Selective recognition of HIV RNA by dinuclear metallic ligands

Article abstract of DOI:10.1016/j.cclet.2018.06.003

We describe the development of dinuclear metallic ligands to target specific HIV RNA structures. Two series of dipyridinyl-N bridged dinuclear metal complexes were synthesized in moderate to good yields and their binding activities toward TAR and RRE RNA were studied both experimentally and theoretically. The docking calculation elucidated some structure features in dimetallic complexes that can affect TAR RNA-binding properties.

Full text of DOI:10.1016/j.cclet.2018.06.003

G Model
CCLET 4579 No. of Pages 4
Chinese Chemical Letters xxx (2018) xxx–xxx
Contents lists available at ScienceDirect
Chinese Chemical Letters
journal homepage: www.elsevier.com/locate/cclet
Communication
Selective recognition of HIV RNA by dinuclear metallic ligands
Xuedong Lia,c, Bo Chenb, Ling Lana,c, Ruili Wanga,c, Duqiang Luob, Li Liua,c
,
Liang Chenga,c,
*
a
Beijing National Laboratory for Molecular Sciences (BNLMS), CAS Key Laboratory of Molecular Recognition and Function, CAS Research/Education Center for
Excellence in Molecular Sciences, Institute of Chemistry, Chinese Academy of Sciences, Beijing 100190, China
b
College of Life Science, Key Laboratory of Medicinal Chemistry and Molecular Diagnosis of the Ministry of Education, Hebei University, Baoding 071002,
China
c
University of Chinese Academy of Sciences, Beijing 100049, China
A R T I C L E I N F O
A B S T R A C T
Article history:
We describe the development of dinuclear metallic ligands to target specific HIV RNA structures. Two
series of dipyridinyl-N bridged dinuclear metal complexes were synthesized in moderate to good yields
and their binding activities toward TAR and RRE RNA were studied both experimentally and theoretically.
The docking calculation elucidated some structure features in dimetallic complexes that can affect TAR
RNA-binding properties.
Received 19 April 2018
Received in revised form 31 May 2018
Accepted 1 June 2018
Available online xxx
Keywords:
HIV RNA
Dinuclear metallic ligands
Binding
© 2018 Chinese Chemical Society and Institute of Materia Medica, Chinese Academy of Medical Sciences.
Published by Elsevier B.V. All rights reserved.
Molecular recognition
Selectivity
The design, synthesis and application of small molecules that
can selectively bind at specific nucleic acid sequences and
structures in RNA have attracted significant interest within the
chemistry and biology community [1–11]. They could potential-
ly be used as sequence/structure-specific probes or pharma-
ceuticals that are capable of disturbing RNA functions for
understanding or controlling genetic information expression. To
this end, decades of researches have introduced many types of
RNA ligands/binders that can specifically target RNA of interest
(ROI) with diverse activity ranging from 1 nmol/L to 1 mmol/L
[12–24]. However, despite the great potential and numerous
effort in this field, finding selective ligands for a specific
sequence and with drug-like properties still remains a chal-
lenge. Many known RNA-binding molecules are polycationic,
thus binding tightly with polyanionic RNA but with limit
selectivity. Therefore, developing organic and/or organometallic
molecules that can specifically bind RNA with high affinity is a
challenge that must be addressed for RNA to be considered a
feasible drug target. Organic ligands bound with metal centers
are highly integrated systems that can be functionalized to
control a variety of bimolecular processes [25–29]. Unlike
traditional aminoglycosides, polypeptides, polycyclic aromatic
molecules and other nucleic acid binders with a significant
amount of cationic charge or aromatic density, the metal ions
bind to nucleobases and/or phosphates via specific coordination
bonds. Those metal complexes can be employed as potential
therapy and diagnosis. However, contrary to the extensive
investigation of organometallics that bind with DNA, their RNA
binding proprieties remained largely unexplored [30–34].
Previously, we have explored several functionalized deoxygen-
ated polypeptide/peptoids (DOPPs) that can specifically bind to
folded RNA structures, such as (UUU)n repeats [35–36]. Polyamines
with chiral side histidine chains could sterically shied the cationic
charges in RNA backbones while remaining its capacity to engage
in catalytic cleavage of phosphate linkages [37–39]. Furthermore,
we have examined whether polyamine-metal complexes with
zinc, copper and iron can be utilized in this process [36]. The
preliminary results indicated that organozinc/copper/iron com-
plexes could bind with RNA with high affinity and specificity. Based
on this, we have initiated a new project to investigate whether the
organic ligand that bound with metal centers can be optimized to
direct binding specificity. To examine these ideas, two types of
dinuclear metal complexes based on 2,7-disubstituted
1,8-naphthalenediol ligands have been prepared [40], and their
binding to the folded RNAs associated with HIV, namely TAR
* Corresponding author at: Beijing National Laboratory for Molecular Sciences
(BNLMS), CAS Key Laboratory of Molecular Recognition and Function, CAS Research/
Education Center for Excellence in Molecular Sciences, Institute of Chemistry,
Chinese Academy of Sciences, Beijing, 100190, China.
E-mail address: chengl@iccas.ac.cn (L. Cheng).
https://doi.org/10.1016/j.cclet.2018.06.003
1001-8417/© 2018 Chinese Chemical Society and Institute of Materia Medica, Chinese Academy of Medical Sciences. Published by Elsevier B.V. All rights reserved.
Please cite this article in press as: X. Li, et al., Selective recognition of HIV RNA by dinuclear metallic ligands, Chin. Chem. Lett. (2018), https://
doi.org/10.1016/j.cclet.2018.06.003

G Model
CCLET 4579 No. of Pages 4
2
X. Li et al. / Chinese Chemical Letters xxx (2018) xxx–xxx
Fig. 2. Fluorescence displacement experiments with ICR.
Therefore, this fluorescence displacement experiments can be
used to probe the interaction of complexes with RNA (Fig. 2).
In our experiment, as illustrated in Fig. 3, the fluorescence
Fig. 1. Dinuclear metal complex scaffolds (A), secondary structures of TAR (B) and
RRE RNA (C).
intensities of ICR-191 bound to TAR RNA at 1 mm show remarkable
decreasing trends with the increasing concentration of the
dimetallic complexes 1a and 2b, respectively, indicating that some
ICR molecules were released into solution after the exchange with
the dimetallic complex, and resulted in the fluorescence recovering
of ICR. Similar phenomenon was observed for RRE RNA and small
molecules (vide infra).
These observations may be interpreted as the intercalation of
the dimetallic complex with RNA. The recovering of ICR released
from RNA by complexes 1a and 2b is in agreement with the linear
Eq. (1):
(Trans-Activation Response) and RRE (Rev Response Element), has
been studied (Fig. 1). TAR and RRE represent two of the most
significant secondary structures in RNAs [41–45]. Two noteworthy
features, a stem and loop with bulges that are sites for protein
binding, make them promising targets to inhibit the viral
replication and for developing antiviral compounds [43]. The
results presented here demonstrated that functionalized dinuclear
metal complexes can be readily synthesized, and that the binding
mode, i.e. the affinity and specificity with TAR and RRE, are
sensitive to alteration of the organic ligands and metals. We also
performed a computational study aimed at better identifying the
bind of these small organometallic complexes to TAR RNA.
The synthesis of complexes 1 and 2 was carried out starting from
commercialavailablecompounds3aand3b(Scheme1). Compound
3a was converted to dipyridinyl methyl amine 3d in 61% yield. The
diol 3b was protected with chloromethyl methyl ether (MOMCl),
which facilitated further α-lithiation and formylation to generate
the dicarbaldehyde 3f in40% yield. Thereductivecondensation of 3f
with aforementioned 3d produced diamine 3 g, from which two
series of dipyridinyl-N bridged dinuclear metal complexes 1 and 2
were synthesized in moderate to good yields.
ꢀ
ꢁ
F ꢀ F0
F ꢀ F0
lg
¼ n lg Ka þ n lg ½Dtꢁ ꢀ n
½Rtꢁ
F0
F
where [Rt] and [Dt] represent the overall concentrations of ICR-
RNA complex and the dinuclear metallic ligand. Thus the Ka and n
values were obtained for the curve [46] and are listed as below
(Table 1), from which a specific or general affinity for TAR RNA was
observed with compounds 1a and 2b. For a comparison, we also
tested
3-amino-6-methyl-N-(3-(trifluoromethyl)phenyl)thieno
reported small molecule
[2,3-b]pyridine-2-carboxamide 3,
a
inhibitor for TAR RNA [47–48]. Again, compound 2b shows
preferably binding affinities towards TAR RNA.
In order to investigate the interaction mode between the
synthetic dinuclear metallic ligands 1 and 2 and RNA, fluorescence
displacement experiments were employed [46]. The intrinsic
fluorescence intensity of RNA is negligible. However, when a
fluorescent probe, like ICR-191 that we used here, intercalated with
RNA, the fluorescence intensity of the ligand will be quenched
(fluorescence OFF). Upon the addition of external ligands, the
binding sites of the RNA available for fluorescent probe will be
decreased, and hence restore the signal (fluorescence ON).
In order to obtain insight into the preferred binding location
and help deepen the understanding of the dinuclear metallic
ligands-RNA interaction, the molecular docking technique was
used to dock complexes 1 and 2 into TAR RNA. AutoDock 4.2 using
the Lamarckian Genetic Algorithm (LGA) for the prediction of
binding affinity and searching for the optimum binding site
together with the AutoDock Tools (ADT) were employed to set up
and perform blind docking calculations of the eight dinuclear
complexes [49]. The structure of RNA with sequence
Scheme 1. Synthesis of dinuclear metal complexes 1 and 2.
Please cite this article in press as: X. Li, et al., Selective recognition of HIV RNA by dinuclear metallic ligands, Chin. Chem. Lett. (2018), https://
doi.org/10.1016/j.cclet.2018.06.003

G Model
CCLET 4579 No. of Pages 4
X. Li et al. / Chinese Chemical Letters xxx (2018) xxx–xxx
3
Fig. 3. Fluorescence spectra of TAR RNA-ICR upon the addition of complexes 1a (A) and 2b (B). The arrows show the change upon the increasing amount of complex
concentration. Inset: plot of F0/F vs. [complex] for the titration of the complex to ICR-191. Plot of lg(F–F0)/F0 vs. lg[[Dt] – n(F–F0)/F [Rt]] for the titration of complexes 1a (C) and
2b (D) to ICR. Binding assay conditions: The fluorescence displacement experiments were performed in Na2HPO4-NaH2PO4 buffer solution (20 mmol/L, pH 7.0 at 25 ꢃC,
containing 20 mmol/L NaCl) with the concentrations of both ICR 191 and TAR RNA at 1 mmol/L. All experiments were performed on a fluorescence spectrophotometer Hitachi
F7000. The excitation wavelength for ligand ICR 191 was set at 411 nm, emission wavelength was set at 420 nm, scaning range 420-600 nm. The slit width was set at (5, 5) nm,
scanning speed 1200 nm/min and photomultiplier voltage was set as 600 V, response: 2.0 s.
Table 1
Binding sites n and binding constants Ka for complexes 1a, 2b and 3.
RNA
TAR
Compd.
n
Ka (ꢂ 104 L/mol)
R2
1a
2b
3
1a
2b
0.85
1.50
0.98
0.29
0.49
1.6
4.0
2.6
0.9
2.2
0.946
0.977
0.999
0.982
0.997
RRE
GCCAGAUUUGAGCCUGGGAGCUCUCUGGC (PDB ID: 1QD3, a se-
quence used in oligonucleotide study) obtained from the Protein
Data Bank (www.rcsb.org/pdb) was constructed using AutoDock
4.2 package to study the RNA-binding properties. The copper
parameters, a vdW radii of 0.96 Å and a vdW well depth of 0.01
kcal/mol, used in the docking calculation were taken from ref. [50].
The coordinates of complexes 1a and 2b were taken from their
crystal structures as a CIF file and converted to the PDB format
using Mercury software 3.10. The receptor (TAR RNA) and the
ligands (dinuclear complexes) files were prepared using AutoDock
Tools. The heteroatoms including water molecules were deleted
and polar hydrogen atoms and Kollman charges were added to the
receptor molecule. All other bonds were allowed to be rotatable. In
the docking analysis, the binding site was assigned across all of the
minor and major grooves of the RNA molecule, which was enclosed
in a box with the number of grid points in x ꢂ y ꢂ z directions,
70 ꢂ 70 ꢂ 70 and a grid spacing of 0.375 Å. Initially, AutoGrid was
run to generate the grid map of various atoms of the ligands and
receptor. After the completion of the grid map, AutoDock was run
by using autodock parameters as follows: GA population size, 150;
maximum number of energy evaluations 2,500,000; and the
number of generations 27,000. A total of 10 runs were carried out. A
maximum of 30 conformers were considered for each molecule,
and the root-mean-square (RMS) cluster tolerance was set to 2.0 Å
in each run. All calculations were performed on an Intel Core i5
based machine running Windows as the operating system. For
each of the docking cases, the lowest energy docked conformation,
according to the Autodock scoring function, was selected as the
binding mode. Visualization of the docked pose was done by using
PyMOL (The PyMOL Molecular Graphics System, Version 2.0,
Schrödinger, LLC) molecular graphics program [51].
Fig. 4. Visualization of the docked poses of complexes 1a (A) and 2b (B) with TAR
RNA. The wireframe model of TAR with the dimetallic complexes (ball and stick) and
showing the interaction.
2.894 Å, leading to an increase of the electrostatic energy and thus
the stronger binding affinity of complex 2b to TAR RNA, which
coincides with the results obtained from the experimental studies
(Table 2). While the AutoDock calculation indicated 2b did not
directly interact with TAR RNA, we predicted a hydrogen bond
network might be involved via water molecule(s) [52–54]. It
should be pointed out that the modeling studies of the interaction
only allow a comparison between the two potential binding
ligands. However, the above spectroscopy experiments together
with the molecular docking studies can provide a comprehensive
understanding of the RNA binding activities, proving that the
dinuclear metallic complexes can strongly recover the intrinsic
fluorescence of ICR through the static binding mechanism with the
ratio of the dicopperII complex being close to 1:1 while the
dinickelII being 1.5:1, and the most possible binding site is in the
proximity of stem area. Thus, the reason that compounds 1a and 2b
bind preferably with TAR may be ascribed to the longer distance
between upper stem and lower stem in RRE.
With the purpose of gaining more information concerning the
favorably ligands of 2b vs. 1a towards TAR RNA, the binding sites
and the binding poses of the two dimetallic complexes in the
docking model with 1QD3 are shown in Fig. 4, from which it can be
seen that the binding poses of the two dimetallic complexes are
different. While complex 1a (O62) can interact with the NH7 (A20)
(1.868 Å), 2b forms four different bindings: OP2 (U38)-N3, 2.878 Å;
OP1 (G36)-O3, 2.678 Å, OP1 (G36)-O1, 2.936 Å; OP2 (G21)-O2,
Please cite this article in press as: X. Li, et al., Selective recognition of HIV RNA by dinuclear metallic ligands, Chin. Chem. Lett. (2018), https://
doi.org/10.1016/j.cclet.2018.06.003

G Model
CCLET 4579 No. of Pages 4
4
X. Li et al. / Chinese Chemical Letters xxx (2018) xxx–xxx
Table 2
Molecular docking results of the dimetallic complexes 1a and 2b with TAR RNA (Unit: kcal/mol).
Complex
Binding free energy
vdW_hb_desolv energy
Gvdw+hb+desolv
Electrostatic energy Total internal energy Torsional free energy Unbound system’s energy
Gelec Gtotal Gtor Gunb
a
(D
Gbinding
)
(
D
)
(D
)
(
D
)
(
D
)
(D
)
1a
2b
ꢀ8.94
ꢀ6.09
ꢀ2.85
ꢀ3.66
0
0
2.98
0
ꢀ10.88
ꢀ10.20
ꢀ3.51
ꢀ3.51
aDGbinding
=
D
Gvdw+hb+desolv
+
D
Gelec
+
D
Gtotal
+
DGtor
ꢀ
DGunb
To investigate whether the differences in the structure features
in dimetallic complexes can affect RNA-binding properties, and
furthermore, to gain some insight into the structure-activity
relationship, in this paper, eight dimetal complexes bridged with
naphthalene core have been synthesized. Two types of ligands,
termed as “close” (1a-1d) and “open” (2a-2d) complexes were
prepared respectively. The comparative investigations of the
binding abilities towards TAR and RRE RNA were explored both
theoretically and experimentally. The reactivity showed that
complexes 1a and 2b can both interact with the TAR and RRE
RNA in the mode electrostatic binding. However, the fluorescence
experiments suggested that their abilities to bind with RNA is
different. Therefore, the structure dependent binding activity was
explained on the basis of the differences in the conformation.
These findings should be valuable in understanding the relation-
ship of RNA-binding behaviors of this class of bidentate complexes.
Their further application as valuable lead compounds towards
RNA-protein binding inhibitors is ongoing in our lab.
[16] D. Lim, W.G. Byun, J.Y. Koo, H. Park, S.B. Park, J. Am. Chem. Soc. 138 (2016)
13630–13638.
[17] S.P. Velagapudi, M.D. Cameron, C.L. Haga, et al., Proc. Natl. Acad. Sci. U. S. A. 113
(2016) 5898–5903.
[18] Y. Katsuda, S. Sato, L. Asano, et al., J. Am. Chem. Soc. 138 (2016) 9037–9040.
[19] J.A. Howe, H. Wang, T.O. Fischmann, et al., Nature 526 (2015) 672–677.
[20] W.Y. Yang, H.D. Wilson, S.P. Velagapudi, M.D. Disney, J. Am. Chem. Soc. 137
(2015) 5336–5345.
[21] C.H. Wong, L. Nguyen, J. Peh, et al., J. Am. Chem. Soc. 136 (2014) 6355–6361.
[22] S. Phongtongpasuk, S. Paulus, J. Schnabl, et al., Angew. Chem. Int. Ed. 52 (2013)
11513–11516.
[23] W.Y. Yang, R. Gao, M. Southern, P.S. Sarkar, M.D. Disney, Nat. Commun. 7 (2016)
11647.
[24] J.F. Arambula, S.R. Ramisetty, A.M. Baranger, S.C. Zimmerman, Proc. Natl. Acad.
Sci. U. S. A. 106 (2009) 16068–16073.
[25] X. Li, Y. Zou, H.G. Hu, Chin. Chem. Lett. (2018), doi:http://dx.doi.org/10.1016/j.
cclet.2018.01.018.
[26] T.F. Fu, L. Ao, Z.C. Gao, X.L. Zhang, F. Wang, Chin. Chem. Lett. 27 (2016) 1147–
1154.
[27] J.W. Zheng, L. Ma, Chin. Chem. Lett. 27 (2016) 627–630.
[28] N. Arshada, N. Abbasa, M.H. Bhatti, et al., J. Photochem. Photobiol. B 117 (2012)
228–239.
[29] L.J.K. Boerner, J.M. Zalesk, Curr. Opin. Chem. Biol. 9 (2015) 135–144.
[30] D.P. Buck, C.B. Spillane, J.G. Collins, F.R. Keene, Mol. BioSyst. 4 (2008) 851–854.
[31] E. Alberti, M. Zampakou, D. Donghi, J. Inorg. Biochem. 163 (2016) 278–291.
[32] J. Malina, M.J. Hannon, V. Brabec, Sci. Rep. 6 (2016) 29674.
[33] B.T. Patterson, J.G. Collins, F.M. Foley, F.R. Keene, J. Chem. Soc. Dalton Trans.
(2002) 4343–4350.
Acknowledgments
This work was supported by the National Key R&D Program of
China (No. 2017YFA0208100), the National Natural Science
Foundation of China (Nos. 21778057, 21502201 and
21420102003), Beijing Natural Science Foundation (No.
2162049), Young Elite Scientist Sponsorship Program by CAST
(No. 2015QNRC001) and Chinese Academy of Sciences.
[34] J.A. Smith, J.G. Collins, B.T. Patterson, F.R. Keene, Dalton Trans. (2004) 1277–
1283.
[35] L. Cheng, A. Mahendran, R.L. Gonzalez, R. Breslow, Proc. Natl. Acad. Sci. U. S. A.
111 (2014) 7920–7924.
[36] L. Cheng, K.G. Abhilash, R. Breslow, Proc. Natl. Acad. Sci. U. S. A. 109 (2012)
12884–12887.
[37] T.J. Thomas, H.A. Tajmir-Riahi, T. Thomas, Amino Acids 48 (2016) 2423–2431.
[38] M. Menzi, H.L. Lightfoot, J. Hall, Future Med. Chem. 7 (2015) 1733–1749.
[39] K.A. Howard, J. Kjems, Expert Opin, Biol. Ther. 7 (2007) 1811–1822.
[40] T. Jany, A. Moreth, C. Gruschka, et al., Inorg. Chem. 54 (2015) 2679–2690.
[41] S.N. Richter, G. Palu, Curr. Med. Chem. 13 (2006) 1305–1315.
[42] M. Yang, Infect. Disord. Drug Targets 5 (2005) 433–444.
[43] S. Bannwarth, A. Gatignol, Curr. HIV Res. 3 (2005) 61–71.
[44] C. Jain, J.G. Belasco, Mol. Cell 7 (2001) 603–614.
[45] M.D. Daugherty, D.S. Booth, B. Jayaraman, Y. Cheng, A.D. Frankelc, Proc. Natl.
Acad. Sci. U. S. A. 107 (2010) 12481–12486.
References
[1] J.L. Childs-Disney, M.D. Disney, Annu. Rev. Pharmacol. 56 (2016) 123–140.
[2] M.D. Disney, A.J. Angelbello, Acc. Chem. Res. 49 (2016) 2698–2704.
[3] T. Hermann, WIRES RNA 7 (2016) 726–743.
[4] C.M. Connelly, M.H. Moon, J.S. Schneekloth, Cell Chem. Bio. 23 (2017) 1077–
1090.
[46] L. Qi, J.R. Wei, X.J. Lv, Y. Huo, Z.Q. Zhang, Biosens. Bioelectron. 86 (2016) 287–
292.
[5] S.P. Velagapudi, B.R. Vummidi, M.D. Disney, Curr. Opin. Chem. Biol. 24 (2015)
97–103.
[47] F.A. Abulwerdi, M.D. Shortridge, J. Sztuba-Solinska, et al., J. Med. Chem. 59
(2016) 11148–11160.
[48] J. Sztuba-Solinska, S.R. Shenoy, P. Gareiss, et al., J. Am. Chem. Soc. 136 (2014)
[6] M.D. Disney, G. Varani, Curr. Opin. Chem. Biol. 30 (2015) 79–88.
[7] S. Kang, K. Im, J. Baek, S. Yoon, H. Min, ChemBioChem 15 (2014) 1071–1078.
[8] M.D. Disney, Drug Discov. Today 18 (2013) 1228–1236.
[9] L.R. Guan, M.D. Disney, ACS Chem. Biol. 7 (2012) 73–86.
[10] J. Gallego, G. Varani, Acc. Chem. Res. 34 (2001) 836–843.
[11] J.R. Thomas, P.J. Hergenrother, Chem. Rev. 108 (2008) 1171–1224.
[12] A.C. Wolter, A.K. Weickhmann, A.H. Nasiri, et al., Angew. Chem. Int. Ed. 56
(2017) 401–404.
8402–8410.
[49] G.M. Morris, R. Huey, W. Lindstrom, et al., J. Comput. Chem. 30 (2009) 2785–
2791.
[50] A. Robertazzi, A.V. Vargiu, A. Magistrato, et al., J. Phys. Chem. B 113 (2009)
10881–10890.
[51] K. Zheng, F. Liu, X.M. Xu, et al., New J. Chem. 38 (2014) 2964–2978.
[52] Y. Yoshikawa, K. Kobayashi, S. Oishi, et al., Bioorg. Med. Chem. Lett. 22 (2012)
2146–2150.
[53] A. Kumar, K.Y. Zhang, J. Chem. Inf. Model. 53 (2013) 1880–1892.
[54] M.L. Verdonk, G. Chessari, J.C. Cole, et al., J. Med. Chem. 48 (2005) 6504–6515.
[13] X.H. Lv, Z.L. Ren, D.D. Li, et al., Chin. Chem. Lett. 28 (2017) 377–382.
[14] M.G. Costales, C.L. Haga, S.P. Velagapudi, et al., J. Am. Chem. Soc. 139 (2017)
3446–3455.
[15] H. Yan, U. Bhattarai, Z.F. Guo, F.S. Liang, J. Am. Chem. Soc. 139 (2017) 4987–
4990.
Please cite this article in press as: X. Li, et al., Selective recognition of HIV RNA by dinuclear metallic ligands, Chin. Chem. Lett. (2018), https://
doi.org/10.1016/j.cclet.2018.06.003