Structural and functional insights into polymorphic enzymes of cytochrome P450 2C8

Article abstract of DOI:10.1007/s00726-010-0743-8

The cytochrome P450 (CYP) superfamily plays a key role in the oxidative metabolism of a wide range of drugs and exogenous chemicals. CYP2C8 is the principal enzyme responsible for the metabolism of the anti-cancer drug paclitaxel in the human liver. Nearl

Full text of DOI:10.1007/s00726-010-0743-8

Amino Acids (2011) 40:1195–1204
DOI 10.1007/s00726-010-0743-8
ORIGINAL ARTICLE
Structural and functional insights into polymorphic enzymes
of cytochrome P450 2C8
Hualin Jiang
Weiyue Feng
Xiangshi Tan
•
Fangfang Zhong
Zhong-Xian Huang
•
Lu Sun
•
•
•
Received: 12 May 2010 / Accepted: 1 September 2010 / Published online: 17 September 2010
Ó Springer-Verlag 2010
Abstract The cytochrome P450 (CYP) superfamily plays
a key role in the oxidative metabolism of a wide range of
drugs and exogenous chemicals. CYP2C8 is the principal
enzyme responsible for the metabolism of the anti-cancer
drug paclitaxel in the human liver. Nearly all previous
works about polymorphic variants of CYP2C8 were
focused on unpurified proteins, either cells or human liver
microsomes; therefore their structure–function relation-
ships were unclear. In this study, two polymorphic
enzymes of CYP2C8 (CYP2C8.4 (I264M) and CYP2C8
P404A) were expressed in E. coli and purified. Metabolic
activities of paclitaxel by the two purified polymorphic
enzymes were observed. The activity of CYP2C8.4 was
binding. This discovery could be valuable for explaining
clinically individual differences in the metabolism of drugs
and provides instructed information for individualized
medication.
Keywords Structure–function relationship ꢀ
Polymorphism ꢀ CYP2C8 ꢀ Drug metabolism ꢀ
Individualized medication
Introduction
The CYP superfamily, a group of hemoproteins present in
all forms of life, plays a key role in the oxidative metab-
olism of a wide range of exogenous chemicals such as
drugs, toxins, carcinogens, steroids, and fatty acids. The
number of CYP families has been continuously growing
and has now reached more than 200, with more than 57
known CYPs in humans. There is considerable variation in
the way patients respond to the same drugs in the clinical
treatment. Researches in ‘‘Human Genome Project’’ (HGP)
suggested that these individual differences were caused by
drug-related genetic polymorphism (Lee et al. 2001).
Polymorphisms are gene mutations, which may change
drug metabolism in the individuals. So whether a certain
drug was effective or caused adverse reactions depended
on the polymorphisms in the patient. Human CYPs are
important drug metabolism enzymes to the detoxification
and activation of drugs. Therefore, the polymorphisms of
human CYPs are of great significance for clinicians to do
individual medication. The polymorphic metabolizers
phenotype can affect the clinical toxicity and the efficacy
of drugs (Dai et al. 2001). Polymorphic variants in CYPs
that metabolize endogenous compounds are also responsi-
ble for certain inherited diseases (Stoilov et al. 1998;
2
5% and CYP2C8 P404A was 30% of that of WT
CYP2C8, respectively. Their structure–function relation-
ships were systematically investigated for the first time.
Paclitaxel binding ability of CYP2C8.4 increased about
two times while CYP2C8 P404A decreased about two
times than that of WT CYP2C8. The two polymorphic
mutant sites of I264 and P404, located far from active site
and substrate binding sites, significantly affect heme and/or
substrate binding. This study indicated that two important
nonsubstrate recognition site (SRS) residues of CYP2C8
are closely related to heme binding and/or substrate
Electronic supplementary material The online version of this
article (doi:10.1007/s00726-010-0743-8) contains supplementary
material, which is available to authorized users.
H. Jiang ꢀ F. Zhong ꢀ L. Sun ꢀ Z.-X. Huang ꢀ X. Tan (&)
Department of Chemistry and Institutes of Biomedical Sciences,
Fudan University, Shanghai 200433, China
e-mail: xstan@fudan.edu.cn
W. Feng
Institute of High Energy Physics, Chinese Academy of Sciences,
Beijing 100049, China
123

1
196
H. Jiang et al.
Plasilova et al. 1999). So the researches about CYPs
polymorphic variants are quite valuable for explaining
clinically individual differences in the metabolism of drugs
and provide instructed information for individualized
medication. The CYP2Cs are a major subfamily of CYP
enzymes that are found primarily in liver cells. The four
human CYP2C enzymes: CYP2C8, CYP2C9, CYP2C18,
and CYP2C19 are known to be polymorphic. Their func-
tional polymorphic variants result in clinically relevant
inter-individual differences in the metabolism of drugs.
Polymorphisms in CYP2C8 were determined in 2001 as the
last one to be known polymorphic, and were known least in
the human CYP2C subfamily. CYP2C8, which makes up
about 7% of total microsomal human hepatic CYP (Shi-
mada et al. 1994; Rendic and Di Carlo 1997), carries out
the oxidative metabolism of at least 5% of clinic drugs
Fig. 1 3D structure of WT CYP2C8 (PDB ID: pdb1pq2a) showing
polymorphic mutation sites of I264 and P404
(
Totah and Rettie 2005). The X-ray crystal structure of
CYP2C8 (Schoch et al. 2004) shows a characteristic large
active site cavity which can accommodate for reasonably
large substrates (Schoch et al. 2004; Totah and Rettie
P404A (Fig. 1). The purified proteins were systematically
characterized with UV and CD spectra. Their thermal
stability, binding ability, and catalytic activity of paclitaxel
were investigated, and the electron transfer kinetics was
studied by stopped-flow. The results based on purified
proteins indicated that I264 and P404 in CYP2C8 were
important for heme binding and/or substrate binding even
if they were non-SRS residues and located far from the
active site and substrate binding sites.
2
005). Many kinds of therapeutically important drugs,
including the anticancer drugs (Rahman et al. 1994; Son-
nichsen et al. 1995), antiarrhythmic drugs (Ohyama et al.
2
000), anti-diabetes drugs (Yamazaki et al. 1999), and
antiepileptic drugs (Kerr et al. 1994) are the substrates
mainly metabolized by CYP2C8. Thus polymorphisms of
CYP2C8 are closely related to an individually variant
response to drugs. Some cases about certain diseases
causally related to polymorphisms of CYP2C8 have been
reported as well (Yasar et al. 2003; Ishikawa et al. 2004).
Up to now, 14 polymorphic variants in CYP2C8, desig-
nated as CYP2C8.2 to CYP2C8.14 (http://www.cypalleles.
ki.se/cyp2c8.htm) and an unclassified form temporarily
named CYP2C8 P404A (Soyama et al. 2002; Totah and
Rettie 2005), have been reported. Polymorphic variants
CYP2C8.2 to CYP2C8.4 have a wide range of distribution
in various ethnic populations of white and black, while
polymorphic variants CYP2C8.5 to CYP2C8.14 and
CYP2C8 P404A have only been detected among the
Japanese population.
Materials and methods
Materials
?
The pCWOri plasmid, encoding CYP2C8dH, was a kind
gift from Prof. E.F. Johnson (The Scripps Research Insti-
tute, California, USA) (Schoch et al. 2004). The E. coli
XL1-Blue strain and restriction enzymes were purchased
from New England Biolabs in Shanghai, China. Ni-NTA
Agarose was from Qiagen (Chatsworth, CA, USA). 3-[(3-
cholamidopropyl)-dimethylammonio]-1-propanesulfonate
(CHAPS) was from Amresco (Solon, OH, USA). Paclitaxel
was got from Fujian South Bio-Technology Co., Ltd
(Fujian, China). b-NADPH and human cytochrome P450
reductase were obtained from Sigma-Aldrich (St. Louis,
MO, USA). The oligonucleotide primer pairs listed below
were synthesized, and DNA sequencing reactions were
performed by Shanghai Invitrogen Biotech Co. Ltd.
Almost all the previous studies on polymorphic variants
of CYP2C8 were not focused on the purified proteins,
either cells or human liver microsomes (Soyama et al.
2
001, 2002; Bahadur et al. 2002; Hichiya et al. 2005;
Hanioka et al. 2010), while limited information about
purified CYP2C8 polymorphic variants, except kinetics of
paclitaxel and arachidonic acid metabolized by CYP2C8.2
and those of arachidonic acid metabolized by CYP2C8.3,
have been reported by Dai et al. (2001). The structure–
function relationships of CYP2C8 polymorphic variants
were unclear. In this paper, we focused on the structure–
function relationships of two purified polymorphic
enzymes of CYP2C8, CYP2C8.4 (I264M) and CYP2C8
Constructions of polymorphic mutations in CYP2C8
Mutants for CYP2C8.4 (I264M) and CYP2C8 P404A were
constructed using Quik Change Site-Directed Mutagenesis
Kit according to its protocol (Stratagene) with plasmid
1
23

Polymorphic enzymes of cytochrome P450 2C8
1197
?
pCWOri encoding CYP 2C8dH as a template. The
containing 10 mM KPi, pH 7.4, 100 mM NaCl, 20% glyc-
erol, 1 mM PMSF, 10 mM b-mercaptoethanol, 0.1%
CHAPS, and 40 mM histidine. The fractions containing
CYP2C8 as judged by its red-brown color were pooled. The
protein was concentrated and the buffer exchanged with
5 mM KPi, pH 7.4, 20% glycerol, 1 mM EDTA, 1 mM
PMSF, 0.2 mM DTT, and 0.1% CHAPS using an ultrafil-
tration device. The concentrated protein was then applied to
a CM-Sepharose column that was pre-equilibrated with
buffer (VI) containing 10 mM KPi, pH 7.4, 20% glycerol,
mutants for CYP2C8.4 and CYP2C8 P404A were made by
replacing I264 with methionine using primer pair P1 and
replacing P404 with alanine using primer pair P2, respec-
tively. The mutated plasmids were isolated and sequenced
by Shanghai Invitrogen Biotech Co. Ltd.
0
P1 [5 AACAATCCTCGGGACTTTATGGATTGCTTC
0
0
CTGATCAAAATGG3 (F), 5 CATTTTGATCAGG
0
AAGCAATCCATAAAGTCCCGAGGATTGTT3 (R)]
0
P2 [5 GATGACAAAGAATTTCCTAATGCAAATAT
0
1
mM EDTA, 1 mM PMSF, 0.2 mM DTT, and 0.1%
0
CTTTGACCCTGGCC3 (F), 5 GGCCAGGGTCAA
CHAPS, then was washed with the buffer (VI) without
CHAPS. The CYP2C8 protein was eluted sharply in 50 mM
KPi, 500 mM NaCl, 20% glycerol, 1 mM EDTA, and
0
AGATATTTGCATTAGGAAATTCTTTGTCATC3
R)]
(
0.2 mM DTT, at pH 7.4. The eluted protein was concentrated
Protein expression and purification
using an ultrafiltration device and then stored at -80°C.
Protein purity was analyzed by imaging Coomassie-Blue
stained 15% SDS-PAGE gels. Heme concentrations were
determined by the pyridine hemochromogen method, using
The expression and purification of WT CYP2C8 and its two
variants were carried out based on several reported methods
with some modifications (Wester et al. 2002, 2004; Schoch
et al. 2004; Sun et al. 2009). Terrific broth media was seeded
with an overnight culture of E. coli XL1-Blue containing the
pCW2C8dH plasmid. When OD600 of the culture reached
-
1
-1
an extinction coefficient of eR-O, 557–540 (22.1 mM cm
(Berry and Trumpower 1987). The extinction coefficients
)
for the substrate-free forms of the wild-type protein and its
-1
-
two variants at 416 nm were 108 mM cm
1
.
0
.5, 1 mM of isopropyl-b-D-thiogalactoside (IPTG) was
added to induce CYP expression. The culture was incubated
at 30°C for 48 h with shaking at 180 rpm. Cells were har-
vested by centrifugation at 4°C. The pellets were re-sus-
pended in 20 mM KH PO –K HPO (KPi) buffer
Spectroscopic characterization
Protein samples were prepared by incubating wild-type or
mutant CYP2C8 in 50 mM KPi buffer, with 500 mM
NaCl, at pH 7.4, containing 20% glycerol. The UV/Vis
spectra of substrate-free ferric WT CYP2C8 and the two
variants were recorded using a HP8453 UV/Vis spectro-
photometer equipped with a temperature controller at
2
4
2
4
containing 20% glycerol, 1 mM phenylmethanesulfonyl
fluoride (PMSF), and 10 mM b-mercaptoethanol. Lysozyme
was added and the cells were incubated at 4°C with stirring
for 1 h. An equal volume of double distilled water of 4°C was
added to the cell solution, and stirring was continued for an
additional 30 min. The spheroplasts were pelleted by cen-
trifugation at 5,000g for 15 min at 4°C; afterwards the
supernatant was discarded, and the pellets were frozen in
liquid nitrogen. The pellet was thawed, re-suspended in
2
?
25°C. The Fe -CYP2C8-CO samples were prepared by
bubbling the proteins with CO prior to reducing the pro-
teins with sodium dithionite (Omura and Sato 1964). The
vacuum far-UV CD spectra (190–270 nm) of substrate-free
ferric WT CYP2C8 and the two variants were measured
with CD spectrophotometer performed at the Beijing
Synchrotron Radiation Facility (BSRF) beam line 4B8 in
the Institute of High Energy Physics, Chinese Academy of
Sciences. The cell chamber was 0.1 mm and filled with N2.
The temperature was kept at 4°C. The near-UV and visible
CD spectra (250–650 nm) of substrate-free ferric WT
CYP2C8 and the two variants were measured on a Jasco
J720 spectrometer at 25°C. The data were recorded every
0.2 nm at a rate of 200 nm/min. The data of CD spectra
were represented as molar ellipticity, [h].
5
0
00 mM KPi buffer, pH 7.4, containing 20% glycerol,
.5 mM PMSF, 10 mM b-mercaptoethanol, and then was
sonicated. Following centrifugation at 7,000g for 15 min at
4
°C, 0.1% CHAPS was added and the material was incubated
with stirring at 4°C for 30 min. Following the incubation, the
material was centrifuged at 105,000g for 60 min at 4°C. The
supernatant was incubated with Ni-NTA Agarose that was
pre-equilibrated with buffer (I) containing 500 mM KPi, pH
7
.4, 20% glycerol, 0.5 mM PMSF, and 10 mM b-mercap-
toethanol. After 3 h, the Ni-NTA resin was loaded into a
small chromatography column and was washed with buffer
(
I), buffer (II) containing 100 mM KPi, pH 7.4, 100 mM
Analysis of thermal stability
NaCl, 20% glycerol, 1 mM PMSF, 10 mM b-mercap-
toethanol, 0.1% CHAPS, buffer (III) [buffer (II) with 50 mM
glycine], and buffer (IV) [buffer (II) with 10 mM histidine]
consecutively. The protein was eluted with buffer (V)
2
?
The Fe -CYP2C8-CO samples were prepared by bubbling
the protein with CO prior to reducing the proteins with
sodium dithionite (Omura and Sato 1964). Each sample of
123

1
198
H. Jiang et al.
2
?
the Fe -CYP-CO form was incubated at 48°C for
–15 min, and at various time points its percentage of P450
form relative to the zero time point value was recorded
Chen et al. 1997; Dickmann et al. 2004). All preparations
1 mM NADPH, and paclitaxel (from 0 to 200 lM), was
prepared with 50 mM HEPES buffer, pH 7.4, which con-
0
tained 30 mM MgCl , 3 mM glutathione reduced, 0.01%
2
(
CHAPS, and 10% glycerol. The mixture was pre-incubated
at 37°C for 5 min and then initiated by the addition of 1 ll of
100 mM NADPH, and terminated after 15 min by four
extractions with 60 ll of ethyl acetate. The extracts were
evaporated to dryness under a gentle steam of nitrogen, and
the residues were re-dissolved in 20 ll of 40% acetonitrile.
The resulting solutions were then subjected to HPLC for
analysis with a ZORBAX 300 SB-C18 column (4.6 mm 9
were performed in triplicate. Half-lives for the thermally
induced conversion of P450 to P420 states were determined
according to first-order decay kinetics (Dickmann et al.
2
004). Electronic absorption spectra were collected on a
HP8453 UV/Vis spectrophotometer equipped with a tem-
perature controller.
25 cm, 5 lm particle size). The separation was performed
Paclitaxel binding study
under isocratic conditions using acetonitrile: water (40:60,
v/v) as the mobile phase at a flow rate of 1.0 ml/min. The
product was monitored at 235 nm. The identity of the
metabolite was confirmed by chromatographic retention
time and LCMS analysis. Unknown concentrations of
metabolite were estimated by comparing the areas of
metabolite peaks with linear calibration curves obtained
for paclitaxel. The assumption was made that paclitaxel and
UV/Vis spectra of paclitaxel binding upon WT CYP2C8
and the two variants were recorded on a HP8453A UV/Vis
spectrophotometer equipped with a temperature controller.
The protein samples in 50 mM KPi buffer, with 500 mM
NaCl, at pH 7.4, containing 20% glycerol and 0.1%
CHAPS, and stock paclitaxel in methanol were prepared.
The concentration of purified CYP2C8 or its variant was
6
2
1
a-hydroxy paclitaxel had similar absorption coefficients at
35 nm according to previous report (Richardson et al.
995). All assays were performed at least in triplicates.
2 lM. The CYP2C8 solutions were incubated at 37°C for
about 20 min until the absorbance at 416 nm was stable,
then the substrate stock solution was titrated to less than
1
% of the initial volume into a 1.0-cm quartz cuvette
Stopped-flow kinetic studies
containing CYP2C8 solutions (sample cuvette), and equal
amounts of the substrate stock solution added to another
cuvette containing buffer only (reference cuvette). All
preparations were performed in triplicate. The absorption
spectra were recorded. The apparent dissociation constant
Pre-steady-state stopped-flow experiments were performed
at 37°C with an SF-61 DX2 stopped-flow instrument (Hi-
Tech, UK) installed in a glove box (MB 100, Braun,
Germany) under pure N2 atmosphere. Electron transfer
kinetics was monitored at 450 nm based on the formation
(
K ) for paclitaxel binding to CYP2C8s, and the extrapo-
d
lated maximum spectral change (DAmax), were estimated
based on nonlinear least-squares regression fitting plots of
DA against substrate concentration with the following
quadratic equation (Koo et al. 2002; Schoch et al. 2008):
2?
of Fe -CYP2C8-CO. All protein samples and Na S O
2 4
2
were in 10 mM KPi buffer, pH 7.4, containing 500 mM
NaCl, and 20% glycerol. Before mixing, protein samples
(
10 lM) and Na S O (40 mM) were saturated with 1 atm
ꢀ
qffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiꢁ
2 2 4
DAmax
nP
2
CO. The rate constants (k) were obtained by fitting the
absorbance change at 450 nm using KinetAsyst 2 software
DA ¼ 2
nP þ S þ Kd ꢁ ðnP þ S þ KdÞ ꢁ 4nPS ;
(Hi-Tech Co.) with first order equation.
Where DA is the absorbance difference between the peak
and trough of the difference spectrum; S is the total con-
centration of paclitaxel at any given point during the
titration; P is the concentration of WT CYP2C8 or the two
variants, and n is the substrate binding sites (n = 1 in the
case of paclitaxel).
Statistical analysis
Data were analyzed by Student’s t test with the SPSS sta-
tistical program (SPSS Inc. USA). Data were expressed as
mean ± SD. P \ 0.05 was considered statistically
significant.
Assay of metabolic activity to paclitaxel
Paclitaxel metabolism assay with WT CYP2C8 and its two
variants was performed, respectively, according to reported
methods (Richardson et al. 1995; Dai et al. 2001). The assay
mixture (100 ll), containing 10 pmol WT CYP2C8 or var-
iant protein, 3 lg 1,2-Didodecanoyl-sn-glycero-3-phos-
phocholine (DLPC), 40 pmol cytochrome P450 reductase,
Results
Expression and purification
Recombinant WT CYP2C8 and its variants CYP2C8.4 and
CYP2C8 P404A were successfully expressed in E. coli and
1
23

Polymorphic enzymes of cytochrome P450 2C8
1199
Fig. 3 The vacuum far-UV CD spectra of substrate-free ferric WT
CYP2C8 and its variants. Buffer was 50 mM KPi, 500 mM NaCl, and
2
0% glycerol buffer, pH 7.4. Protein concentrations were 10 lM. The
Fig. 2 15% SDS-PAGE gel stained with Coomassie blue. Lanes 1, 2,
3, 4 are CYP2C8 P404A, CYP2C8.4, WT CYP2C8, standard marker,
respectively
2
cell chamber was 0.1 mm and filled with N . The temperature was
kept at 4°C
Table 1 Secondary structure of WT CYP2C8, CYP2C8.4 and CYP
P404A
purified by Ni-NTA column and CM-Sepharose column.
SDS-PAGE gel analysis indicated high purity (*90%
homogeneity) of these proteins (Fig. 2). The molecular
mass of WT CYP2C8, measured by MALDI-TOF mass
spectrometry, was 53,657 Da, which was close to the
reported value of 53,979 Da.
Helix (%) Beta sheet (%) Turn (%) Random (%)
WT CYP2C8
CYP2C8.4
33.3
40.8
39.0
35.7
42.6
37.4
10.4
3.3
20.5
13.4
17.6
CYP2C8
P404A
5.9
Spectroscopic characterization
variants of CYP2C8 shared the similar profile of near-UV
and visible CD spectra to that of WT CYP2C8; however,
the CD Soret/delta (*[h]420 nm/*[h]350 nm) ratios were
significantly different (Fig. 4) (WT CYP2C8, 4.67;
CYP2C8.4, 2.30; CYP2C8 P404A, 3.20). Enhancement of
WT CYP2C8 and the two variants showed similar sub-
strate-free ferric UV/Vis spectra with other CYPs. The
Soret absorbance at 416 nm, a and b bands at 569 and
5
35 nm revealed the low-spin hexa-coordinated heme iron
(
Dawson et al. 1982; Martinis et al. 1996; Denisov et al.
2
005). The Fe -CYP-CO form had the characteristic peak
?
2
at 450 nm and a/b band at 551 nm similar to that of other
CYPs (Haugen and Coon 1976; Dawson et al. 1982;
McLean et al. 1998; Koo et al. 2000). CYP2C8.4 showed
2
?
an obvious peak at 420 nm in the spectra of Fe -CYP-CO
form indicating that part of this protein was in P420 state,
an inactive form of CYP enzymes (Martinis et al. 1996;
Chen et al. 1997) (SF1).
Far-UV CD spectra (Fig. 3) showed the secondary
structures of CYP2C8.4 and CYP P404A, which were dif-
ferent from that of WT CYP2C8. The secondary structures
of the proteins were analyzed by Jasco Secondary Structure
Estimation [Version 1.54.03 (Build 1), JASCO Corpora-
tion]. Helix and sheet increased while turn and random
decreased in the two variants compared to WT CYP2C8.
Detailed data of changed structure were shown in Table 1.
Near-UV and visible CD spectra indicated some infor-
mation of tertiary structure of the proteins. The two
Fig. 4 The near-UV and visible CD spectra of substrate-free ferric
WT CYP2C8 and its variants. Spectra were recorded in 50 mM KPi,
5
00 mM NaCl, and 20% glycerol buffer, pH 7.4, at 25°C in a 10 mm
pathlength quartz cuvette at 17 lM protein concentration
123

1
200
H. Jiang et al.
the Soret trough relative to the delta band showed a more
‘open’’ active-site pocket in CYP, such as CYPLM-2 vs.
‘
CYPLM-4 (Wang and Kimura 1976; Andersson and
Peterson 1995). These CD Soret/delta ratios of the two
variants reflected the alteration of the protein tertiary
structure by mutations.
Thermal stability
The P420 state is an inative form of these CYP enzymes,
with a typical absorbance peak at 420 nm in the UV/Vis
2
?
spectra of Fe -CYP-CO (Martinis et al. 1996; Chen et al.
997). Various conditions, such as high temperature, can
1
convert P450 state to P420 state, and the conversion
reflects the generalized function loss of the enzyme
Fig. 6 The difference spectrum of 30 lM paclitaxel binding to WT
CYP2C8 and its variants
(
Dickmann et al. 2004). The conversion of P450 to P420 of
WT CYP2C8 and its variants, CYP2C8.4 and CYP2C8
P404A, were investigated at 48°C, and the percentage of
remaining P450 form as a function of time was shown in
Fig. 5. The half-lives of these enzymes were *8.3 ± 0.4,
the enzyme. The difference spectrum analysis of substrate
binding showed that paclitaxel induced the WT CYP2C8,
CYP2C8.4, and CYP P404A to form a type I difference
spectrum with a peak at near 380 nm and a trough at near
6
.0 ± 0.5 (P \ 0.01), 6.8 ± 0.5 (P \ 0.05) min for WT
CYP2C8, CYP2C8.4, and CYP2C8 P404A, respectively.
Thermal stability of CYP2C8.4 and CYP2C8 P404A were
significantly different from that of WT CYP2C8. Both of
the variants were less thermally stable than WT CYP2C8.
4
20 nm (Fig. 6) (Jefcoate 1978). The substrate binding was
monitored by DA, the absorbance difference between the
peak and trough of the difference spectrum (Estabrook and
Werringloer 1978). The paclitaxel-binding ability was
shown in Table 2. K of WT CYP2C8, CYP2C8.4, and CYP
d
Paclitaxel binding ability
P404A were 139.5 ± 10.3 lM, 67.9 ± 3.6 lM, and
2
45.1 ± 41.8 lM, respectively. These indicated that pac-
Paclitaxel was the prototypical substrate of CYP2C8, and
was commonly used in vitro to studythe metabolic activityof
litaxel-binding ability of CYP2C8.4 was about two times
stronger, while that of CYP P404A was about two times
weaker than that of WT CYP2C8.
Paclitaxel metabolic activity
The paclitaxel metabolic activity of WT CYP2C8 and the
two variants, CYP2C8.4 and CYP2C8 P404A, were
assayed by monitoring the product 6a-hydroxypaclitaxel at
2
35 nm with 300 SB-C18 columns on HPLC. The retention
times were *18 min for paclitaxel and *9 min for
a-hydroxypaclitaxel. The identity of the metabolite was
6
Table 2 Parameters of paclitaxel binding to WT CYP2C8 and its
variants
Enzymes
Paclitaxel-binding
DAmax
d
K (lM)
Fig. 5 Percentage of remaining P450 state of WT CYP2C8 and its
variants as a function of time. The Fe -CYP2C8-CO samples were
prepared by bubbling the protein with CO in 50 mM KPi buffer,
Wild type CYP2C8
CYP2C8.4
0.24 ± 0.013
0.16 ± 0.005
0.29 ± 0.041
139.5 ± 10.3
67.9 ± 3.6**
245.1 ± 41.8*
2?
CYP2C8 P404A
5
00 mM NaCl, pH 7.4, containing 20% glycerol prior to reducing the
2?
proteins with sodium dithionite. Each sample of the Fe -CYP-CO
form was incubated at 48°C for 0–15 min, and at various time points
its percentage of P450 form (value of 450 nm) relative to the zero
time point value was recorded
Data are means ± SD of three independent experiments
Significantly different (P \ 0.05) from WT CYP2C8
** Significantly different (P \ 0.01) from WT CYP2C8
*
1
23

Polymorphic enzymes of cytochrome P450 2C8
1201
Stopped-flow kinetic studies
Electron transfer from Na S O to the heme Fe ion of
3
?
2
2 4
WT CYP2C8 or its polymorphic enzymes was successfully
monitored at 450 nm with Stopped-flow (SF2). The rate
-
1
constants are 0.47, 0.55, and 0.45 s for WT CYP2C8,
CYP2C8.4, and CYP2C8 P404A, respectively. The maxi-
mum absorbance changes at 450 nm (DAmax) are 0.36,
0.32, and 0.35 AU for WT CYP2C8, CYP2C8.4, and CYP
2C8 P404A, respectively. The rate constant and reduction
extent of the variants are close to those of WT CYP2C8.
The results indicated that the heme center of CYP2C8.4 or
CYP2C8 P404A was probably not disturbed by mutation.
Fig. 7 Representative Michaelis–Menten kinetics of paclitaxel
a-hydroxylation by WT CYP2C8 and its variants. The solid line
indicates fitting of data to the Michaelis–Menten equation by
nonlinear regression
Discussion
The objective of this study was to investigate the structure–
function relationship of two polymorphic enzymes,
CYP2C8.4 and CYP2C8 P404A. Through genetics (site-
directed mutagenesis), biochemistry, and biophysics
approaches, we purified WT CYP2C8 and the two poly-
morphic enzymes, and then compared the properties and
metabolic activities of the resulting polymorphic mutants
to the WT CYP2C8. Based on the results above we try to
decipher why the metabolic activity of paclitaxel by
CYP2C8.4 and CYP2C8 P404A were just about 30% of
that by WT CYP2C8.
confirmed by chromatographic retention time and LCMS
analysis (SF3-SF5). LCMS data (see supporting informa-
tion) were consistent with the previous report of paclitaxel
and 6a-hydroxy paclitaxel (Kumar et al. 1994; Poon et al.
1
996). The concentrations of metabolite were estimated by
comparing the areas of metabolite peaks with linear cali-
bration curves obtained for paclitaxel because paclitaxel
and 6a-hydroxypaclitaxel had similar absorption coeffi-
cients at 235 nm according to previous report (Richardson
et al. 1995). LCMS data was consistent with the previous
report of paclitaxel and 6a-hydroxypaclitaxel (SF4 and
SF5) (Kumar et al. 1994; Poon et al. 1996). Ion transitions
of m/z 854 ? 569 for paclitaxel and m/z 870 ? 585 for
CD spectra indicated that the secondary and tertiary
structures of the two variants greatly changed due to their
respective amino acid mutations. The mutant CYP2C8.4
(Ile264 M) on helix H altered residue hydropathy from 4.5
(Ile) to 1.9 (Met), while the variant Pro404A on the loop
between helix K’ and L (Fig. 1) changed relative residue
6
a-hydroxypaclitaxel. Representative Michaelis–Menten
3
3
˚
˚
kinetics for 6a-hydroxylation catalyzed by these enzymes
was shown in Fig. 7. The solid lines indicated the fitting of
kinetic data with the Michaelis–Menten equation by non-
linear regression. The metabolic activity of paclitaxel by
CYP2C8.4 and CYP2C8 P404A were about 25 and 30% of
that of wild-type CYP2C8, respectively. The kinetic
parameters are presented in Table 3.
volume from 123.4 A (Pro) to 91.5 A (Ala), respectively
(Kyte and Doolittle 1982; Pontius et al. 1996). The structural
changes resulted in loss of function. The conversion half-life
from P450 state to P420 state for both the polymorphic
enzymes was shorter than that of WT CYP2C8, and the
variants were less thermally stable than WT CYP2C8.
CYP2C8.4 showed an obvious P420 state, as an inactive
Table 3 Kinetic parameters of paclitaxel 6a-hydroxylation by WT CYP2C8 and its variants
Enzymes
V
(
max
K
m
(lM)
Intrinsic clearance Vmax/K
m
(lL min nmol P450)
-1
-1
nmol min nmol P450)
-1
-1
-1
WT CYP2C8
CYP2C8.4
2.5 ± 0.21
0.9 ± 0.07
1.5 ± 0.14
21.0 ± 1.39
30.5 ± 3.1
119.2 ± 8.9
29.8 ± 3.3**
36.2 ± 2.1**
CYP2C8 P404A
40.2 ± 1.8**
Data are means ± SD of three independent experiments
* Significantly different (P \ 0.01) from WT CYP2C8
*
123

1
202
H. Jiang et al.
form of the enzyme, in reduced-CO spectrum at room tem-
perature, and the P420 state was also observed in unpurified
CYP2C8.4 in membrane of bacterial (Singh et al. 2008),
most likely because of the weakening of iron-thiolate
interaction between the heme and coordinated Cys435 in this
polymorphic enzyme (Tian et al. 1995; Udit et al. 2006).
The paclitaxel-binding ability of CYP2C8.4 was about
two times stronger than that of WT CYP2C8, while pac-
litaxel-binding ability of CYP P404A was about 50%
paclitaxel 6a-hydroxylase kinetics compared with WT
CYP2C8. This kind of inconsistence took place on
CYP2C8.3 too. Dai et al. (2001) reported its paclitaxel
metabolic activity was at about 15% of that of WT
CYP2C8, while Akiko Soyama et al. (2001) reported that it
was about 75%. It is quite complicated to compare these
results obtained with different experiment systems.
The two variants, CYP2C8.4 and CYP2C8 P404A,
exhibited depressed metabolic activity of paclitaxel, the
prototypical substrate of CYP2C8, emphasizing that the
difference between the variants and WT CYP2C8 should be
carefully considered in the treatment of patients with these
polymorphic genes when using the drugs metabolized by
CYP2C8.
weaker than that of WT CYP2C8. The K of CYP2C8.4 is
d
about half of that of WT CYP2C8, but K of CYP2C8.4 is
m
not significantly different from that of WT CYP2C8. The
smaller K does not correspond to the smaller K , indi-
d
m
cating that the enhanced substrate-binding ability does not
help to increase enzyme activity. This is likely due to the
product 6a-hydroxypaclitaxel hard dissociation from the
transformed active-site pocket, which retarded the meta-
bolic activity of CYP2C8.4. CYP P404A showed 30%
Acknowledgments We thank Prof. E.F. Johnson (The Scripps
Research Institute, California, USA) for the generous gift of the
pCWOri ? plasmid, encoding CYP 2C8dH and Prof. J.M. Chen
(
Fudan University, Shanghai, China) for the generous support of
6
a-hydroxylase activity of that by WT CYP2C8. The
paclitaxel. This work is supported in part by Shanghai Pujiang Talent
Project (08PJ14017), the National Science Foundation of China
depressed paclitaxel metabolic activity of CYP2C8 P404A
was mainly due to weaker paclitaxel binding ability. A
possible turn-to-helix change in the secondary structure of
CYP2C8 P404A was predicted by Chou-Fasman secondary
structure prediction software (Soyama et al. 2001), and this
prediction was confirmed by our CD studies. The far-UV
CD spectra showed that in the secondary structure of CYP
P404A turn decreased 5.4% and helix increased 5.7%.
The substrate recognition sites (SRS) predetermine CYP
substrate specificity (Denisov et al. 2005). Both I264 and
P404 are non-SRS residues, and they locate far from heme
and substrate binding sites. Our study showed that residue
substitution at I264 and P404 in CYP2C8 resulted in
structural and functional changes. These two residues may
involve in ‘‘long-range’’ interactions in the surrounding
structure to alter protein motif(s) or the key sites in the
motif(s). Numerous examples have been reported to dem-
onstrate that non-SRS residues are important for proper
functions and folding of enzymes (Krone et al. 2005;
Zhang et al. 2002; Hlavica 2006).
(
(
20771029), the Shanghai Leading Academic Discipline Project
B108), the Program for the Platform of new medicine creation (NO.
2
009ZX09301-011), the Specialized Research Fund for the Doctoral
Program of Higher Education, and Beijing Synchrotron Radiation
Facility (BSRF) in the Institute of High Energy Physics, Chinese
Academy of Sciences.
References
Andersson LA, Peterson JA (1995) Active-site analysis of ferric P450
enzymes: hydrogen-bonding effects on the circular dichroism
spectra. Biochem Biophys Res Commun 211:389–395
Bahadur N, Leathart JB, Mutch E, Steimel-Crespi D, Dunn SA,
Gilissen R, Houdt JV, Hendrickx J, Mannens G, Bohets H,
Williams FM, Armstrong M, Crespi CL, Daly AK (2002)
CYP2C8 polymorphisms in Caucasians and their relationship
with paclitaxel 6alpha-hydroxylase activity in human liver
microsomes. Biochem Pharmacol 64:1579–1589
Berry EA, Trumpower BL (1987) Simultaneous determination of
hemes a, b, and c from pyridine hemochrome spectra. Anal
Biochem 161:1–15
In this study we used purified proteins, and found that
the metabolic activities of paclitaxel by CYP2C8.4 and
CYP2C8 P404A were about 25 and 30% of that of WT
CYP2C8, respectively. Metabolism of paclitaxel by E. coli
membrance fractions coexpressing CYP2C8 variants and
P450 reductase has been studied. A significantly lower
level (*15%) of metabolic activity of paclitaxel by
CYP2C8.4 was reported by Rajinder Singh et al. (2008). In
Rajinder’s study the substrate paclitaxel concentration was
in the range 15–100 lM, and lower than 15 lM was not
performed due to the limit of the HPLC system. However,
using lower than 15 lM substrate paclitaxel, Rowbotham
et al. (2010) did not observe significant activity difference
for the CYP2C8.3 or CYP2C8.4 enzymes with respect to
Chen CD, Doray B, Kemper B (1997) Efficient assembly of
functional cytochrome P450 2C2 requires a spacer sequence
between the N-terminal signal anchor and catalytic domains.
J Biol Chem 272:22891–22897
Dai D, Zeldin DC, Blaisdell JA, Chanas B, Coulter SJ, Ghanayem BI,
Goldstein JA (2001) Polymorphisms in human CYP2C8
decrease metabolism of the anticancer drug paclitaxel and
arachidonic acid. Pharmacogenetics 11:597–607
Dawson JH, Andersson LA, Sono M (1982) Spectroscopic investi-
gations of ferric cytochrome P-450-CAM ligand complexes.
Identification of the ligand trans to cysteinate in the native
enzyme. J Biol Chem 257:3606–3617
Denisov IG, Makris TM, Sligar SG, Schlichting I (2005) Structure
and chemistry of cytochrome P450. Chem Rev 105:2253–2277
Dickmann LJ, Locuson CW, Jones JP, Rettie AE (2004) Differential
roles of Arg97, Asp293, and Arg108 in enzyme stability and
substrate specificity of CYP2C9. Mol Pharmacol 65:842–850
1
23

Polymorphic enzymes of cytochrome P450 2C8
1203
Estabrook RW, Werringloer J (1978) The measurement of difference
spectra: application to the cytochromes of microsomes. Methods
Enzymol 52:212–220
Hanioka N, Matsumoto K, Saito Y, Narimatsu S (2010) Functional
characterization of CYP2C8.13 and CYP2C8.14: catalytic
activities toward paclitaxel. Basic Clin Pharmacol Toxicol. doi:
Ohyama K, Nakajima M, Nakamura S, Shimada N, Yamazaki H,
Yokoi T (2000) A significant role of human cytochrome P450
2C8 in amiodarone N-deethylation: an approach to predict the
contribution with relative activity factor. Drug Metab Dispos
28:1303–1310
Omura T, Sato R (1964) The carbon monoxide-binding pigment of
liver microsomes. I. Evidence for its hemoprotein nature. J Biol
Chem 239:2370–2378
Plasilova M, Stoilov I, Sarfarazi M, Kadasi L, Ferakova E, Ferak V
(1999) Identification of a single ancestral CYP1B1 mutation in
Slovak Gypsies (Roms) affected with primary congenital
glaucoma. J Med Genet 36:290–294
Pontius J, Richelle J, Wodak SJ (1996) Deviations from standard
atomic volumes as a quality measure for protein crystal
structures. J Mol Biol 264:121–136
1
0.1111/j.1742-7843.2010.00543.x
Haugen DA, Coon MJ (1976) Properties of electrophoretically
homogeneous phenobarbital-inducible and beta-naphthofla-
vone-inducible forms of liver microsomal cytochrome P-450.
J Biol Chem 251:7929–7939
Hichiya H, Tanaka-Kagawa T, Soyama A, Jinno H, Koyano S, Katori
N, Matsushima E, Uchiyama S, Tokunaga H, Kimura H, Minami
N, Katoh M, Sugai K, Goto Y, Tamura T, Yamamoto N, Ohe Y,
Kunitoh H, Nokihara H, Yoshida T, Minami H, Saijo N, Ando
M, Ozawa S, Saito Y, Sawada J (2005) Functional character-
ization of five novel CYP2C8 variants, G171S, R186X, R186G,
K247R, and K383 N, found in a Japanese population. Drug
Metab Dispos 33:630–636
Poon GK, Wade J, Bloomer J, Clarke SE, Maltas J (1996) Rapid
screening of taxol metabolites in human microsomes by liquid
chromatography/electrospray ionization-mass spectrometry.
Rapid Commun Mass Spectrom 10:1165–1168
Hlavica P (2006) Functional interaction of nitrogenous organic bases
with cytochrome P450: a critical assessment and update of
substrate features and predicted key active-site elements steering
the access, binding, and orientation of amines. Biochim Biophys
Acta 1764:645–670
Ishikawa C, Ozaki H, Nakajima T, Ishii T, Kanai S, Anjo S, Shirai K,
Inoue I (2004) A frameshift variant of CYP2C8 was identified in
a patient who suffered from rhabdomyolysis after administration
of cerivastatin. J Hum Genet 49:582–585
Jefcoate CR (1978) Measurement of substrate and inhibitor binding to
microsomal cytochrome P-450 by optical-difference spectros-
copy. Methods Enzymol 52:258–279
Kerr BM, Thummel KE, Wurden CJ, Klein SM, Kroetz DL, Gonzalez
FJ, Levy RH (1994) Human liver carbamazepine metabolism.
Role of CYP3A4 and CYP2C8 in 10, 11-epoxide formation.
Biochem Pharmacol 47:1969–1979
Rahman A, Korzekwa KR, Grogan J, Gonzalez FJ, Harris JW (1994)
Selective biotransformation of taxol to 6 alpha-hydroxytaxol by
human cytochrome P450 2C8. Cancer Res 54:5543–5546
Rendic S, Di Carlo FJ (1997) Human cytochrome P450 enzymes: a
status report summarizing their reactions, substrates, inducers,
and inhibitors. Drug Metab Rev 29:413–580
Richardson TH, Jung F, Griffin KJ, Wester M, Raucy JL, Kemper B,
Bornheim LM, Hassett C, Omiecinski CJ, Johnson EF (1995) A
universal approach to the expression of human and rabbit
cytochrome P450s of the 2C subfamily in Escherichia coli. Arch
Biochem Biophys 323:87–96
Rowbotham SE, Boddy AV, Redfern CP, Veal GJ, Daly AK (2010)
Relevance of nonsynonymous CYP2C8 polymorphisms to 13-cis
retinoic acid and paclitaxel hydroxylation. Drug Metab Dispos
38:1261–1266
Schoch GA, Yano JK, Wester MR, Griffin KJ, Stout CD, Johnson EF
(2004) Structure of human microsomal cytochrome P450 2C8.
Evidence for a peripheral fatty acid binding site. J Biol Chem
279:9497–9503
Koo LS, Tschirret-Guth RA, Straub WE, Moenne-Loccoz P, Loehr
TM, Ortiz de Montellano PR (2000) The active site of the
thermophilic CYP119 from Sulfolobus solfataricus. J Biol Chem
2
75:14112–14123
Koo LS, Immoos CE, Cohen MS, Farmer PJ, Ortiz de Montellano PR
2002) Enhanced electron transfer and lauric acid hydroxylation
by site-directed mutagenesis of CYP119. J Am Chem Soc
24:5684–5691
Schoch GA, Yano JK, Sansen S, Dansette PM, Stout CD, Johnson EF
(2008) Determinants of cytochrome P450 2C8 substrate binding:
structures of complexes with montelukast, troglitazone, felodip-
ine, and 9-cis-retinoic acid. J Biol Chem 283:17227–17237
Shimada T, Yamazaki H, Mimura M, Inui Y, Guengerich FP (1994)
Interindividual variations in human liver cytochrome P-450
enzymes involved in the oxidation of drugs, carcinogens and
toxic chemicals: studies with liver microsomes of 30 Japanese
and 30 Caucasians. J Pharmacol Exp Ther 270:414–423
Singh R, Ting JG, Pan Y, Teh LK, Ismail R, Ong CE (2008)
Functional role of Ile264 in CYP2C8: mutations affect haem
incorporation and catalytic activity. Drug Metab Pharmacokinet
23:165–174
Sonnichsen DS, Liu Q, Schuetz EG, Schuetz JD, Pappo A, Relling
MV (1995) Variability in human cytochrome P450 paclitaxel
metabolism. J Pharmacol Exp Ther 275:566–575
Soyama A, Saito Y, Hanioka N, Murayama N, Nakajima O, Katori N,
Ishida S, Sai K, Ozawa S, Sawada JI (2001) Non-synonymous
single nucleotide alterations found in the CYP2C8 gene result in
reduced in vitro paclitaxel metabolism. Biol Pharm Bull
24:1427–1430
(
1
Krone N, Riepe FG, Grotzinger J, Partsch CJ, Bramswig J, Sippell
WG (2005) The residue E351 is essential for the activity of
human 21-hydroxylase: evidence from a naturally occurring
novel point mutation compared with artificial mutants gener-
ated by single amino acid substitutions. J Mol Med 83:561–
5
68
Kumar GN, Oatis JE Jr, Thornburg KR, Heldrich FJ, Hazard ES 3rd,
Walle T (1994) 6 alpha-Hydroxytaxol: isolation and identifica-
tion of the major metabolite of taxol in human liver microsomes.
Drug Metab Dispos 22:177–179
Kyte J, Doolittle RF (1982) A simple method for displaying the
hydropathic character of a protein. J Mol Biol 157:105–132
Lee VH, Sporty JL, Fandy TE (2001) Pharmacogenomics of drug
transporters: the next drug delivery challenge. Adv Drug Deliv
Rev 50 (Suppl 1):S33–S40
Martinis SA, Blanke SR, Hager LP, Sligar SG, Hoa GH, Rux JJ,
Dawson JH (1996) Probing the heme iron coordination structure
of pressure-induced cytochrome P420cam. Biochemistry
Soyama A, Hanioka N, Saito Y, Murayama N, Ando M, Ozawa S,
Sawada J (2002) Amiodarone N-deethylation by CYP2C8 and its
variants, CYP2C8*3 and CYP2C8 P404A. Pharmacol Toxicol
91:174–178
Stoilov I, Akarsu AN, Alozie I, Child A, Barsoum-Homsy M, Turacli
ME, Or M, Lewis RA, Ozdemir N, Brice G, Aktan SG, Chevrette
L, Coca-Prados M, Sarfarazi M (1998) Sequence analysis and
3
5:14530–14536
McLean MA, Maves SA, Weiss KE, Krepich S, Sligar SG (1998)
Characterization of a cytochrome P450 from the acidothermo-
philic archaea Sulfolobus solfataricus. Biochem Biophys Res
Commun 252:166–172
123

1
204
H. Jiang et al.
homology modeling suggest that primary congenital glaucoma
on 2p21 results from mutations disrupting either the hinge region
or the conserved core structures of cytochrome P4501B1. Am J
Hum Genet 62:573–584
Wester MR, Stout CD, Johnson EF (2002) Purification and crystal-
lization of N-terminally truncated forms of microsomal cyto-
chrome P450 2C5. Methods Enzymol 357:73–79
Wester MR, Yano JK, Schoch GA, Yang C, Griffin KJ, Stout CD,
Johnson EF (2004) The structure of human cytochrome P450
2C9 complexed with flurbiprofen at 2.0-A resolution. J Biol
Chem 279:35630–35637
Sun L, Wang ZH, Ni FY, Tan XS, Huang ZX (2009) The role of
Ile476 in the structural stability and substrate binding of human
cytochrome P450 2C8. Protein J. doi:10.1007/s10930-009-
9
218-8
Yamazaki H, Shibata A, Suzuki M, Nakajima M, Shimada N,
Guengerich FP, Yokoi T (1999) Oxidation of troglitazone to a
quinone-type metabolite catalyzed by cytochrome P-450 2C8
and P-450 3A4 in human liver microsomes. Drug Metab Dispos
27:1260–1266
Yasar U, Bennet AM, Eliasson E, Lundgren S, Wiman B, De Faire U,
Rane A (2003) Allelic variants of cytochromes P450 2C modify
the risk for acute myocardial infarction. Pharmacogenetics
13:715–720
Tian WD, Wells AV, Champion PM, Di Primo C, Gerber N, Sligar
SG (1995) Measurements of CO geminate recombination in
cytochromes P450 and P420. J Biol Chem 270:8673–8679
Totah RA, Rettie AE (2005) Cytochrome P450 2C8: substrates,
inhibitors, pharmacogenetics, and clinical relevance. Clin Phar-
macol Ther 77:341–352
Udit AK, Hagen KD, Goldman PJ, Star A, Gillan JM, Gray HB, Hill
MG (2006) Spectroscopy and electrochemistry of cytochrome
P450 BM3-surfactant film assemblies.
28:10320–10325
Wang HP, Kimura T (1976) Purification and characterization of
adrenal cortex mitochondrial cytochrome P-450 specific for
cholesterol side chain cleavage activity. J Biol Chem 251:
J
Am Chem Soc
Zhang X, Su T, Zhang QY, Gu J, Caggana M, Li H, Ding X (2002)
Genetic polymorphisms of the human CYP2A13 gene: identi-
fication of single-nucleotide polymorphisms and functional
characterization of an Arg257Cys variant. J Pharmacol Exp
Ther 302:416–423
1
6
068–6074
1
23