Synthesis, characterization and nucleic acid binding studies of mononuclear copper(II) complexes derived from azo containing O, O donor ligands

Article abstract of DOI:10.1080/15257770.2018.1508694

Azo linked salicyldehyde and a new 2-hydroxy acetophenone based ligands (HL¹ and HL²) with their copper(II) complexes [Cu(L¹)₂] (1) and [Cu(L²)₂] (2) were synthesized and characterized by s

Full text of DOI:10.1080/15257770.2018.1508694

Nucleosides, Nucleotides and Nucleic Acids
ISSN: 1525-7770 (Print) 1532-2335 (Online) Journal homepage: http://www.tandfonline.com/loi/lncn20
Synthesis, characterization and nucleic acid
binding studies of mononuclear copper(II)
complexes derived from azo containing O, O donor
ligands
Mamta Tripathi, Chandra Gopal Giri, Devashish Das, Rama Pande, Sougata
Sarkar, Santanab Giri, Gourisankar Roymahapatra & Avijit Sarkar
To cite this article: Mamta Tripathi, Chandra Gopal Giri, Devashish Das, Rama Pande,
Sougata Sarkar, Santanab Giri, Gourisankar Roymahapatra & Avijit Sarkar (2018): Synthesis,
characterization and nucleic acid binding studies of mononuclear copper(II) complexes derived
from azo containing O, O donor ligands, Nucleosides, Nucleotides and Nucleic Acids, DOI:
10.1080/15257770.2018.1508694
To link to this article: https://doi.org/10.1080/15257770.2018.1508694
Published online: 13 Nov 2018.
Submit your article to this journal
Article views: 18
View Crossmark data
Full Terms & Conditions of access and use can be found at
http://www.tandfonline.com/action/journalInformation?journalCode=lncn20

NUCLEOSIDES, NUCLEOTIDES AND NUCLEIC ACIDS
https://doi.org/10.1080/15257770.2018.1508694
Synthesis, characterization and nucleic acid binding
studies of mononuclear copper(II) complexes derived
from azo containing O, O donor ligands
Mamta Tripathia , Gopal Chandra Girib, Devashish Dasc, Rama Pandea,
Sougata Sarkard, Santanab Girie, Gourisankar Roymahapatraf, and Avijit
Sarkarb
aSchool of Studies in Chemistry, Pt. Ravishankar Shukla University, Raipur, Chhattisgarh, India; bDepartment
c
of Chemistry, Bhairab Ganguly College, Kolkata, India; DNA Skew Analytics Pvt. Ltd, Bengaluru,
d
Karnataka, India; Department of Chemistry, Ramakrishna Mission Vivekananda Centenary
e
College, Kolkata, India; Department of Chemistry, National Institute of Technology Rourkela,
f
Rourkela, India; Department of Applied Sciences, Haldia Institute of Technology, Haldia, India
ABSTRACT
ARTICLE HISTORY
Received 10 April 2018
Accepted 30 July 2018
Azo linked salicyldehyde and a new 2-hydroxy acetophenone
based ligands (HL1 and HL2) with their copper(II) complexes
[Cu(L1)2] (1) and [Cu(L2)2] (2) were synthesized and characterized
by spectroscopic methods such as 1H, 13C NMR, UV–Vis spec-
troscopy and elemental analyses. Calculation based on Density
Functional Theory (DFT), have been performed to obtain opti-
mized structures. Binding studies of these copper (II) complexes
with calf thymus DNA (ct-DNA) and torula yeast RNA (t-RNA)
were analyzed by absorption spectra, emission spectra and
Viscosity studies and Molecular Docking techniques. The absorp-
tion spectral study indicated that the copper(II) complexes of 1
and 2 had intrinsic binding constants with DNA or RNA in the
range of 7.6 0.2 ꢀ 103 M21 or 6.5 0.3 ꢀ 103M21 and 5.7 0.4 ꢀ
104 M21 or 1.8 0.5 ꢀ 103 M21 respectively. The synthesized
compounds and nucleic acids were simulated by molecular dock-
ing to explore more details mode of interaction of the complexes
and their orientations in the active site of the receptor.
KEYWORDS
Azo; copper complexes;
ct-DNA; molecular
docking; t-RNA
CONTACT Avijit Sarkar
rite2avijit@gmail.com
Department of Chemistry, Bhairab Ganguly College,
Belghoria, Kolkata 700056, India
Color versions of one or more of the figures in the article can be found online at www.tandfonline.com/lncn.
Supplemental data for this article can be accessed at https://doi.org/10.1080/15257770.2018.1508694.
ß 2018 Taylor & Francis Group, LLC

2
M. TRIPATHI ET AL.
Two mononuclear copper (II) complexes [Cu(L1)2] (1) and
[Cu(L2)2] (2) have been synthesized from 2-hydroxy-5 (phenyl-
diazenyl)benzaldehyde and 1-(2-hydroxy-5-(phenyldiazenyl)phe-
nyl)ethanone ligands. All these metal complexes are
characterized using different spectroscopy technique and these
two structures optimized theoretically. Nucleic acid binding
studies are carried out with both Cu(II)-azo linked complexes
and molecular docking technique are also performed to know
best probable binding interaction mode with nucleic acid.
1. Introduction
Recently, design and synthesis of transition metal complexes and there
interaction with nucleic acid has become a subject of tremendous inter-
est.[1–4] This interest not only for non-covalent interaction of metal com-
plexes with DNA and RNA but also to develop anti-inflammatory,
antifungal, anti bacterial, anti cancer agents and therapeutic drugs.[5–8]
DNA is the starting material of protein synthesis machinery, targeting
DNA is most important step, RNA formed from DNA acts as template for
further process, RNA serve as migratory material from nucleoplasm to
cytoplasm. DNA is the main genetic carrier and it is main target of many
metal based drugs. So, DNA binding study is one of the important steps in
drug design, for knowing the chemical biological potency of the metal com-
10]
plexes and enables to design best effective DNA targeted drugs.[9,
Several reports have been published on metal complexes interaction
with DNA[11–14] but only few information were published on RNA–metal
complex interaction.[15–18] Hence, much attention has been targeted on the
design of metal-based complexes, which can bind to nucleic acid.[19] The
efficacy of using azo (–N¼ N–) linked transition metal complexes in many
fields of applications such as catalysis,[20] sensors,[21] antibacterial activity[22, 23]
and anticancer activity.[24] Copper(II) complexes are regarded as the most
promising alternatives to cis-platin as anticancer drugs. The biologically access-
ible redox potential made copper complexes a class of the most frequently
studied metallonucleases. In view of the diversified roles of azo derivatives of
metal complexes, it was thought important to design new Cu(II)-azo linked
complexes and study their role on nucleic acid–metal complex interaction.[25]
In this present work, we describe a detailed synthetic account of the
preparation of a mononuclear copper(II) complexes (1 and 2) by HL1 and
HL2 (Chart 1). Complexes 1 and 2 were characterized by different
spectroscopy techniques and optimized structures theoretically. The nucleic
acid binding ability of these copper (II) complexes with ct-DNA (calf
thymus DNA) and t-RNA (torula yeast RNA) were studied by various
spectroscopic methods and molecular docking technique.

NUCLEOSIDES, NUCLEOTIDES AND NUCLEIC ACIDS
3
2. Experimental section
2.1. Materials and reagents used
All the starting chemicals and solvents were analytically pure and used
without further purification. Copper(II) carbonate, aniline, sodium carbon-
ate, sodium nitrite were obtained from S D Fine Chem, India and triethyl-
amine, salicylaldehyde, 2-hydroxy acetophenone obtained from Merck,
India and were used without further purification. The 2-hydroxy-5 (phenyl-
diazenyl)benzaldehyde (HL1) was prepared by published method[23]and
new ligand 1-(2-hydroxy-5-(phenyldiazenyl)phenyl)ethanone (HL2) was
prepared by modified literature method.[23]All other chemicals and solvents
were reagent grade materials and were used as received without further
purification. Calf Thymus DNA (ct-DNA) used for experimentation was
purchased from Merck and Torula Yeast (t-RNA), Ethidium Bromide (EB),
Tris-HCl and NaOH from Sigma Aldrich. The stock solution of ct-DNA
was prepared in buffer (50 mM NaCl-5 mM Tris-HCl) at room temperature
and retained pH 7.8 with 0.01 M HCl prepared by standard procedure.
The stock solution of ct-DNA in buffer gave a ratio of 1.8-1.9:1 UV-
absorbance at 260-280 nm, pointing out that the DNA was sufficiently free
from protein contamination.[26] t-RNAPhe (yeast) concentration was deter-
mined spectrophotometrically using a molar extinction coefficient (e)
6900 Mꢁ1 cmꢁ1 at 258 nm, expressed in terms of nucleotide phosphates.
The ratio of the absorbance at 260 to 280 nm indicated that the sample was
free from protein contaminations.[26] All t-RNA binding experiments were
carried out in citrate-phosphate (CP) buffer (1 mM [Naþ], pH 7.0, contain-
ing 0.5 mM Na2HPO4, pH was adjusted using citric acid.[27] All the chemi-
cals used were of spectroscopic grade and deionized and triple distilled
water was passed through Millipore filters of pore size 0.221 mM (Millipore
India Pvt. Ltd. Bangalore, India) and used for preparing buffer and
other solutions.
Caution! Perchlorate salts are potentially explosive, only a small amount
should be prepared, and handled with proper care.
2.2. Synthesis of ligand HL1 and HL2
2.2.1 General Procedure for synthesis of Azo-linked ligands (HL1-HL2):
Azo dyes (HL1–HL2) were synthesized according to the modified well-
known literature procedure [19]. A mixture of aniline (0.93 g, 10 mmol) in
hydrochloric acid (2.5 ml), and water (20 mL) were heated to 70 ꢂC. The
clear solutions were poured into an ice-water mixture, and were diazotized
between 0 ꢂC to 5 ꢂC with sodium nitrite (0.97 g, 14 mmol) dissolved
in water (5 mL). The cold diazo solutions were added to a solution of

4
M. TRIPATHI ET AL.
Scheme 1. Synthetic route of ligands HL1 and HL2.
salicylaldehyde (1.06 ml, 10 mmol) or 2-hydroxy acetophenone (1.20 ml,
10 mmol) in water (19 mL) containing sodium hydroxide (3.99 g, 10 mmol)
and sodium carbonate (4.2 g, 40 mmol) during the period of 30 min at 0 ꢂC
during the adding process, the diazo solutions were vigorously stirred. The
products were collected by filtration and washed with 100 mL of NaCl solu-
tion (10%) under vacuum. Then, the solids were dried under vacuum at
80 ꢂC overnight and recrystallized from acetonytrile. (Scheme 1)
2.2.2. Ligand (HL1) 2-hydroxy-5 (phenyldiazenyl)benzaldehyde
Brown powder, yield: 2.15 g (95%). Elemental analysis for C13H10N2O2
(226.23 g/mol): Calc. C, 69.02; H, 4.46; N, 12.38. Found: C, 68.96; H, 4.41;
1
N, 12.34%. NMR (CDCl3, d ppm): H, 11.32 (br, 1 H, OH), 10.001 (s, 1 H,
CH ¼ O), 8.16 (s, 1 H, aromatic CH), 7.88 (d, 2 H, aromatic CH), 7.37-7.51
(m, 5 H, aromatic CH)). 13C, 196.18 (CHO), 163.38, 152.00, 145.55, 130.7,
130.26 128.97(2 x aromatic CH), 122.49 (2 x aromatic CH), 120.82, 119.94,
118.20. IR (KBr, cmꢁ1): 3365, 3058, 2872, 1666, 1607, 1575, 1523, 1477,
1285, 1156, 1107, 1071, 1019, 952, 900, 843, 765, 709, 683, 641, 581. UV-
Vis (MeOH); kmax¼ 340 nm.
2.2.3. Ligand (HL2) 1-(2-hydroxy-5-(phenyldiazenyl)phenyl)ethanone
Brown powder, yield: 1.76 g (73.2%). Elemental analysis for
C14H12N2O2(240.26 g/mol): Calc. C, 69.99; H, 5.03; N, 11.66. Found: C, 62.00;
1
H, 4.05; N, 10.31%. NMR (CDCl3, d ppm): H, 12.61 (br, 1H, OH), 8.38 (s,
1H, aromatic CH), 8.13 (d, 1H, aromatic CH), 7.89 (d, 1H, aromatic CH),
7.50-7.73 (m, 5 H, aromatic CH), 2.75 (s, 3 H, COCH3). 13C, 204.6 (C ¼ O),
164.7, 152.3, 144.9, 130.8, 129.3, 129.0 (2 x aromatic CH), 127.8, 122.5 (2 x
aromatic CH) 119.2, 26.6. IR (KBr, cmꢁ1): 30, 2857, 1659, 1619, 1574, 1479,
1379, 1278, 1191, 1170, 1155, 1016, 951, 842, 817, 764, 737, 691, 581, 508.

NUCLEOSIDES, NUCLEOTIDES AND NUCLEIC ACIDS
5
UV-Vis (MeOH); kmax¼ 243 nm, 340 nm. IR (KBr, cmꢁ1): 3398, 3059, 2916,
1636, 1597, 1478, 1423, 1366, 1323, 1206, 1119, 1061, 1018, 834, 818, 766, 686,
666, 623, 516. UV-Vis (MeOH); kmax¼ 343 nm.
2.2.3. Synthesis of [Cu(L1)2] and [Cu(L2)2] complexes
The ligand 0.452 g (2 mmol) for HL1 and 0.48 g (2 mmol) for HL2 was dis-
solved in MeOH (25 mL). The solution was stirred for 30 minutes and fol-
lowed by addition of Cu(ClO4)2.6H2O (0.37 g, 1 mmol) in MeOH (5 mL).
After 15 min, a MeOH solution (5 mL) of NEt3 (2 mmol) was added slowly
to the previous solution during 10 min. Two reaction mixtures were then
stirred for another 30 min. Brown solids were separated from the resulting
green solution on solvent evaporation in air. The products were collected
by filtration and washed thoroughly with hexane and diethyl ether and
dried in vacuum over P4O10.
Caution!! Perchlorate complexes of metal ions involving organic ligands
are potentially explosive. Only small quantities of the complexes should be
prepared, and these should be handled with care.
[Cu(L1)2]: Yield: 0.385 g, 75%. Elemental analysis for C26H18N4O4Cu1
(513.06 g/mol): Calc. C, 60.76; H, 3.53; N, 10.90. Found: C, 60.70; H, 3.52;
N, 10.86%. Selected FT-IR bands (KBr, cmꢁ1): 3071, 1621, 1517, 1405,
1323, 1221, 1137, 962, 832, 768, 651. Molar conductance, KM: (DMF solu-
tion) 8.3 ohmꢁ1cm2molꢁ1. UV-vis spectra [kmax, nm (e, l molꢁ1 cmꢁ1)]:
(DMF solution) 372 (6100).
[Cu(L2)2]: Brown powder, yield, 0.352 g (65%). Elemental analysis for
C28H22N4O4Cu1 (542.04 g/mol): Calc. C, 62.04; H, 4.09; N, 10.34. Found: C,
62.00; H, 4.05; N, 10.31%. IR (KBr, cmꢁ1): 3061, 1581, 1507, 1415, 1323, 1230,
1174, 1119, 971, 850, 749, 648. KM: (DMF solution) 6.22 ohmꢁ1cm2molꢁ1.
UV-vis spectra [kmax, nm (e, l molꢁ1 cmꢁ1)]: (DMF solution) 368 (2654).
2.3. Physical measurements
The elemental analyses (C, H, N) were performed with a Perkin-Elmer model
240 C elemental analyzer. FT-IR spectra were recorded on a Perkin-Elmer
Spectrum RX1 spectrometer. The solution electrical conductivity and elec-
tronic spectra were obtained using a Unitech type U131C digital conductivity
meter with a solute concentration of about 10ꢁ3–10ꢁ4 M and a Shimadzu UV
2450 UV-vis spectrophotometer for complexes and ligands respectively. For
the DNA binding study electronic spectra were recorded on UV-Vis absorp-
tion spectra were obtained by using Varian Cary 50 UV-Visible spectropho-
tometer with 1.0 cm quartz cells. Fluorescence intensities were measured by
using Cary Eclipse fluorescence spectrophotometer (Varian, USA) equipped
with xenon flash lamp using 1.0 cm quartz cells. The fluorescence spectra

6
M. TRIPATHI ET AL.
were recorded by keeping the concentration of solution as same in UV-Vis
absorption measurements. Ethidium bromide displacement method was also
carried out using fluorescence spectrophotometer, by varying the concentra-
tion of metal complexes and keeping the concentration of DNA/RNA con-
stant. Viscometric measurements were made using Ubbelohole viscometer,
pH measurements were carried out with Eutech Oakton digital pH meter
with a combined glass-calomel electrode and tarsons spin with micro centri-
fuge (1.5 ml tube), 6000 ppm was used.
2.4. Computational details
In order to understand the structures of synthesized complexes 1 and 2
were computationally optimized using density functional theory (DFT)
technique at the B3LYP level of theory with LANL2DZ basis set.[28–32] All
calculations were carried out using the Gaussian-03-E01 program with the
aid of the GaussView visualization program.[33] The vibrational frequency
calculations were performed to ensure that the optimized geometries repre-
sent the local minima on the potential energy surface
2.5. DNA binding experiments
2.5.1. Absorption method
The absorbance measurement spectra were scanned by keeping the concen-
tration of the complex constant and varying the concentration of DNA/
RNA from 0 to 200 mM, after each successive addition of ct-DNA/tRNA,
followed by 10 min of incubation. The data obtained were fitted in the fol-
lowing Equation [1],
½DNA=RNAꢃ= e ꢁ e ¼ ½DNA=RNAꢃ= e – e þ 1=Kb e ꢁ e
fꢃ fꢃ fꢃ
½
½
½
a
b
b
[1]
Where, [DNA/RNA] is the concentration of ct-DNA/tRNA, ea, ef and eb
correspond to the extinction coefficients, for the metal complex alone, for
each addition of ct-DNA/tRNA to the metal complex and for the metal
complex in the fully bound form, respectively. The same equation is used
for calculation of various parameters in successive addition of t-RNA. A
plot of [DNA/RNA]/[ea - ef] versus [DNA/RNA], which gives Kb, the
intrinsic binding constant as the ratio of slope to the intercept.[34] The
Percentage hyperchromicity is calculated using the formula,
% hyperchromicity¼ (Afree - Abound)/Afree, where A denotes absorbance.

NUCLEOSIDES, NUCLEOTIDES AND NUCLEIC ACIDS
7
2.5.2. Fluorescence method
Fluorescence emission study is carried out by keeping concentration of metal
complex constant and varying the concentration of nucleic acid (0–200 mM).
Fluorescence intensities were recorded after every successive addition of
different nucleic acid solution, followed by 10 min of incubation. The values
obtained were calculated by using the following Equation[2],
log½F0 ꢁ F=Fꢃ ¼ logKf þ nlog½DNA=tRNAꢃ
[2]
Where, F0 and F are the fluorescence intensities of the fluorophore
in the absence and presence of different concentrations of ct-DNA/t-RNA
and n is the number of binding sites. The linear equations is obtained for
log(F - F0)/F vs. log [DNA]/[RNA]. The values of Kf clearly underscore the
affinity of metal complexes for DNA/RNA.[35]
2.5.3. EB Competitive Binding Method with Fluorescence Spectroscopy
In fluorescence competitive binding studies, nucleic acids were pretreated
with EB for 30 min. Fluorescence quenching experiments were conducted
by adding the metal complex solution to the samples containing 10 mM EB
and 100 mM ct-DNA at different complex concentrations (0–250 mM) solu-
tion and the effect on the emission intensity was measured. For the tRNA
quenching studies, 10 mM of EB and 100 mM of t-RNA at different com-
plex concentration (0–250 mM) were used and the emission intensity was
recorded. The observed Fluorescence values were corrected for Inner Filter
Effect (IFE) as per the equation [3][36]
Fcorr ¼ Fobs ꢀ 10ðAexc þ Aem=2Þ
[3]
Where, Fcorr and Fobs are the corrected and uncorrected fluorescence
intensities and Aexc and Aem are the absorbance values at the current excita-
tion and emission wavelengths. The corrected values of Fluorescence were
used for the calculating quenching studies using Stern-Volmer-Equation.[36]
F0=F ¼ 1 þ Ksv½Qꢃ
[4]
Where, F0 and F are the fluorescence intensities in the absence and pres-
ence of metal complex respectively, Ksv is a linear Stern-Volmer constant
and Q is the concentration of quencher.
2.5.4. Viscometric method
Hydrodynamic property and particularly viscosity provide a better conclu-
sion on the binding of small molecule to nucleic acid. This sort of inter-
action of small molecule to nucleic acid results in a substantial change of
the double helix, if intercalation suppose to the mode of binding whereas,
in other interactional mode helix of nucleic acid remain unchanged.

8
M. TRIPATHI ET AL.
Intercalation mode of binding causes lengthening and stiffening of the helix
which results in an increase in viscosity of nucleic acid.1 ml of ct-DNA/t-
RNA solution was placed in the viscometer and aliquots of stock solution
of the complex (0–800 ml)
Intercalation mode of binding causes lengthening and stiffening of
the helix which results in an increase in viscosity of nucleic acid.1 ml of
ct-DNA/t-RNA solution was placed in the viscometer and aliquots of stock
solution of the complex (0–800 ml) under study were added. Flow time of
the sample alone and sample with different ratio of metal complex was
measured in triplicate with accuracy of 0.01 and the relative viscosity was
calculated using Equation [5],
Â
g’sp=gsp ¼
t
ꢁ t = t
½ð
ꢁ t
[5]
0Þꢃ
ð
0Þ
complex
control
where, g’sp and gsp are the specific viscosity of ct-DNA/t-RNA in the
presence and absence of the metal complex and t0, tcomplex, tcontrol are the
average efflux times of buffer, complex and ct-DNA/t-RNA, respectively.[37]
2.5.5. Determination of fluorescence quantum efficiencies. The quantum
efficiency of nucleic acid binding ligand is a measure of the energy trans-
ferred from the nucleic acid to ligand upon complexation and is evaluated
from the ratio of the quantum efficiency of ligand to nucleic acid (qb) to
the quantum efficiency of the free ligand (qf),[38] as given by the following
Equation [6],
qb Ib ef
Q ¼
¼
ꢀ
[6]
qf qf eb
Where, Ib, If, ef and eb represents intensity and molar extinction coefficients
of the free and metal complex bound to ct-DNA/t-RNA, respectively.[39]
2.5.6. Molecular Docking
Molecular docking was done by using software tool Autodock4.0.was
used for molecular docking studies.[40] The DFT optimized geometry of
Complexes were prepared in PDB format of the complexes was obtained
by converting their CIF files using Mercury software. The crystal structures
of 1BNA d(CGCGAATTCGCG) DNA and (PDB ID: 1EHZ) t-RNAPhe has a
sequence of a monomer (GCGGAUUUAGCUCAGUUGG-GAGAGCGCCAG
ACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA)
were downloaded from RCSB Protein Data Bank. The water molecules
were removed from the DNA and tRNA before calculations. The binding
site was centered on the DNA and a grid box was created with
60 ꢀ 60 ꢀ 60 points and a 0.375 Å grid spacing in which almost the entire
macromolecules were involved. For each docking calculation, different

NUCLEOSIDES, NUCLEOTIDES AND NUCLEIC ACIDS
9
Scheme 2. Schematic representation of the Copper (II) complexes obtained in this work.
poses were required within the energy range of 2 kcal molꢁ1. All other
parameters were kept at their default values.
3. Results and discussion
3.1. Synthesis and characterization
The azo linked derived ligands 2-hydroxy-5 (phenyldiazenyl)benzaldehyde
and 1-(2-hydroxy-5-(phenyldiazenyl)phenyl)ethanone (H3L) and its reac-
tion with copper(II) salts have been systematically investigated. (Scheme 2)
The control complexes 1 and 2, were synthesized by the use of NEt3 in
MeOH solvent media produce mononuclear copper (II) complexes.
Brown complexes [Cu(m-L1)2] and [Cu(m-L2)2], (1 and 2) are directly
synthesized in ꢄ75% and 65% yield in MeOH media under aerobic
conditions at room temperature by stirring a reaction mixture of
Cu(ClO4)2ꢅ6H2O, HL1 or HL2 and NEt3 in 1:2:2 molar ratio for 1 h.
The syntheses of 1 and 2 from HL1 and HL2 are summarized in eq. I.1
and I.2.
Â
Ã
1
1
ð
ð
Þ
Þ
(I.1)
(I.2)
ð
ð
Þ
Þ
2HL þ Cu ClO4 ꢅ 6H2O þ 2NEt3 Cu mꢁL
þ 2NHEt3ClO4 þ 12H2O
þ 2NHEt3ClO4 þ 12H2O
2
2
2
Â
Ã
2
2
2HL þ Cu ClO4 ꢅ 6H2O þ 2NEt3 Cu mꢁL
2
3.2. Structural analysis of complexes
3.2.1. NMR spectra
1
The H and 13C NMR spectra of the ligands (HL1–HL2) were performed
in CDCl3. solvent medium. The obtained data were given in the experi-
1
mental section. The H NMR and 13C NMR spectra of the ligands are
1
given in the Figure S1–S4 in the supporting information. The H NMR
spectrum of HL1 and HL2 showed a broad signal at 11.52 and 11.03 ppm

10
M. TRIPATHI ET AL.
assigned to the phenolic-OH proton, respectively. The carbonyl group pro-
ton HC ¼ O and COCH3 in the compounds HL1 and HL2 was observed at
10.00 ppm and 2.75 ppm for both compounds.[41] Aromatic protons of
these two ligand were observed in the range of 7.37-8.38 ppm in the spec-
trum. The 13C NMR spectra of the HL1 and HL2 showed signals at 196.18
and 204.6 ppm, respectively, assigned to the carbonyl group (C ¼ O) carbon
atom.[23] The aromatic carbons for two ligands were observed in the 122.5-
164.7 ppm range. These NMR spectrum of the ligands showed that there
was no major organic impurity in the ligands.
3.2.2. FT-IR Spectroscopy
The infrared spectra of the free ligands HL1, HL2 and their copper(II)
complexes were obtained using a KBr disc. The characteristic IR spectral
data of the ligands and its complexes are given in Table 1. The infrared
spectral bands of the free ligands were compared with those of the Cu(II)
complexes to access the coordination of the ligands to Cu(II) ion. The
spectra of HL1, HL2 ligands and their Cu(II) complexes were given in
Figures S5–S8, respectively. The FT-IR spectra of the ligands showed
characteristic bands for OH, aromatic C–H, –N ¼ N– and C–O vibrations.
In the spectra of the ligands HL1 and HL2, the phenolic group m (O-H)
stretching was observed at a range of 3365 cmꢁ1–3398 cmꢁ1 as a broad
band.[42, 43]
The absence of these bands confirmed the formation of the complexes
by deprotonation of the phenolic group of the ligand. The characteristic
peak of azo group ꢀ (-N ¼ N-) at the range of 1473-1478 cmꢁ1 confirmed
that all the azo-linked ligands and their complexes containing azo group in
the solid state.[44] A comparison between infrared spectra of HL1 or HL2
and 1 or 2 complexes shows that a band, characteristic of m (C-O) at 1285
or 1205 cmꢁ1, are shifted to 1325 or 1317 cmꢁ1, due to C-O-M bond for-
mation. In these spectra, the ligands HL1 or HL2 and complexes 1 or 2
exhibits bands at 3058 cmꢁ1 or 3059 cmꢁ1 and 3071 cmꢁ1 or 3052 cmꢁ1
that are assignable to vibrations of aromatic C–H stretchings.[43] In add-
ition, all the metal complexes show new bands in the range at 698-
544 cmꢁ1 due to formation of M-O, further confirming formation of coord-
ination complexes. After complex formation the carbonyl group m (C ¼ O)
stretching shifted to the lower wavenumber values of the complexes
Table 1. Characteristic IR absorption bands for ligands and its complexes.
Compound
ꢀ (N ¼ N)
ꢀ (O–H)
m(C–H)aromatic
m (C ¼ O)
m (C–O)
m (Cu–O)
HL1
1477
1478
1473
1475
3365
3398
–
3058
3059
3071
3052
1636
1621
1666
1632
1285
1206
1325
1317
–
–
651
648
HL2
[Cu(m-L1)2]
[Cu(m-L2)2]
–

NUCLEOSIDES, NUCLEOTIDES AND NUCLEIC ACIDS
11
[Cu(L1)2] and [Cu(L2)2] from 1636 cm-1 to 1621 cm-1 and 1666 cm-1 to
1632 cm-1 respectively.[45]
3.2.3. Absorption Properties of Complexes in Solution
Absorption spectra for ligands were recorded in MeOH but complexes 1 and
2 were recorded in DMF solvent medium because of very poor solubility of
these metal complexes in MeOH. The azo linked containing ligands HL1 and
HL2 shows absorption band in the range 300-400nm. (Figure S9).[46] The
ꢆ
bands in these range can be assigned to the p ꢁ p transitions due to p elec-
trons in the structure of the aromatic ligands. The absorption bands of the
complexes 1 and 2 were ligand based electronic transitions. In the spectra of
the complexes there is no assignable d-d transitions being observed.[45, 47]
3.2.4. Optimized structures
Cu(II) forms a neutral complex as shown in Figures 1 and 2 with the anionic
form of ligand. So two ligands take part to form square planner complexes
having molecular formula C26H18N4O4Cu1 (1) C28H22N4O4Cu1(2) both the
complexes have C-1 point group of symmetry. Selective bond parameters are
listed in Table 2. The bond distance between Cu-O
varies between
phenolic
1.919 Å (for 1) to 1.911 Å (2) and that of Cu-O
1.980 Å (for 1) to
carboxylic
1.969 Å (2).[48] Extra –CH3 in complex 2 (þI effect) increase the electron
density on ‘O’ atom, favor the Cu-O bond formation stronger. Related bond
angels pivoting the Cu atom are in right angle (varies 0.5ꢂ) and the dihe-
dral angles recorded infers the square planner structure of the complexes.
3.3. DNA binding studies
3.3.1. Electronic absorption Studies
UV-Vis absorption spectroscopy emerge as effective method to find out the
transitional interaction between nucleic acids (DNA/RNA) and metal
Figure 1. Optimized Structure of 1.

12
M. TRIPATHI ET AL.
Figure 2. Optimized Structure of 2.
Table 2. Selective Bond parameters of Optimized structures.
1
2
Bond Length (Å)
Cu(51) – O(23) ¼ 1.919
Cu(50) – O(23) ¼ 1.911
Cu(50) – O(25) ¼ 1.969
Cu(50) – O(48) ¼ 1.911
Cu(50) – O(51) ¼ 1.969
Cu(51) – O(26) ¼ 1.980
Cu(51) – O(49) ¼ 1.919
Cu(51) – O(52) ¼ 1.980
Bond Angle (ꢂ)
O(23)–Cu(51)–O(26) ¼ 90.503
O(26)–Cu(51)–O(49) ¼ 89.497
O(49)–Cu(51)–O(52) ¼ 90.505
O(52)–Cu(51)–O(23) ¼ 89.495
Dihedral Angle(ꢂ)
O(23)–Cu(50)–O(25) ¼ 89.452
O(25)–Cu(50)–O(48) ¼ 90.548
O(48)–Cu(50)–O(51) ¼ 89.452
O(51)–Cu(50)–O(23) ¼ 89.548
O(23)–O(26)–Cu(51)–O(49) ¼ 179.99
O(26)–O(49)–Cu(51)–O(52) ¼ 179.99
O(49)–O(52)–Cu(51)–O(23) ¼ 179.99
O(52)–O(23)–Cu(51)–O(26) ¼ 179.99
O(23)–O(25)–Cu(50)–O(48) ¼ 179.99
O(25)–O(48)–Cu(50)–O(51) ¼ 180.00
O(48)–O(51)–Cu(50)–O(23) ¼ 179.99
O(51)–O(23)–Cu(50)–O(25) ¼ 180.00
complexes.[49, 50] Aromatic group, heteroatom comprises of nitrogen, oxy-
gen, and sulfur donor atom containing metallic complexes are synthesized
and their ct-DNA binding affinity is checked.[51, 52] Herein this method
interactional parameter can be investigated by comparing absorption spec-
tra of Cu(II) complexes before (without adding nucleic acids) and after
(with adding nucleic acids) the reaction is keenly observed. Measurement
of two Cu(II) complexes 1 and 2 chelating with azo group ligands were
studied with ct-DNA and t-RNA using absorption spectroscopy shown in
Figure(3a, S10a) and Figure (3b,S10b). In Figure-3a and Figure S10a both
the complex of Cu(II) titrated with increasing amount of ct-DNA which
clearly, illustrate a hyperchromic shift at approx. range of 200-290 nm,
ꢆ
which resemble p!p transitions of the pyrimidine and purine ring sys-
tems with interacting Cu(II) complexes with nucleobases, increasing hyper-
chromism (De, for 1 is 32%, for 2 is 22%) with a narrow range of (10 nm)
red-shift, predicting preference of groove binding mode over intercalative
mode of DNA binding. Isosbestic point (Ia) observed at approx. 294 nm in
1 whereas in 2, Ia observed around 295 nm, which indicates a spectral shift

NUCLEOSIDES, NUCLEOTIDES AND NUCLEIC ACIDS
13
Figure 3. Absorption spectra (a) for complex 1 in a 5% DMF–5 mM Tris-HCl–50 mM NaCl buffer
at pH 7.2 in the absence (R ¼ 0) and presence of (R ¼ 25) of increasing amounts of ct-DNA.
Inset: plots of [DNA]/(ea ꢁ ef) vs. [DNA] for titration of DNA with complex, (b) for 1 in a 5%
DMF–5 mM Tris-HCl–50 mM NaCl buffer at pH 7.2 in the absence (R ¼ 0) and presence of
(R ¼ 25) of increasing amounts of t RNA. Inset: plots of [RNA]/(ea ꢁ ef) vs. [RNA] for titration of
RNA with complexes.
in complexes at Isosbectic point spectral orientation is uniformly constant
after Ia point a sudden downfall in spectra i.e., hypochromic transition in
ꢆ
spectra is observed between 300-500 nm which merely due to n!p transi-
tion. A clear variable transition is observed in both complexes in different
range of spectra. Both the complexes are struggling for their insertion in
ct-DNA double helix, this can be clearly seen in the pattern of spectra
observed. To determine the intrinsic binding constant, Kb of the 1/[DNA]
systems, the quantity [DNA]/jea-efj at 266 nm for 1 and 262 nm for 2 was
plotted as a function of the molar concentration of respectively duplex
ct-DNA (inset in Figure. 3a and Figure. S8a. Whereas, in case of t-RNA
both the Cu(II) complex in Figure 3b and Figure S10b, titrated same as
mentioned above with ct-DNA, exhibit a similar pattern of spectra as
ct-DNA, but the structural conformation of tRNA is very complex its
insight reveals a different pockets which attributes different binding inter-
actions, hyperchromism seen in figures indicate as complexes bind with
tRNA which probably may be due to electrostatic interaction this may be
due to between Cu(II) complexes and negatively phosphate backbone of
the tRNA.[53] On the other hand, the yeast tRNA helix offers many hydro-
gen bonding sites in both the minor and major grooves, and it is likely
that the aromatic groups of Cu(II) complex possess the potency of forming
hydrogen bonds with tRNA, which may also contribute to the observed
hyperchromism.[54]
The binding constants were obtained by plotting the data [DNA/RNA]/
jea-efj versus [DNA/RNA] and finding the best linear fit using the follow-
ing equation.[55, 56] The ratio of slope to intercept in the plot of [DNA]/(ea
- ef) versus [DNA] gives the value of Kb.The Kb values obtained by the lin-
ear fittings of the experimental data are 1 is 7.6 0.2 ꢀ 103 Mꢁ1 2 is

14
M. TRIPATHI ET AL.
5.7 0.4 ꢀ 104 Mꢁ1.The structure of tRNAPhe is highly complex structure to
find out its insight interaction is Kb t-RNA value 1 is 6.5 0.3 ꢀ 103Mꢁ1
is 1.8 0.5 ꢀ 103 Mꢁ1.
2
3.3.2. Fluorescence emission studies
The fluorescent method has wide range of sensitivity, reliability and accuracy.
This method adds the more precision and correctness in predicting the bind-
ing mode of interaction. Previous findings unfolds the mechanism of various
sensitive fluorescent probe which retrieve the structural variation of nucleic
acids and the way this fluorescent probe binds with DNA/RNA reveals
the exact binding interaction.[57] Hence, this probes used as reference for
interpretation of binding route/pattern of small molecules. Here, in this work
the 1 complex with 375 nm in Tris HCL without nucleic acid at room tem-
perature showed maximum emission at 390nm, where as 2 was excited with
395nm in same buffer showed emission at near approx 425 nm. On addition
of increasing amount on nucleic acid a distinct spectra observed which estab-
lish the binding mode. In Figure 4a and Figure S11a indicates the hyperchro-
mic spectra of both complex on adding increasing amount of ct-DNA,
where as in Figure 4b and Figure S11b indicates the spectra of t-RNA which
too shows the hyperchromic shift. The spectral shift resembles same as infer-
ence drawn from UV method.
Hence in both cases interaction give rise to a consistent enhanced orienta-
tion of spectral shift which indicates that complete intercalation of complex
with nucleic acid is missing, the binding mode may be partial intercalation
or groove as hyperchromic shift laid more emphasis on these binding modes.
The binding affinity constant (Kf) for ct-DNA calculated for complex 1 as
9.17 0.5 ꢀ 10ꢁ2 Mꢁ1 number of binding sites(n) was found as 0.29, whereas
value for complex 2 were calculated as 6.77 0.3 ꢀ 10ꢁ2 Mꢁ1 and value of n
Figure 4. Emission spectra (a) for 1 in DMF, in the absence and in presence of ct-DNA in 5 mM
Tris-HCl–50 mM NaCl, pH ¼7.2, at room temperature. Inset: plots of log[jFo ꢁ Fj/F] vs. log[DNA]
for titration of DNA with complex (b) Emission spectra of 1 in the absence and in presence of
t-RNA in 5 mM Tris-HCl–50 mM NaCl, pH ¼7.2, at room temperature. Inset: plots of log[jFo ꢁ Fj/
F] vs. log[RNA] for titration of RNA with complex.

NUCLEOSIDES, NUCLEOTIDES AND NUCLEIC ACIDS
15
is 0.89, whereas value Kf for tRNA were observed for 1 as 5.73 0.5 ꢀ 10ꢁ2
Mꢁ1 and 0.79 observed number of binding sites, for second complex 2 Kf
was calculated as 1.06 0.2ꢀ 10ꢁ2 Mꢁ1 and 0.7 number of binding sites.
3.3.3. Competitive Binding Method
Further studies were carry forward to confirm the binding modes,
Ethidium Bromide (EB) a classical intercalator is used as probe, EB itself is
non-emissive in buffer solution, but when mixed with nucleic acid(DNA/
RNA) show enhance fluorescence emission. EB-DNA/RNA[58] system show
enhanced emission as EB intercalates between the base pairs of nucleic
acids and imparts fluorescent property.[59] In this method second complex
(1 and 2) try to competes with conjugated EB-Nucleic acid system, if com-
peting molecules was found successful in quenching the enhanced emission
of EB bound with nucleic acid, then the of reaction phase will be probably
symbolizes intercalation or groove binder that whereas on the other side
if complexes fails in quenching EB from EB-DNA/RNA system its clearly
predicts as complex as surface or major groove binder. Presently, com-
plexes 1 and 2 were reacted with EB-DNA system, in Figure 5a complex 1
shows remarkable decrease in spectra as its able to displace intercalated EB
from system most probable binding mode inferred as intercalator or groove
above findings point minor groove as binding mode and fluorescence
values were corrected using IFE which is further used for calculating Stern-
Volmer constant, Ksv found as 1.04 0.2 ꢀ 102 Mꢁ1, whereas complex 2
shows (Figure S12a) immense increase pattern of spectra this clearly shows
that this complex was unable to quench EB from EB-DNA system and the
value Ksv obtained as -1.40 0.4 ꢀ 102 Mꢁ1, values obtained and spectral
shift nullify the assumption of intercalator and minor groove its confirms
other non-covalent mode of interaction. Figure 5b and Figure S12b both
complexes 1 and 2 competes with EB in EB-tRNA system in this both
Figure 5. Emission spectra (a) EB bound to DNA in the presence of increasing amount of com-
plexes 1 (Inset: Stern–Volmer plots (Fo/F vs.[1]) of fluorescence titration); (b) Emission spectra of
EB bound to RNA in the presence of increasing amount of complexes 1 (Inset: Stern–Volmer
plots (Fo/F vs. [1/2]) of fluorescence titration).

16
M. TRIPATHI ET AL.
complexes show same spectral shift alignment i.e., enhancement in fluores-
cent spectra.
Hence in case of t-RNA its clearly neglect chance of intercalation but
considered as a groove binder. The value of Ksv obtained as in negative and
numerically equals to -1.81 0.2 ꢀ 102 Mꢁ1 for 1 and -1.71 ꢀ 102 Mꢁ1 for 2.
3.3.4. Viscometric studies
Hydrodynamic measurements are techniques come out to be an acute
method which provides clear evidences of binding mode. As it known fact
that relative viscosity tends to increase if complexes insert itself into the
base pairs of nucleic acids commonly observed in intercalation interactional
mode, worthwhile in other cases relative viscosity may be increases too due
to sticking or attaching of complexes in inserted pockets of groove
region[60–62] or sometimes a decrease phenomena in relative viscosity occur
this may be due to kinking of DNA/RNA fragments encountered as a
results of interaction. Therefore, in Figure 6a,b indicates the changes in
relative viscosity of ct-DNA and t-RNA alone and after reacting with com-
plexes in increasing concentration.[63, 64]
In Figure 6a the graph display increase in relative viscosity in case of
ct-DNA, this may be due to successful insertion of both complexes in
ct-DNA binding sockets which results in up gradation in graph, whereas,
in case of t-RNA both the complexes show a decrease in relative viscosity
measurement, as t-RNA is highly complicated structure inference of viscos-
ity not add much to interpretation, but a rough idea may be drawn, as in
this case it show that molecule were unable to insert itself into t-RNA.
3.3.5. Quantum efficiency
Quantum efficiency (Q) calculation supports the extent of binding of both
Cu(II)complexes 1 and 2 of to nucleic acid. A plot of absorbance against
the inverse of nucleic acid concentration gave an exponential plot from
which a quantum efficiency value of greater than one has been determined
which indicates enhancement of the energy of the bound ligand. Q > 1 is
Figure 6. Effect of increasing amount of the Complex 1 and 2 on the relative viscosities of
a) ct-DNA and b) t-RNA, at 25 ꢂC.

NUCLEOSIDES, NUCLEOTIDES AND NUCLEIC ACIDS
17
Figure 7. Molecular docked model of 1 with (a) DNA (b) RNA dodecamer duplex.
indicative of enhancement of fluorescence intensity and greater retention of
fluorescence energy by the bound both the complex due to shielding within
the binding site from quenching by solvent.[39]
3.3.6. Molecular docking
Theoretically software base calculations too were done to find out the best
probable binding interaction mode. Methods play an important role in
eliminating the tentative position most to correct position were precisely
known. Molecular docking analysis of the both Cu(II) azo complexes 1 and
2 were performed. The best fitted poses with most favorable energetic cal-
culation were chosen. Energetically most favorable conformations for the
(1BNA) DNA docked structures of both the complexes were shown in
Figure 7a and Figure S13a. It was observed that both complexes fitted well
into the groove region of DNA with A/T and G/C rich regions.
Both the Complexes 1 and 2 favor multiple types of chemical bonding
with Carbon, Oxygen, and Nitrogen of adenine, thymine and Guanine base
pairs of DNA. 1 complex docked into the minor groove region of DNA
with Carbon-Hydrogen and p-p type of interact, whereas 2 complex
docked into major groove region of the DNA showing p-alkyl and p-anion
sort of interaction. The relative binding energies of both the complexes
docked into DNA are -12.07 kcal/mol and -11.64 kcal/mol respectively. In
case of RNA both the complexes possess the interactional affinity with
carbon and nitrogen component of adenine and Uracil.[65] In Figure 7b
and Figure S13b docked structures of both the complexes are shown with
RNA. Both the complex bind exactly on the same region of RNA. The rela-
tive binding energy of both the complexes are calculated as -4.86 kcal/mol.
4. Conclusion
The work done in this paper helps in knowing exact insights of DNA and
RNA by the sort of interaction portrayed by both the Cu(II) Complexes.

18
M. TRIPATHI ET AL.
Inference drawn from experimental work verified with computational
work. Techniques employed are absorption spectroscopy briefly gives the
assumption of partial intercalation and groove binders, which further
checked with fluorescence spectroscopy which to flows with assumption
drawn from UV method. Competitive Binding assay laid the confirmation
of binding mode as minor groove in case of DNA for 1 and major groove
for 2. Displacement assays clearly resolve the confusion of intercalation
for both the complexes. Viscometric measurement complements the finding
of above methods. Finally, molecular docking analysis were done which
confirmed the assumption of both the complexes as groove binders. Hence,
it can be concluded that 1 binds in minor groove region of DNA and
when it comes to RNA it switches it binding mode from minor to major
groove, While 2 shows potency as major groove binders in both the cases.
Experimental data complements the theoretical findings and proves
as important tool.
Acknowledgments
A.S is thankful to Department of Science & Technology, Government of West Bengal.
Memo: 244 Sanc.)/ST/P/S&T/15G-35/2017). R.P. indebted to UGC for providing BSR
Faculty Fellowship, Grant No. F.No. 18-1/2016(BSR) and M.T is thankful to DST for
awarding Inspire Fellowship (DST/INSPIRE Fellowship/2013/635).
Funding
R.P. indebted to UGC for providing BSR Faculty Fellowship, Grant No. F. No. 18-1/2011
(BSR), Id 201617-BSRFACULTY-10225-1 and M.T is thankful to DST for awarding Inspire
Fellowship (DST/INSPIRE Fellowship/2013/635).
ORCID
Mamta Tripathi
Avijit Sarkar
http://orcid.org/0000-0001-8235-9110
http://orcid.org/0000-0002-4939-603X
References
[1] Bergamo, A.; Sava, G. Linking the Future of Anticancer Metal-Complexes to the
Therapy of Tumour Metastases. Chem. Soc. Rev. 2015, 44, 8818.
[2] Zou, T.; Lum, C. T.; Lok, C. N.; Zhang, J. J.; Che, C. M. Chemical Biology of
Anticancer Gold(III) and Gold(I) Complexes Chem. Chem. Soc. Rev. 2015, 44, 8786.
[3] Nikoli, M. V.; Mijajlovi, M. Z.; Jevti, V. V.; Ratkovi, Z. R.; Novakovi, S. B.;
Bogdanovi, G. A.; Milovanovi, J.; Arsenijevi, A.; Stojanovi, B.; Trifunovi, S. R.; Radi,
G. P. Cytotoxicity of Copper(II)-Complexes with Some S-Alkyl Derivatives of

NUCLEOSIDES, NUCLEOTIDES AND NUCLEIC ACIDS
19
Thiosalicylic Acid. Crystal Structure of the Binuclear Copper(II)-Complex with S-
Ethyl Derivative of Thiosalicylic Acid. J. Mol. Struct 2016, 1116, 264.
[4] Theiner, S.; Varbanov, H. P.; Galanski, M.; Egger, A. E.; Berger, W.; Heffeter, P.;
Keppler, B. K. Comparative in Vitro and in Vivo Pharmacological Investigation of
Platinum(IV) Complexes as Novel Anticancer Drug Candidates for Oral application.
J. Biol. Inorg. Chem. 2015, 20, 89.
[5] Takjoo, R.; Akbari, A.; Ebrahimipour, S. Y.; Kubicki, M.; Mohamadi, M.; Mollania, N.
Synthesis, Spectral Characterization, DFT Calculations, Antimicrobial Activity and
Molecular Docking of 4-Bromo-2-((2-Hydroxy-5-Methylphenylimino)Methyl)Phenol
and Its V(V) Complex. Inorg. Chim. Acta 2017, 455, 173.
[6] Subarkhan, M. M.; Prabhu, R. N.; Kumar, R. R.; Ramesh, R. Antiproliferative
Activity of Cationic and Neutral Thiosemicarbazone Copper(II) Complexes. RSC
Adv. 2016, 6, 25082.
ꢀ
[7] Ebrahimipour, S. Y.; Sheikhshoaie, I.; Castro, J.; Dusek, M.; Tohidiyan, Z.; Eigner,
V.; Khaleghi, M. Synthesis, Spectral Characterization, Structural Studies, Molecular
Docking and Antimicrobial Evaluation of New Dioxidouranium(VI) Complexes
Incorporating Tetradentate N2O2 Schiff Base Ligand. RSC Adv. 2015, 5, 95104.
[8] Correia, I.; Roy, S.; Matos, C. P.; Borovic, S.; Butenko, N.; Cavaco, I.; Marques, F.;
ꢁ
Lorenzo, J.; Rodrıguez, A.; Moreno, V.; Pessoa, J. C. Vanadium(IV) and Copper(II)
Complexes of Salicylaldimines and Aromatic Heterocycles: Cytotoxicity, DNA
Binding and DNA Cleavage properties . J. Inorg. Biochem. 2015, 147, 134.
[9] El-Sonbati, A. Z.; Diab, M. A.; El-Bindary, A. A.; Mohamed, G. G.; Morgan, S. M.;
Abou-Dobara, M. I.; Nozha, S. G. Geometrical Structures, Thermal Stability and
Antimicrobial Activity of Schiff Base Supramolecular and Its Metal Complexes. J.
Mol. Liq 2016, 215, 423.
[10] Alessio, E. Thirty Years of the Drug Candidate NAMI-a and the Myths in the Field
of Ruthenium Anticancer Compounds: A Personal Perspective. Eur. J. Inorg. Chem.
2017, 2017, 1549.
[11] Łakomska, I.; Fandzloch, M. Application of 1,2,4-Triazolo[1,5-a]Pyrimidines for the
Design of Coordination Compounds with Interesting Structures and New Biological
Properties. Coord. Chem. Rev 2016, 327-328, 221.
[12] Almaqwashi, A. A.; Paramanathan, T.; Rouzina, I.; Williams, M. C. Mechanisms of
Small Molecule–DNA Interactions Probed by Single-Molecule Force Spectroscopy.
Nucleic Acids Res. 2016, 44, 3971.
[13] Liu, W.; Gust, R. Update on Metal N-Heterocyclic Carbene Complexes as Potential
anti-Tumor Metallodrugs. Coord. Chem. Rev 2016, 329, 191.
[14] Brabec, V.; Hrabina, O.; Kasparkova, J. Cytotoxic Platinum Coordination
Compounds. DNA Binding Agents. Coord.Chem. Rev 2017, 351, 2.
[15] Li, J.; Sun, Y.; Zhu, Z.; Zhao, H.; Tan, L. Binding Properties of Ruthenium(II)
Complexes [Ru(bpy)2(ppn)](2þ) and [Ru(phen)2(ppn)](2þ) with triplex RNA: As
ꢆ
molecular "light switches" and stabilizers for poly(U)ꢅpoly(A) poly(U)
triplex. J. Inorg. Biochem. 2016, 161, 128.
[16] Pandey, S.; Ogloblina, A. M.; Belotserkovskii, B. P.; Dolinnaya, N. G.;
Yakubovskaya, M. G.; Mirkin, S. M.; Hanawalt, P. C. Transcription Blockage by
Stable H-DNA Analogs in vitro. Nucleic Acids Res. 2015, 43, 6994.
[17] Wang, J.; Schultz, P. G.; Johnson, K. A. Mechanistic Studies of a small-molecule
modulator of SMN2 splicing. Proc. Natl. Acad. Sci. USA. 2018, 115, E4604.
[18] Donlic, A.; Hargrove, A. E. Targeting RNA in Mammalian Systems with Small
Molecules. Wires. RNA 2018, 9, e1477.

20
M. TRIPATHI ET AL.
[19] Pratihar, J. L.; Pattanayak, P.; Patra, D.; Lin, C.; Chattopadhyay, S. Synthesis,
Characterization and Structure of New Diazoketiminato Chelates of Palladium(II):
Potential Catalyst for C–C Coupling Reactions. Polyhedron 2012, 33, 67.
[20] Rezaeian, K.; Khanmohammadi, H. Naked-eye detection of biologically important
anions by a new chromogenic azo-azomethine sensor. Spectrochim. Acta. A Mol.
Biomol. Spectrosc. 2014, 133, 31.
[21] Gulcan, M.; Ozdemir, S.; Du€ndar, A.; Ispir, E.; Kurtoglu, M. Mononuclear Complexes
Based on Pyrimidine Ring Azo Schiff-Base Ligand: Synthesis, Characterization,
Antioxidant, Antibacterial, and Thermal Investigations: Mononuclear Complexes Based
on Pyrimidine Ring Azo Schiff-Base Ligand. Z. Anorg. Allg. Chem 2014, 640, 1754.
[22] Khosravi, F.; Mansouri-Torshizi, H. Antibacterial Combination Therapy Using
Co3þ, Cu2þ, Zn2þ and Pd2þ Complexes: Their Calf Thymus DNA Binding Studies.
J. Biomol. Struct. and Dyn 2018, 36, 512.
[23] Ganguly, D.; Jain, C. K.; Santra, R. C.; Roychoudhury, S.; Majumder, H. K.; Mondal,
T.; Das, S. Anticancer Activity of a Complex of CuII with 2-(2-Hydroxy Phenylazo)-
Indole-3/-Acetic Acid on Three Different Cancer Cell Lines: A Novel Feature for
Azo Complexes. Chemistry Select 2017, 2, 2044.
[24] Ramakrishnan, S.; Shakthipriya, D.; Suresh, E.; Periasamy, V. S.; Akbarsha, M. A.;
Palaniandavar, M. Ternary Dinuclear Copper(II) Complexes of a Hydroxybenzamide
Ligand with Diimine Coligands: The 5,6-dmp ligand enhances DNA binding and
cleavage and induces apoptosis. Inorg. Chem. 2011, 50, 6458.
[25] Marmur, J. A Procedure for the Isolation of Deoxyribonucleic Acid from
Microorganisms. J. Mol. Biol 1961, 3, 208.
[26] Sinha, R.; Islam, M. M.; Bhadra, K.; Kumar, G. S.; Banerjee, A.; Maiti, M.
The Binding of DNA Intercalating and non-intercalating compounds to A-form and
protonated form of poly(rC).poly(rG): spectroscopic and viscometric study. Bioorg.
Med. Chem. 2006, 14, 800.
[27] Lee, C.; Yang, W.; Parr, R. G. Development of the Colle-Salvetti Correlation-Energy
Formula into a Functional of the Electron Density. Phys. Rev. B 1988, 37, 785.
[28] Adhikary, S. D.; Samanta, T.; Roymahapatra, G.; Loiseau, F.; Jouvenot, D.; Giri, S.;
Chattaraj, P. K.; Dinda, J. Synthesis, Structure and Electrochemical Behaviour of
Ru(II)- and Pt(II)Carbene Complexes of the NCN-Pincer 1,3-Bis(2-Pyridylmethyl)-
1Hbenzimidazolium Chloride. New J. Chem. 2010, 34, 1974.
[29] Samanta, T.; Kumar Rana, B.; Roymahapatra, G.; Giri, S.; Mitra, P.; Pallepogu, R.; Kumar
Chattaraj, P.; Dinda, J. Synthesis, Structure and Theoretical Studies of Hg(II)–NH
Carbene Complex of Annulated Ligand Pyridinyl[1,2-a]{2-Pyridylimidazol}-3-Ylidene
Hexaflurophosphate. Inorg. Chim.Acta 2011, 375, 271.
[30] Roymahapatra, G.; Giri, S.; Danopoulos, A. A.; Chattaraj, P. K.; Mahapatra, A.;
Bertolasi, V.; Dinda, J. Pd(II)–N-Heterocyclic Carbene Complexes of 2,6-Bis{N-Methyl
(Imidazolium/Benzimidazolium)}Pyrazinechloride: Synthesis, Structure, Catalysis and
Theoretical Studies. Inorg.Chim.Acta 2012, 383, 83.
[31] Roymahapatra, G.; M. Mandal, S.; F. Porto, W.; Samanta, T.; Giri, S.; Dinda, J.; L.
Franco, O.; K. Chattaraj, P. Pyrazine functionalized Ag(I) and Au(I)-NHC
Complexes are Potential Antibacterial Agents. CMC 2012, 19, 4184.
[32] Gaussian 03. Revision, E.-0. Wallingford CT: Gaussian Inc, 2004.
[33] Pyle, A. M.; Rehmann, J. P.; Meshoyrer, R.; Kumar, C. V.; Turro, N.; Barton, J.
Mixed-Ligand Complexes of Ruthenium(II): Factors Governing Binding to DNA. J.
Am. Chem. Soc. 1989, 111, 3051.

NUCLEOSIDES, NUCLEOTIDES AND NUCLEIC ACIDS
21
[34] Song, G.; Yan, Q.; He, Y. Studies on Interaction of Norfloxacin, Cu2þ, and DNA by
Spectral methods. J. Fluoresc. 2005, 15, 673.
[35] (a) Ohno, T. Fluorescence Inner-Filtering Correction for Determining the
Humification Index of Dissolved Organic Matter. Environ. Sci. Technol. 2002, 36,
742. (b) Sun, Y.; Bi, S.; Song, D.; Qiao, C.; Mu, D.; Zhang, H. Study on the
Interaction Mechanism between DNA and the Main Active Components in
Scutellaria Baicalensis Georgi. Sens. Actuat 2008, 129, 799.
[36] Ray, A.; Kumar, G. S.; Maiti, M. Molecular Aspects on the Interaction of aristololac-
tam-beta-D-glucoside with H(L)-form deoxyribonucleic acid structures. J. Biomol.
Struct. Dyn. 2003, 21, 141.
[37] Garbett, N. C.; Hammond, N. B.; Graves, D. E. Influence of the Amino Substituents
in the Interaction of Ethidium Bromide with DNA. Biophys. J. 2004, 87, 3974.
[38] Giri, P.; Kumar, G. S. Spectroscopic and Calorimetric Studies on the Binding of the
Phototoxic and Cytotoxic Plant Alkaloid Sanguinarine with Double Helical Poly(a).
J. Photochem. Photobiol. A 2008, 194, 111.
[39] Yilmaz, V. T.; Icsel, C.; Suyunova, F.; Aygun, M.; Cevatemre, B.; Ulukaya, E.
Synthesis, Structures, DNA/Protein Binding, Molecular Docking, Anticancer Activity
and ROS Generation of Ni(II), Cu(II) and Zn(II) 5,5-Diethylbarbiturate Complexes
with Bis(2-Pyridylmethyl)Amine and Terpyridine. New J. Chem. 2017, 41, 8092.
[40] Eren, T.; Kose, M.; Sayin, K.; Mckee, V.; Kurtoglu, M. A Novel Azo-Aldehyde and
Its Ni(II) Chelate; Synthesis, Characterization, Crystal Structure and Computational
Studies of 2-Hydroxy-5-{(E)-[4-(Propan-2yl)Phenyl]Diazenyl} Benzaldehyde. J. Mol.
Struct. 2014, 1066, 191.
[41] Eren, T.; Kose, M.; Kurtoglu, N.; Ceyhan, G.; McKee, V.; Kurtoglu, M. An
Azo-Azomethine Ligand and Its Copper(II) Complex: Synthesis, X-Ray Crystal
Structure, Spectral, Thermal, Electrochemical and Photoluminescence Properties.
Inorg. Chim. Acta 2015, 430, 268.
[42] Williams, D. H.; Fleming, I. Spectroscopic Methods in Organic Chemistry Third
McGraw Hill New York: McGraw Hill, 1980; pp. 49.
[43] Yahyazadeh, A.; Azimi, V. Synthesis of Some Unsymmetrical New Schiff Bases from
Azo Dyes. Eur. Chem. Bull. 2013, 2, 453.
[44] Kose, R.; Gungor, S. A.; Kariper, S. E.; Kose, M.; Kurtoglu, M. The New O,O and
N,O Type Ligands and Their Cu(II) and Ni(II) Complexes: Crystal Structure,
Absorption-Emission Properties and Superoxide Dismutase Mimetic Studies. Inorg.
Chim. Acta 2017, 462, 130.
[45] Soliman, A. A. Effect of Solvents on the Electronic Absorption Spectra of Some
Salicylidene Thioschiff Bases. Spectrochim. Acta A 1997, 53, 509.
[46] Sarigul, M.; Sari, A.; Kose, M.; McKee, V.; Elmastas, M.; Demirtas, I.; Kurtoglu, M.
New Bio-Active Azo-Azomethine Based Cu(II) Complexes. Inorg. Chim. Acta 2016,
444, 166.
[47] Nafisi, S.; Hajiakhoondi, A.; Yektadoost, A. Thymol and Carvacrol Binding to DNA:
model for Drug-DNA interaction . Biopolymers 2004, 74, 345.
[48] Khorasani-Motlagh, M.; Noroozifar, M.; Khmmarnia, S. Study on Fluorescence and
DNA-Binding of Praseodymium(III) Complex Containing 2,20-Bipyridine.
Spectrochim. Acta A: Mole. and Biomol. Spect 2011, 78, 389.
[49] Kalanur, S. S.; Katrahalli, U.; Seetharamappa, J. Electrochemical Studies and
Spectroscopic Investigations on the Interaction of an Anticancer Drug with DNA
and Their Analytical Applications. J. Electroanal.Chem 2009, 636, 93.

22
M. TRIPATHI ET AL.
[50] Nowicka, A. M.; Zabost, E.; Donten, M.; Mazerska, Z.; Stojek, Z. Electroanalytical
and Spectroscopic Procedures for Examination of Interactions between Double
Stranded DNA and Intercalating drugs . Anal. Bioanal. Chem. 2007, 389, 1931.
[51] Vijayalakshmi, R.; Kanthimathi, M.; Subramanian, V.; Nair, B. Interaction of DNA
with [Cr(Schiff Base)(H2O)2]ClO4. Biochim. Biophys. Acta 2000, 1475, 157.
[52] Lakshmipraba, J.; Arunachalam, S. Studies on the Interactions of Polymer-Anchored
Copper(II) Complexes with tRNA. Transition Met. Chem. 2010, 35, 477.
[53] Terenzi, A.; Bonsignore, R.; Spinello, A.; Gentile, C.; Martorana, A.; Ducani, C.;
€
Hogberg, B.; Almerico, A. M.; Lauria, A.; Barone, G. Selective G-Quadruplex Stabilizers:
Schiff-Base Metal Complexes with Anticancer Activity. RSC Adv. 2014, 4, 33245.
[54] Campbell, N. H.; Karim, N. H.; Parkinson, G. N.; Gunaratnam, M.; Petrucci, V.;
Todd, A. K.; Vilar, R.; Neidle, S. Molecular Basis of Structure-Activity Relationships
between Salphen Metal Complexes and Human Telomeric DNA Quadruplexes. J.
Med. Chem 2011, 55, 209.
[55] Li, J.; Li, B.; Wu, Y.; Shuang, S.; Dong, C.; Choi, M. M. F. Luminescence and
Binding Properties of Two Isoquinoline Alkaloids Chelerythrine and Sanguinarine
with ctDNA. Spectrochim. Acta A 2012, 95, 80.
[56] Li, P.; Niu, M.; Hong, M.; Cheng, S.; Dou, J. Effect of Structure and Composition of
Nickel(II) Complexes with Salicylidene Schiff Base Ligands on Their DNA/protein
interaction and cytotoxicity . J. Inorg. Biochem. 2014, 137, 101.
[57] Rajarajeswari, C.; Loganathan, R.; Palaniandavar, M.; Suresh, E.; Riyasdeen, A.;
Akbarsha, M. A. Copper(II) Complexes with 2NO and 3N Donor Ligands: synthesis,
Structures and Chemical Nuclease and Anticancer activities. Dalton Trans. 2013,
42, 8347.
[58] Ji, L. N.; Zou, X. H.; Liu, J. G. Shape- and Enantioselective Interaction of Ru(II)/
Co(III) Polypyridyl Complexes with DNA. Coord Chem Rev 2001, 216-217, 513.
[59] Liu, Y.-J.; Chao, H.; Tan, L.-F.; Yuan, Y.-X.; Wei, W.; Ji, L.-N. Interaction
of Polypyridyl Ruthenium (II) Complex Containing Asymmetric Ligand with DNA.
J. Inorg. Biochem 2005, 99, 530.
[60] Deng, H.; Xu, H.; Yang, Y.; Li, H.; Zou, H.; Qu, L. H.; Ji, L. N. Synthesis,
Characterization, DNA-Binding and Cleavage Studies of [Ru(Bpy)2(Actatp)]2þ and
[Ru(Phen)2(Actatp)]2 þ (Actatp ¼ Acenaphthereno[1,2-b]-1,4,8. 9tetraazari-Phenylence
J. Inorg. Biochem 2003, 97, 207.
[61] Satyanarayana, S.; Dabrowiak, J. C.; Chaires, J. B. Tris(phenanthroline)ruthenium(II)
Enantiomer Interactions with DNA: Mode and Specificity of Binding. Biochemistry
1993, 32, 2573.
[62] Qin, D. D.; Yang, Z. Y.; Wang, B. D. Spectra and DNA-Binding Affinities
of Copper(II), Nickel(II) Complexes with a Novel Glycine Schiff Base Derived from
Chromone. Spectrochim. Acta. A Mol. Biomol. Spectrosc. 2007, 68, 912.
[63] Morris, G. M.; Goodsell, D. S.; Halliday, R. S.; Huey, R.; Hart, W. E.; Belew, R. K.;
Olson, A. J. Automated Docking Using a Lamarckian Genetic Algorithm and an
Empirical Binding Free Energy Function. J. Comput. Chem. 1998, 19, 1639.
[64] Solis, F. J.; Wets, R. J. B. Minimization by Random Search Technique. Math.
Oper. Res. 1981, 6, 19.
[65] Nguyen, M. T.; Uchimaru, T.; Zeegers-Huyskens, T. Protonation and Deprotonation
Enthalpies of Guanine and Adenine and Implications for the Structure and Energy
of Their Complexes with Water: Comparison with Uracil, Thymine, and Cytosine. J.
Phys. Chem. A. 1999, 103, 8853–8860.