Recombinant expression and characterization of a l-amino acid oxidase from the fungus Rhizoctonia solani

Article abstract of DOI:10.1007/s00253-016-8054-y

l-Amino acid oxidases (L-AAOs) catalyze the oxidative deamination of l-amino acids to the corresponding α-keto acids, ammonia, and hydrogen peroxide. l-AAOs are homodimeric enzymes with FAD as a non-covalently bound cofactor. They are of potential interest for biotechnological applications. However, heterologous expression has not succeeded in producing large quantities of active recombinant l-AAOs with a broad substrate spectrum so far. Here, we report the heterologous expression of an active l-AAO from the fungus Rhizoctonia solani in Escherichia coli as a fusion protein with maltose-binding protein (MBP) as a solubility tag. After purification, it was possible to remove the MBP-tag proteolytically without influencing the enzyme activity. MBP-rsLAAO1 and 9His-rsLAAO1 converted basic and large hydrophobic l-amino acids as well as methyl esters of these l-amino acids. The progress of the conversion of l-phenylalanine and l-leucine into the corresponding α-keto acids was determined by HPLC and ¹H-NMR analysis of reaction mixtures, respectively. Enzymatic activity was stimulated 50–100-fold by SDS treatment. K_m values ranging from 0.9–10?mM and v_max values from 3 to 10?U?mg^?1 were determined after SDS activation of 9His-rsLAAO1 for the best substrates. The enzyme displayed a broad pH optimum between pH 7.0 and 9.5. In summary, a successful overexpression of recombinant l-AAO in E. coli was established that results in a promising enzymatic activity and a broad substrate spectrum for biotechnological application.

Full text of DOI:10.1007/s00253-016-8054-y

Appl Microbiol Biotechnol
DOI 10.1007/s00253-016-8054-y
BIOTECHNOLOGICALLY RELEVANT ENZYMES AND PROTEINS
Recombinant expression and characterization of a L-amino acid
oxidase from the fungus Rhizoctonia solani
1
1
2
3
Katharina Hahn & Katrin Neumeister & Andreas Mix & Tilman Kottke
&
4
1
Harald Gröger & Gabriele Fischer von Mollard
Received: 21 September 2016 /Revised: 30 November 2016 /Accepted: 5 December 2016
Springer-Verlag Berlin Heidelberg 2016
#
Abstract L-Amino acid oxidases (L-AAOs) catalyze the ox-
idative deamination of L-amino acids to the corresponding α-
keto acids, ammonia, and hydrogen peroxide. L-AAOs are
homodimeric enzymes with FAD as a non-covalently bound
cofactor. They are of potential interest for biotechnological
applications. However, heterologous expression has not
succeeded in producing large quantities of active recombinant
L-AAOs with a broad substrate spectrum so far. Here, we
report the heterologous expression of an active L-AAO from
the fungus Rhizoctonia solani in Escherichia coli as a fusion
protein with maltose-binding protein (MBP) as a solubility
tag. After purification, it was possible to remove the MBP-
tag proteolytically without influencing the enzyme activity.
MBP-rsLAAO1 and 9His-rsLAAO1 converted basic and
large hydrophobic L-amino acids as well as methyl esters of
these L-amino acids. The progress of the conversion of L-phe-
nylalanine and L-leucine into the corresponding α-keto acids
after SDS activation of 9His-rsLAAO1 for the best substrates.
The enzyme displayed a broad pH optimum between pH 7.0
and 9.5. In summary, a successful overexpression of recombi-
nant L-AAO in E. coli was established that results in a prom-
ising enzymatic activity and a broad substrate spectrum for
biotechnological application.
.
.
Keywords L-Aminoacidoxidase Heterologousexpression
.
.
E. coli Maltose-binding protein Solubility tag
Introduction
L-Amino acid oxidases (L-AAOs, EC 1.4.3.2) have been iden-
tified in diverse organisms such as snakes, bacteria, fungi, and
algae (Bender and Krebs 1950; Geueke and Hummel 2002;
Nuutinen and Timonen 2008; Pollegioni et al. 2013). They
catalyze the oxidative deamination of L-amino acids under
formation of the corresponding α-keto acids, ammonia, and
hydrogen peroxide. Flavin adenine dinucleotide (FAD) acts as
a tightly but not covalently bound cofactor, which accepts a
hydride under formation of α-imino acid intermediates. The
latter hydrolyse spontaneously to α-keto acids and ammonia
1
was determined by HPLC and H-NMR analysis of reaction
mixtures, respectively. Enzymatic activity was stimulated 50–
1
1
00-fold by SDS treatment. Km values ranging from 0.9–
0 mM and vmax values from 3 to 10 U mg were determined
−1
*
Gabriele Fischer von Mollard
(Faust et al. 2007; Moustafa et al. 2006). The reduced FAD
gabriele.mollard@uni-bielefeld.de
reacts with oxygen to regenerate the oxidized FAD under for-
mation of hydrogen peroxide. Most L-AAOs are active as
homodimers, but there are also monomeric enzymes
1
2
Biochemie III, Fakultät für Chemie, Universität Bielefeld,
Universitätsstrasse 25, 33615 Bielefeld, Germany
(
Pollegioni et al. 2013). The protein structures of the
Anorganische Chemie und Strukturchemie, Fakultät für Chemie,
Universität Bielefeld, Universitätsstrasse 25,
homodimers have been determined for L-AAOs from snake
venoms and from the bacterium Rhodococcus opacus (Faust
et al. 2007; Moustafa et al. 2006; Ullah et al. 2012; Zhang
et al. 2004). Some L-AAOs such as the enzymes from
R. opacus and from the fungus Hebeloma cylindrosporum
convert most proteinogenic α-amino acids (Geueke and
Hummel 2002; Nuutinen et al. 2012). Other oxidases are more
3
3615 Bielefeld, Germany
3
4
Physikalische und Biophysikalische Chemie, Fakultät für Chemie,
Universität Bielefeld, Universitätsstrasse 25,
3
3615 Bielefeld, Germany
Organische Chemie I, Fakultät für Chemie, Universität Bielefeld,
Universitätsstrasse 25, 33615 Bielefeld, Germany

Appl Microbiol Biotechnol
specific. For example, cobra venom L-AAO prefers hydropho-
bic amino acids (Bender and Krebs 1950).
Since genomes of dozens of fungi have been sequenced
recently (e.g., Cubeta et al. 2014; Floudas et al. 2012; Tang
et al. 2012), putative L-AAOs can be identified by sequence
similarities especially in the FAD and substrate-binding sites.
In the following, we report the successful overexpression of a
fungal putative L-AAO recombinantly in E. coli with a high
yield and a detailed characterization of the biochemical prop-
erties of the enzyme as well as initial applications in biotrans-
formations for α-keto acid syntheses.
The related D-amino acid oxidases are already used success-
fully for various biotechnological applications (Pollegioni and
Molla 2011). Accordingly, several potential biotechnological
applications for L-AAOs can be envisaged. L-AAOs could be
used for the production of α-keto acids of L-arginine, L-lysine,
L-cysteine, and L-methionine. These α-keto acids are not sub-
strates in biosynthetic pathways of the corresponding L-amino
acids. Therefore, they cannot be produced by engineering bio-
synthetic pathways directly as described for, e.g., α-keto acids
in branched chain amino acid biosynthesis (Tashiro et al. 2015).
A further application is the use of L-AAOs for the preparation of
enantiomerically pure D-amino acids from racemic mixtures of
α-amino acids by enzymatic resolution via L-AAOs. Finally, L-
AAOs could be used as components of biosensors. However, a
major limitation so far is the lack of suitable simple heterolo-
gous expression systems enabling a production of large quan-
tities of active recombinant L-AAOs with a broad substrate
spectrum (Hossain et al. 2014; Pollegioni et al. 2013). The L-
AAO from R. opacus expressed in Escherichia coli was insol-
uble and could not be refolded into an active form (Geueke and
Hummel 2003). An active R. opacus L-AAO was obtained after
recombinant expression in Streptomyces lividans. However, the
Materials and methods
Amplification and cloning of the rsLAAO1
A synthetic gene (Life Technologies) of a putative Rhizoctonia
solani AG-3 Rhs1AP L-AAO1 (EUC54418.1, Cubeta et al.
2014) codon optimized for expression in P. pastoris (sequence
in GenBank under accession number KX925447) was cloned
into the expression vector pMALc5X (New England Biolabs)
encoding an N-terminal maltose-binding protein (MBP) follow-
ed by a recognition site for the Factor Xa protease under the
control of a tac promoter via the restriction sites Nde I and Eco
RI generating pKHRi1 (MBP-rsLAAO1). To insert a sequence
encoding a 9His-tag after the sequence encoding the recogni-
tion site for the Factor Xa protease, a forward primer (GCGG
CCGCATGCATCATC ACCATCACCACCATCACCAT
TCCTCCAAAGAGTTCAAGGAC) with a Not I site
(underlined sequence) and a 9His-tag (bold) and a reverse prim-
er (GCGGCCGCGCATATGTGAAATCCTTCCCTC) with a
Not I site were used to PCR-amplify pKHRi1. The PCR-
product was digested with Not I and ligated yielding pKHRi2.
To enable the low-temperature cleavage of the fusion protein, a
sequence encoding the PreScission protease recognition site
was introduced upstream of the sequence encoding the N-ter-
minal 9His-tag by PCR amplification of pKHRi2 with the fol-
lowing primers (restriction sites are underlined, 9His-tag are in
bold, and PreScission protease sequences are in italics): GCGG
CCGCCTCGAAGTAC TGTTCCAGGGTCCTATGC
ATCATCACCATCACCAC and GCGGCCGCCATA
TGTGAAATCCTTCCCTC, generating pKHRi4 (MBP-P-
9His-rsLAAO1) after Not I digestion and ligation. The vector
pKHRi7 was generated by cloning the synthetic gene into
pET28b (Novagen) via the restriction sites Nde I and Eco RI
for expression of 6His-rsLAAO1 with an N-terminal 6His-tag.
−1
specific L-AAO activity was only 0.029 U mg in crude ex-
tracts from S. lividans while crude extracts derived from the
wild-type organism R. opacus contained 0.071 U mg−1
(
Geueke and Hummel 2003). An L-AAO of the fungus
H. cylindrosporum belonging to the division of
Basidiomycota has been expressed recombinantly in E. coli as
an active but almost completely insoluble fusion protein with an
N-terminal 6-His tag (Nuutinen et al. 2012). These results un-
derline the challenge of heterologously overexpressing L-
AAOs with a broad substrate spectrum.
Heterologous expression of L-AAOs with a narrow sub-
strate spectrum has been more successful. An L-aspartate ox-
idase from the archaea Sulfolobus tokodaii has been expressed
in E. coli with a His-tag (Bifulco et al. 2013). The L-AAO
from the bacterium Streptococcus oligofermens, which can
utilize seven amino acids as substrate, has also been expressed
as a soluble 6His-tagged fusion protein in E. coli (Tong et al.
2
008). Moreover, L-phenylalanine and L-histidine have been
converted by the L-AAO from the fungus Trichoderma
harzianum ETS323 after expression as 6His-tagged fusion
proteins in E. coli and refolding from inclusion bodies
(
Cheng et al. 2011). A truncated L-amino acid deaminase from
the bacterium Proteus mirabilis with a 6His-tag has been
refolded from E. coli inclusion bodies and deaminates L-his-
tidine, L-arginine, L-phenylalanine, and L-glutamate under for-
mation of the corresponding α-keto acids (Liu et al. 2013).
The yeast Pichia pastoris has been used as expression system
for the L-AAO from the fish Platichthys stellate with a 6-His
tag for application as an antibacterial agent (Kasai et al. 2015).
Expression
pKHRi1 and pKHRi7 were transformed into E. coli BL21
CodonPlus (DE)-RP and Arctic Express (DE) (Ferrer et al.
2004) competent cells and cultured in LB broth supplemented
with antibiotics (50 μg mL kanamycin, 100 μg mL ampi-
cillin, 20 μg mL
−
1
−1
−
1
− 1
gentamycin, 25 μg mL

Appl Microbiol Biotechnol
chloramphenicol). MBP-rsLAAO1 expression was induced at
an OD600 of 0.8 by 0.05 or 0.2 mM isopropyl β-D-1-thio-
galactopyranoside (IPTG) at 16 and 24 °C for 5 h. The test
expression in Arctic Express cells (Ferrer et al. 2004) was
performed following the manufacturer’s instructions using
supplemented with 0.025% SDS. Hydrogen peroxide (H O )
2 2
production in the native PAGE gels was detected by incubat-
ing the gels at room temperature in 50 mM triethanolamine
−
1
(TEA) buffer (pH 8.0), 10 mM L-arginine, 2 mg mL o-
−1
dianisidine, and 5 U mL horseradish peroxidase until the
bands were visible (Geueke and Hummel 2002).
0
.05 mM. Cells taken at the indicated time points were resus-
pended in PBS (20 mM sodium phosphate buffer, pH 7.4,
50 mM NaCl), briefly sonicated, and centrifuged. The solu-
1
Protein determination
ble fraction and the remaining pellet (resuspended in the same
volume) were separated by SDS-PAGE and stained with
Coomassie Brilliant Blue R-250. For expression on a
The concentration of rsLAAO1 proteins was determined ac-
cording to the method developed by Bradford (1976) using
bovine serum albumin as standard. The purity and expression
rates of rsLAAO1 samples were monitored by SDS-PAGE.
5
00-mL scale, Arctic Express (DE3) cells with pKHRi1 or
pKHRi4 were grown overnight at 37 °C in LB broth with
1
2
0 μg mL− gentamycin for selection of the cpn10/cpn60
chaperonin expression plasmid. The culture was diluted to
an OD600 of 0.15 with LB broth and incubated at 30 °C until
the OD600 reached 1.3–1.5. Expression was induced after a
Spectroscopy
Absorbance spectra were recorded using a UV-2450 UV-VIS
spectrophotometer (Shimadzu). The FAD content in 9His-
rsLAAO1 was determined by absorbance in 50 mM potassi-
um phosphate buffer, pH 8.5, containing 300 mM NaCl. The
concentration of FAD bound to rsLAAO1 was calculated
1
5-min preincubation at 11 °C by 0.05 mM IPTG for 18 h at
11 °C.
Purification of the rsLAAO1 protein
from the absorbance at 450 nm (ε = 11,300 M− cm ;
Whitby 1953). The cofactor occupancy of 9His-rsLAAO1
was calculated from the ratio of the absorbance at 280 and
1
−1
Purification of the tagged proteins was carried out at 4 °C.
Cells of a 500-mL culture were pelleted, resuspended in
−
1
−1
2
0 mL MBP buffer (20 mM Tris-HCl, pH 8.2, 200 mM
450 nm (ε280nm = 20,552 M cm for free FAD,
ε280nm = 128,230 M cm for 9His-rsLAAO1 calculated
with EXTCOEF; http://workbench.sdsc.edu).
−1
−1
NaCl, 1 mM EDTA), and disrupted by French press. After
centrifugation at 27.000×g for 30 min, the resulting soluble
fraction was applied to an amylose column, which was equil-
ibrated with MBP buffer. After washing, MBP-rsLAAO1 or
MBP-P-9His-rsLAAO1 was eluted by supplementing the
MBP buffer with 10 mM maltose.
Enzyme assay
To determine the oxidase activity of rsLAAO1, the initial
For the two-step purification of MBP-P-9His-rsLAAO1,
the elution fractions were pooled and diluted with His buffer
production rate of hydrogen peroxide was measured.
(
50 mM sodium phosphate buffer, pH 8.2, 300 mM NaCl) in a
1. The Ampliflu Red (10-acetyl-3,7-dihydroxyphenoxazine)
ratio of 1:1. One microgram of PreScission protease was
added to 100 μg fusion protein for cleaving the MBP-tag
and incubated for 18 h at 4 °C, and the solution was applied
to a Ni -NTA column. The free MBP-tag and the PreScission
protease were in the flow through. After washing with 10
column volumes of His buffer, 9His-rsLAAO1 was eluted
with His buffer containing 500 mM imidazole (pH 8.2). The
fractions were pooled, rebuffered to His buffer via ultrafiltra-
tion (Vivaspin 6 30.000 MWCO, Sartorius), and stored at
reagent was used to measure H O release in enzyme
2
2
reactions (Zhou et al. 1997). Fluorescence signals (exci-
tation at 550 nm, emission at 585 nm) were recorded
using a Tecan Infinite 200 microplate reader at 30 °C.
Unless otherwise stated, the final reaction mixture
2
+
−
1
contained 10 mM L-arginine, 10 U mL peroxidase,
10 μM Ampliflu Red, and rsLAAO1 in limiting amounts
in 200 mM TEA/HCl buffer (pH 8.5) in a final volume of
200 μL. The H O concentrations in the calibration stan-
2
2
4
°C.
dards were 0.05 to 7.5 μM.
2
. The coupled peroxidase/dye assay determined H O by
2
2
Polyacrylamide gel electrophoresis
detection of oxidized o-dianisidine (Vanboven et al.
988). This was monitored spectrophotometrically at
436 nm (ε = 8100 M cm ). The standard assay mixture
1
−1
−1
Sodium dodecyl sulfate polyacrylamide gel electrophoresis
(
SDS-PAGE) was carried out with 11% acrylamide in the
contained 10 mM L-arginine, 50 mM TEA/HCl buffer
−1
−1
separating gel (Laemmli 1970). Proteins were stained with
Coomassie Brilliant Blue R-250. Native PAGE was per-
formed in 8% polyacrylamide gels using a sample buffer with-
out SDS and 2-mercaptoethanol. Some samples were
(pH 8.5), 0.2 mg mL o-dianisidine, 5 U mL peroxi-
dase, and rsLAAO in limiting amounts. Reactions were
carried out in 96-well plates at 30 °C in a Tecan Infinite
200 microplate reader.

Appl Microbiol Biotechnol
One unit was defined as the amount of enzyme that cata-
lyzes the conversion of 1 μmol L-amino acid per minute. Km
and vmax were determined with L-amino acid concentrations of
2011). Rhizoctonia belongs to the same class Agaricomycetes
in the division of Basidiomycota as Hebeloma. A synthetic
gene encoding this sequence optimized for expression in
Pichia pastoris (sequence in GenBank under accession number
KX925447) was cloned into an E. coli expression plasmid to
produce fusion proteins with an N-terminal 6His-tag.
Expression was tested at 16 and 24 °C. Soluble proteins in
the cell lysate (Fig. 1a, S) and pellets (P) were separated by
SDS-PAGE. 6His-rsLAAO1 was barely detected in the soluble
fraction even though large amounts were found in the pellet
after expression at 24 °C. Maltose-binding protein (MBP) has
been used to increase the solubility of fusion proteins (Kapust
and Waugh 1999), but may interfere with activity due to its size
of 40 kDa. Almost half of the MBP-rsLAAO1 was detected in
the soluble fraction (Fig. 1b) under the same expression condi-
tions. These data indicate that the MBP-tag increased the solu-
bility compared to a 6His-tag. Expression conditions were fur-
ther tested with different concentrations of IPTG for different
amounts of time. Soluble fractions were analyzed by western
blotting with antiserum against the MBP-tag. A fusion protein
band was detected, which had the expected mobility slightly
above 100 kDa (Fig. 1c). Maximal amounts of soluble MBP-
rsLAAO1 were obtained at 24 °C. However, the L-AAO activ-
ity per milligram of MBP-rsLAAO1 protein was about 3-fold
higher in cleared cell lysates after expression at 16 °C compared
to lysates after expression at 24 °C (Fig. 1d) indicating that part
of the soluble protein was inactive at 24 °C.
0
.1–30 mM.
Reversed-phase high performance liquid chromatography
Five millimolars of L-phenylalanine, 0.05 U SDS-activated
9
His-rsLAAO1 (24 μg), and 32.5 U catalase were incubated
in 50 mM TEA buffer (pH 8.5) in a total volume of 650 μL for
different periods of time at 30 °C. Samples were boiled to stop
the reaction, and 20 μL of the reaction products were separat-
ed by HPLC (Jasco) with a Macherey-Nagel RP 18 column
(
NUCLEODUR® C18 HTec, 4.6 × 150 mm, 5 μm with a
guard column) using eluent A (water 0.1% (v/v) trifluoroacetic
acid (TFA)) and eluent B (methanol 0.1% (v/v) TFA).
−1
Separation was obtained at a flow rate of 1 mL min and a
linear gradient from 60 to 30% A over 8 min followed by a
linear gradient from 30 to 60% A over 4 min; effluent fractions
were monitored at λ = 220 nm. The products were identified
by comparison with L-phenylalanine and phenylpyruvate.
Proton NMR measurements
9
His-rsLAAO1 was dialyzed against 80 mM sodium phos-
phate buffer pH 8.0 in D O. Twenty millilimolars of L-leucine,
2
0
.8 U SDS-activated 9His-rsLAAO1 (260 μg), and 200 U
catalase were incubated in 80 mM sodium phosphate buffer
As lower expression temperatures improved yields of ac-
tive protein, we tested an expression system, which is opti-
mized for expression at even lower temperatures. The E. coli
strain Arctic Express produces two cold-adapted chaperonins
allowing for protein expression at 4–12 °C (Ferrer et al. 2004).
Then, conducting such an expression, less fusion protein was
lost in the pellet after induction for 18 h at 11 °C (Fig. 1b). The
soluble fraction (Fig. 2, S) was loaded onto amylose resin.
After washing (W), the fusion protein was eluted by 10 mM
maltose (E1–E7) and high amounts of soluble, active MBP-
rsLAAO1 were obtained.
pH 8.0 (in D O, final volume 4 mL) at 30 °C. After several
2
time points, samples were boiled (5 min 95 °C) to stop the
reaction and centrifuged, and the supernatants were analyzed.
NMR measurements were conducted on a Bruker Avance 600
1
spectrometer ( H: 600.13 MHz) at 25 °C. Chemical shifts of
resonances in spectra were referenced to residual solvent
peaks (H O, δ = 4.79 ppm). The identities of components
2
responsible for the resonances present in the spectra were
1
assigned by comparison with H spectra of authentic
standards.
The activity of MBP-rsLAAO1 was assayed with different
amino acids and derivatives (10 mM) to determine the sub-
strate spectrum. The activities relative to L-arginine were cal-
culated (Table 1). The best substrates were on the one hand the
basic amino acids L-arginine, L-lysine, and L-ornithine and on
the other hand the large hydrophobic amino acids L-phenylal-
anine, L-leucine, norleucine, and L-methionine. Polar and
acidic amino acids were not converted. Interestingly, methyl
esters derived from α-amino acids were also substrates as
shown for L-phenylalanine methyl ester, L-leucine methyl es-
ter, and L-methionine methyl ester even though with lower
relative activity compared to the corresponding free α-amino
acids. Next, different derivatives of L-phenylalanine were test-
ed in a systematic approach (Fig. 3a). D-Phenylalanine was
not converted, demonstrating the influence of the absolute
Results
The complete genome sequences of many fungi have been
determined in recent years revealing dozens of candidates for
L-amino acid oxidases (L-AAOs). A Blast search with the pro-
tein sequence of L-AAO1 from H. cylindrosporum revealed a
putative protein from R. solani AG-3 Rhs1AP (GenBank
accession number EUC54418.1; Cubeta et al. 2014). The align-
ment showed that 33% of the amino acid residues were identi-
cal including residues predicted to be important for the interac-
tion with FAD and substrates. This rsLAAO1 does not contain
a signal sequence according to the prediction programs PSORT
II (Nakai and Horton 1999) and SignalP 4.1 (Petersen et al.

Appl Microbiol Biotechnol
Fig. 1 Expression of an active recombinant Rhizoctonia solani L-amino
acid oxidase fusion protein in E. coli. a 6His-rsLAAO1 was expressed in
the E. coli strain BL21-CodonPlus (DE3)-RP at 16 °C (left) or 24 °C
strain BL21-CodonPlus (DE3)-RP at 16 °C (left) or 24 °C (right) for 2, 3,
or 5 h after induction with 0.05 or 0.2 mM IPTG. Control cells were
harvested before induction (0 h). Soluble fractions were analyzed by
SDS-PAGE. The band above 100 kDa was identified as MBP-
rsLAAO1 by immunoblotting with antiserum directed against the
MBP-tag. d The specific activity of MBP-rsLAAO1 is higher after ex-
pression at 16 °C (black) than at 24 °C (gray). Soluble fractions of cell
lysates after induction with 0.2 mM IPTG for 3 h were analyzed for L-
AAO activity using a coupled peroxidase Ampliflu Red assay with
10 mM L-arginine, L-leucine, or L-phenylalanine as substrates. The
(
middle) for 3 h with 0.2 mM IPTG or in the E. coli strain Arctic
Express at 11 °C (right) for 11 h with 0.05 mM IPTG. Control cells were
harvested before induction (0 h). Cells were lysed by sonification and
separated into soluble fractions (S) and pellets (P) by centrifugation.
Fractions were analyzed by SDS PAGE. 6His-rsLAAO1 (arrow) was
detected in the pellet after expression at 16 and 24 °C while low amounts
were expressed at 11 °C. b MBP-rsLAAO1 was expressed and analyzed
as above. MBP-rsLAAO1 (arrow) was found in the pellets and soluble
fractions at 16 and 24 °C. MBP-rsLAAO1 was predominantly soluble
after expression at 11 °C. c MBP-rsLAAO1 was expressed in the E. coli
−1
−1
amounts of MBP-rsLAAO1 (0.95 mg mL at 16 °C and 3.5 mg mL
at 24 °C) were estimated in Coomassie-stained gels by comparison to
serial dilutions of bovine serum albumin
configuration. L-Tyrosine as a polar derivative was converted
very slowly even taking into account the low substrate con-
centration (about 2 mM due to limited solubility). L-
Phenylglycine did not serve as substrate, indicating that the
amino group. A β-amino acid did not serve as substrate as
shown for L-β-phenylalanine ((S)-3-amino-3-phenylpropionic
acid). The amine 2-phenylethylamine was not converted dem-
onstrating the importance of the carboxyl group. Isomers of L-
leucine and L-valine were compared to evaluate the influence
of branched alkyl chains (Fig. 3b). The linear isomer D/L-
norleucine was assayed at 5 mM of L-norleucine because of
its limited solubility. At this concentration, norleucine was
converted with a comparable rate to 5 mM of L-leucine (data
not shown) but slower than 10 mM of L-leucine (Fig. 3b). L-
Isoleucine bearing a branched β-position was a very poor
substrate. In addition, L-valine and L-tert-leucine bearing three
lack of the β-CH group is unfavorable. The presence of the
2
α-methyl group in L-α-methyl phenylalanine prevented con-
version as well. N-methyl-L-phenylalanine was not converted,
demonstrating the detrimental effect of a methylation at the
CH groups at the β-position were not converted.
3
The pH dependence of MBP-rsLAAO1 activity was ana-
lyzed between pH 5 and pH 11 for L-arginine (Fig. 4a), L-
leucine (Fig. 4b), and L-phenylalanine (data not shown).
Citrate buffers, TEA buffers, and glycine buffers were pre-
pared to cover this pH range. The enzyme was more active
in TEA buffer (circles) than in citrate buffer (squares) at pH
7.0 and glycine buffer (triangles) at pH 8.5 for all substrates. In
addition, MBP-rsLAAO1 showed a broad pH optimum be-
tween pH 7.0 and 9.5.
Since the MBP-tag may influence the enzymatic properties
of rsLAAO1, an expression plasmid was generated that codes
for an N-terminal MBP followed by a recognition sequence
for PreScission protease, a 9His-tag, and rsLAAO1 (MBP-P-
Fig. 2 Purification of recombinant MBP-rsLAAO1. MBP-rsLAAO1
was expressed in the E. coli strain Arctic Express at 11 °C. Cells were
lysed, debris and insoluble proteins removed by centrifugation, and the
soluble fractions (S) loaded onto an amylose resin. After collection of the
flow through (FL) and wash fractions (W), proteins were eluted using
1
0 mM maltose (E1–E7). Fractions were separated by SDS PAGE and
stained with Coomassie

Appl Microbiol Biotechnol
Table 1 Substrate spectrum of
MBP-rsLAAO1
Relative activity (%)
0
L-Amino acids
Hydrophobic amino acids
L-Alanine
L-Leucine
L-Valine
7
0
0
3
3
8
6
0
0
0
0
0
3
0
0
0
1
1
4
.1
.4
L-Isoleucine
a
5
8
D/L-Norleucine
L-Phenylalanine
L-Tryptophane
D-Phenylalanine
L-Phenylglycine
(S)-β-Phenylalanine
L-Proline
L-tert-Leucine
L-Methionine
L-Serine
2
Polar amino acids
Basic amino acids
L-Cysteine
L-Threonine
L-Glutamine
L-Asparagine
.6
b
L-Tyrosine
100
L-Arginine
5
5
0
0
5
0
0
L-Lysine
6
L-Ornithine
L-Canavanine
L-Histidine
.2
Acidic amino acids
L-Aspartic acid
L-Glutamic acid
L-Leucine methyl ester
Amino acid derivates
61
6
7
0
0
0
0
0
2
L-Phenylalanine methyl ester
N-Methyl-L-Phenylalanine
L-(α)-Methylphenylalanine
N-Acetyl-L-Phenylalanine methyl ester
2
-Phenylethylamine
N-α-Acetyl-L-Arginine
1
L-Methionine methyl ester
The standard substrate concentration was 10 mM amino acid in the assay
a
In the case of racemic D/L-amino acids, the concentration of L-amino acids was 5 mM in the assay mixture
A saturated solution was used for amino acids with low solubility
b
9
His-rsLAAO1). Treatment of the purified recombinant pro-
tein with PreScission protease removes the MBP-tag. The
His-tag can be used for an additional affinity purification step
of a 65-kDa band consistent with 9His-rsLAAO1 and a 40-
kDa band corresponding to the size of MBP (C) indicating
that the MBP-tag was removed. This mixture was loaded onto
Ni-NTA resin, and a 65-kDa band was eluted by 500 mM
imidazole (E2). Western blotting with antibodies directed
against the MBP- and 9His-tag confirmed the identity of these
bands (data not shown). Accordingly, purified 9His-
rsLAAO1 was obtained successfully.
9
and for detection by antibodies. Large amounts of soluble
MBP-P-9His-rsLAAO1 with a mobility of slightly above
1
tion was detected in the pellet (P) after expression in the E. coli
strain Arctic Express at 11 °C. The soluble fraction (S) was
loaded onto amylose resin. After washing (W1), the fusion
protein was eluted by 10 mM maltose (E1). Incubation of
the eluate with PreScission protease resulted in the appearance
00 kDa (Fig. 5a, S) were obtained while a considerable frac-
L-Amino acid oxidases require a FAD cofactor, which is
bound tightly but not covalently. UV-Vis spectroscopy was
used to analyze the recombinant purified 9His-rsLAAO1

Appl Microbiol Biotechnol
Fig. 3 Activity of MBP-
rsLAAO1 towards substrates
related to L-phenylalanine (a) and
L-leucine (b). MBP-rsLAAO1
converted methyl esters of L-
phenylalanine and L-leucine with
a reduced rate. L-Tyrosine was a
poor substrate. D-phenylalanine,
L-phenylglycine, N-methyl-L-
phenylalanine, and ß-
phenylalanine were not
converted. The linear L-
norleucine served as good and L-
isoleucine as very poor substrates
while L-valine and L-tert-leucine
did not react. A coupled
peroxidase o-dianisidine assay
was used with 10 mM substrate
concentration except for L-
norleucine (5 mM) and L-tyrosine
(below 2 mM)
Fig. 5 Purification of MBP-P-9His-rsLAAO1, digestion to 9His-
rsLAAO1, and determination of FAD content. a A fusion protein
consisting of maltose-binding protein (MBP), a consensus sequence for
the PreScission protease (–P–), a 9His-tag, and rsLAAO1 was expressed
in the E. coli strain Arctic Express. Cells were lysed, a pellet (P) removed
by centrifugation, and the soluble fractions (S) loaded onto an amylose
resin. After collection of the flow through (F1) and wash fractions (W1),
proteins were eluted using 10 mM maltose (E1). The fusion protein was
incubated with PreScission protease to remove MBP (C), loaded onto Ni-
NTA resin (flow through: F2), and washed (W2), and 9His-rsLAAO1
eluted with 500 mM imidazole (E2). Fractions were separated by SDS-
PAGE and stained with Coomassie. b The UV-Vis spectrum of purified
9His-rsLAAO1 (solid line) showed an absorption spectrum between 350
and 500 nm that is typical for flavoproteins and differs from free FAD
(dashed line). Quantification revealed an occupancy of 9His-rsLAAO1
with FAD of 70–100% in different preparations
Fig. 4 pH optimum of MBP-rsLAAO1 was between pH 8.5 and 9.5 for
L-arginine (a) and L-leucine (b). The enzymatic activity was assayed with
peroxidase and o-dianisidine in citrate buffers (squares), TEA buffers
(circles), and glycine buffers (triangles) of the indicated pH. Data are
mean of three independent experiments; error bars are standard
deviations

Appl Microbiol Biotechnol
because FAD in proteins has a characteristic absorption spec-
trum between 300 and 500 nm (Fig. 5b, solid line). The co-
factor occupancy was determined from the spectrum using the
extinction coefficients for FAD at 280 and 450 nm and the
calculated extinction coefficient at 280 nm for the apoprotein.
As a result, between 70 and 100% of the subunits contained a
molecule of the cofactor FAD in different preparations of
rsLAAO1 and 9His-rsLAAO1 were assayed spectrophoto-
metrically after preincubation with different amounts of SDS
−1
(Fig. 6b). Enzymatic activity was 0.05–0.15 U mg in the
absence of SDS. It was dramatically increased to 5–
−1
10 U mg in the presence of 1–2 mM SDS at an optimal
weight ratio of three parts of SDS to one part of protein.
MBP-rsLAAO1 and 9His-rsLAAO1 had similar specific ac-
tivities and were stimulated to a similar extent by comparable
SDS concentrations. These data indicate that the MBP-tag did
not influence enzymatic activities.
9
His-rsLAAO1 as well as MBP-rsLAAO1.
It has been reported that SDS treatment is required to acti-
vate recombinant H. cylindrosporum LAAO1 expressed in
E. coli (Nuutinen et al. 2012). Therefore, we tested whether
low amounts of SDS influenced the activity of 9His-
rsLAAO1 and MBP-P-9His-rsLAAO1. Soluble proteins
from cell extracts (Fig. 6a, S), MBP-P-9His-rsLAAO1 eluted
from an amylose column (E1), and 9His-rsLAAO1 eluted
from Ni-NTA agarose (E2) were either left untreated or were
incubated with 0.025% SDS before separation by native
PAGE. Gels were assayed for L-arginine-dependent produc-
tion of H O with peroxidase and o-dianisidine. LAAO1 ac-
The effect of SDS treatment was quantified further. A 1-L
culture of E. coli Arctic Express yielded 236 mg of protein in
the soluble fraction of cell lysates with a total activity of 54 U
−1
(specific activity 0.2 U mg with L-arginine) upon expression
of MBP-P-9His-rsLAAO1. After two affinity chromatogra-
phy steps, 4.4 mg 9His-rsLAAO1 with a specific activity of
−1
9 U mg was obtained (total activity 40 U). To determine the
kinetic properties of 9His-rsLAAO1, initial velocities were
determined for different substrate concentrations after SDS
activation. Km and vmax (Table 2) were calculated from
2
2
tivity was low in the absence of SDS (Fig. 6a, left). By con-
trast, strong activity was observed after an incubation with
Hanes-Woolf plots. L-Arginine had a K of 0.9 mM and
m
−1
0
.025% SDS (Fig. 6a, right). To quantify this effect, MBP-
vmax of 8.3 U mg . The presence of a methyl ester moiety
increased K strongly (2.3 mM for L-phenylalanine, 13.9 mM
m
for L-phenylalanine methyl ester, 2.4 mM for L-leucine, and
6.3 mM L-leucine methyl ester) while vmax values were in a
comparable range. These values were compared to enzymatic
activities of MBP-rsLAAO1 without SDS activation
−
1
(
Table 2). For L-arginine, v
was only 0.1 U mg without
max
−1
SDS but 8.3 U mg with SDS. Similar differences in vmax of
0–100-fold were obtained for all substrates tested. In con-
5
trast, the effect of SDS activation on the K values was much
m
smaller. Substrate spectra were very similar for untreated
MBP-rsLAAO1 (Table 1) and SDS-activated 9His-
rsLAAO1 (data not shown).
In addition, we applied the expressed 9His-rsLAAO1 in
initial biotransformations, which also enables us to obtain a
direct proof for the formation of α-keto acids by two different
methods. A procedure was developed to separate L-phenylal-
anine (retention time 3 min) from phenylpyruvate (retention
time 5.7 min) by reversed-phase HPLC (data not shown).
SDS-activated 9His-rsLAAO1 was incubated with L-phenyl-
alanine for 0, 15, 30, or 60 min in the presence of catalase to
avoid oxidation of phenylpyruvate by H O . Reaction mix-
2
2
tures were boiled to stop the reaction and separated by
reversed-phase HPLC. A peak with a retention time of
Fig. 6 Low amounts of SDS increased the activity of MBP-rsLAAO1
and 9His-rsLAAO1 by a factor of 20. a Soluble proteins from cell
extracts (S), MBP-P-9His-rsLAAO1 eluted from an amylose column
5
.7 min was absent at the time point 0 min, but appeared after
a 15-min conversion time and increased further after 30 and
0 min (Fig. 7a). Side products were not detected. These data
(E1), and 9His-rsLAAO1 eluted from Ni-NTA agarose (E2) were incu-
6
bated without (left) or with (right) 0.025% SDS, separated by native
PAGE, and assayed for L-AAO activity with arginine as substrate. b
MBP-rsLAAO1 (gray triangles) and 9His-rsLAAO1 (black circles) were
incubated at a protein concentration of 0.1 mg mL− with SDS at the
indicated concentration for 5 min. L-AAO activity was measured using
a coupled peroxidase o-dianisidine assay
indicate that L-phenylalanine was converted to
phenylpyruvate with high selectivity.
1
1
H NMR was used as an alternative analytical method,
which can distinguish L-leucine from α-keto leucine and al-
lows for a quantification of these components. The protons at

Appl Microbiol Biotechnol
Table 2 Kinetic properties of
native MBP-rsLAAO1 (top) and
SDS-activated 9His-rsLAAO1
−
1
−1
Substrate
ν
max (U∙mg )
K
m
(mM)
k
cat (s )
kcat/K
m
0
0
0
0
0
0
0
.10 ± 0.02
.13 ± 0.02
.10 ± 0.02
.13 ± 0.01
.07 ± 0.01
.08 ± 0.01
.06 ± 0.01
0.4 ± 0.01
6.8 ± 0.3
6.1 ± 0.1
11.7 ± 0.2
1.3 ± 0.1
5.6 ± 0.2
20.0 ± 1.1
0.13
0.16
0.13
0.16
0.09
0.10
0.08
0.30
0.02
0.02
0.01
0.07
0.02
(bottom)
L-Arginine
L-Phenylalanine
L-Leucine
L-Phenylalanine methyl ester
L-Lysine
L-Ornithine
0.004
L-Methionine
−
1
−1
Substrate
ν
max (U∙mg )
K
m
(mM)
k
cat (s )
kcat/K
m
8
9
8
8
3
6
5
9
.3 ± 0.2
.7 ± 0.4
.6 ± 0.1
.1 ± 0.2
.6 ± 0.1
.0 ± 0.5
.7 ± 0.2
.5 ± 0.4
0.9 ± 0.04
2.3 ± 0.1
2.4 ± 0.3
13.9 ± 0.6
2.3 ± 0.2
12.4 ± 0.2
5.4 ± 0.3
6.3 ± 0.2
10.4
12.2
10.8
10.2
4.6
11.4
5.3
4.6
0.7
2.0
0.6
1.3
1.9
L-Arginine
L-Phenylalanine
L-Leucine
L-Phenylalanine methyl ester
L-Lysine
7.5
L-Ornithine
7.2
L-Methionine
11.8
L-Leucine methyl ester
K
m
and vmax were calculated from Hanes-Woolf plots. Data are means of three independent experiments with
standard deviations
the β-carbon and γ-carbon are found at a chemical shift of 2.6
and 2.1 ppm, respectively, in α-keto leucine (Fig. 7b). By
contrast, a multiplet between 1.6 and 1.7 ppm is observed
for these protons in L-leucine. The proton attached to the α-
carbon of L-leucin at 3.7 ppm is removed during the enzymatic
11 °C. A higher proportion of the soluble MBP-rsLAAO1
was inactive after expression at 24 °C compared to 16 and
11 °C. As lower temperatures reduce the rate of protein syn-
thesis, more time is available for correct folding, incorporation
of the cofactor FAD, and homodimerisation. As a result, be-
tween 70 and 100% of the subunits contained FAD after pu-
rification. However, a larger fraction of MBP-rsLAAO1 and
MBP-P-9His-rsLAAO1 did not bind to the amylose column
and was found in the flow through (Figs. 2 and 5, FL) even
though the column had high binding capacity. In addition, the
MBP-P-9His-rsLAAO1 activity in the soluble fraction was
much lower than expected from the protein amount in the
native gel (Fig. 6a). These data indicate that even after expres-
sion at 11 °C, the soluble MBP-P-9His-rsLAAO1 was partial-
ly misfolded and inactive. The situation was worse for an
MBP-fusion protein with a putative L-AAO from the fungus
Fibroporia radiculosa (GenBank accession number
CL98847; Tang et al. 2012), which shares 35% of the amino
acid residues with LAAO1 from Hebeloma cylindosporum
and 30% of the amino acid residues with rsLAAO1. This
fusion protein was partially soluble after expression at
11 °C, but did not bind to the amylose column and no L-
AAO activity could be detected (data not shown). Problems
in folding could be due to the lack of posttranslational modi-
fications. However, both proteins do not contain endoplasmic
reticulum-import signals and are most likely cytosolic accord-
ing to prediction programs. Therefore, they should not be
glycosylated. We obtained a specific L-AAO activity of
1
reaction. The H NMR signal of the protons of both –CH3
groups remains unchanged at 0.9 ppm and can be used as
1
reference for quantification. As water produces a strong H
NMR signal, all buffers were prepared in D O and the purified
2
9
His-rsLAAO1 was dialyzed against a buffer in D O and
2
activated by SDS. The reaction was stopped after 0, 30, 60,
or 120 min and the spectra analyzed (Fig. 7b). Peaks at a
chemical shift of 2.6 and 2.1 ppm characteristic for α-keto
leucine appeared and increased with time while peaks for L-
leucine vanished. Accordingly, 95% of the L-leucine was con-
verted into α-keto leucine within 120 min.
Discussion
Here, we described the successful heterologous expression of
a fusion protein with R. solani L-AAO1 in E. coli. A key factor
was the usage of an MBP-fusion protein as solubility tag
(
Kapust and Waugh 1999). Sufficient amounts of soluble pro-
tein were detected upon expression of MBP-rsLAAO1 and
MBP-P-9His-rsLAAO1. MBP as solubility tag was required
only during biosynthesis in E. coli. Once being correctly
folded, the purified 9His-rsLAAO1 was stable in solution
even after proteolytic removal of the MBP-tag. The second
key to success was lowering the expression temperature to
−1
0.2 U mg after SDS activation in E. coli crude lysates, which
−
1
is much higher than 0.029 U mg measured after

Appl Microbiol Biotechnol
form. On the other hand, L-AAO folding during biosynthesis
in E. coli may differ slightly from folding in the fungal cells.
SDS binds to hydrophobic regions of proteins and can change
the structure of proteins. In most cases, this results in inacti-
vation and finally denaturation of proteins. Interestingly, SDS
treatment affected the K values of MBP-rsLAAO1 and 9His-
m
rsLAAO1 much less than vmax. These data suggest that SDS
does not influence the binding of the substrate in the active
site. There have also been reports that SDS can activate some
endogenous enzymes. Tyrosinases and polyphenol oxidases
can be synthesized as latent, inactive enzymes in plants but
also in the frog Xenopus laevis. Different treatments including
incubation with SDS induce conformational changes, which
activate these enzymes and induce enzymatic browning of
fruits and vegetables (Espin and Wichers 1999; Moore and
Flurkey 1990; Wittenberg and Triplett 1985).
Basic and large hydrophobic α-amino acids are the best
substrates for MBP-rsLAAO1 and 9His-rsLAAO1. Polar or
acidic amino acids as well as amino acids with substituents in
the β-position are converted poorly or not at all. This substrate
spectrum is narrower and differs greatly from that of
H. cylindrosporum LAAO1 (Nuutinen et al. 2012), which
shares 33% of the amino acid residues with rsLAAO1. The
best substrate for H. cylindrosporum LAAO1 is L-glutamate
followed by L-glutamine. Basic, polar, and hydrophobic ami-
no acids are accepted as well with good activities by
hcLAAO1. Interestingly, MBP-rsLAAO1 and 9His-
rsLAAO1 also convert methyl esters of L-phenylalanine and
L-leucine with vmax values similar to that of the corresponding
Fig. 7 Detection of α-keto acids produced by 9His-rsLAAO1 by HPLC
analysis (a) and H NMR spectroscopy (b). a The reaction mixture with
1
5
mM of L-phenylalanine, SDS-activated 9His-rsLAAO1, and catalase
was incubated for 0, 15, 30, and 60 min at 30 °C. After boiling, the
reaction mixtures were analyzed by HPLC on a reversed-phase C18 col-
umn. L-Phenylalanine (retention time 3 min) was converted with high
selectivity to phenylpyruvate (retention time 5.7 min) without the forma-
tion of any side products. b The reaction mixtures containing 20 mM L-
leucine, SDS-activated 9His-rsL-AAO1, and catalase in D O were incu-
2
bated for the indicated time periods at 30 °C and boiled. The supernatants
were investigated by proton NMR at room temperature. α-Keto leucine
free α-amino acids. However, K values were increased by a
m
factor of 6 and 3, respectively, by the presence of methyl
esters. These lower binding affinities indicate that the carbox-
yl group contributes to binding of the substrate. Hebeloma
cylindrosporum LAAO1 also converts L-phenylalanine and
L-phenylalanine methyl ester with similar relative activities
(4-methyl-2-oxovaleric acid) was obtained in high purity without any side
products. Characteristic peaks for leucine are at 3.7 ppm (hydrogen at α-
carbon) and at 1.6 and 1.7 ppm (hydrogens at β- and γ-carbon). In α-keto
leucine, the peak at 2.5 ppm is due to hydrogens at β-carbon and at
(Nuutinen et al. 2012). However, neither a L-AAO from the
2
.1 ppm caused by the hydrogen at the γ-carbon
fungus Neurospora crassa (division Ascomycota, Thayer and
Horowitz 1951) nor L-AAO from the bacterium R. opacus
(Geueke and Hummel 2002) is able to react with methyl esters
heterologous expression of R. opacus L-AAO in crude extracts
from S. lividans (Geueke and Hummel 2003). However, even
higher activities are desirable for biocatalytic applications.
Purified MBP-rsLAAO1 and 9His-rsLAAO1 had very low
of amino acids. The L-AAO isolated from king cobra venom
could also convert L-leucine methyl ester, but the Km was
3.2 mM compared to 0.2 mM for L-leucine (Tan and
Saifuddin 1991). An extremely low activity towards methyl
ester was observed for the L-AAO from the venom of the rattle
−1
specific activities of 0.06–0.13 U mg , which could be in-
creased 50–100-fold by brief incubation with 1–2 mM SDS to
−1
snake Crotalus adamantus (0.006 U mg for Nε-CBZ-L-ly-
−1
−1
specific activities of 3–10 U mg depending on the substrate.
A similar effect of SDS was detected after the heterologous
expression of H. cylindrosporum LAAO1 in E. coli (Nuutinen
et al. 2012): no activity was observed without SDS, while
sine methyl ester compared to 0.405 U mg for Nε-CBZ-L-
lysine) (Hanson et al. 1992). The structures of R. opacus L-
AAO and snake venom L-AAO1 from Calloselasma
rhodostoma revealed that the amino acid substrate is bound
in a similar way in the active site. In both cases, the carboxyl
group of the substrate interacts with a guanidinium group of
an arginine residue, the hydroxyl group of a tyrosine residue,
and a water molecule coordinated by a lysine residue of the L-
−1
specific L-AAO activities of 6–14 U mg were measured after
SDS treatment. However, L-AAO activity was detected in
crude mycelial extracts (Nuutinen and Timonen 2008) indi-
cating that the endogenous protein is produced in an active

Appl Microbiol Biotechnol
Floudas D, Binder M, Riley R, Barry K, Blanchette RA, Henrissat B,
Martinez AT, Otillar R, Spatafora JW, Yadav JS, Aerts A, Benoit I,
Boyd A, Carlson A, Copeland A, Coutinho PM, de Vries RP,
Ferreira P, Findley K, Foster B, Gaskell J, Glotzer D, Gorecki P,
Heitman J, Hesse C, Hori C, Igarashi K, Jurgens JA, Kallen N,
Kersten P, Kohler A, Kuees U, Kumar TKA, Kuo A, LaButti K,
Larrondo LF, Lindquist E, Ling A, Lombard V, Lucas S, Lundell T,
Martin R, McLaughlin DJ, Morgenstern I, Morin E, Murat C, Nagy
LG, Nolan M, Ohm RA, Patyshakuliyeva A, Rokas A, Ruiz-Duenas
FJ, Sabat G, Salamov A, Samejima M, Schmutz J, Slot JC, John FS,
Stenlid J, Sun H, Sun S, Syed K, Tsang A, Wiebenga A, Young D,
Pisabarro A, Eastwood DC, Martin F, Cullen D, Grigoriev IV,
Hibbett DS (2012) The Paleozoic origin of enzymatic lignin decom-
position reconstructed from 31 fungal genomes. Science 336:1715–
AAO (Faust et al. 2007; Moustafa et al. 2006). These three
amino acid residues are conserved in R. solani L-AAO1.
Differences in the conversion of the amino acid methyl esters
must be due to minor differences in the active site. The ability
to accept methyl esters of amino acids is a very interesting
property for biocatalytic applications because α-keto acids
are less stable than their corresponding esters.
Acknowledgements We thank Denise Weinberg and Thomas Geisler
for excellent technical assistance.
Compliance with ethical standards
1
719. doi:10.1126/science.1221748
Geueke B, Hummel W (2002) A new bacterial L-amino acid oxidase with a
broad substrate specificity: purification and characterization. Enzym
Microb Technol 31:77–87. doi:10.1016/s0141-0229(02)00072-8
Geueke B, Hummel W (2003) Heterologous expression of Rhodococcus
opacus L-amino acid oxidase in Streptomyces lividans. Protein Expr
Purif 28:303–309. doi:10.1016/s1046-5928(02)00701-5
Funding This study was funded by Deutsche Forschungsgemeinschaft
(grant number KO3580/4-1).
Conflict of interest The authors declare that they have no conflict of
interest.
Hanson RL, Bembenek KS, Patel RN, Szarka LJ (1992) Transformation
of N-epsilon-CBZ-L-lysine to CBZ-L-oxylysine using L-amino-
acid oxidase from Providencia-alcalifaciens and L-2-hydroxy-
isocaproate dehydrogenase from Lactobacillus-confusus. Appl
Microbiol Biotechnol 37:599–603
Ethical approval This article does not contain any studies with human
participants or animals performed by any of the authors.
Hossain GS, Li J, Shin H-d, Du G, Liu L, Chen J (2014) L-Amino acid
oxidases from microbial sources: types, properties, functions, and
applications. Appl Microbiol Biotechnol 98:1507–1515.
doi:10.1007/s00253-013-5444-2
References
Kapust RB, Waugh DS (1999) Escherichia coli maltose-binding protein
is uncommonly effective at promoting the solubility of polypeptides
to which it is fused. Protein Sci 8:1668–1674
Kasai K, Hashiguchi K, Takahashi H, Kasai A, Takeda S, Nakano M,
Ishikawa T, Nakamura T, Miura T (2015) Recombinant production
and evaluation of an antibacterial l-amino acid oxidase derived from
flounder Platichthys stellatus. Appl Microbiol Biotechnol 99:6693–
Bender AE, Krebs HA (1950) The oxidation of various synthetic alpha-
amino-acids by mammalian D-amino-acid oxidase, L-amino-acid
oxidase of cobra venom and the L-amino-acid and D-amino-acid
oxidases of Neurospora-crassa. Biochem J 46:210–219
Bifulco D, Pollegioni L, Tessaro D, Servi S, Molla G (2013) A thermo-
stable L-aspartate oxidase: a new tool for biotechnological applica-
tions. Appl Microbiol Biotechnol 97:7285–7295. doi:10.1007
6
703. doi:10.1007/s00253-015-6428-1
Laemmli UK (1970) Cleavage of structural proteins during the assembly
of the head of bacteriophage T4. Nature 227:680–685
/s00253-013-4688-1
Bradford MM (1976) Rapid and sensitive method for quantitation of
microgram quantities of protein utilizing principle of protein-dye
binding. Anal Biochem 72:248–254. doi:10.1006/abio.1976.9999
Cheng CH, Yang CA, Liu SY, Lo CT, Huang HC, Liao FC, Peng KC
Liu L, Hossain GS, Shin HD, Li JH, GC D, Chen J (2013) One-step
production of alpha-ketoglutaric acid from glutamic acid with an
engineered L-amino acid deaminase from Proteus mirabilis. J
Biotechnol 164:97–104. doi:10.1016/j.jbiotec.2013.01.005
Moore BM, Flurkey WH (1990) Sodium dodecyl-sulfate activation of a
plant polyphenoloxidase - effect of sodium dodecyl-sulfate on en-
zymatic and physical characteristics of purified broad bean
polyphenoloxidase. J Biol Chem 265:4982–4988
(2011) Cloning of a novel L-amino acid oxidase from Trichoderma
harzianum ETS 323 and bioactivity analysis of overexpressed L-
amino acid oxidase. J Agric Food Chem 59:9142–9149.
doi:10.1021/jf201598z
Cubeta MA, Thomas E, Dean RA, Jabaji S, Neate SM, Tavantzis S, Toda
T, Vilgalys R, Bharathan N, Fedorova-Abrams N, Pakala SB, Pakala
SM, Zafar N, Joardar V, Losada L, Nierman WC (2014) Draft ge-
nome sequence of the plant-pathogenic soil fungus Rhizoctonia
solani anastomosis group 3 strain Rhs1AP. Genome announcements
Moustafa IM, Foster S, Lyubimov AY, Vrielink A (2006) Crystal struc-
ture of LAAO from Calloselasma rhodostoma with an L-
phenylalanine substrate: insights into structure and mechanism. J
Mol Biol 364:991–1002. doi:10.1016/j.jmb.2006.09.032
Nakai K, Horton P (1999) PSORT: a program for detecting sorting signals
in proteins and predicting their subcellular localization. Trends
Biochem Sci 24:34–35. doi:10.1016/s0968-0004(98)01336-x
Nuutinen JT, Marttinen E, Soliymani R, Hilden K, Timonen S (2012) L-
Amino acid oxidase of the fungus Hebeloma cylindrosporum dis-
plays substrate preference towards glutamate. Microbiology 158:
272–283. doi:10.1099/mic.0.054486-0
Nuutinen JT, Timonen S (2008) Identification of nitrogen mineralization
enzymes, L-amino acid oxidases, from the ectomycorrhizal fungi
Hebeloma spp. and Laccaria bicolor. Mycol Res 112:1453–1464.
doi:10.1016/j.mycres.2008.06.023
Petersen TN, Brunak S, von Heijne G, Nielsen H (2011) SignalP 4.0:
discriminating signal peptides from transmembrane regions. Nat
Meth 8:785–786. doi:10.1038/nmeth.1701
2
. doi:10.1128/genomeA.01072-14
Espin JC, Wichers HJ (1999) Activation of a latent mushroom (Agaricus
bisporus) tyrosinase isoform by sodium dodecyl sulfate (SDS).
Kinetic properties of the SDS-activated isoform. J Agric Food
Chem 47:3518–3525. doi:10.1021/jf981275p
Faust A, Niefind K, Hummel W, Schomburg D (2007) The structure of a
bacterial (L)-amino acid oxidase from Rhodococcus opacus gives
new evidence for the hydride mechanism for dehydrogenation. J
Mol Biol 367:234–248. doi:10.1016/j.jmb.2006.11.071
Ferrer M, Chernikova TN, Timmis KN, Golyshin PN (2004) Expression
of a temperature-sensitive esterase in a novel chaperone-based
Escherichia coli strain. Appl Environ Microbiol 70:4499–4504.
doi:10.1128/aem.70.8.4499-4504.2004

Appl Microbiol Biotechnol
Pollegioni L, Molla G (2011) New biotech applications from evolved D-
amino acid oxidases. Trends Biotechnol 29:276–283. doi:10.1016/j.
tibtech.2011.01.010
Pollegioni L, Motta P, Molla G (2013) L-Amino acid oxidase as biocat-
alyst: a dream too far ? Appl Microbiol Biotechnol 97:9323–9341
Tan NH, Saifuddin MN (1991) Substrate-specificity of king cobra
snake venom L-amino acid oxidases. Biochem Biophys Res Com
421:124–128. doi:10.1016/j.bbrc.2012.03.129
Vanboven A, Tan PST, Konings WN (1988) Purification and characteri-
zation of a dipeptidase from Streptococcus-cremoris Wg2. Appl
Environ Microbiol 54:43–49
Whitby LG (1953) A new method for preparing flavin-adenine dinucle-
otide. Biochem J 54(3):437–442
Wittenberg C, Triplett EL (1985) A detergent-activated tyrosinase from
Xenopus-laevis .2. Detergent activation and binding. J Biol Chem
(
Ophiophagus-hannah) venom L-amino-acid oxidase. Int J
Biochem 23:323–327
Tang JD, Perkins AD, Sonstegard TS, Schroeder SG, Burgess SC, Diehl
SV (2012) Short-read sequencing for genomic analysis of the brown
rot fungus Fibroporia radiculosa. Appl Environ Microbiol 78:
2
60:2542–2546
Zhang HM, Teng M, Niu LW, Wang YB, Wang YZ, Liu Q, Huang QQ,
Hao Q, Dong YH, Liu P (2004) Purification, partial characterization,
crystallization and structural determination of AHP-LAAO, a novel
L-amino-acid oxidase with cell apoptosis-inducing activity from
Agkistrodon halys pallas venom. Acta Crystallog Sect D 60:974–
2
272–2281. doi:10.1128/aem.06745-11
Tashiro Y, Rodriguez GM, Atsumi S (2015) 2-Keto acids based biosyn-
thesis pathways for renewable fuels and chemicals. J Ind Microbiol
Biotechnol 42:361–373. doi:10.1007/s10295-014-1547-8
Thayer PS, Horowitz NH (1951) The L-amino acid oxidase of
9
77. doi:10.1107/s0907444904000046
Neurospora. J Biol Chem 192:755–767
Tong HC, Chen W, Shi WY, Qi FX, Dong XZ (2008) SO-LAAO, a novel
L-amino acid oxidase that enables Streptococcus oligofermentans to
outcompete Streptococcus mutans by generating H O from pep-
2 2
tone. J Bacteriol 190:4716–4721. doi:10.1128/jb.00363-08
Ullah A, Souza TACB, Abrego JRB, Betzel C, Murakami MT, Arni RK
Zhou MJ, Diwu ZJ, PanchukVoloshina N, Haugland RP (1997) A stable
nonfluorescent derivative of resorufin for the fluorometric determi-
nation of trace hydrogen peroxide: applications in detecting the ac-
tivity of phagocyte NADPH oxidase and other oxidases. Anal
Biochem 253:162–168. doi:10.1006/abio.1997.2391
(
2012) Structural insights into selectivity and cofactor binding in