiofrequency ablation for hepatocellular carci-
noma: one step forward? J Clin Oncol 31:406–408
11. Forner A, Gilabert M, Bruix J, Raoul JL (2014) Treatment of
intermediate-stage hepatocellular carcinoma. Nat Rev Clin Oncol
11:525–535
12. Schickel R, Boyerinas B, Park SM, Peter ME (2008) Micro-
RNAs: key players in the immune system, differentiation,
tumorigenesis and cell death. Oncogene 27:5959–5974
13. Li M, Marin-Muller C, Bharadwaj U, Chow KH, Yao Q, Chen C
(2009) MicroRNAs: control and loss of control in human phys-
iology and disease. World J Surg 33:667–684
32. Reed JC (2008) Bcl-2-family proteins and hematologic malig-
nancies: history and future prospects. Blood 111:3322–3330
33. McIlwain DR, Berger T, Mak TW (2013) Caspase functions in
cell death and disease. Cold Spring Harb Perspect Biol 5:a008656
34. Li Z, Xu X, Huang Y et al (2012) Swainsonine activates mito-
chondria-mediated apoptotic pathway in human lung cancer
A549 cells and retards the growth of lung cancer xenografts. Inter
J Biol Sci 8:394–405
35. Duriez PJ, Shah GM (1997) Cleavage of poly(ADP-ribose)
polymerase: a sensitive parameter to study cell death. Biochem
Cell Biol 75:337–349
14. Yi B, Piazza GA, Su X, Xi Y (2013) MicroRNA and cancer
chemoprevention. Cancer Prev Res 6:401–409
15. Smith KT, Workman JL (2009) Histone deacetylase inhibitors:
anticancer compounds. The Inter J Biochem & Cell Biol
41:21–25
36. Napso T, Fares F (2014) Zebularine induces prolonged apoptosis
effects via the caspase-3/PARP pathway in head and neck cancer
cells. Int J Oncol 44:1971–1979
16. Delcuve GP, Khan DH, Davie JR (2012) Roles of histone
deacetylases in epigenetic regulation: emerging paradigms from
studies with inhibitors. Clinical Epigenetics 4:5
37. Marks PA, Richon VM, Breslow R, Rifkind RA (2001) Histone
deacetylase inhibitors as new cancer drugs. Curr Opin Oncol
13:477–483
17. Barneda-Zahonero B, Parra M (2012) Histone deacetylases and
cancer. Mol Oncol 6:579–589
18. Marks PA (2010) Histone deacetylase inhibitors: a chemical
genetics approach to understanding cellular functions. Biochim
Biophys Acta 1799:717–725
38. Min A, Im SA, Kim DK et al (2015) Histone deacetylase inhi-
bitor, suberoylanilide hydroxamic acid (SAHA), enhances anti-
tumor effects of the poly (ADP-ribose) polymerase (PARP)
inhibitor olaparib in triple-negative breast cancer cells. Breast
Cancer Res 17:33
19. Wiech NL, Fisher JF, Helquist P, Wiest O (2009) Inhibition of
histone deacetylases: a pharmacological approach to the treat-
ment of non-cancer disorders. Curr Top Med Chem 9:257–271
20. Witt O, Deubzer HE, Milde T, Oehme I (2009) HDAC family:
what are the cancer relevant targets? Cancer Lett 277:8–21
21. Nishioka C, Ikezoe T, Yang J, Takeuchi S, Koeffler HP,
Yokoyama A (2008) MS-275, a novel histone deacetylase inhi-
bitor with selectivity against HDAC1, induces degradation of
FLT3 via inhibition of chaperone function of heat shock protein
90 in AML cells. Leuk Res 32:1382–1392
39. Fan H, Zhang R, Tesfaye D et al (2012) Sulforaphane causes a
major epigenetic repression of myostatin in porcine satellite cells.
Epigenetics 7:1379–1390
40. Siegel D, Hussein M, Belani C et al (2009) Vorinostat in solid
and hematologic malignancies. J Hematol & Oncol 2:31
41. Stamatopoulos B, Meuleman N, De Bruyn C, Delforge A, Bron
D, Lagneaux
L (2010) The histone deacetylase inhibitor
suberoylanilide hydroxamic acid induces apoptosis, down-regu-
lates the CXCR4 chemokine receptor and impairs migration of
chronic lymphocytic
95:1136–1143
leukemia
cells.
Haematologica
22. Kang MR, Kang JS, Han SB et al (2009) A novel delta-lactam-
based histone deacetylase inhibitor, KBH-A42, induces cell cycle
arrest and apoptosis in colon cancer cells. Biochem Pharmacol
78:486–494
42. Kim HJ, Bae SC (2011) Histone deacetylase inhibitors: molecular
mechanisms of action and clinical trials as anti-cancer drugs. Am
J Trans Res 3:166–179
23. Sun C, Zhou J (2008) Trichostatin a improves insulin stimulated
glucose utilization and insulin signaling transduction through the
repression of HDAC2. Biochem Pharmacol 76:120–127
24. Marks PA, Breslow R (2007) Dimethyl sulfoxide to vorinostat:
development of this histone deacetylase inhibitor as an anticancer
drug. Nat Biotechnol 25:84–90
43. Li D, Marchenko ND, Moll UM (2011) SAHA shows preferential
cytotoxicity in mutant p53 cancer cells by destabilizing mutant
p53 through inhibition of the HDAC6-Hsp90 chaperone axis. Cell
Death Differ 18:1904–1913
44. Karmodiya K, Krebs AR, Oulad-Abdelghani M, Kimura H, Tora
L (2012) H3K9 and H3K14 acetylation co-occur at many gene
regulatory elements, while H3K14ac marks a subset of inactive
inducible promoters in mouse embryonic stem cells. BMC
Genom 13:424
45. Xiao Z, Li CH, Chan SL et al (2014) A small-molecule modulator
of the tumor-suppressor miR34a inhibits the growth of hepato-
cellular carcinoma. Cancer Res 74:6236–6247
46. Bandi N, Vassella E (2011) miR-34a and miR-15a/16 are co-
regulated in non-small cell lung cancer and control cell cycle
progression in a synergistic and Rb-dependent manner. Molecular
Cancer 10:55
25. Mack GS (2010) To selectivity and beyond. Nature biotechnol
28:1259–1266
26. West AC, Johnstone RW (2014) New and emerging HDAC
inhibitors for cancer treatment. J Clin Investig 124:30–39
27. Rosato RR, Almenara JA, Dai Y, Grant S (2003) Simultaneous
activation of the intrinsic and extrinsic pathways by histone
deacetylase (HDAC) inhibitors and tumor necrosis factor-related
apoptosis-inducing ligand (TRAIL) synergistically induces
mitochondrial damage and apoptosis in human leukemia cells.
Mol Cancer Ther 2:1273–1284
123

Apoptosis
47. Su H, Yang JR, Xu T et al (2009) MicroRNA-101, down-regu-
lated in hepatocellular carcinoma, promotes apoptosis and sup-
presses tumorigenicity. Cancer Res 69:1135–1142
48. Bi Q, Tang S, Xia L et al (2012) Ectopic expression of MiR-125a
inhibits the proliferation and metastasis of hepatocellular carci-
noma by targeting MMP11 and VEGF. PLoS One 7:e40169
49. Xu T, Zhu Y, Xiong Y, Ge YY, Yun JP, Zhuang SM (2009)
MicroRNA-195 suppresses tumorigenicity and regulates G1/S
transition of human hepatocellular carcinoma cells. Hepatology
50:113–121
50. Shan G, Li Y, Zhang J et al (2008) A small molecule enhances
RNA interference and promotes microRNA processing. Nat
Biotechnol 26:933–940
51. Melo S, Villanueva A, Moutinho C et al (2011) Small molecule
enoxacin is a cancer-specific growth inhibitor that acts by
enhancing TAR RNA-binding protein 2-mediated microRNA
processing. Proc Natl Acad Sci USA 108:4394–4399
cancer: a California cancer consortium study. Clin Cancer Res
14:7138–7142
54. Bots M, Johnstone RW (2009) Rational combinations using
HDAC inhibitors. Clin Cancer Res 15:3970–3977
55. Wozniak MB, Villuendas R, Bischoff JR et al (2010) Vorinostat
interferes with the signaling transduction pathway of T-cell
receptor and synergizes with phosphoinositide-3 kinase inhibitors
in cutaneous T-cell lymphoma. Haematologica 95:613–621
56. Xu WS, Parmigiani RB, Marks PA (2007) Histone deacetylase
inhibitors: molecular mechanisms of action. Oncogene
26:5541–5552
57. Schrump DS (2009) Cytotoxicity mediated by histone deacety-
lase inhibitors in cancer cells: mechanisms and potential clinical
implications. Clinical Cancer Res 15:3947–3957
58. Liu K, Liu PC, Liu R, Wu X (2015) Dual AO/EB staining to
detect apoptosis in osteosarcoma cells compared with flow
cytometry. Med Sci Monit Basic Res 21:15–20
52. Srinivas C, Ramaiah MJ, Lavanya A et al (2015) Novel etoposide
analogue modulates expression of angiogenesis associated
microRNAs and regulates cell proliferation by targeting STAT3
in breast cancer. PLoS One 10:e0142006
59. Al-Yacoub N, Fecker LF, Mobs M et al (2012) Apoptosis
induction by SAHA in cutaneous T-cell lymphoma cells is related
to downregulation of c-FLIP and enhanced TRAIL signaling.
J Invest Dermatol 132:2263–2274
53. Luu TH, Morgan RJ, Leong L et al (2008) A phase II trial of
vorinostat (suberoylanilide hydroxamic acid) in metastatic breast
60. Grant S, Easley C, Kirkpatrick P (2007) Vorinostat. Nat Rev
Drug Discov 6:21–22
123