Discovery and antiproliferative evaluation of new quinoxalines as potential DNA intercalators and topoisomerase II inhibitors

Article abstract of DOI:10.1002/ardp.201900123

In continuation of our previous work on the design and synthesis of topoisomerase II (Topo II) inhibitors and DNA intercalators, a new series of quinoxaline derivatives were designed and synthesized. The synthesized compounds were evaluated for their cytotoxic activities against a panel of three cancer cell lines (Hep G-2, Hep-2, and Caco-2). Compounds 18b, 19b, 23, 25b, and 26 showed strong potencies against all tested cell lines with IC₅₀ values ranging from 0.26 ± 0.1 to 2.91 ± 0.1 μM, comparable with those of doxorubicin (IC₅₀ values ranging from 0.65 ± 0.1 to 0.81 ± 0.1 μM). The most active compounds were further evaluated for their Topo II inhibitory activities and DNA intercalating affinities. Compounds 19b and 19c exhibited high activities against Topo II (IC₅₀ = 0.97 ± 0.1 and 1.10 ± 0.1 μM, respectively) and bound the DNA at concentrations of 43.51 ± 2.0 and 49.11 ± 1.8 μM, respectively, whereas compound 28b exhibited a significant affinity to bind the DNA with an IC₅₀ value of 37.06 ± 1.8 μM. Moreover, apoptosis and cell-cycle tests of the most promising compound 19b were carried out. It was found that 19b can significantly induce apoptosis in Hep G-2 cells. It has revealed cell-cycle arrest at the G2/M phase. Moreover, compound 19b downregulated the Bcl-2 levels, indicating its potential to enhance apoptosis. Furthermore, molecular docking studies were carried out against the DNA–Topo II complex to examine the binding patterns of the synthesized compounds.

Full text of DOI:10.1002/ardp.201900123

Received: 18 April 2019
Revised: 25 July 2019
Accepted: 26 July 2019
|
|
DOI: 10.1002/ardp.201900123
F U L L P A P E R
Discovery and antiproliferative evaluation of new
quinoxalines as potential DNA intercalators and
topoisomerase II inhibitors
Ibrahim H. Eissa1
Rezk R. Ayyad1
Kamal M.A. El‐Gamal7
Mostafa. A. Elhendawy9
|
Ahmed M. Metwaly2
Khaled El‐Adl1,6 Hazem A. Mahdy1
Mohamad E. El‐Sawah7 Souad A. Elmetwally8
Mohamed M. Radwan9,10 Mahmoud A. ElSohly9,11
|
Amany Belal3,4
|
Ahmed B.M. Mehany5
|
|
|
|
Mohammed S. Taghour1
|
|
|
|
|
|
1Pharmaceutical Medicinal Chemistry Department, Faculty of Pharmacy (Boys), Al‐Azhar University, Cairo, Egypt
2Department of Pharmacognosy, Faculty of Pharmacy (Boys), Al‐Azhar University, Cairo, Egypt
3Department of Medicinal Chemistry, Faculty of Pharmacy, Beni‐Suef University, Beni‐Suef, Egypt
4Department of Pharmaceutical Chemistry, College of Pharmacy, Taif University, Taif, Saudi Arabia
5Department of Zoology, Faculty of Science, Al‐Azhar University, Cairo, Egypt
6Department of Pharmaceutical Chemistry, Faculty of Pharmacy and Drug Technology, Heliopolis University for Sustainable Development, Cairo, Egypt
7Department of Pharmaceutical Organic Chemistry, Faculty of Pharmacy (Boys), Al‐Azhar University, Cairo, Egypt
8Department of Basic Science, Higher Technological Institute, 10th of Ramadan City, Egypt
9National Center for Natural Products Research, University of Mississippi, Mississippi
10Department of Pharmacognosy, Faculty of Pharmacy, Alexandria University, Alexandria, Egypt
11Department of Pharmaceutics and Drug Delivery, University of Mississippi, Mississippi, Mississippi
Correspondence
Abstract
Ibrahim H. Eissa, Pharmaceutical Medicinal
Chemistry Department, Faculty of Pharmacy
In continuation of our previous work on the design and synthesis of topoisomerase II (Topo
II) inhibitors and DNA intercalators, a new series of quinoxaline derivatives were designed
and synthesized. The synthesized compounds were evaluated for their cytotoxic activities
against a panel of three cancer cell lines (Hep G‐2, Hep‐2, and Caco‐2). Compounds 18b,
19b, 23, 25b, and 26 showed strong potencies against all tested cell lines with IC50 values
ranging from 0.26 0.1 to 2.91 0.1 µM, comparable with those of doxorubicin (IC50
values ranging from 0.65 0.1 to 0.81 0.1 µM). The most active compounds were further
evaluated for their Topo II inhibitory activities and DNA intercalating affinities.
Compounds 19b and 19c exhibited high activities against Topo II (IC50 = 0.97 0.1 and
1.10 0.1 µM, respectively) and bound the DNA at concentrations of 43.51 2.0 and
49.11 1.8 µM, respectively, whereas compound 28b exhibited a significant affinity to
bind the DNA with an IC50 value of 37.06 1.8 µM. Moreover, apoptosis and cell‐cycle
tests of the most promising compound 19b were carried out. It was found that 19b can
significantly induce apoptosis in Hep G‐2 cells. It has revealed cell‐cycle arrest at the G2/M
phase. Moreover, compound 19b downregulated the Bcl‐2 levels, indicating its potential to
enhance apoptosis. Furthermore, molecular docking studies were carried out against the
DNA–Topo II complex to examine the binding patterns of the synthesized compounds.
(Boys), Al‐Azhar University, Cairo 11884,
Egypt.
Email: Ibrahimeissa@azhar.edu.eg
Mahmoud A. ElSohly, National Center for
Natural Products Research, University of
Mississippi, MS 38677, USA.
Email: mmelsohly@olemiss.edu
K E Y W O R D S
anticancer, apoptosis, DNA intercalator, molecular docking, quinoxalines, topoisomerase II
|
Arch Pharm Chem Life Sci. 2019;e1900123.
wileyonlinelibrary.com/journal/ardp © 2019 Deutsche Pharmazeutische Gesellschaft
1 of 22
https://doi.org/10.1002/ardp.201900123

2 of 22
EISSA ET AL.
|
|
1
INTRODUCTION
Quinoxaline nucleus is the backbone of many bioactive com-
pounds,[19–21] some of them have anticancer activities.[22] The
discovery and development of new therapeutic DNA intercalators
for the treatment of cancer are considered one of the most important
targets in the field of medicinal chemistry.[23] Quinoxaline analogs
exhibited excellent anticancer activities through DNA intercalation.
For instance, echinomycin 6, a natural DNA intercalator, showed
potent activities in phase I and II trials against a wide array of
cancer.[24] Moreover, compound 7 was previously synthesized by our
team and exhibited excellent Topo II inhibitory activity and DNA‐
binding affinity with the induction of apoptosis in Caco‐2 cells.[25]
On the basis of the earlier findings and in continuation of our
previous efforts in the design and synthesis of new anticancer
agents,[26–29] especially Topo II inhibitors and DNA intercalators,[25,30,31]
we report the design, synthesis, DNA‐binding, and docking studies of a
new series of quinoxaline derivatives. These derivatives were designed
based on the main pharmacophoric features of DNA intercalators.
According to the WHO fact sheet, published in October 2018, cancer
is the second leading cause of death all over the world, accounting for
9.6 million deaths in 2018. The number of affected persons over the
next 20 years is expected to increase by around 70%.[1] Anticancer
drugs have been classified into two types: the first one is drugs that
affect DNA, RNA, or proteins. The second target includes other
elements involved in the carcinogenesis process, such as the immune
system, the endothelium, and the extracellular matrix.[2] Molecules
that affect DNA include groove binders, alkylating agents, DNA
intercalators, and topoisomerase inhibitors.[3]
Topoisomerases are important nuclear enzymes, which play
a
crucial role in DNA replication, transcription, chromosome
segregation, and recombination.[4] There are two major types of
topoisomerases. (a) Topoisomerase I (Topo I), which is responsible
for cleavage, relaxing, and releasing of one strand of the DNA
duplex. (b) Topoisomerase II (Topo II), which cleaves both strands of
the DNA helix simultaneously to remove DNA supercoiling.[5] These
enzymes covalently bind to DNA via tyrosine residues in the active
site. These linkages are transient and easily reversible, and the
covalently bound structure is known as the cleavable complex.[6]
Accordingly, topoisomerases are considered as important targets
for cancer chemotherapy treatments.[7] Topoisomerase inhibitors
block the ligation step of the cell‐cycle, generating single‐ and
double‐stranded breaks that harm the integrity of the genome.[8]
Introduction of these breaks subsequently leads to apoptosis and
cell death.[9]
|
1.1
The rationale of the molecular design
A study of the structure–activity relationships (SAR) and binding
pattern of DNA intercalators revealed that they shared three main
features: (a) A planar polyaromatic system, which involves three or
four fused rings (chromophore) binding with DNA. The chromophore
is oriented with its long axis perpendicular to the long axis of the
adjacent base pairs.[32] Once the intercalator has been sandwiched
between the DNA base pairs, the stability of the complex is
optimized by a number of noncovalent interactions, including the
van der Waals and π‐stacking interactions.[33] (b) Cationic species,
which increase the efficiency of DNA intercalators by interaction
with the negatively charged DNA sugar‐phosphate backbone. The
cationic species are basic groups (e.g., amino or nitrogen‐containing
heterocyclic groups) that can be protonated under physiological
pH[15] (Figure 1). (c) Groove‐binding side chain, which can occupy the
minor groove of DNA.[34–36]
Some anticancer drugs targeting Topo II inhibit the enzymatic
activity as a primary mode of action and are known as catalytic Topo
II inhibitors.[10] Another type of Topo II‐targeting drugs, including
intercalating drugs, interfere with the enzyme’s cleavage and
rejoining activities by trapping the cleavable complex and thereby
increasing the half‐life of the transient Topo II‐catalyzed DNA breaks.
These drugs are referred to as Topo II poisons because they convert
the Topo II enzyme into a DNA‐damaging agent.[7,10]
The rationale of our molecular design depended on the lead
modification of our previously synthesized compound 7 through the
generation of two scaffolds of [1,2,4]triazolo[4,3‐a]quinoxaline
derivatives. The scaffold 1 was 4‐sulfanyl‐[1,2,4]triazolo[4,3‐a]qui-
noxaline moiety with a groove‐binding side chain at position‐4
(compounds 18a,b, 19a–c, 20, 21, 22, and 23) to act as classical DNA
intercalators. The scaffold 2 was 1‐sulfanyl‐[1,2,4]triazolo[4,3‐a]‐
quinoxalin‐4(5H)‐one moiety with two groove‐binding side chains at
positions 1 and 4 (compounds 24a–g, 25a–d, 26, 27, and 28a,b) to act
as threading DNA intercalators. The choice of different substituents
was based on their relatively high lipophilicity to pass the nuclear
membranes aiming to have strong DNA intercalation.[37] Moreover,
the variability of substitutions enabled us to study the SAR of the
final compounds (Figure 3).
DNA intercalators as Topo II poisons are molecules that intercalate
between DNA base pairs. They have attracted particular attention due
to their promising antitumor activities.[11] Many intercalative Topo II
poisons are either used already as anticancer drugs or still under clinical
trials (e.g., doxorubicin 1,[12] amsacrine 3,[13] mitoxantrone 2,[14]
ellipticine 4,[15] and nogalamycin 5[16]; Figure 1). DNA intercalation is
the process by which compounds containing planar aromatic or
heteroaromatic ring systems are inserted between the adjacent base
pairs perpendicular to the axis of the DNA helix.[17]
Intercalating agents share common structural features, which
include planar polyaromatic system linked to a groove‐binding side
chain in addition to one or more cationic species[15] (Figure 1). The
presence of two groove‐binding side chains, as in case of nogalamycin
5, which contains two sugar moieties at both ends of its chromophore
leads to a special type of interaction with DNA called threading
intercalation, in which one sugar unit is oriented to the minor groove
and the other to the major groove of DNA[18] (Figure 2).
In general, the synthesized compounds were evaluated for their
in vitro antiproliferative activities against hepatocellular carcinoma
(Hep G‐2), human laryngeal carcinoma (Hep‐2), and colorectal
adenocarcinoma (Caco‐2) cell lines. The results prompted further

EISSA ET AL.
3 of 22
|
FIGURE 1 Some reported DNA intercalators and their basic pharmacophoric features
examinations to reach a deep insight into the mechanism of action.
First, the most cytotoxic agents were further examined as potential
Topo II inhibitors. Second, these compounds were evaluated to
assess their binding affinities against DNA through DNA/methyl
green assay. Third, the effect of the most active compound 19b on
apoptosis and cell cycle was investigated in Hep G‐2 cell line. Fourth,
gene expression analysis was done for compound 19b in Hep G‐2 cell
line to determine the affected genes. Finally, molecular docking was
carried out to examine the binding patterns with the prospective
target, DNA–Topo II complex (PDB‐code: 4G0U).
reacted with oxalic acid 9 in the presence of 4 N HCl to give 1,4‐
dihydroquinoxaline‐2,3‐dione 10.[38] The latter was treated with
thionyl chloride to afford 2,3‐dichloroquinoxaline 11.[38] Treatment
of the 2,3‐dichloroquinoxaline with hydrazine hydrate with contin-
uous stirring at room temperature produced 2‐chloro‐3‐hydrazinyl-
quinoxaline 12.[39] Cyclization of 12 was carried out by heating with
triethylorthoformate to give 4‐chloro[1,2,4]triazolo[4,3‐a]quinoxaline
13.[39] The reaction of 13 with thiourea in absolute alcohol with
subsequent treatment with 10% KOH followed by acidification using
conc. HCl produced [1,2,4]triazolo[4,3‐a]quinoxaline‐4‐thiol 14.[40]
Compound 15,[40] the potassium salt of 14, was prepared by
treatment of 14 with alc. KOH. 1H NMR spectrum of 15 revealed
the disappearance of exchangeable proton signals, in addition to the
presence of a sharp singlet aromatic proton corresponding the
methine group, which attached to two N‐atoms; 13C and distortion-
less enhancement by polarization transfer (DEPT)‐135 spectra of
15 showed an aromatic peak for the same group. On the contrary,
|
2
RESULTS AND DISCUSSION
Chemistry
|
2.1
For the synthesis of the title compounds, the sequence of the
reactions is illustrated in Schemes 1–3. o‐Phenylenediamine
8

4 of 22
EISSA ET AL.
|
FIGURE 2 Schematic representation of
the classical and threading DNA
intercalation
compound 12 was allowed to react with CS2 with the presence of
KOH in absolute ethanol followed by acidification using diluted HCl
(10%) to afford compound 16. The dipotassium salt of 1‐sulfanyl‐
[1,2,4]triazolo[4,3‐a]quinoxalin‐4(5H)‐one 17 was prepared by heat-
ing compound 15 in alc. KOH solution (Scheme 1). The infrared (IR)
spectrum of compound 16 demonstrated the stretching bands at
3,264, 2,550, and 1,693 cm−1 corresponding to NH, SH, and C═O,
respectively.
corresponding to the SCH2 protons. On the contrary, 13C NMR and
DEPT‐135 spectra of 18a,b, 19a–c, 20, 21, 22, and 23 show a
characteristic peak for a deshielded methylene group corresponding to
SCH2 carbon. Also 13C data reveals the presence of an ester and an
amide carbonyl signals in the spectra of 18a and b and the existence of
an amide carbonyl signal in the spectra of 19a–c, 20, 21, and 22,
whereas 13C spectra of compound 23 showed the presence of a
ketone and an amide carbonyl signals. All those carbonyl signals seems
to have disappeared in the DEPT‐135 spectra.
The potassium salt 15 was treated with the appropriate
2‐chloroacetamido or 3‐chloropropanamido derivatives namely,
4‐(2‐chloroacetamido)benzoic acid and ethyl 4‐(2‐chloroacetamido)‐
benzoate, 2‐chloro‐N‐(4‐sulfamoylphenyl)acetamide, 2‐chloro‐N‐(4‐(N‐
(pyridin‐2‐yl)sulfamoyl)phenyl) acetamide, and 2‐chloro‐N‐(4‐(N‐(thia-
zol‐2‐yl)sulfamoyl)phenyl)acetamide, 3‐chloro‐N‐(4‐sulfamoylphenyl)‐
propanamide, 3‐chloro‐N‐(4‐sulfamoylphenyl)propanamide, 2‐chloroa-
cetamide, and N‐(4‐acetylphenyl)‐2‐chloroacetamide in dry N,N‐
dimethylformamide (DMF) in the presence of KI as a catalyst to
afford the corresponding compounds 18a,b, 19a–c, 20, 21, 22, and 23,
respectively (Scheme 2). The IR spectra of these compounds
demonstrated stretching bands at a range of 3,185–3,324 cm−1
corresponding to the NH amide groups, and other bands at a range of
1,672–1,691 cm−1 corresponding to C═O amide groups. In addition,
the presence of NH2 absorption bands at a range of 3180–3197 cm−1
for compounds 19a, 20, 21, and 22. 1H NMR spectra of these
compounds showed characteristic D2O exchangeable signals at a
range of 10.00–10.86 ppm corresponding to the NH amide groups, in
addition to the presence of characteristic D2O exchangeable signals at
a range of 7.20–7.30 ppm corresponding to the NH2 groups of
compounds 19a, 20, 21, and 22. Moreover, 1H NMR spectra showed
singlet signals of aliphatic protons at a range of 4.13–4.45 ppm
The dipotassium salt 17 was allowed to react with the different
alkyl halids namely, methyl bromide, ethyl bromide, n‐butyl bromide,
n‐hexyl, n‐decyl bromide, allyl bromide, and benzyl bromide in dry
DMF in the presence of KI as a catalyst to afford the corresponding
target compounds 24a−g, respectively. Moreover, compound 17
was further treated with the appropriate 2‐chloroacetate or
2‐chloropropanoate derivatives namely, methyl 2‐chloroacetate,
ethyl 2‐chloroacetate, isopropyl 2‐chloroacetate, and isobutyl 2‐
chloroacetate and methyl 2‐chloropropanoate in dry DMF in the
presence of KI as
a catalyst to give the corresponding title
compounds 25a–d, 26, respectively. The IR spectra of compounds
25a–d and 26 demonstrated the stretching bands at 1,734 and
1,742 cm−1 corresponding to C═O groups of esters. Moreover, 1H
NMR of these compounds showed disappearance of the SH signal
and appearance of aliphatic signal in the aliphatic region. Finally, the
dipotassium salt 17 reacted with the appropriate 2‐chloroacetamido
derivatives namely, 4‐(2‐chloroacetamido)benzoic acid 2‐chloro‐N‐
(4‐sulfamoylphenyl)acetamide and 2‐chloro‐N‐(4‐(N‐(pyridin‐2‐yl)sul-
famoyl)phenyl)acetamide in dry DMF to produce the corresponding
final compounds 27 and 28a,b, respectively (Scheme 3). The IR
spectra of compounds 27 and 28a,b demonstrated stretching bands

EISSA ET AL.
5 of 22
|
FIGURE 3 Rationale of the molecular design of new DNA intercalators
at 1,685, 1,675, and 1,687 cm−1 corresponding to the C═O groups
of these compounds, respectively. Moreover, 1H NMR of these
compounds showed exchangeable signals at a range of 10.53–10.98
ppm corresponding to the NH groups. The structures of all newly
synthesized compounds were confirmed under the basis of spectral
and elemental analyses, which were in full agreement with the
proposed structures. On the contrary, 13C NMR and DEPT‐135
carbonyl signal in the spectra of 24a–g and the existence of an amide
and two ester carbonyl signals in the spectra of 25a–d and 26,
whereas 13C NMR spectra of compound 27 and 28a,b showed the
presence of three amide carbonyl signals. All those carbonyl signals
seem to have disappeared in the DEPT‐135 spectra.
|
2.2
2.2.1
Biological evaluation
spectra of 24b–g, 25a–d, 27, and 28a,b show a characteristic peak
for a deshielded methylene group corresponding to the SCH2 carbon.
Also, 13C NMR and DEPT‐135 spectra of 26 show a characteristic
peak for a deshielded methine group corresponding to the SCH
carbon. In addition, 13C data reveals the presence of an amide
|
In vitro antiproliferative activities
The synthesized compounds were tested for their antiproliferative
activities against three different cancer cell lines: hepatocellular
carcinoma (Hep G‐2), human laryngeal carcinoma (Hep‐2), and

6 of 22
EISSA ET AL.
|
SCHEME 1 General procedure for the preparation of target compounds 15–17
colorectal adenocarcinoma (Caco‐2). Neutral red assay protocol was
used in this test as described by Borenfreund and Puerner.[41]
Doxorubicin was used as a positive control. The IC50 values of the
synthesized compounds against the aforementioned cell lines are
summarized in Table 1.
In addition, the compounds 19c, 21, 24b, 24c, 24f, and 24g showed
superior antiproliferative activities against two tumor cell lines with IC50
values ranging from 0.96 0.1 to 4.79 0.1 μM. Moreover, compounds
18a, 19a, 24e, 25c, 25d, 27, and 28a were found to possess moderate
antiproliferative activities toward at least two cell lines with IC50 values
ranging from 8.54 0.2 to 18.39 0.8 µM.
The results revealed that most of the synthesized compounds
exhibited excellent, modest, or weak antiproliferative activities
against the three cell lines. Overall, compounds 16, 18b, 19b, 22,
23, 24a, 25a, 25b, 26, and 28b showed excellent antiproliferative
activities against all tested cancer cell lines with IC50 values ranging
from 0.26 to 5.26 µM.
Finally, few compounds were found to possess weak antiproli-
ferative activities against one or two cell lines with IC50 values
ranging from 26.63 0.2 to 41.52 0.2 μM.
|
2.2.2
Topoisomerase II inhibitory activity
In particular, compounds 18b, 19b, 23, 25b, and 26 were found to
be the most potent members. Compound 18b was 1.38, 0.47, and
0.36 times as active as doxorubicin against Hep G‐2 (IC50 = 0.55 0.1
µM), Hep‐2 (IC50 = 1.37 0.2 µM), and Caco‐2 (IC50 = 2.23 0.1 µM),
respectively. For compound 19b, it was 1.52, 0.86, and 0.27 times as
active as doxorubicin against Hep G‐2 (IC50 = 0.50 0.1 µM), Hep‐2
Twelve compounds showing the highest cytotoxic activities (16, 18b,
19b, 19c, 22, 23, 24a, 25a, 25b, 26, 27, and 28b) were further
examined as Topo II inhibitors, according to the reported method
described by Furet et al.[42] Doxorubicin was also tested using the
same procedure as
a positive control. The IC50 values were
(IC50 = 0.75
respectively. Compound 23 was 2.37, 2.50, and 0.40 times as active
as doxorubicin against Hep G‐2 (IC50 = 0.32 0.1 µM), Hep‐2 (IC50
0.26 0.1 µM), and Caco‐2 (IC50 = 1.99 0.1 µM), respectively.
Compound 25b was 0.42, 0.58, and 0.57 times as active as
doxorubicin against Hep G‐2 (IC50 = 1.79 0.1 µM), Hep‐2 (IC50
1.11 0.2 µM), and Caco‐2 (IC50 = 1.41 0.1 µM), respectively.
0.1 µM), and Caco‐2 (IC50 = 2.91
0.1 µM),
calculated from the concentration–inhibition response curve and
are summarized in Table 2.
=
As shown in Table 2, most of the tested compounds could
interfere with the Topo II activity. They exhibited good to moderate
inhibitory activities with IC50 values ranging from 0.97 0.1 to 5.07
0.7 µM. To a great extent, the reported results were in agreement
with the in vitro cytotoxicity activity. Among the active compounds,
compound 19b potently inhibited Topo II at a low IC50 value (0.97
0.1 µM). Also, compounds 16, 19c, 22, 23, 26, 27, and 28b possessed
low IC50 values (1.57 0.1, 1.10 0.1, 1.68 0.1, 1.12 0.2, 1.72
=
Compound 26 was 0.63, 0.31, and 1.35 times as active as doxorubicin
against Hep G‐2 (IC50 = 1.19 0.1 µM), Hep‐2 (IC50 = 2.08 0.2 µM),
and Caco‐2 (IC50 = 0.60 0.1 µM), respectively.

EISSA ET AL.
7 of 22
|
SCHEME 2 General procedure for the preparation of target compounds 18a,b, 19a–c, 20, 21, 22, and 23
0.1, 1.70 0.1, and 1.62 0.1 µM, respectively), compared with that
to evaluate their DNA‐binding affinities using the methyl
green dye according to the reported procedure described by
Burres et al.[43] The results of DNA‐binding affinity are reported
as IC50 values and summarized in Table 2. Doxorubicin, as one of
the most powerful DNA intercalators, was used as a positive
control.
of the reference drug, doxorubicin (IC50 0.94 0.1 µM). On the
=
contrary, some compounds showed moderate activities, such as
compounds 18b, 24a, 25a, and 25b (IC50 = 2.89 0.2, 3.06 0.4, 5.07
0.7, and 3.02 0.2 µM, respectively).
The tested compounds displayed moderate DNA‐binding affinities.
Compound 28b intercalated with DNA at an IC50 value of 37.06 1.8
µM, while compounds 16, 19b, 19c, 23, 24a, 26, and 27 exhibited IC50
values of 50.19 2.1, 43.51 2.0, 49.11 1.8, 45.32 2.2, 53.93 2.9,
53.35 3.4, and 51.32 1.9 µM, respectively. Finally, compounds 18b,
|
2.2.3
assay)
DNA intercalation assay (DNA/methyl green
The most active antiproliferative derivatives (16, 18b, 19b,
19c, 22, 23, 24a, 25a, 25b, 26, 27, and 28b) were selected

8 of 22
EISSA ET AL.
|
SCHEME 3 General procedure for the preparation of target compounds 24a–g, 25a–d, 26, 27, and 28a,b
22, 25a, and 25b showed higher IC50 values of 67.89 4.1, 77.62 4.5,
important role in controlling cell number and proliferation.[44] Flow
cytometric analysis is a rapid, reliable, and reproducible method that
allows estimation and analysis of cell‐cycle parameters of surviving
cells.[45] The most promising compound 19b was further evaluated
for its effect on the cell‐cycle progression and induction of apoptosis
in Hep G‐2 cell lines. In this test, 0.5 µM of compound 19b was added
to Hep G‐2 cells with incubation for 24 hr, and the effect of such
compound on the normal cell cycle and induction of apoptosis was
analyzed.[46]
65.65 3.9, to 59.81 3.7 µM, respectively.
|
2.2.4
Flow cytometric analysis of the cell cycle and
apoptosis
Apoptosis or programmed cell death is a major control mechanism by
which cells die if DNA damage exceeds the capacity of repair
mechanisms. As part of normal development, apoptosis plays an

EISSA ET AL.
9 of 22
|
TABLE 1 Antiproliferative activity of the synthesized compounds
toward Hep G‐2, Hep‐2, and Caco‐2 cell lines
TABLE 2 In vitro enzymatic inhibitory activities of the most active
compounds against Topo II and DNA intercalating affinity of the
tested compounds
IC50 (µM)a
Topo II inhibition
IC50 (µM)a
DNA intercalation
IC50 (µM)a
Compound
14
Hep G‐2
Hep‐2
Caco‐2
Compound
5.84 0.5
0.64 0.1
1.58 0.1
0.55 0.1
3.91 0.1
0.50 0.1
0.96 0.1
1.32 0.2
1.03 0.1
2.47 0.1
0.32 0.1
0.90 0.1
1.05 0.1
1.31 0.1
1.67 0.1
9.11 0.9
2.52 0.1
1.12 0.1
3.87 0.2
1.79 0.1
16.86 0.3
10.13 0.4
1.19 0.1
2.34 0.2
4.09 0.1
2.87 0.1
0.76 0.1
32.81 0.8
3.22 0.1
16.67 0.9
1.37 0.2
13.70 0.9
0.75 0.1
3.59 0.3
41.52 0.2
36.50 0.9
5.69 0.2
0.26 0.1
3.47 0.2
4.01 0.2
4.49 0.1
8.11 0.6
10.22 0.1
11.87 0.4
13.19 0.2
5.08 0.1
1.11 0.2
17.72 0.9
7.19 0.1
2.08 0.2
18.39 0.8
13.99 0.7
2.39 0.1
0.65 0.1
9.29 0.9
2.88 0.1
8.54 0.2
2.23 0.1
15.25 0.2
2.91 0.1
10.13 0.2
26.63 0.2
1.05 0.1
4.15 0.1
1.99 0.1
5.26 0.1
38.52 0.6
32.56 0.9
29.92 0.9
16.89 0.6
4.79 0.1
3.07 0.1
3.05 0.2
1.41 0.1
15.46 0.2
8.34 0.9
0.60 0.1
9.52 0.1
18.20 0.4
3.27 0.2
0.81 0.1
16
1.57 0.1
2.89 0.2
0.97 0.1
1.10 0.1
1.68 0.1
1.12 0.2
3.06 0.4
5.07 0.7
3.02 0.2
1.72 0.1
1.70 0.1
1.62 0.1
0.94 0.1
50.19 2.1
67.89 4.1
43.51 2.0
49.11 1.8
77.62 4.5
45.32 2.2
53.93 2.9
65.65 3.9
59.81 3.7
53.35 3.4
51.32 1.9
37.06 1.8
30.24 1.2
16
18b
19b
19c
22
18a
18b
19a
19b
19c
20
23
24a
25a
25b
26
21
22
23
27
24a
24b
24c
24d
24e
24f
28b
Doxorubicin
Abbreviation: SD, standard deviation.
aIC50 values are the mean SD of three separate experiments.
TABLE 3 Percentage of cell‐cycle phases and pre‐G1 apoptosis
upon treatment with compound 19b using Hep G‐2 cells
24g
25a
25b
25c
25d
26
Sample
G0–G1 (%) S (%)
G2–M (%) Pre‐G1 (%)
19b/Hep G‐2
40.16
52.31
14.77
31.38
45.07
16.31
14.18
2.04
Cont. Hep G‐2
(negative control)
27
28a
28b
Doxorubicin
|
2.2.5
Apoptosis induction
Annexin V/propidium iodide (PI) double‐staining assay method was
performed to investigate the mode of induced cell death in Hep G‐2
cells at pre‐G1 phase.[47] Hep G‐2 cells were treated with 0.5 µM of
compound 19b for 24 hr. In general, the total percentage of apoptosis
induced by the treatment of Hep G‐2 cells with compound 19b was
Abbreviation: SD, standard deviation.
aIC50 values are the mean SD of three separate experiments.
The exposure of Hep G‐2 cells to compound 19b resulted in an
interference with the normal cell‐cycle distribution, where 19b
induced the accumulation of cells in G2/M phase by about
threefolds (45.07%) and increased the percentage of cells in pre‐
G1 more than sevenfolds (14.18%) compared with the control
values (16.31% and 2.04%, respectively). Such an increase was
accompanied by a significant reduction in the percentage of cells
at the G0–G1 (40.16%) and S phases (14.77%) of the cell cycle
compared with the control (52.31% and 31.38%, respectively).
The accumulation of cells in pre‐G1 phase may have resulted
60
50
40
%G0-G1
%S
30
20
10
0
%G2-M
%Pre-G1
from the degradation of the genetic materials, indicating
a
possible role of apoptosis, while the accumulation of the cells in
G2/M phase may have resulted from the G2/M arrest (Table 3
and Figures 4 and 5). These findings revealed that apoptosis has a
pivotal role in the cancer cell death induced by the synthesized
compounds.
19b / HePG-2
Cont. HePG-2
FIGURE 4 Schematic diagram for the percentage of Hep G‐2 cells
in each phase and the apoptosis effect upon treatment with 0.5 µM
of compound 19b

10 of 22
EISSA ET AL.
|
FIGURE 5 Cell‐cycle analysis by flow cytometry: (a) control Hep G‐2 cell line (negative control) and (b) the effect of compound 19b on Hep
G‐2 cells
|
Gene expression analysis (RNA extraction
and real‐time RT‐PCR for tested genes)
13.53. In the early stage, it was found that there is an increase in the
percentage of apoptotic cells from 0.51% for control untreated cells to
4.25%, whereas in the late stage, there was an increase in the
apoptotic cells from 0.25% for control Hep G‐2 cells to 9.28%. From
the obtained results, we can deduce that compound 19b can induce
pre‐G1 apoptosis, as shown in Table 4 and Figures 6 and 7.
2.2.6
The gene expression pattern of compound 19b was examined against
the most sensitive cells (Hep G‐2). The results can provide an additional
insight into the possible molecular mechanisms of growth inhibition
caused by the synthesized compounds. In this test, two of the most
apoptosis‐related factors (Bcl‐2 and Bax genes) were determined. It was
reported that Bcl‐2 protein has an apoptosis resistance effect in
hepatocellular carcinoma, moreover, Bcl‐2 can inhibit apoptosis and
promote the tumorigenesis and chemoresistance processes.[48] On the
contrary, the Bax gene can permit the triggering of the apoptotic
pathway,[49] and the drugs that activate Bax hold promise as anticancer
agents by inducing apoptosis in cancer cells.[50]
TABLE 4 Percent of cell death induced by compound 19b on Hep
G‐2 cells
Apoptosis
Sample
Total Early
16.04 4.25
2.04 0.51
Late Necrosis
9.28 2.51
19b/Hep G‐2
Cont. Hep G‐2 (negative control)
0.25 1.28
The results shown in Table 5 and Figure 8 revealed that the
treatment of Hep G‐2 cells with compounds 19b reduced the
FIGURE 6 Flow cytometric assay with annexin V‐FITC/PI double staining. Hep G‐2 cells were treated with 0.5 µM of compound
19b for 24 hr, stained with annexin V‐FITC and PI, and then measured by flow cytometer. FITC, fluorescein isothiocyanate; PI, propidium
iodide

EISSA ET AL.
11 of 22
|
18
16
14
12
10
8
into the DNA‐binding site of Topo II (PDB ID: 4G0U). The binding
free energies (ΔG) are reported in Table 6. The negative values of
free energies indicate the spontaneous nature of binding of the
tested compound to the DNA–Topo II complex. The reported key
binding site of DNA–Topo II consists of amino acid and nucleotide
residues of Asp479, Arg503, Gln778, Met782 Cyt8, Thy9, Cyt11,
Gua13, and Ade12.[51]
Total
Early
Late
6
Necrosis
The proposed binding mode of doxorubicin showed an affinity
value equal to −82.10 kcal/mol. The planar aromatic system formed
13 aromatic stacking interactions with Ade12, Gua13, Cyt8, Thy9,
and Ala521. It formed three hydrogen bonds with Gua13, Arg503,
Lys505, and Lue502. The sugar moiety was oriented into the minor
groove of DNA. These data were in agreement with the reported
results[52] (Figure 9).
4
2
0
19b / HePG-2
cont.HepG2
FIGURE 7 Schematic diagram for the percentage of cell death
induced by compound 19b on Hep G‐2 cells
The proposed binding mode of amsacrine showed affinity value
equal to –55.56 kcal/mol and a root‐mean‐square deviation value of
1.01. The planar aromatic system formed 14 aromatic stacking
interactions with Ade12, Gua13, Cyt8, and Thy9. The methoxy group
formed a hydrogen bond with Gua13. The NH group formed a
hydrogen bond with Glu522. N‐(3‐Methoxyphenyl)methanesulfona-
mide side‐chain provided secondary interactions with the DNA minor
groove (Figure 10).
TABLE 5 RT‐PCR in gene expression of Bcl‐2 and Bax genes of
Hep G‐2 cells treated with compound 19b
Gene
Bcl‐2
Bax
Control
332.82
947.51
Regulationa/19b
Effect
117.52
Downregulated
Downregulated
472.19
aThree independent experiments were performed.
The obtained results indicated that most of the studied ligands
have similar position and orientation inside the putative binding site
of doxorubicin and amsacrine. The designed molecules showed
binding energies ranging from −34.44 to −65.47 kcal/mol (Table 6).
The proposed binding mode of compound 19b showed an affinity
value of −50.01 kcal/mol. It exhibited a mode of classical intercala-
tion with DNA. It showed one hydrogen bond interaction between
the NH group of acetamide moiety and Glu522. In addition, the
planar aromatic system ([1,2,4]triazolo[4,3‐a]quinoxaline) formed 14
aromatic stacking interactions with Ade12, Gua13, Cyt8, and Thy9.
expression levels of the anti‐apoptotic protein Bcl‐2 from 332.82
(control untreated cells) to 117.52. The ability of these compounds to
downregulate Bcl‐2 level, emphasizes its potential to enhance
apoptosis. Also, it was found that compound 19b downregulated
the Bax gene.
|
2.3
Molecular docking
Docking studies
|
2.3.1
TABLE 6 The calculated ΔG (binding free energies) of the
synthesized compounds and reference drugs against
DNA–topoisomerase II complex
In this study, molecular docking investigational study was performed
for the synthesized compounds and two reference DNA intercalators
(doxorubicin and amsacrine). This study was carried out to gain
further insight into the binding modes of the synthesized compounds
Compound
14
ΔG (kcal/mol)
−47.57
−48.31
−55.49
−51.62
−48.68
−50.01
−51.44
−50.82
−48.38
−38.04
−55.00
−34.44
−37.01
−37.88
Compound
24d
ΔG (kcal/mol)
−40.30
−50.33
−35.40
−45.11
−47.45
−50.98
−51.00
−52.12
−46.15
−63.13
−65.47
−60.01
−82.10
−55.56
16
24e
1000
900
800
700
600
500
400
300
200
100
0
18a
18b
19a
19b
19c
20
24f
24g
25a
25b
25c
25d
21
26
22
27
23
28a
Bcl-2
BaX
24a
24b
24c
28b
Control
19b
Doxorubicin
Amsacrine
FIGURE 8 Schematic diagram for the real‐time PCR data for Bax
and Bcl‐2 genes and their control

12 of 22
EISSA ET AL.
|
FIGURE 9 Binding of doxorubicin with Topo II. The hydrogen bonds are represented in green dashed lines and the π interactions are
represented in orange dashed lines
Moreover, the terminal N‐(4‐(N‐(pyridin‐2‐yl)sulfamoyl)phenyl)acet-
amide moiety was oriented at the minor groove of DNA, forming two
hydrophobic interactions with Ala521 (Figure 11).
hydrophobic interactions with Ala521 and Pro544. The other
4‐acetamidobenzoic side chain was oriented at the major groove,
forming four hydrogen bonds with Gua5, Gua7, and Gua13. Also, it
formed one hydrophobic interaction with Met782. Moreover, the
planar aromatic system ([1,2,4]triazolo[4,3‐a]quinoxalin‐4(5H)‐one)
formed sixteen aromatic stacking interactions with Ade12, Gua13,
Cyt8, and Thy9 (Figure 12).
Compound 27 showed an affinity value of −63.13 kcal/mol. It
exhibited a mode of threading intercalation with DNA, where one 4‐
acetamidobenzoic side chain was oriented at the minor groove of
DNA, forming one hydrogen bond with Arg503 and two
FIGURE 10 Binding of amsacrine with Topo II. The hydrogen bonds are represented in green dashed lines and the π interactions are
represented in orange dashed lines

EISSA ET AL.
13 of 22
|
FIGURE 11 Binding of compound 19b with Topo II. The hydrogen bonds are represented in green dashed lines and the π interactions are
represented in orange dashed lines
|
2.4
Structure–activity relationship (SAR)
the two scaffolds having the same substituents with each other. For
example, compound 18a (4‐acetamidobenzoic acid derivative)
incorporating scaffold 1 has decreased IC50 values against Hep
G‐2, Hep‐2, and Caco‐2 cell lines (1.58 0.1, 16.67 0.9, and 8.54
0.2 µM, respectively) compared with the corresponding
member 27 incorporating scaffold 2 (2.34 0.2, 18.39 0.8, and
9.52 0.1 µM, respectively). Also, compound 19a (N‐(4‐sulfamoyl-
phenyl)acetamide derivative) incorporating scaffold 1 has decreased
the IC50 values against Hep G‐2, Hep‐2, and Caco‐2 cell lines (3.91
In general, structure–activity correlation of the synthesized com-
pounds against Hep G‐2, Hep‐2 and Caco‐2 cell lines revealed that
the unsubstituted 1‐sulfanyl‐[1,2,4]triazolo[4,3‐a]quinoxalin‐4(5H)‐
one (scaffold 2) 16 was more active than the unsubstituted
4‐sulfanyl‐[1,2,4]triazolo[4,3‐a]quinoxaline (scaffold 1) 14. On the
contrary, the substituted 4‐sulfanyl‐[1,2,4]triazolo[4,3‐a]quinoxaline
derivatives (scaffold 1) were more active than the substituted 1‐
sulfanyl‐[1,2,4]triazolo[4,3‐a]quinoxalin‐4(5H)‐one derivatives (scaf-
fold 2). These findings became clear by comparing the cytotoxicity of
0.1, 13.70
0.9, and 15.25
0.2 µM, respectively) than the
FIGURE 12 Binding of compound 27 with Topo II. The hydrogen bonds are represented in green dashed lines and the π interactions are
represented in orange dashed lines

14 of 22
EISSA ET AL.
|
corresponding member 28a incorporating scaffold 2 (4.09
0.1,
compound 19b (IC50 = 0.97
0.1 µM). DNA intercalation assay
13.99 0.7, and 18.20 0.4 µM). In addition, compound 19b (N‐(4‐
(N‐(pyridin‐2‐yl)sulfamoyl)phenyl)acetamide derivative) incorporat-
ing scaffold 1 has lower IC50 values against Hep G‐2, Hep‐2, and
revealed that some of the synthesized compounds moderately bind
to DNA such as compound 28b (IC50 = 37.06 1.8 µM). In addition,
flow cytometry analysis demonstrated that 19b could significantly
induce apoptosis (13.53%) of Hep G‐2 cell at a concentration of 0.5
µM and can arrest the cell cycle at the G2/M phase. The SAR study
revealed that substituted scaffold 1 showed better activity than the
substituted scaffold 2. These results indicate that derivatives of the
two scaffolds can act as potent Topo II inhibitors and effective
anticancer agents. In addition, optimization of these derivatives may
result in discovering more promising Topo II inhibitors.
Caco‐2 cell lines (0.50
0.1, 0.75
0.1, and 2.91
0.1 µM,
respectively) than the corresponding member 28b incorporating
scaffold 2 (2.87 0.1, 2.39 0.7, and 3.27 0.2 µM, respectively).
Then, we explored the effect of substitution on the thiol group of
4‐sulfanyl‐[1,2,4]triazolo[4,3‐a]quinoxaline nucleus (scaffold 1) by
different moieties. It was found that compound 23 incorporating N‐
(4‐acetylphenyl)acetamide moiety (IC50 = 0.32 0.1, 0.26 0.1, and
1.99 0.1 µM) had higher activity than the corresponding members
incorporating other moieties. With regard to the effect of other
moieties, the activities decreased in the order of N‐(4‐sulfamoylphe-
nyl)acetamide derivative 19b > 4‐acetamidobenzoic acid derivatives
18b > N‐(4‐sulfamoylbenzyl)acetamide derivative 21 > N‐(4‐sulfa-
moylphenyl)propionamide derivative 20 > acetamide derivative 22.
Moreover, it was found that ethyl benzoate derivative 18b was more
active than free benzoic acid derivative 18a. In addition, N‐(pyridin‐2‐
yl)benzenesulfonamide derivative 19b showed better activity than
the N‐(thiazol‐2‐yl)benzenesulfonamide derivative 19c, and the
latter exhibited higher activity than free benzenesulfonamide
derivative 19a.
|
4
EXPERIMENTAL
Chemistry
|
4.1
|
4.1.1
General
All melting points (m.p.) were carried out by an open capillary method
on a Gallenkamp melting point apparatus and were uncorrected. The
IR spectra were carried out on a Pye‐Unicam SP‐3‐300 infrared
spectrophotometer (KBr disks) and expressed in wavenumber (cm−1).
1H NMR spectra were recorded at 400 MHz, on Bruker BioSpin
GmbH 400 and 500 NMR spectrometers (Bruker, Rheinstetten,
Germany), whereas 13C NMR spectra were run at 100 MHz. TMS was
used as an internal standard in deuterated dimethylsulfoxide (DMSO‐
d6). Chemical shifts (δ) are quoted in ppm. The abbreviations used are
as follows: s, singlet; d, doublet; m, multiplet. All coupling constant (J)
values were given in Hertz. The mass spectra were recorded on
Shimadzu GCMS‐QP‐1000EX mass spectrometer at 70 eV. Elemental
analyses were performed on a CHN analyzer and all compounds were
within 0.4 of the theoretical values. The reactions were monitored
by thin‐layer chromatography (TLC) using TLC sheets coated with UV
fluorescent silica gel Merck 60 F254 plates and were visualized using
UV lamp and different solvents as mobile phases. Compounds 10, 11,
12, 13, 14, and 15 were synthesized according to the reported
methods.[38–40]
Next, we explored the impact of substitution on 1‐sulfanyl‐[1,2,4]
triazolo[4,3‐a]quinoxalin‐4(5H)‐one nucleus (scaffold 2) by different
moieties. It was found that the activities decreased in the order of
methyl propionate derivative 26 > alkyl derivatives 24a–g > alkyl
acetate derivatives 25a–d > N‐(4‐sulfamoylphenyl)acetamide deriva-
tives 28a,b > 4‐acetamidobenzoic acid derivative 27. Concerning the
activities of derivatives with alkyl substitutions 24a–g, it was found
that increasing lengths of alkyl chain led to decreased cytotoxic
activities (methyl 24a > ethyl 24b > butyl 24c > hexyl 24d > decyl
24e). With regard to the effect of substitution with alkyl acetates
25a–d, it was found that activities decreased in the order of ethyl
acetate 25b > methyl acetate 25a > isobutyl acetate 25d > isopropyl
acetate 25c. Finally, it was found that N‐(pyridin‐2‐yl)benzenesulfo-
namide derivative 28b showed better activity than free benzene-
sulfonamide derivative 28a.
The InChI codes of the investigated compounds together with
some biological activity data are provided as Supporting Information.
|
3
CONCLUSION
|
4.1.2
Synthesis of sulfanyl‐[1,2,4]triazolo[4,3‐a]‐
quinoxalin‐4(5H)‐one (16)
In summary, 26 derivatives of 4‐sulfanyl‐[1,2,4]triazolo[4,3‐a]qui-
noxaline (scaffold 1) and 1‐sulfanyl‐[1,2,4]triazolo[4,3‐a]quinoxalin‐
4(5H)‐one (scaffold 2) have been designed and synthesized. Some
compounds showed potent antiproliferative activities against Hep G‐
2, Hep‐2, and Caco‐2 cancer cell lines such as 18b (IC50 = 0.55 0.1,
1.37 0.2, and 2.23 0.1 µM, respectively), 19b (IC50 = 0.50 0.1,
0.75 0.1, and 2.91 0.1 µM, respectively), 23 (IC50 = 0.32 0.1,
0.26 0.1, and 1.99 0.1 µM, respectively), 25b (IC50 = 1.79 0.1,
1.11 0.2, and 1.41 0.1 µM, respectively), and 26 (IC50 = 1.19 0.1,
A mixture of 2‐chloro‐3‐hydrazinylquinoxaline 12 (1.94 g, 0.01 mol),
carbon disulfide (0.76 g, 0.71 ml, 0.03 mol), and potassium hydroxide
(0.56 g, 0.02 mol) was refluxed in absolute ethanol (30 ml) for 4 hr.
Then, the reaction mixture was concentrated, cooled to room
temperature, and acidified with diluted hydrochloric acid. The
obtained precipitate was filtered, washed with water, and recrys-
tallized from ethanol to give compound 16.
Yellow crystals (yield, 65%); m.p. = 180–182°C. IR (KBr, cm−1):
3,073 (CH aromatic), 2,935 (CH aliphatic), 1,693 (C═O), and 1,597
(C═N); 1H NMR (DMSO‐d6) δ (ppm): 7.34–7.38 (dd, 1H, J = 7.2, 8.8
2.08
0.2, and 0.60
0.1 µM, respectively). Moreover, some
compounds displayed potent inhibitory activities against Topo II as

EISSA ET AL.
15 of 22
|
Hz, Ar‐H, H‐8 of quinoxaline), 7.44–7.48 (dd, 1H, J = 7.2, 8.4 Hz, Ar‐H,
H‐7 of quinoxaline), 7.51–7.54 (d, 1H, J = 8.4 Hz, Ar‐H, H‐6 of
quinoxaline), 10.15 (d, 1H, J = 8.8 Hz, Ar‐H, H‐9 of quinoxaline), 13.74
(s, 1H, NH, D2O exchangeable), 14.55 (s, 1H, SH, D2O exchangeable);
13C NMR (DMSO‐d6, 100 MHz) δ (ppm): 121.16, 121.86, 129.28,
130.17, 132.85, 133.80, 149.36, 169.00, and 176.87; DEPT (DMSO‐
d6, 100 MHz) δ (ppm): 121.16, 121.86, 129.28, and 132.85 (4CH);
Anal. calcd. for C9H6N4OS (218.23): C, 49.53; H, 2.77; N, 25.67.
Found: C, 49.22%; H, 2.48%; N, 25.31%.
141.76, 141.88, 143.31, 151.53, 166.86, and 167.55; DEPT
(DMSO‐d6, 100 MHz) δ (ppm): 34.53 (1CH2), 116.97, 118.88(2),
128.22, 128.59, 130.91(2), 138.18. 167.55 (9CH); MS (m/z): 379
(M+, 10.9%), 334 (41.9%), and 169 (100% base beak); Anal. calcd.
for C18H13N5O3S (379.39): C, 56.99; H, 3.45; N, 18.46. Found: C,
56.52%; H, 3.71%; N, 18.82%.
Ethyl 4‐(2‐([1,2,4]triazolo[4,3‐a]quinoxalin‐4‐ylthio)acetamido)‐
benzoate (18b)
Yellow crystals (yield, 65%); m.p. = 218–220°C. IR (KBr, cm−1): 3,256
(NH), 3,082 (CH aromatic), 2,983 (CH aliphatic), 1,712, and 1,672
(2C═O), and 1,603 (C═N); 1H NMR (DMSO‐d6) δ (ppm): 1.30 (t, 3H,
J = 7.0 Hz, CH3), 4.29 (q, 2H, OCH2, J = 7.0 Hz), 4.42 (s, 2H, SCH2),
7.61 (dd, 1H, J = 7.5, 8 Hz, Ar‐H, H‐8 of quinoxaline), 7.65 (dd, 1H, J =
7.5, 8 Hz, Ar‐H, H‐7 of quinoxaline), 7.77 (d, 2H, J = 8.5 Hz, Ar‐H, H‐3,
and H‐5 of phenyl), 7.85 (d, 1H, J = 8 Hz, Ar‐H, H‐9 of quinoxaline),
7.92 (d, 2H, J = 8.5 Hz, Ar‐H, H‐2, and H‐6 of phenyl), 8.31 (d, 1H, J =
7.5 Hz, Ar‐H, H‐6 of quinoxaline), 10.04 (s, 1H, Ar‐H, N–CH═N),
10.68 (s, 1H, exchangeable with D2O, –NH); 13C NMR (DMSO‐d6,
100 MHz) δ (ppm): 14.62, 34.47, 60.84, 117.02, 119.11(2), 124.02,
125.10, 128.24, 128.33, 128.66, 130.66(2), 135.59, 138.14, 141.86,
143.67, 151.58, 165.78, and 168.91; DEPT (DMSO‐d6, 100 MHz) δ
(ppm): 14.62, 34.47, 60.84, 117.02, 119.11(2), 128.24, 128.33,
128.66, 130.66(2), and 138.14; MS (m/z): 407 (M+, 9.08%), 170
(9.94%), 119 (66.91%), and 64.98 (100% base beak); Anal. calcd. for
C20H17N5O3S (407.11): C, 58.96; H, 4.21; N, 17.19. Found:
C, 58.57%; H, 3.81%; N, 17.52%.
|
4.1.3
Potassium 4‐oxo‐1‐sulfido‐4H‐[1,2,4]
triazolo‐[4,3‐a]quinoxalin‐5‐ide (17
)
A mixture of 16 (2.18 g, 0.01 mol) and potassium hydroxide (1.12 g,
0.02 mol) in absolute ethanol (20 ml) was refluxed for 0.5 hr. Upon
cooling to room temperature, a yellow precipitate was obtained,
which was collected and washed with diethyl ether to afford the
corresponding potassium salt 17. Yield, 97%; m.p.: >300°C. Anal.
calcd. for C9H4K2N4OS (294.41); Calcd.: C, 36.72; H, 1.37; N, 19.03.
Found: C, 36.40%; H, 1.66%; N, 19.45%.
|
4.1.4
General procedure for the synthesis of
compounds 18a,b, 19a–c, 20, 21, 22, 23
A mixture of the potassium salt 15 (2.40 g, 0.01 mol) and the
appropriate 2‐chloro‐acetamido or 3‐chloropropanamido derivatives
(0.01 mol) namely, 4‐(2‐chloroacetamido)benzoic acid and ethyl 4‐(2‐
chloroacetamido)benzoate,
2‐chloro‐N‐(4‐sulfamoyl‐phenyl)aceta-
mide, 2‐chloro‐N‐(4‐(N‐(pyridin‐2‐yl)sulfamoyl)phenyl)acetamide,
2‐([1,2,4]Triazolo[4,3‐a]quinoxalin‐4‐ylthio)‐N‐(4‐sulfamoylphenyl)‐
acetamide (19a)
and 2‐chloro‐N‐(4‐(N‐(thiazol‐2‐yl)sulfamoyl)phenyl)acetamide, 3‐
chloro‐N‐(4‐sulfamoyl‐phenyl)propanamide, 3‐chloro‐N‐(4‐sulfamoyl-
phenyl)propanamide, 2‐chloroacetamide and N‐(4‐acetylphenyl)‐2‐
chloroacetamide in dry DMF (30 ml) was heated on a water bath for
3 hr. After cooling, the reaction mixture was poured onto ice water
(250 ml) with continuous stirring. The formed precipitate was
filtered, washed with water, dried, and crystallized from methanol
to afford the corresponding compounds 18a,b, 19a–c, 20, 21, 22, and
23, respectively.
Greenish‐white crystals (yield, 60%); m.p. = 262–263°C. IR (KBr,
cm−1): 3,324, 3,193 (NH, NH2), 3,053 (CH aromatic), 2,953 (CH
aliphatic), 1,685 (C═O), 1,593 (C═N), 1,252 (SO2); 1H NMR (DMSO‐
d6) δ (ppm): 4.42 (s, 2H, SCH2), 7.20 (br, s, 2H, exchangeable with
D2O, –NH2), 7.61 (dd, 1H, J = 7.5, 8.1 Hz, Ar‐H, H‐8 of quinoxaline),
7.64 (dd, 1H, J = 7.5, 8.1 Hz, Ar‐H, H‐7 of quinoxaline), 7.73–7.79 (m,
4H, Ar‐H, phenyl), 7.84 (d, 1H, J = 7.5 Hz, Ar‐H, H‐9 of quinoxaline),
8.28 (d, 1H, J = 7.5 Hz, Ar‐H, H‐6 of quinoxaline), 10.00 (s, 1H, Ar‐H,
N–CH═N), and 10.71 (s, 1H, exchangeable with D2O, –NH); 13C NMR
(DMSO‐d6, 100 MHz) δ (ppm): 34.35, 116.99, 119.40 (2C), 123.85,
123.91, 127.21 (2C), 128.34, 128.77, 135.54, 138.11, 139.06, 141.81,
142.26, 151.45, and 166.98; DEPT (DMSO‐d6, 100 MHz) δ (ppm):
34.36, 116.92, 116.99, 119.40, 127.21 (2C), 128.33, 128.35, 128.77,
and 138.11; MS (m/z): 414 (M+, 8.9%), 335 (71%), and 169 (100%
base beak); Anal. calcd. for C17H14N6O3S2 (414.46): C, 49.27; H, 3.40;
N, 20.28. Found: C, 49.59%; H, 3.69%; N, 20.92%.
4‐(2‐([1,2,4]Triazolo[4,3‐a]quinoxalin‐4‐ylthio)acetamido)benzoic
acid (18a)
Buff crystals (yield, 60%); m.p. = 270–271°C. IR (KBr, cm−1): 3,516
(OH), 3,248 (NH), 3,079 (CH aromatic), 2,925 (CH aliphatic), 1,692
and 1,673 (2C═O), and 1,596 (C═N); 1H NMR (DMSO‐d6) δ (ppm):
4.42 (s, 2H, CH2), 7.53 (dd, 1H, J = 7.5, 8.0 Hz, Ar‐H, H‐8 of
quinoxaline), 7.59 (dd, 1H, J = 7.5, 8.4 Hz, Ar‐H, H‐7 of quinoxa-
line), 7.74 (d, 1H, J = 8.0 Hz, Ar‐H, H‐9 of quinoxaline), 7.77 (d, 1H,
J = 8.4 Hz, Ar‐H, H‐6 of quinoxaline), 7.91 (d, 2H, J = 7.6 Hz, Ar‐H,
H‐3, and H‐5 of phenyl), 8.25 (d, 2H, J = 7.6 Hz, Ar‐H, H‐2, and H‐6
of phenyl), 10.05 (s, 1H, Ar‐H, N–CH═N), 10.81 (s, 1H, exchange-
able with D2O, –NH), 12.74 (s, 1H, exchangeable with D2O, –OH);
13C NMR (DMSO‐d6, 100 MHz) δ (ppm): 34.52, 116.98, 118.89(2),
123.92, 126.22, 128.22, 128.59, 130.91(2), 135.48, 138.18,
2‐([1,2,4]Triazolo[4,3‐a]quinoxalin‐4‐ylthio)‐N‐(4‐(N‐(pyridin‐2‐yl)‐
sulfamoyl)phenyl)acetamide (19b)
Yellow crystals (yield, 65%); m.p. = 248–250°C. IR (KBr, cm−1): 3,278,
3,182 (2NH), 3,049 (CH aromatic), 2,939 (CH aliphatic), 1,688 (C═O),
1,625 (C═N), and 1,152 (SO2); 1H NMR (DMSO‐d6) δ (ppm): 4.43 (s,
2H, SCH2), 6.86 (dd, 1H, J = 6.4 Hz, H‐5 of pyridine), 7.14 (d, 1H,

16 of 22
EISSA ET AL.
|
J = 8.4 Hz, H‐3 of pyridine, 7.55–7.89 (m, 10H, Ar‐H), 8.32 (s, 1H, Ar‐
H, N–CH═N), 10.04 (s, 1H, exchangeable with D2O, –CONH), and
10.65 (s, 1H, exchangeable with D2O, –SO2NH); 13C NMR (DMSO‐d6,
100 MHz) δ (ppm): 34.92, 114.31, 116.98, 117.90, 118.87(2), 126.27,
128.29, 128.30(3), 128.23, 135.57, 138.21, 139.09, 140.79, 143.31,
143.36, 150.44, 151.62, 153.59, and 167.59; Anal. calcd. for
C22H17N7O3S2 (491.54): C, 53.76; H, 3.49; N, 19.95. Found: C,
53.99%; H, 3.88%; N, 20.35%.
(C═O), 1,597 (C═N), and 1,136 (SO2); 1H NMR (DMSO‐d6) δ (ppm): 4.24
(s, 2H, SCH2), 4.40 (s, 2H, –NHCH2), 7.30 (br, s, 2H, exchangeable with
D2O, –NH2), 7.43 (d, 2H, Ar‐H, J = 7.88 Hz, H‐3, and H‐5 of phenyl),
7.62 (dd, 1H, J = 7.5, 8.1 Hz, Ar‐H, H‐8 of quinoxaline), 7.68 (dd, 1H, J =
7.5, 8.0 Hz, Ar‐H, H‐7 of quinoxaline), 7.70 (d, 2H, Ar‐H, J = 7.88 Hz, H‐2,
and H‐6 of phenyl), 7.86 (d, 1H, J = 8.1 Hz, Ar‐H, H‐9 of quinoxaline),
8.34 (d, 1H, J = 8.0 Hz, Ar‐H, H‐6 of quinoxaline), 8.90 (s, 1H, Ar‐H,
N–CH═N), and 10.09 (s, 1H, exchangeable with D2O, –NH); 13C NMR
(DMSO‐d6, 100 MHz) δ (ppm): 32.93, 42.75, 117.04, 123.97, 126.07
(2C), 127.83 (2C), 128.26, 128.44, 128.71, 135.56, 138.21, 141.90,
143.05, 143.79, 151.66, and 167.56; DEPT (DMSO‐d6, 100 MHz) δ
(ppm): 32.93, 42.75, 117.03, 126.06 (2C), 127.82 (2C), 128.25, 128.44,
128.70, and 138.21; Anal. calcd. for C18H16N6O3S2 (428.49): C, 50.46;
H, 3.76; N, 19.61. Found: C, 50.78%; H, 3.44%; N, 19.85%.
2‐([1,2,4]Triazolo[4,3‐a]quinoxalin‐4‐ylthio)‐N‐(4‐(N‐(thiazol‐2‐yl)‐
sulfamoyl)phenyl)acetamide (19c)
Yellowish white crystals (yield, 70%); m.p. = 232–235°C. IR (KBr, cm−1):
3,267, 3,185 (2NH), 3,108 (CH aromatic), 2,915 (CH aliphatic), 1,691
(C═O), 1,590 (C═N), and 1,138 (SO2); 1H NMR (DMSO‐d6) δ (ppm): 4.41
(s, 2H, –SCH2), 6.77 (d, 1H, J = 4.8 Hz, H‐5 of thiazol), 7.19 (d, 1H, J = 4.8
Hz, H‐4 of thiazol), 7.54–7.58 (m, 3H, Ar‐H, H‐7, H‐8 and H‐9 of
quinoxaline), 7.67 (d, 2H, J = 8.2 Hz, Ar‐H, H‐3 and H‐5 of phenyl), 7.73
(d, 2H, J = 8.2 Hz , Ar‐H, H‐2 and H‐6 of phenyl), 7.79 (d, 1H, J = 8 Hz,
Ar‐H, H‐6 of quinoxaline), 8.24 (s, 1H, Ar‐H, N–CH═N), 10.00 (s, 1H,
exchangeable with D2O, CONH), and 10.68 (s, 1H, exchangeable with
D2O, –SO2NH): 13C NMR (DMSO‐d6, 100 MHz) δ (ppm): 34.45, 108.48,
116.93, 119.29(2), 123.92, 124.98, 127.46(2), 128.20, 128.29, 128.60,
135.53, 137.41, 138.08, 141.84, 142.49, 151.51, 166.89, and 168.19;
DEPT (DMSO‐d6, 100 MHz) δ (ppm): 34.45, 108.47, 116.92, 119.38(2),
124.99, 127.47(2), 128.20, 128.29, 128.60, 138.08; MS (m/z): 497 (M+,
14.69%), 204.03 (45.39%), 155.23 (45.18%), and 78.64 (100% base
beak); Anal. calcd. for C20H15N7O3S3 (497.57): C, 48.28; H, 3.04; N,
19.71. Found: C, 48.58%; H, 3.44%; N, 20.05%.
2‐([1,2,4]Triazolo[4,3‐a]quinoxalin‐4‐ylthio)acetamide (22
)
Beige yellow crystals (yield, 70%); m.p. = 255–256°C. IR (KBr, cm−1):
3,197, 3,120 (NH2), 3,066 (CH aromatic), 2,925 (CH aliphatic), 1,667
(C═O), and 1,624 (C═N); 1H NMR (DMSO‐d6) δ (ppm): 4.13 (s, 2H,
CH2), 7.27 (s, 2H, exchangeable with D2O, –NH2), 7.64 (dd, 1H, J =
7.5, 8.1 Hz, Ar‐H, H‐8 of quinoxaline), 7.71 (dd, 1H, J = 7.5, 8.1 Hz, Ar‐
H, H‐7 of quinoxaline), 7.92 (d, 1H, J = 8.1 Hz, Ar‐H, H‐9 of
quinoxaline), 8.34 (d, 1H, J = 7.5 Hz, Ar‐H, H‐6 of quinoxaline), and
10.10 (s, 1H, Ar‐H, N–CH═N); 13C NMR (DMSO‐d6, 100 MHz) δ
(ppm): 33.01, 117.07, 124.00, 128.30, 128.49, 128.66, 135.63,
138.21, 141.93, 151.78, and 169.22; DEPT (DMSO‐d6, 100 MHz) δ
(ppm): 33.01 (1CH2), 117.07, 128.30, 128.49, 128.66, and 138.22
(5CH); MS (m/z): 259 (M+, 24.08%), 212 (48.79%), 202.60 (14.16%),
and 96.75 (100% base beak); Anal. calcd. for C11H9N5OS (259.29): C,
50.96; H, 3.50; N, 27.01. Found: C, 50.61%; H, 3.11%; N, 27.42%.
3‐([1,2,4]Triazolo[4,3‐a]quinoxalin‐4‐ylthio)‐N‐(4‐sulfamoylphenyl)‐
propanamide (20)
Brown crystals (yield, 67%); m.p. = 264–265°C. IR (KBr, cm−1): 3,240,
3,183 (NH, NH2), 3,052 (CH aromatic), 2,925 (CH aliphatic), 1,680
(C═O), 1,592 (C═N), and 1,155 (SO2); 1H NMR (DMSO‐d6) δ ppm:
2.99 (t, 2H, J = 6.5 Hz, COCH2), 3.67 (t, 2H, J = 6.5 Hz, –SCH2). 7.25
(s, 2H, exchangeable with D2O, –NH2), 7.58 (dd, 1H, J = 7.6, 8.4 Hz,
Ar‐H, H‐8 of quinoxaline), 7.63 (dd, 1H, J = 7.6, 8.0 Hz, Ar‐H, H‐7 of
quinoxaline), 7.70 (d, 1H, J = 8.4 Hz, Ar‐H, H‐9 of quinoxaline), 7.75
(d, 1H, J = 8.0 Hz, Ar‐H, H‐6 of quinoxaline), 7.79 (d, 2H, J = 8.0 Hz,
Ar‐H, H‐2, and H‐6 of phenyl), 7.91 (d, 2H, J = 8.0 Hz, Ar‐H, H‐3, and
H‐5 of phenyl), 8.30 (s, 1H, Ar‐H, N–CH═N), and 10.05 (s, 1H,
exchangeable with D2O, –NH); 13C NMR (DMSO‐d6, 100 MHz) δ
(ppm): 24.21, 36.08, 116.93, 119.07(2), 123.85, 127.17(3), 128.16,
128.50, 135.66, 138.14, 138.76, 142.01, 142.35, 151.95, and 170.38;
DEPT (DMSO‐d6, 100 MHz) δ (ppm): 24.21, 36.09 (2CH2), 116.92,
119.06(2), 127.17(3), 128.16, and 128.49(2); Anal. calcd. for
C18H16N6O3S2 (428.49): C, 50.46; H, 3.76; N, 19.61. Found: C,
50.11%; H, 3.31%; N, 19.02%.
2‐([1,2,4]Triazolo[4,3‐a]quinoxalin‐4‐ylthio)‐N‐(4‐acetylphenyl)acet-
amide (23)
Brown powder (yield, 75%); m.p. = 117–118°C. IR (KBr, cm−1): 3,248
(NH), 3,045 (CH aromatic), 2,900 (CH aliphatic), 1,675 (C═O), and
1,594 (C═N); 1H NMR (DMSO‐d6) δ (ppm): 2.66 (s, 3H, –COCH3),
4.45 (s, 2H, CH2), 7.55 (dd, 1H, J = 7.4, 8.0 Hz, Ar‐H, H‐8 of
quinoxaline), 7.62 (dd, 1H, J = 7.4, 8.6 Hz, Ar‐H, H‐7 of quinoxaline),
7.79 (d, 1H, J = 8.0 Hz, Ar‐H, H‐9 of quinoxaline), 7.82 (d, 1H, J = 8.6
Hz, Ar‐H, H‐6 of quinoxaline), 7.99 (d, 2H, J = 7.5 Hz, Ar‐H, H‐2, and
H‐6 of phenyl), 8.35 (d, 2H, J = 7.5 Hz, Ar‐H, H‐3, and H‐5 of phenyl),
10.10 (s, 1H, Ar‐H, N–CH═N), and 10.80 (s, 1H, exchangeable with
D2O, –NH); 13C NMR (DMSO‐d6, 100 MHz) δ (ppm): 27.60, 34.52,
116.16, 118.88, 119.05(2), 123.34, 126.21, 128.26, 129.62(2),
135.56, 138.22, 143.42, 146.72, 151.57, 166.90, 170.25, and
196.88; Anal. calcd. for C19H15N5O2S (377.42): C, 60.47; H, 4.01;
N, 18.56. Found: C, 60.22%; H, 4.41%; N, 18.92%.
|
4.1.5
General procedure for the synthesis of
2‐([1,2,4]Triazolo[4,3‐a]quinoxalin‐4‐ylthio)‐N‐(4‐sulfamoylbenzyl)‐
compounds 24a–g
acetamide (21
)
Yellow crystals (yield, 60%); m.p. = 215–217°C. IR (KBr, cm−1): 3,310,
A mixture of the potassium salt 17 (2.94 g, 0.01 mol) and the
3,180 (NH, NH2), 3,079 (CH aromatic), 2,925 (CH aliphatic), 1,685
different alkyl halids (0.025 mol), namely, methyl bromide, ethyl

EISSA ET AL.
17 of 22
|
bromide, n‐butyl bromide, n‐hexyl bromide, n‐decyl bromide, allyl
bromide, and benzyl bromide in dry DMF (40 ml) was heated on a
water bath for 4 hr. After cooling, the reaction mixture was poured
onto ice water (300 ml) with continuous stirring. The formed
precipitate was filtered, washed with water, and crystallized from
ethanol to afford the corresponding compounds 24a–g, respectively.
21.91, 28.25, 31.12, 31.27, 33.91 (6CH2), 116.35, 127.91, 127.94,
and 28.67 (4CH); Anal. calcd. for C17H22N4OS (330.45): C, 61.79; H,
6.71; N, 16.96. Found: C, 61.55%; H, 6.45%; N, 16.72%.
5‐Hexyl‐1‐(hexylthio)‐[1,2,4]triazolo[4,3‐a]quinoxalin‐4(5H)‐one
(24d)
Yellow crystals (yield, 65%); m.p. = 199–201°C. IR (KBr, cm−1): 3,069
(CH aromatic), 2,920 (CH aliphatic), 1,691 (C═O), and 1,592 (C═N);
1H NMR (DMSO‐d6) δ (ppm): 0.82 (t, 3H, SCH2CH2CH2CH2CH2CH3),
0.86 (t, 3H, NCH2CH2CH2CH2CH2CH3), 1.23–1.41 (m, 12H, SCH2
CH2CH2CH2CH2CH3, and NCH2CH2CH2CH2CH2CH3), 1.72–1.81
(m, 4H, SCH2CH2CH2CH2CH2CH3, and NCH2CH2CH2CH2CH2CH3),
3.34 (t, 2H, J = 9.20 Hz, SCH2CH2CH2CH3), 3.44 (t, 2H, J = 7.20 Hz,
NCH2CH2CH2CH3, 7.37 (dd, 1H, J = 7.5, 8.0 Hz, Ar‐H, H‐8 of
quinoxaline), 7.54 (dd, 1H, J = 7.5, 8.1 Hz, Ar‐H, H‐7 of quinoxaline),
7.59 (d, 1H, J = 8.1 Hz, Ar‐H, H‐6 of quinoxaline), and 8.14 (d, 1H, J =
8.0 Hz, Ar‐H, H‐9 of quinoxaline); 13C NMR (DMSO‐d6, 100 MHz) δ
(ppm): 14.18, 14.30, 22.35 (2C), 22.43, 28.12, 28.40, 28.56, 29.13,
31.12 (2C), 31.18, 39.40, 40.85, 116.31, 116.88, 125.18, 127.88,
128.17, 128.60, and 136.34; Anal. calcd. for C21H30N4OS (386.56): C,
65.25; H, 7.82; N, 14.49. Found: C, 65.15%; H, 7.66%; N, 14.87%.
5‐Methyl‐1‐(methylthio)‐[1,2,4]triazolo[4,3‐a]quinoxalin‐4(5H)‐one
(24a)
Beige crystals (yield, 75%); m.p. = 159–160°C. IR (KBr, cm−1): 3,070
(CH aromatic), 2,915 (CH aliphatic), 1,689 (C═O), and 1,596 (C═N);
1H NMR (DMSO‐d6) δ (ppm): 2.71 (s, 3H, SCH3), 2.92 (s, 3H, NCH3),
7.58 (dd, 1H, J = 7.8, 8.0 Hz, Ar‐H, H‐8 of quinoxaline), 7.63 (dd, 1H, J
= 7.8, 8.2 Hz, Ar‐H, H‐7 of quinoxaline), 7.88 (d, 1H, J = 8.2 Hz, Ar‐H,
H‐6 of quinoxaline), and 8.41 (d, 1H, J = 7.8 Hz, Ar‐H, H‐9 of
quinoxaline); 13C NMR (DMSO‐d6, 100 MHz) δ (ppm): 11.76, 16.53,
116.24, 125.15, 127.95, 128.02, 128.72, 136.34, 144.33, 148.22, and
153.23; DEPT (DMSO‐d6, 100 MHz) δ (ppm): 13.15, 17.93 (2CH3),
117.66, 129.44, 130.14, and 136.34 (4CH); Anal. calcd. for
C11H10N4OS (246.29): C, 53.64; H, 4.09; N, 22.75. Found: C,
53.98%; H, 4.41%; N, 22.42%.
5‐Ethyl‐1‐(ethylthio)‐[1,2,4]triazolo[4,3‐a]quinoxalin‐4(5H)‐one
5‐Decyl‐1‐(decylthio)‐[1,2,4]triazolo[4,3‐a]quinoxalin‐4(5H)‐one
(24e)
24b
( )
Yellow crystals (yield, 70%); m.p. = 173–175°C. IR (KBr, cm−1): 3,065
(CH aromatic), 2,915 (CH aliphatic), 1,687 (C═O), and 1,590 (C═N);
1H NMR (DMSO‐d6) δ (ppm): 1.39 (t, 3H, SCH2CH3), 1.43 (t, 3H,
NCH2CH3), 3.25 (q, 2H, SCH2CH3), 3.41 (q, 2H, NCH2CH3), 7.55 (dd,
1H, J = 6.8, 8.5 Hz, Ar‐H, H‐8 of quinoxaline), 7.58 (dd, 1H, J = 6.8, 8.1
Hz, Ar‐H, H‐7 of quinoxaline), 7.82 (d, 1H, J = 8.1 Hz, Ar‐H, H‐6 of
quinoxaline), 8.44 (d, 1H, J = 8.5 Hz, Ar‐H, H‐9 of quinoxaline); 13C
NMR (DMSO‐d6, 100 MHz) δ (ppm): 14.60, 14.98, 23.12, 28.57,
116.31, 125.17, 127.92, 127.95, 128.66, 136.31, 144.06, 147.11, and
152.63; DEPT (DMSO‐d6, 100 MHz) δ (ppm): 14.60, 14.98 (2CH3),
22.89, 28.56 (2CH2), 116.31, 127.92, 127.95, and 128.67 (4CH); Anal.
calcd. for C13H14N4OS (274.34): C, 56.92; H, 5.14; N, 20.42. Found:
C, 56.65%; H, 5.49%; N, 20.77%.
Greenish‐white crystals (yield, 60%); m.p. = 80–81°C. IR (KBr, cm−1):
3,078 (CH aromatic), 2,920 (CH aliphatic), 1,688 (C═O), and 1,603
(C═N); 1H NMR (DMSO‐d6) δ (ppm): 0.84–0.87 (m, 6H, 2CH3),
1.23–1.26 (m, 24H, 12CH2), 1.38–1.42 (m, 4H, 2CH2), 1.75–1.78 (m,
4H, 2CH2), 3.26 (t, 2H, SCH2), 3.38 (t, 2H, NCH2), 7.23 (dd, 1H, J =
6.5, 8.0 Hz, Ar‐H, H‐8 of quinoxaline), 7.32 (dd, 1H, J = 6.5, 8.5 Hz, Ar‐
H, H‐7 of quinoxaline), 7.72 (d, 1H, J = 8.5 Hz, Ar‐H, H‐6 of
quinoxaline), 8.32 (d, 1H, J = 8.0 Hz, Ar‐H, H‐9 of quinoxaline); 13C
NMR (DMSO‐d6, 100 MHz) δ (ppm): 14.28 (2C), 22.47 (2C), 25.94,
29.08 (2C), 29.37 (3C), 29.41 (3C), 29.45 (2C), 29.49, 31.70 (2C),
61.23 (2C), 116.30, 116.84, 125.13, 125.18, 127.80, 127.86, 128.10,
128.55, and 136.30; DEPT (DMSO‐d6, 100 MHz) δ (ppm): 14.28,
22.47 (2CH3), 25.94(2), 29.04, 29.09(2), 29.30(2), 29.39, 29.44(2),
29.48(2), 31.70(2), 32.99(2), 61.23(2) (18CH2), 116.30, 127.80,
127.86, and 128.10 (4CH); Anal. calcd. for C29H46N4OS (498.77):
C, 69.84; H, 9.30; N, 11.23. Found: C, 69.53%; H, 9.68%; N, 11.61%.
5‐Butyl‐1‐(butylthio)‐[1,2,4]triazolo[4,3‐a]quinoxalin‐4(5H)‐one
(24c)
Yellow crystals (yield, 68%); m.p. = 205–207°C. IR (KBr, cm−1): 3,089
(CH aromatic), 2,935 (CH aliphatic), 1,687 (C═O), and 1,583 (C═N);
1H NMR (DMSO‐d6) δ (ppm): 0.82 (t, 3H, SCH2CH2CH2CH3), 0.98 (t,
3H, NCH2CH2CH2CH3), 1.44–1.53 (m, 4H, SCH2CH2CH2CH3, and
NCH2CH2CH2CH3), 1.73–1.80 (m, 4H, SCH2CH2CH2CH3, and
NCH2CH2CH2CH3), 3.34 (t, 2H, SCH2CH2CH2CH3), 3.43 (t, 2H,
NCH2CH2CH2CH3), 7.55 (dd, 1H, J = 7.3, 8.0 Hz, Ar‐H, H‐8 of
quinoxaline), 7.59 (dd, 1H, J = 7.3, 8.1 Hz, Ar‐H, H‐7 of quinoxaline),
7.85 (d, 1H, J = 8.1 Hz, Ar‐H, H‐6 of quinoxaline), and 8.55 (d, 1H, J =
8.0 Hz, Ar‐H, H‐9 of quinoxaline); 13C NMR (DMSO‐d6, 100 MHz) δ
(ppm): 13.74, 13.86, 21.62, 21.91, 28.25, 31.12, 31.27, 33.91, 116.35,
125.27, 127.91, 127.94, 128.67, 136.40, 144.14, 147.29, and 152.84;
DEPT (DMSO‐d6, 100 MHz) δ (ppm): 13.74, 13.86 (2CH3), 21.62,
5‐Allyl‐1‐(allylthio)‐[1,2,4]triazolo[4,3‐a]quinoxalin‐4(5H)‐one (24f)
Yellowish white crystals (yield, 73%); m.p. = 210–212°C. IR (KBr,
cm−1): 3,067 (CH aromatic), 2,920 (CH aliphatic), 1,692 (C═O), and
1,591 (C═N); 1H NMR (DMSO‐d6) δ (ppm): 3.97 (d, 2H, J = 8 Hz,
SCH2), 4.08 (d, 2H, J = 8.5, NCH2), 5.13–5.22 (m, 4H, 2CH2),
5.96–6.08 (m, 2H, 2CH2CH = CH2), 7.48 (dd, 1 H, J = 6.4, 8.8 Hz, Ar‐
H, H‐8 of quinoxaline), 7.55 (dd, 1H, J = 6.4, 8.4 Hz, Ar‐H, H‐7 of
quinoxaline), 7.77 (d, 1H, J = 8.4 Hz, Ar‐H, H‐6 of quinoxaline), and
8.41 (d, 1H, J = 8.8 Hz, Ar‐H, H‐9 of quinoxaline); 13C NMR (DMSO‐
d6, 100 MHz) δ (ppm): 31.27, 36.80, 116.24, 119.27, 119.85, 125.03,
127.89, 128.02, 128.60, 133.03, 133.45, 136.06, 143.89, 146.50, and
151.77; DEPT (DMSO‐d6, 100 MHz) δ (ppm): 31.26, 36.80, 116.24,

18 of 22
EISSA ET AL.
|
119.26, 119.84 (4CH2), 127.89, 128.02, 128.60, 133.03, and 133.45
(6CH); Anal. calcd. for C15H14N4OS (298.36): C, 60.38; H, 4.73; N,
18.78. Found: C, 60.73%; H, 4.38%; N, 18.41%.
(10.25%); Anal. calcd. for C15H14N4O5S (362.36): C, 49.72; H, 3.89; N,
15.46. Found: C, 49.44%; H, 3.58%; N, 15.81%.
Ethyl 2‐((5‐(2‐ethoxy‐2‐oxoethyl)‐4‐oxo‐4,5‐dihydro‐[1,2,4]triazolo‐
[4,3‐a]quinoxalin‐1‐yl)thio)acetate (25b
)
5‐Benzyl‐1‐(benzylthio)‐[1,2,4]triazolo[4,3‐a]quinoxalin‐4(5H)‐one
(24g)
Yellowish white crystals (yield, 77%); m.p. = 148–150°C. IR (KBr,
cm−1): 3,081 (CH aromatic), 2,933 (CH aliphatic), 1,734 (C═O), and
1,590 (C═N); 1H NMR (DMSO‐d6) δ (ppm): 1.14 (t, 3H, J = 7.5 Hz,
CH2CH3), 1.22 (t, 3H, J = 7 Hz, CH2CH3), 4.09 (q, 2H, J = 7.5 Hz,
CH2CH3), 4.16 (q, 2H, J = 7 Hz, CH2CH3), 4.24 (s, 2H, SCH2), 4.39 (s,
2H, NCH2), 7.58 (dd, 1H, J = 6.4, 8.1 Hz, Ar‐H, H‐8 of quinoxaline),
7.64 (dd, 1H, J = 6.4, 8.1 Hz, Ar‐H, H‐7 of quinoxaline), 7.77 (d, 1H, J =
8.1 Hz, Ar‐H, H‐6 of quinoxaline), and 8.41 (d, 1H, J = 8.1 Hz, Ar‐H, H‐
9 of quinoxaline); 13C NMR (DMSO‐d6, 100 MHz) δ (ppm): 14.35,
14.56, 31.57, 36.10, 61.67, 61.91, 116.45, 125.03, 128.24, 128.50,
128.63, 135.94, 143.85, 146.65, 151.33, 168.24, and 168.70; DEPT
(DMSO‐d6, 100 MHz) δ (ppm): 14.36, 14.57 (2CH3), 31.58, 36.11,
61.67, 61.91 (4CH2), 116.44, 128.24, 128.50, and 128.63 (4CH); Anal.
calcd. for C17H18N4O5S (390.41): C, 52.30; H, 4.65; N, 14.35. Found:
C, 52.63%; H, 4.28%; N, 14.71%.
Beige crystals (yield, 66%); m.p. = 188–190°C. IR (KBr, cm−1): 3,073
(CH aromatic), 2,935(CH aliphatic), 1,693 (C═O), and 1,597 (C═N);
1H NMR (DMSO‐d6) δ ppm: 4.62 (s, 2H, SCH2), 4.70 (s, 2H, NCH2),
7.22–7.40 (m, 6H, Ar‐H, H‐3, H‐4, and H‐5 of two phenyl), 7.45 (dd,
1H, J = 7.4, 8.2 Hz, Ar‐H, H‐8 of quinoxaline), 7.55 (dd, 1H, J = 7.4,
8.1 Hz, Ar‐H, H‐7 of quinoxaline), 7.57–7.60 (m, 4H, Ar‐H, H‐2, H‐6
of two phenyl), 7.94 (d, 1H, J = 8.1 Hz, Ar‐H, H‐6 of quinoxaline),
8.41 (d, 1 H, J = 8.2 Hz, Ar‐H, H‐9 of quinoxaline); 13C NMR (DMSO‐
d6, 100 MHz) δ (ppm): 32.46, 38.15, 116.52, 125.28, 127.71, 128.10,
128.13, 128.24, 128.75, 128.89, 128.94, 128.97(2), 129.65(2),
129.70(2), 129.75, 136.21, 136.72, 137.80, 143.96, 146.82, and
151.91; DEPT (DMSO‐d6, 100 MHz) δ (ppm): 32.46, 38.15 (2CH2),
116.52, 127.70, 128.11, 128.23, 128.75, 128.89(2), 128.93(2),
129.64(2), and 129.74(3) (14CH); Anal. calcd. for C23H18N4OS
(398.48): C, 69.33; H, 4.55; N, 14.06. Found: C, 69.03%; H, 4.98%; N,
14.51%.
Isopropyl 2‐((5‐(2‐isopropoxy‐2‐oxoethyl)‐4‐oxo‐4,5‐dihydro‐[1,2,4]‐
triazolo[4,3‐a]quinoxalin‐1‐yl)thio)acetate (25c)
Yellow crystals (yield, 60%); m.p. = 141–143°C. IR (KBr, cm−1): 3,079
(CH aromatic), 2,983 (CH aliphatic), 1,735 (C═O), and 1,586 (C═N);
1H NMR (DMSO‐d6) δ ppm: 1.12 (d, 6H, J = 6.40 Hz, 2CH3), 1.23 (d,
6H, J = 6.40 Hz, 2CH3), 4.23 (s, 2H, SCH2), 4.32 (s, 2 H, –NHCH2),
4.91 (m, 1H, –CH), 4.98 (m, 1H, –CH), 7.64 (dd, 1H, J = 7.5, 8.1 Hz, Ar‐
H, H‐8 of quinoxaline), 7.70 (dd, 1H, J = 7.5, 8.0 Hz, Ar‐H, H‐7 of
quinoxaline), 7.85 (d, 1H, J = 8.0 Hz, Ar‐H, H‐6 of quinoxaline), and
8.58 (d, 1H, J = 8.1 Hz, Ar‐H, H‐9 of quinoxaline); 13C NMR (DMSO‐
d6, 100 MHz) δ (ppm): 21.80 (2C), 21.97 (2C), 31.86, 36.58, 69.23,
69.57, 116.64, 125.24, 128.35, 128.56, 128.71, 136.14, 143.93,
151.51, 167.63, and 168.08 (2C); DEPT (DMSO‐d6, 100 MHz) δ
(ppm); 21.80 (2C), 21.97 (2C), 31.86, 36.57, 69.23, 69.57, 116.64,
128.35, 128.56, and 128.71; Anal. calcd. for C19H22N4O5S (418.47):
C, 54.53; H, 5.30; N, 13.39. Found: C, 54.88%; H, 5.44%; N, 13.85%.
|
4.1.6
General procedure for the synthesis of
compounds 25a–d and 26
A mixture of the dipotassium salt 17 (2.94 g, 0.01 mol) and the
appropriate 2‐chloroacetate or 2‐chloropropanoate derivatives
(0.025 mol), namely, methyl 2‐chloroacetate, ethyl 2‐chloroacetate,
isopropyl 2‐chloroacetate and isobutyl 2‐chloroacetate, and methyl
2‐chloropropanoate in dry DMF (40 ml) was heated on a water bath
for 2 hr. After cooling, the reaction mixture was poured onto ice
water (300 ml). Then, DCM (100 ml) was added. The organic layer
was separated using separating funnel, dried over anhydrous NaSO4,
and evaporated under vacuum. The formed precipitate was crystal-
lized from ethanol to afford the corresponding compounds 25a–d,
and 26, respectively.
Isobutyl 2‐((5‐(2‐isobutoxy‐2‐oxoethyl)‐4‐oxo‐4,5‐dihydro‐[1,2,4]‐
triazolo[4,3‐a]quinoxalin‐1‐yl)thio)acetate (25d)
Methyl 2‐((5‐(2‐methoxy‐2‐oxoethyl)‐4‐oxo‐4,5‐dihydro‐[1,2,4]tria-
zolo‐[4,3‐a]quinoxalin‐1‐yl)thio)acetate (25a)
Yellow crystals (yield, 60%); m.p. = 120–121°C. IR (KBr, cm−1): 3,079
(CH aromatic), 2,983 (CH aliphatic), 1,735 (2C═O), and 1,586 (C═N);
1H NMR (DMSO‐d6) δ (ppm): 0.78 (t, 6H, J = 6.5 Hz, CH (CH3)2), 0. 87
(t, 6H, J = 6.5 Hz, CH(CH3)2), 1.78–1.83 (m, 1H, –CH(CH3)2),
1.88–1.91 (m, 1H, –CH(CH3)2), 3.82 (d, 2H, J = 7 Hz, Hz, OCH2), 3.92
(d, 2H, J = 6.5 Hz, OCH2), 4.26 (s, 2H, SCH2), 4.37 (s, 2H, NCH2), 7.63
(dd, 1H, J = 7.4, 8.5 Hz, Ar‐H, H‐8 of quinoxaline), 7.70 (dd, 1H, J =
7.4, 8.1 Hz, Ar‐H, H‐7 of quinoxaline), 7.82 (d, 1H, J = 8.1 Hz, Ar‐H, H‐
6 of quinoxaline), 8.51 (d, 1H, J = 8.5 Hz, Ar‐H, H‐9 of quinoxaline);
13C NMR (DMSO‐d6, 100 MHz) δ (ppm): 19.07(2), 19.19(2), 27.64,
27.72, 31.44, 36.11, 71.40, 71.55, 116.52, 125.13, 128.30, 128.58,
128.67, 136.08, 143.93, 146.67, 151.41, 168.18, 168.54; DEPT
(DMSO‐d6, 100 MHz) δ (ppm): 19.07(2), 19.19(2) (4CH3), 27.64,
White powder (yield, 80%); m.p. = 155–157°C. IR (KBr, cm−1): 3,089
(CH aromatic), 2,930 (CH aliphatic), 1,735 (C═O), and 1,586 (C═N);
1H NMR (DMSO‐d6) δ (ppm): 3.67 (s, 3H, OCH3), 3.73 (s, 3H, OCH3),
4.27 (s, 2H, SCH2), 4.40 (s, 2H, NCH2), 7.57 (dd, 1H, J = 6.4, 7.8 Hz,
Ar‐H, H‐8 of quinoxaline), 7.61 (dd, 1H, J = 6.4, 8.0 Hz, Ar‐H, H‐7 of
quinoxaline), 7.78 (d, 1H, J = 8.0 Hz, Ar‐H, H‐6 of quinoxaline), and
8.41 (d, 1H, J = 7.8 Hz, Ar‐H, H‐9 of quinoxaline); 13C NMR (DMSO‐
d6, 100 MHz) δ (ppm): 31.28, 35.99, 52.91, 53.03, 116.39, 125.03,
128.18, 128.47, 128.67, 135.96, 143.90, 146.57, 151.23, 168.70, and
169.23; DEPT (DMSO‐d6, 100 MHz) δ (ppm): 31.28, 35.89 (2CH3),
52.91, 53.03 (CH2), 116.39, 128.19, 128.48, and 128.68 (4CH); MS
(m/z): 362 (M+, 1.7%), 319 (100% base beak), 287 (11.54%), and 188

EISSA ET AL.
19 of 22
|
27.72, 31.44, 36.11 (4CH2), 71.40, 71.55, 116.52, 128.30, 128.58,
128.67 (6CH); Anal. calcd. for C21H26N4O5S (446.52): C, 56.49; H,
5.87; N, 12.55. Found: C, 56.12%; H, 5.55%; N, 13.01%.
C27H20N6O7S (572.55): C, 56.64; H, 3.52; N, 14.68. Found: C,
56.92%; H, 3.95%; N, 15.01%.
2‐(4‐Oxo‐1‐((2‐oxo‐2‐((4‐sulfamoylphenyl)amino)ethyl)thio)‐[1,2,4]‐
triazolo[4,3‐a]quinoxalin‐5(4H)‐yl)‐N‐(4‐sulfamoylphenyl)acetamide
(28a)
Methyl 2‐((5‐(1‐methoxy‐1‐oxopropan‐2‐yl)‐4‐oxo‐4,5‐dihydro‐
[1,2,4]triazolo[4,3‐a]quinoxalin‐1‐yl)thio)propanoate (26)
Brown crystals (yield, 82%); m.p. = 230–231°C. IR (KBr, cm−1): 3,254,
3,190 (NH2 and 2NH overlapped), 3,056 (CH aromatic), 2,924 (CH
aliphatic), 1,675 (C═O), 1,594 (C═N), and 1,154 (SO2); 1H NMR
(DMSO‐d6) δ ppm: 3.73 (s, 2H, SCH2), 4.43 (s, 2H, NCH2), 7.34 (br, s,
4H, exchangeable with D2O, 2NH2), 7.10–7.22 (m, 8H, Ar‐H, of 2
phenyl), 7.40 (dd, 1H, J = 7.5, 8.0 Hz, Ar‐H, H‐8 of quinoxaline), 7.41
(dd, 1H, J = 7.5, 8.1 Hz, Ar‐H, H‐7 of quinoxaline), 7.56 (d, 1H, J = 8.1
Hz, Ar‐H, H‐6 of quinoxaline), 8.14 (d, 1H, J = 8.0 Hz, Ar‐H, H‐9 of
quinoxaline), 10.77 (s, 1H, exchangeable with D2O, –SCONH), and
10.85 (s, 1H, exchangeable with D2O, –NCONH); 13C NMR (DMSO‐
d6, 100 MHz) δ (ppm): 34.28, 51.06, 119.36 (4C), 127.28 (4C), 128.37
(2C), 128.63, 136.01 (2C), 133.00, 137.32, 139.01, 142.02, 142.32,
146.87, 155.06, 159.05, and 167.05 (2C): DEPT (DMSO‐d6, 100 MHz)
δ (ppm): 34.38, 51.06, 119.36 (4C), 127.30 (4C), 128.26, 128.56,
133.00, and 137.32. Anal. calcd. for C25H22N8O7S3 (642.68): C,
46.72; H, 3.45; N, 17.44. Found: C, 46.44%; H, 3.05%; N, 17.91%.
Yellow crystals (yield, 70%); m.p. = 173–175°C. IR (KBr, cm−1): 3,053
(CH aromatic), 2,953 (CH aliphatic), 1,742 (C═O), and 1,593 (C═N);
1H NMR (DMSO‐d6) δ ppm: 1.60 (d, 3H, J = 7.20 Hz, SCHCH3), 1.67
(d, 3H, J = 7.20 Hz, NCHCH3), 3.55 (s, 3H, OCH3), 3.73 (s, 3H, OCH3),
4.53 (q, 1H, J = 7.20 Hz, SCHCH3), 4.76 (q, 1H, J = 7.20 Hz, SCHCH3),
7.57 (dd, 1H, J = 7.2, 8.4 Hz, Ar‐H, H‐8 of quinoxaline), 7.76 (dd, 1H, J
= 7.4, 8.0 Hz, Ar‐H, H‐7 of quinoxaline), 7.78 (d, 1H, J = 8.0 Hz, Ar‐H,
H‐6 of quinoxaline), and 8.65 (d, 1H, J = 8.4 Hz, Ar‐H, H‐9 of
quinoxaline); 13C NMR (DMSO‐d6, 100 MHz) δ (ppm): 17.62, 17.96,
40.94, 45.78, 53.04, 53.10, 116.43, 125.19, 128.33, 128.53, 128.64,
136.03, 143.65, 144.80, 150.91, 171.40, and 172.20; DEPT (DMSO‐
d6, 100 MHz) δ (ppm): 17.62, 17.96, 53.04, 53.10 (4CH3), 40.94,
45.78, 116.43, 128.33, 128.53, and 128.64 (6CH); Anal. calcd. for
C17H18N4O5S (390.41): C, 52.30; H, 4.65; N, 14.35. Found: C,
52.62%; H, 5.05%; N, 14.05%.
2‐(4‐Oxo‐1‐((2‐oxo‐2‐((4‐(N‐(pyridin‐2‐yl)sulfamoyl)phenyl)amino)‐
ethyl)thio)‐[1,2,4]triazolo[4,3‐a]quinoxalin‐5(4H)‐yl)‐N‐(4‐(N‐(pyri-
|
4.1.7
General procedure for the synthesis of
compounds 27 and 28a,b
din‐2‐yl)sulfamoyl)phenyl)acetamide (28b
)
A mixture of the dipotassium salt 17 (2.94 g, 0.01 mol) and the
appropriate 2‐chloroacetamido derivatives (0.02 mol), namely, 4‐(2‐
chloroacetamido)benzoic acid, 2‐chloro‐N‐(4‐sulfamoylphenyl)aceta-
mide, and 2‐chloro‐N‐(4‐(N‐(pyridin‐2‐yl)sulfamoyl)phenyl)acetamide
in dry DMF (30 ml) was heated on a water bath for 4 hr. After
cooling, the reaction mixture was poured onto ice water (250 ml)
with continuous stirring. The formed precipitate was filtered, washed
with water, and crystallized from ethanol to afford the corresponding
compounds 27 and 28a,b, respectively.
Brown powder (yield, 75%); m.p. = 228–229°C. IR (KBr, cm−1): 3,293
(NH), 3,039 (CH aromatic), 2,965 (CH aliphatic), 1,687 (C–O), 1,592
(C═N), and 1,136 (SO2); 1H NMR (DMSO‐d6) δ (ppm): 4.37 (s, 2H,
SCH2), 4.45 (s, 2H, NCH2), 6.81–6.85 (m, 2H, Ar‐H), 7.12 (d, 2H, Ar‐
H), 7.61–8.05 (m, 13H, Ar‐H), 8.37 (d, 2H, Ar‐H), 10.22 (s, 1H,
exchangeable with D2O, –SCONH), 10.53 (s, 2H, exchangeable with
D2O, –NCONH), and 10.98 (s, 2H, exchangeable with D2O, –SO2NH);
13C NMR (DMSO‐d6, 100 MHz) δ (ppm): 34.38, 38.89, 114.19 (3C),
116.05 (2C), 119.27 (6C), 124.92, 128.23 (5C), 135.88 (2C), 136.48,
136.62, 140.84, 142.29, 142.62, 143.61, 143.81, 146.73, 151.61,
153.50 (2C), 166.21, and 167.00 (2C); DEPT (DMSO‐d6, 100 MHz) δ
(ppm): 34.38, 38.89 (2CH2), 114.21(2), 116.04(2), 116.29(2),
119.28(4), 124.92(2), 128.25(4), 142.62(2), and 143.61(2) (20CH);
Anal. calcd. for C35H28N10O7S3 (796.13): C, 52.76; H, 3.54; N, 17.58.
Found: C, 52.47%; H, 3.22%; N, 17.25%.
4‐(2‐((5‐(2‐((4‐Carboxyphenyl)amino)‐2‐oxoethyl)‐4‐oxo‐4,5‐dihydro‐
[1,2,4]triazolo[4,3‐a]quinoxalin‐1‐yl)thio)acetamido)benzoic acid
(27)
Beige crystal (yield, 60%); m.p. = 267–278°C. IR (KBr, cm−1): 3,590
(OH), 3,082 (CH aromatic), 2,920 (CH aliphatic), 1,685 (C═O), and
1,601 (C═N); 1H NMR (DMSO‐d6) δ (ppm): 4.31 (s, 2H, SCH2), 4.44 (s,
2H, NCH2), 7.46 (dd, 1H, J = 7.5, 8.1 Hz, Ar‐H, H‐8 of quinoxaline),
7.59 (dd, 1H, J = 7.5, 8.1 Hz, Ar‐H, H‐7 of quinoxaline), 7.70 (d, 1H, J =
8.1 Hz, Ar‐H, H‐6 of quinoxaline), 7.84–7.89 (m, 8H, Ar‐H, phenyl),
8.39 (d, 1H, J = 8.1 Hz, Ar‐H, H‐9 of quinoxaline), 10.67 (s, 1H,
exchangeable with D2O, –SCONH), 10.74 (s, 1H, exchangeable with
D2O, –NCONH), and 12.73 (br s, 2H, exchangeable with D2O, 2OH);
13C NMR (DMSO‐d6, 100 MHz) δ (ppm): 34.48, 49.06, 118.96(4),
124.96, 125.83, 125.94, 128.07, 128.29, 128.52, 130.38(2),
130.88(2), 135.94, 143.00, 143.30, 143.83, 146.81, 151.66, 166.14,
166.89, 167.37, and 167.40(2); MS (m/z): 572 (M+, 26.25%), 551
(100% base beak), 396 (56.61%), and 216 (20%); Anal. calcd. for
|
4.2
Biological evaluation
|
4.2.1
In vitro antiproliferative activity
Antiproliferative activity screening of the newly synthesized com-
pounds was carried out against three human cancer cell lines namely
Hep G‐2, Hep‐2, and Caco‐2. The cell lines were obtained from ATCC
(American Type Culture Collection) via the Holding company
for biological products and vaccines (Vacsera, Cairo, Egypt). The
anti‐cancer activity was measured quantitatively using the neutral
red assay protocol as described by Borenfreund and Puerner[41] as
follows:

20 of 22
EISSA ET AL.
|
The cell lines were cultured on Dulbecco’s modified Eagle Media
(DMEM; Lonza) supplemented with 200 mM of L‐glutamine and 10%
of fetal bovine serum (Gibco‐BRL). The test compounds were
dissolved in a mixture of dimethyl sulfoxide and DMEM with ratio
4:100 (v/v), respectively. An initial dose of (1 mg/ml) was tested on all
cell lines and subsequenced by seven more dilutions using the value
of 50% as a dilution factor from the starting dose. The cells were
seeded with a concentration of 6 × 104 cell/ml for 24 hr in flat‐
bottom 96‐well plates at 5% CO2 and 37°C until semiconfluent cell
layer was obtained, then, treated with 100 µl of each of serially
diluted compounds. After 48 hr, the anticancer activity of the
compounds was measured quantitatively by enzyme‐linked immuno-
sorbent assay microplate reader at wavelength 540 nm using neutral
red assay protocol.
(the difference between DNA/methyl green complex and free
cabinol) provides the simplest means for detecting the DNA‐binding
affinity and relative binding strength. IC50 values were determined
using the GraphPad Prism 5.0 software. The reaction was performed
as follows.
A mixture of calf thymus DNA (10 mg) and methyl green (20 mg)
(Sigma‐Aldrich) in 100 ml of 0.05 M Tris–HCl buffer (pH 7.5)
containing 7.5 mM MgSO4. Then, the mixture was stirred for 24 hr at
37°C. The test samples were dissolved in ethanol and dispensed into
wells of a 96‐well microtiter tray at a concentration of 10, 100 and
1,000 µM. From each well, the excess solvent was removed under
vacuum followed by an addition of 200 µl of the DNA/methyl green
solution. The test samples were incubated in the dark at an ambient
temperature. After 24 hr, the absorbance of each sample was
determined at 642.5–645 nm. Readings were corrected for initial
absorbance and normalized as the percentage of the untreated DNA/
methyl green absorbance value.
|
4.2.2
Measurement of Topo II activity
Twelve compounds that showed high antiproliferative activities (16,
18b, 19b, 19c, 22, 23, 24a, 25a, 25b, 26, 27, and 28b) were further
evaluated to assess their Topo II inhibitory activities. In this test, a
Topo II drug screening kit (TopoGEN, Inc., Columbus) was utilized to
determine the Topo II activity according to the method described by
Ibrahim et al.[19] Doxorubicin was used as a reference drug in this
test.
|
4.2.4
Flow cytometric analysis of cell cycle and
apoptosis
According to the method described by Léonce et al.,[46] flow
cytometric analysis was carried out. In this test, PI is used to
discriminate between living cells from dead ones or for cell‐cycle
analysis. The cell‐cycle analysis is based on the stoichiometric binding
of PI to intracellular DNA. Hep G‐2 cells were seeded in 100‐mm
culture dishes and immediately incubated with the test compound
19b. After 24 hr, the cells were washed, fixed, and stained in
phosphate‐buffered saline (PBS), Triton X‐100 (0.1%), RNase A
(1 mg/ml), and 0.5 ml of PI in PBS (1 mg/ml). Then, the DNA content
was determined with a flow cytometer and the distribution of cells in
pre‐G1 (apoptotic cells), G0/G1, S, and G2/M peaks were quantified
by histogram analysis. The obtained data represent three indepen-
dent experiments.
A typical enzyme reaction contained a mixture of human Topo
II (2 µl), substrate supercoiled pHot1 DNA (0.25 µg), 50 µg/ml test
compound (2 µl), and assay buffer (4 µl). The reaction started upon
incubation of the mixture in 37°C for 30 min. The reaction was
terminated by addition of 10% sodium dodecylsulfate (2 µl) and
proteinase K (50 µg/ml) at 37°C for 15 min followed by incubation
for 15 min at 37°C. Then, the DNA was run on 1% agarose gel in
BioRad gel electrophoresis system for 1–2 hr followed by staining
with GelRed™ stain for 2 hr and destained for 15 min with TAE
buffer (Tris base, acetic acid and EDTA). The gel was imaged via
BioRad’s Gel Doc™ EZ system. Both supercoiled and linear strands
DNA were incorporated in the gel as markers for DNA–Topo II
intercalators. The results of IC50 values were calculated using the
GraphPad Prism version 5.0. Each reaction was performed in
duplicate, and at least three independent determinations of each
IC50 were made.
|
4.2.5
Apoptosis using annexin V–fluorescein
isothiocyanate (FITC) assay
Further apoptotic effects of compound 19b against Hep G‐2 cells
were estimated using an Annexin V–FITC Apoptosis Detection Kit
I (Becton Dickenson, Franklin Lakes, NJ) following the manufac-
turer's protocol. In this test, Hep G‐2 cells were treated with
compound 19b (2.5 μg/ml) for 24 and 48 hr. Then, the cells were
collected through centrifugation at 2,000 rpm for 5 min. The
supernatant was rejected, and the pellets were washed in 100 μl of
binding buffer. Next, the cells were incubated for 15 min on ice in
the dark with a mixture of 5 μl of PI and 5 μl of annexin V. Then,
400 μl of binding buffer (10 mM 4‐(2‐hydroxyethyl)‐1‐piperazi-
neethanesulfonic acid, 140 mM NaCl, and 2.5 mM CaCl2 at pH 7.4)
|
4.2.3
DNA/methyl green assay
Twelve compounds that exhibited significant antiproliferative activ-
ities (16, 18b, 19b, 19c, 22, 23, 24a, 25a, 25b, 26, 27, and 28b) were
further evaluated to determine their DNA‐binding affinities. Doxor-
ubicin as a DNA intercalator was used as a positive control. In this
test, methyl green dye can bind with DNA to form colored reversible
complex of DNA/methyl green. These complexes stay stable at
neutral pH. Upon addition of intercalating agents, the methyl green is
displaced from DNA with the addition of H2O molecule to the dye
resulting in the formation of the colorless carbinol, leading to a
dramatic decrease in spectrophotometric absorbance.[43] ΔA value
were loaded and the analysis was completed using
a flow
cytometer. The untreated cells were considered as negative
control.[47]

EISSA ET AL.
21 of 22
|
|
4.2.6
Gene expression analysis (RNA extraction
ORCID
and real‐time RT‐PCR for tested genes)
Ibrahim H. Eissa
Amany Belal
http://orcid.org/0000-0002-6955-2263
http://orcid.org/0000-0003-1045-0163
http://orcid.org/0000-0002-8922-9770
According to the manufacturer’s protocol, Gene–JET RNA Purifica-
tion Kit (Thermo Fisher Scientific) was used for extraction of the total
RNA from treated and controlled cells. Thermo Scientific cDNA
Synthesis Kit was used for the synthesis of complementary DNA
(cDNA). The quantification of Bcl‐2 and Bax genes was done by real‐
time PCR using the Maxima SYBR Green/ROX qPCR Master Mix. RT‐
PCR was performed in a total reaction volume of 25 μl, which
included 2 μl cDNA, 8 μl forward and reverse primer, 2.5 μl nuclease‐
free water, and 12.5 μl SYBR green PCR master mix according to the
manufacturer's protocol. The thermal cycling protocol of RT was
carried out as follows: 50°C for 2 min, 95°C for 15 min, 40 cycles of
15 s at 94°C, 30 s at 50°C, and 30 s at 72°C.[53] Primer sequences are
the following:
Khaled El‐Adl
REFERENCES
[1] WHO, Cancer, Fact Sheet, 2018 (accessed October 2018). Retrieved
from http://www.who.int/news‐room/fact‐sheets/detail/cancer.
[2] E. Espinosa, P. Zamora, J. Feliu, M. González Barón, Cancer Treat. Rev.
2003, 29, 515.
[3] L. H. Hurley, Nat. Rev. Cancer 2002, 2, 188.
[4] J. C. Wang, Nat. Rev. Mol. Cell. Biol. 2002, 3, 430.
[5] H. Lodish, A. Berk, S.L. Zipursky, P. Matsudaira, D. Baltimore,
J. Darnell, Mol. Cell. Biol. 2000.
[6] W. A. Denny, Expert Opin. Emerg. Drugs 2004, 9, 105.
[7] Y. Pommier, E. Leo, H. Zhang, C. Marchand, Chem. Biol. 2010,
17, 421.
Bcl‐2 F: 5′‐CCTGTGGACTGAGTACC‐3′. Bcl‐2 R: 5′‐GAGACAG
CCAGGAGAAATCA‐3′.
[8] M. A. Hogan, D. S. McKinney, in Comprehensive Review for NCLEX‐PN,
2nd ed., Pearson, New Jersey 2012.
Bax F: 5′‐GTTTCATCCAGGATCGAGCAG‐3′. Bax R: 5′‐CATCTT
CTTCCAGATGGTGA‐3′.
[9] B. Kaina, Biochem. Pharmacol. 2003, 66, 1547.
[10] J. L. Nitiss, Nat. Rev. Cancer 2009, 9, 338.
[11] R. Martinez, L. Chacon‐Garcia, Curr. Med. Chem. 2005, 12, 127.
[12] L. F. Liu, Ann. Rev. Biochem. 1989, 58, 351.
|
4.3
Molecular docking
Docking studies
[13] A. Chilin, G. Marzaro, C. Marzano, L. D. Via, M. G. Ferlin, G. Pastorini,
A. Guiotto, Bioorg. Med. Chem. 2009, 17, 523.
|
4.3.1
[14] T. D. Shenkenberg, Ann. Intern. Med. 1986, 105, 67.
[15] C. Avendano, J. Menéndez, in Medicinal Chemistry of Anticancer Drugs,
2nd ed., Elsevier, Amsterdam 2008, pp. 199–228.
Docking studies were performed using Discovery Studio 4.0, where
the binding affinities of the designed compounds against the target
macromolecule (DNA–Topo II complex) were evaluated. The three‐
dimensional (3D) crystal structure of the target complex was
retrieved from the Protein data Bank (PDB ID: 4G0U, resolution:
2.7 Å). First, the ligand and water molecules were deleted from the
target molecule, leaving only the protein and DNA. Then, the atoms
with incorrect valence were corrected using the Valence monitor
option. Then, the energy of the DNA–Topo complex was minimized
by applying CHARMM and MMFF94 force fields as described in the
Supporting Information.[54–57] The active binding site from the
receptor cavity was defined and prepared for docking procedure as
described in the Supporting Information. The structures of the
synthesized compounds and reference ligands, doxorubicin, and
amsacrine (cocrystallized ligand) were sketched using ChemBioDraw
Ultra 14.0 and saved in MDL‐SD file format. Next, the SD file was
opened, 3D structures were protonated and the energy was
minimized by applying CHARMM and MMFF94 force fields. The
sequence of energy minimization of the designed compounds and the
reference ligands was carried out as described in the Supporting
Information.
[16] Y. C. Liaw, Y. G. Gao, H. Robinson, G. A. van der Marel, J. H. van
Boom, A. H. J. Wang, Biochemistry 1989, 28, 9913.
[17] B. A. Armitage, in DNA Binders and Related Subjects, Springer, New
York 2005, pp. 55–76.
[18] S. Takenaka, M. Takagi, Bull. Chem. Soc. Japan 1999, 72, 327.
[19] M.‐K. Ibrahim, A. A. Abd‐Elrahman, R. R. A. Ayyad, K. El‐Adl,
A. M. Mansour, I. H. Eissa, Bull. Fac. Pharm. Cairo Univ. 2013, 51,
101–111.
[20] M. K. Ibrahim, I. H. Eissa, A. E. Abdallah, A. M. Metwaly, M. M.
Radwan, M. A. ElSohly, Bioorg. Med. Chem. 2017, 25, 1496.
[21] A.‐G. A. El‐Helby, R. R. A. Ayyad, K. El‐Adl, H. Sakr, A. A.
Abd‐Elrahman, I. H. Eissa, A. Elwan, Med. Chem. Res. 2016, 25, 3030.
[22] B. Oyallon, M. Brachet‐Botineau, C. Logé, P. Bonnet, M. Souab, T. Robert,
S. Ruchaud, S. Bach, P. Berthelot, F. Gouilleux, M. C. Viaud‐Massuard, C.
Denevault‐Sabourin, Eur. J. Med. Chem. 2018, 154, 101.
[23] M. G. Varrica, C. Zagni, P. G. Mineo, G. Floresta, G. Monciino, V.
Pistarà, A. Abbadessa, A. Nicosia, R. M. Castilho, E. Amata, A.
Rescifina, Eur. J. Med. Chem. 2018, 143, 583.
[24] Y.‐S. Park, W.‐S. Shin, C.‐S. Kim, C. M. Ahn, X.‐F. Qi, S.‐K. Kim, J.
Biochem. Mol. Toxicol. 2018, 14, 9.
[25] M. K. Ibrahim, M. S. Taghour, A. M. Metwaly, A. Belal, A. B. M.
Mehany, M. A. Elhendawy, M. M. Radwan, A. M. Yassin, N. M. El‐
Deeb, E. E. Hafez, M. A. ElSohly, I. H. Eissa, Eur. J. Med. Chem. 2018,
155, 117.
[26] W. M. Eldehna, M. F. Abo‐Ashour, A. Nocentini, P. Gratteri, I. H.
Eissa, M. Fares, O. E. Ismael, H. A. Ghabbour, M. M. Elaasser, H. A.
Abdel‐Aziz, C. T. Supuran, Eur. J. Med. Chem. 2017, 139, 250.
[27] A. A. Gaber, A. H. Bayoumi, A. M. El‐Morsy, F. F. Sherbiny, A. B. M.
Mehany, I. H. Eissa, Bioorg. Chem. 2018, 80, 375.
CDOCKER protocol was used for carrying out the docking
studies, which employs CHARMM (Chemistry at Harvard Macro-
molecular Mechanics)‐based molecular dynamics scheme to dock
ligands into a receptor‐binding site. A maximum of 10 conformers
was considered for each molecule in the docking analysis. Finally, the
most ideal pose was selected according to the minimum free energy
of the DNA–Topo II ligand interactions.
[28] A. M. El‐Naggar, M. M. Abou‐El‐Regal, S. A. El‐Metwally, F. F.
Sherbiny, I. H. Eissa, Mol. Divers. 2017, 21, 967.
[29] S. A. Elmetwally, K. F. Saied, I. H. Eissa, E. B. Elkaeed, Bioorg Chem.
2019, 88, 102944.

22 of 22
EISSA ET AL.
|
[30] I. H. Eissa, A. M. El‐Naggar, M. A. El‐Hashash, Bioorg. Chem. 2016, 67,
43.
[50] D. Westphal, R. M. Kluck, G. Dewson, Cell Death Differ. 2014, 21, 196.
[51] A. Kumar, U. Bora, Interdiscip. Sci.: Comp. Life Sci. 2014, 6, 285.
[52] I. H. Eissa, A. M. El‐Naggar, N. E. A. A. El‐Sattar, A. S. A. Youssef,
Anticancer Agents Med. Chem. 2018, 18, 195.
[31] I. H. Eissa, A. M. El‐Naggar, N. E. A. A. El‐Sattar, A. S. A. Youssef,
Anticancer Agents Med. Chem. 2018, 18, 195.
[32] D. E. Graves, L. M. Velea, Curr. Org. Chem. 2000, 4, 915.
[33] F. Gago, Methods 1998, 14, 277.
[53] K. J. Livak, T. D. Schmittgen, Methods 2001, 25, 402.
[54] A. G. A. El‐Helby, R. R. Ayyad, H. M. Sakr, A. S. Abdelrahim, K. El‐Adl,
F. S. Sherbiny, I. H. Eissa, M. M. Khalifa, J. Mol. Struct. 2017, 1130,
333.
[34] G. Minotti, P. Menna, E. Salvatorelli, G. Cairo, L. Gianni, Pharmacol.
Rev. 2004, 56, 185.
[35] J. Gallego, A. R. Ortiz, B. Pascual‐Teresa, F. Gago, J. Comp. Aided Mol.
Des. 1997, 11, 114.
[55] M. K. Ibrahim, I. H. Eissa, M. S. Alesawy, A. M. Metwaly, M. M.
Radwan, M. A. ElSohly, Med. Chem. 2017, 25, 4723.
[36] S. A. Bailey, D. E. Graves, R. Rill, Biochemistry 1994, 33, 11493.
[37] P. Traxler, P. Furet, Pharmacol. Ther. 1999, 82, 195.
[38] D. R. Romer, J. Heterocyclic Chem. 2009, 46, 317.
[39] R. Sarges, H. R. Howard, R. G. Browne, L. A. Lebel, P. A. Seymour, B.
K. Koe, J. Med. Chem. 1990, 33, 2240.
[56] K. M. El‐Gamal, A. M. El‐Morsy, A. M. Saad, I. H. Eissa, M. Alswah, J.
Mol. Struct. 2018, 1166, 15.
[57] M. A. El‐Zahabi, E. R. Elbendary, F. H. Bamanie, M. F. Radwan, S. A.
Ghareib, I. H. Eissa, Bioorg. Chem. 2019, 91, 103115.
[40] M. Alswah, A. Ghiaty, A. El‐Morsy, K. El‐Gamal, ISRN Org. Chem.
2013, 2013, 1.
SUPPORTING INFORMATION
[41] E. Borenfreund, J. A. Puerner, Toxicol. Lett. 1985, 24, 119.
[42] P. Furet, G. Caravatti, N. Lydon, J. P. Priestle, J. M. Sowadski,
U. Trinks, P. Traxler, J. Comp. Aided Mol. Des. 1995, 9, 465.
[43] N. S. Burres, A. Frigo, R. R. Rasmussen, J. B. McAlpine, J. Nat. Prod.
1992, 55, 1582.
Additional supporting information may be found online in the
Supporting Information section.
[44] S. W. Lowe, A. W. Lin, Carcinogenesis 2000, 21, 485.
[45] C. Riccardi, I. Nicoletti, Nat. Protoc. 2006, 1, 1458.
[46] S. Léonce, V. Pérez, S. Lambel, D. Peyroulan, F. Tillequin, S. Michel,
M. Koch, B. Pfeiffer, G. Atassi, J. A. Hickman, A. Pierré, Mol.
Pharmacol. 2001, 60, 1383.
How to cite this article: Eissa IH, Metwaly AM, Belal A, et al.
Discovery and antiproliferative evaluation of new
quinoxalines as potential DNA intercalators and
[47] K. K.‐W. Lo, T. K.‐M. Lee, J. S.‐Y. Lau, W.‐L. Poon, S.‐H. Cheng, Inorg.
Chem. 2008, 47, 200.
topoisomerase II inhibitors. Arch Pharm Chem Life Sci.
2019;e1900123. https://doi.org/10.1002/ardp.201900123
[48] Y. Tsujimoto, C. M. Croce, Proc. Natl. Acad. Sci. USA 1986, 83, 5214.
[49] J. Pawlowski, A. S. Kraft, Proc. Natl. Acad. Sci. USA 2000, 97, 529.